NOVEL VIRUS VECTOR AND METHODS FOR PRODUCING AND USING SAME
20210395774 · 2021-12-23
Assignee
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C07K14/705
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61K48/005
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
Abstract
The following are provided: a novel adenovirus vector having a shortened backbone; a nucleic acid vector expressing five or more Cas guide RNA; a nucleic acid vector containing a Cas protein-coding gene and a Cas guide RNA expression unit; a composition for genome editing containing these vectors; and a gene therapeutic method using these.
Claims
1. A recombinant adenovirus vector, wherein a region having a length of more than 2685 base pairs lacks from an E3 region.
2. The recombinant adenovirus vector according to claim 1, wherein a region of 2837 base pairs lacks from the E3 region.
3. The recombinant adenovirus vector according to claim 1, wherein the recombinant adenovirus vector is an Ad5 vector-derived recombinant adenovirus vector where 27982.sup.th to 30818.sup.th bases as positions in an Ad5 vector are deleted from the E3 region.
4. A nucleic acid vector, which expresses seven or more Cas guide RNA.
5. (canceled)
6. The nucleic acid vector according to claim 4, wherein the nucleic acid vector is configured to introduce at least four double nicking to cause at least 4 genome cuttings.
7. The nucleic acid vector according to claim 6, wherein the nucleic acid vector is designed to knock down a target sequence to be knocked down on a genome by introducing two double nicking into a region upstream and in proximity to the target sequence and further introducing two double nicking into a region downstream and in proximity to the target sequence.
8. The nucleic acid vector according to claim 4, wherein the nucleic acid vector is a recombinant adenovirus vector, wherein a region having a length of more than 2685 base pairs lacks from an E3 region.
9. A nucleic acid vector, wherein the nucleic acid vector is an integration-type Cas nucleic acid vector including a Cas protein-coding gene and at least one Cas guide RNA expression unit.
10. The nucleic acid vector according to claim 9, wherein the nucleic acid vector includes three or more of the at least one Cas guide RNA expression unit.
11. The nucleic acid vector according to claim 10, wherein the nucleic acid vector includes four of the at least one Cas guide RNA expression unit.
12. The nucleic acid vector according to claim 9, wherein at least one pair of the at least one Cas guide RNA expression unit is configured to cause double nicking.
13. The nucleic acid vector according to claim 9, wherein the nucleic acid vector is a recombinant adenovirus vector, wherein a region having a length of more than 2685 base pairs lacks from an E3 region.
14. A nucleic acid vector, comprising: at least one Cas guide RNA expression unit; a Cas protein-coding gene; and a donor DNA sequence to be knocked in.
15. The nucleic acid vector according to claim 14, wherein the nucleic acid vector includes two or more of the at least one Cas guide RNA expression unit, which are configured to introduce double nicking.
16. The nucleic acid vector according to claim 14, wherein the nucleic acid vector includes eight of the at least one Cas guide RNA expression unit, which are configured to introduce four double nicking.
17. The nucleic acid vector according to claim 14, wherein the nucleic acid vector is a recombinant adenovirus vector, wherein a region having a length of more than 2685 base pairs lacks from an E3 region.
Description
BRIEF DESCRIPTION OF DRAWING
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
DESCRIPTION OF EMBODIMENTS
[0091] Hereinafter, embodiments of the present invention will be described. The following descriptions are merely illustrative. The scope of the present invention should not be construed as being limited to these descriptions. The present invention can be practiced while appropriately modifying them in such a scope as not to impair the gist of the present invention.
Definitions
[0092] In the present specification, when two or more numerical ranges are presented, a range is also meant that is formed by a combination of any of the lower limits and any of the upper limits in those numerical ranges.
[0093] In the present invention, “recombinant adenovirus vector” or “adenovirus vector” refers to an adenovirus containing, in the genome thereof, a base sequence other than the intrinsic base sequence of the adenovirus. The base sequence other than the intrinsic base sequence of the adenovirus is not particularly limited and may be a gene encoding a protein, a regulatory gene such as a promoter or a poly A sequence, or a base sequence having no function.
[0094] A foreign gene contained in the recombinant adenovirus vector of the present invention is, for example, a gene for therapy of human, a so-called reporter gene such as a GFP gene, or a recombinase. A position at which the foreign gene is to be inserted may be selected from an E1 region-deleted site, an E3 region-deleted site, and an insertion site upstream of an E4 gene, but the position is not limited thereto.
[0095] The origin of the recombinant adenovirus vector of the present invention is not particularly limited, but it is preferably an adenovirus derived from human. The adenovirus derived from human is more preferably type 2 or type 5 classified as type C.
[0096] A production method of the recombinant adenovirus vector is not particularly limited. It is preferable to use a method of inserting the intended gene into a cosmid vector containing the full-length adenovirus genome and then transfecting the resultant vector into 293 cells to obtain the recombinant adenovirus vector (the full-length DNA introducing method: Fukuda et al., Microbiol. Immunol. 2006, Vol. 50, pp. 463-454).
[0097] In the present invention, “genome editing” refers to a series of gene manipulations causing DNA to be inserted, substituted, or removed in the target DNA, for example, the genome of a cell, by use of one or more nucleases and/or nickases. A nuclease causes a specific double-strand cutting at a desired position on the genome and uses an endogenous mechanism of a cell to repair the caused cutting through homology directed repair (HDR) or non-homologous end-joining (NHEJ). A nickase causes a specific single-strand cutting at a desired position on the genome. In some embodiments, two nickases can be used to cause two single-strand cuttings in the strand facing the target DNA, to thereby form blunt or cohesive ends. Any suitable nuclease can be introduced to cause genome editing of the target DNA sequence. Examples thereof include, but are not limited to, CRISPR-associated protein (Cas) nucleases, Cpf1, zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), mega nucleases, other endo- or exo-nucleases, variants thereof, fragments thereof, and combinations thereof.
[0098] In the present invention, “genome cutting” or “cutting of the genome” refers to cutting of both strands of a double-strand nucleic acid constituting the genome accompanied with the aforementioned genome editing. Cutting of the double-strand nucleic acid may result in formation of blunt ends through cutting at the base pair shared between the sense strand and the antisense strand or formation of cohesive ends through cutting at proximal different positions between the sense strand and the antisense strand.
[0099] In the present invention, “CRISPR/Cas system” refers to a system using CRISPR (clustered regularly interspaced short palindromic repeat) nucleic acid, which is an immune mechanism of prokaryotes, and a Cas protein (CRISPR-associated protein). “CRISPR/Cas system” is classified into class 1 and class 2, and “CRISPR/Cas system” of class 2 is further classified into type II, type V, and type VI (Yamano et al., Molecular Cell, 2017, Vol. 67, pp. 633-645).
[0100] A system classified as type II “CRISPR/Cas system” and using Cas9 as the Cas protein uses a Cas9 protein derived from Streptococcus pyogenes and a guide RNA (gRNA) composed of trans-activating crRNA (tracrRNA), which contains CRISPR RNA (crRNA) and trans-activating RNA having partial complementarity thereto and serving as a scaffold for binding to the Cas9 protein. The above crRNA and tracrRNA may be supplied as a fused single RNA molecule (single guide RNA) or may be supplied as separate RNA molecules (which may be referred to as “non-single guide RNA”). In one embodiment, “CRISPR/Cas9 system” is supplied to the target cells as a DNA fragment encoding a Cas9 protein, a DNA fragment encoding crRNA, and a DNA fragment expressing tracrRNA. In one embodiment, “CRISPR/Cas9 system” is supplied as a DNA fragment encoding a Cas9 protein and a DNA fragment encoding single guide RNA. In one embodiment, these DNA fragments are supplied to the target cells using a virus vector. These DNA fragments may be supplied to the target cells using a single virus vector or separate virus vectors. The DNA encoding tracrRNA is not particularly limited and may be appropriately selected from known ones. For example, a plasmid (pX260) available from Addgene and the like may be appropriately used. The specific DNA sequence of a part encoding tracrRNA in the plasmid is set forth in SEQ ID NO. 52.
[0101] In the present invention, “Cas protein” refers to a protein constituting “CRISPR/Cas system” and functioning as an effector molecule, and a derivative thereof. For example, “Cas protein” refers to a Cas9 protein, a Cpf1 protein, or a variant thereof having a DNA cutting activity. In one embodiment, “Cas protein” is a Cas nuclease having a DNA double-strand cutting activity. In one embodiment, “Cas protein” is a Cas nickase having an activity to cut only one strand of DNA double strands. In one embodiment, the Cas nickase may be a Cas9 (D10A) nickase having a mutation in a RuvC domain thereof (Jinek et al., 2012, Science, 2012, Vol. 337, no 6096, pp. 816-821).
[0102] In the present invention, “guide RNA expression unit” or “Cas guide RNA expression unit” refers to a DNA constituting unit for expressing guide RNA (which may also be referred to as “Cas guide RNA”) used in the CRISPR/Cas system. In the case of using it in the CRISPR/Cas9 system, the guide RNA may be single guide RNA in which crRNA and tracrRNA are fused together or may be a non-single guide RNA in which crRNA and tracrRNA are separate. Embodiments of the “guide RNA expression unit” may include “single guide RNA expression unit” for expressing single guide RNA in which crRNA and tracrRNA are fused together, “crRNA expression unit” for expressing crRNA, and “tracrRNA expression unit” for expressing tracrRNA. The “guide RNA expression unit” may be a guide RNA expression unit formed only of “single guide RNA expression unit”, may be a guide RNA expression unit formed of “crRNA expression unit” and “tracrRNA expression unit”, or may be a guide RNA expression unit containing “single guide RNA expression unit”, “crRNA expression unit”, and “tracrRNA expression unit”. The guide RNA expression unit contains not only DNA encoding the guide RNA but also, for example, expression regulatory regions that regulate its expression, such as a promoter. The promoter is not particularly limited and may be, for example, a U6 promoter, an H1 promoter, a tRNA promoter, or an adenovirus VA promoter. When two or more guide RNA expression units are incorporated into a vector, usually, these are adjacently arranged in tandem so as to be transcribed in the same direction.
[0103] In the present invention, that the Cas guide RNA expression unit is “configured to cause double nicking” refers to that at least two guide expression units are selected to introduce a single strand cutting; i.e., a “nick” in each of the sense strand and the antisense strand positioned in proximity on the genome, so that the double strand of the genome DNA are cut in the vicinity of the two nicks.
[0104] In the present invention, that two positions on DNA are “positioned in proximity” refers to that between the two positions are present, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50 base pairs, which are non-limitative.
[0105] In the present invention, “nucleic acid” is used as an equivalent to “nucleotide” or “polynucleotide” and refers to deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and polymers thereof, in the form of a single strand, a double strand, or a multiple strand. The “nucleic acid” includes, but not limited to, single-strand, double-strand, or multiple-strand DNA or RNA, genome DNA, cDNA, and DNA-RNA hybrids. For example, the “nucleic acid” also includes polymers containing purine bases and/or pyrimidine bases, or other naturally-occurring, chemically-modified, biochemically-modified, not naturally-occurring, synthesized, or derivatized nucleotide bases. Unless otherwise specified, the nucleic acid having a specific sequence encompasses its conservatively modified variants (e.g., through substitution of degenerate codons), alleles, orthologs, single nucleotide polymorphisms (SNP), and complementary sequences.
[0106] In the present invention, the DNA sequence “encoding” specific RNA is a DNA nucleic acid sequence to be transcribed to RNA. A DNA polynucleotide may code for RNA to be translated to a protein (mRNA). Alternatively, the DNA polynucleotide may code for RNA not to be translated to a protein (e.g., tRNA, rRNA, or DNA-targeting RNA, which may also be referred to as “non-coding” RNA or “ncRNA).
[0107] In the present invention, “gene” is used as an equivalent to “a nucleotide sequence encoding a polypeptide” and refers to a DNA segment responsible for the production of a polypeptide chain. The DNA segment contains not only a region directly encoding a polypeptide but also regions before and after the coding region (leader and trailer) which are responsible for the regulations of its transcription and translation). The DNA segment may also contain an intervening sequence (intron) between the coding regions (exons).
[0108] In the present invention, “polypeptide”, “peptide”, and “protein” are used as equivalents to each other and refer to polymers of amino acid residues. The “polypeptide” includes naturally-occurring amino acid polymers, not naturally-occurring amino acid polymers, and polymers in which some amino acids are substituted with corresponding artificial chemical mimics.
[0109] In the present invention, “nucleic acid vector” refers to a molecule of nucleic acid used for delivering a foreign gene into the target cells. The nucleic acid vector is not particularly limited and may be a virus vector such as a plasmid, a DNA virus vector, or a RNA virus vector. The virus vector may be, for example, an adenovirus, a lentivirus, a baculovirus, a Sendai virus, a vaccinia virus, a herpes virus, or a variant thereof.
[0110] In the present invention, “double nicking” is a technique of forming nicks (single-strand cutting) in the sense strand and the antisense strand of double-stranded DNA at proximal positions, to thereby configure that the genome is cut at the intended site only when the nicks are formed at these two positions. A genome editing system including two or more guide RNA expression units constituted for using this technique may be referred to as “double-nicking system”. The distance between the nicks is, for example, within 40 base pairs, and may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, and 40 base pairs, which are non-limitative.
[0111] By performing two “double nicking” at proximal positions, the genome cutting at the intended position can be made safer and more reliable. When two double nicking is introduced to proximal regions upstream of the target sequence to be knocked down from the genome and further two double nicking is introduced to proximal regions downstream of the target sequence, the target sequence can be knocked down very safely and reliably.
[0112] In the present invention, “integration-type Cas nucleic acid vector” or “all-in-one type Cas nucleic acid vector” refers to that the nucleic acid vector contains both the Cas guide RNA expression units and the Cas protein-coding gene. The “integration-type Cas nucleic acid vector” may be referred to simply as “integration-type nucleic acid vector” or “all-in-one type nucleic acid vector”. Depending on the kind of the Cas protein, it may also be referred to as “integration-type Cas9 nucleic acid vector” or “all-in-one type Cas9 nucleic acid vector”. Also, when the nucleic acid vector is, for example, an adenovirus vector, it may also be referred to as, for example, “integration-type Cas adenovirus vector”.
[0113] The numbers of the Cas guide RNA expression units and the Cas protein-coding genes included in the “integration-type Cas nucleic acid vector” are not particularly limited. Typically, the “integration-type Cas nucleic acid vector” may include one copy of the Cas protein-coding gene and two or more, for example, 2, 3, 4, 5, or 6 Cas guide RNA expression units. A preferable embodiment is an embodiment where it includes four single guide RNA expression units and one Cas protein-coding gene, an embodiment where it includes two tracrRNA expression units, six crRNA expression units, and one Cas protein-coding gene, an embodiment where it includes four tracrRNA expression units, four crRNA expression units, and one Cas protein-coding gene, or an embodiment where it includes six tracrRNA expression units, two crRNA expression units, and one Cas protein-coding gene.
[0114] Also, the “integration-type Cas nucleic acid vector” of the present invention may further include a donor DNA sequence to be knocked in. The donor DNA sequence may be a sequence encoding a gene or may be a sequence not encoding a gene. The “integration-type Cas knock-in nucleic acid vector” can introduce the donor DNA sequence at a specific position on the genome with remarkably high efficiency. Typically, the integration-type Cas knock-in nucleic acid vector has a structure composed of one pair (two) of Cas guide RNA expression units for forming double nicking, one donor DNA sequence, and a gene encoding one Cas protein, but this structure is non-limitative.
[0115] In the present invention, “host cells” typically refer to cells into which a foreign DNA sequence has been transduced, and in particular, refer to cells suitable for the production of the nucleic acid vector of the present invention. Examples of the cells usable include microorganisms, yeast cells, insect cells, and mammalian cells. In particular, use of mammalian cells is preferable. Suitable examples of mammalian cells usable, but are not necessarily limited thereto, include HeLa cells, CHO cells, 293 cells, Vero cells, NIH3T3 cells, Huh-7 cells, BHK cells, PC12 cells, COS cells, COS-7 cells, RAT1 cells, mouse L cells, Sf9 cells, human embryonic kidney (HEK) cells, and HepG2 cells.
[0116] In the present invention, “complementarity” refers to an ability of nucleic acid to form hydrogen bonds with a different nucleic acid sequence. The percentage of complementarity refers to a percentage of bases in a nucleic acid molecule that are able to form hydrogen bonds with a different nucleic acid sequence. “Completely complement” means that all of the consecutive residues of a nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence. As used in the present specification, that two nucleic acids are “substantially complement” means that the two nucleic acids are hybridized under stringent conditions.
[0117] In the present invention, “stringent conditions” refer to conditions under which nucleic acid having complementarity to the target sequence mainly hybridizes with that target sequence and does not substantially hybridize with a non-target sequence. In general, the longer a sequence, the higher the temperature at which the sequence specifically hybridizes with its target sequence.
[0118] In the present invention, “mutant” or “variant” refers to an organism, a strain, a gene, a polynucleotide, a polypeptide, or one form of its characteristics. (Adenovirus vector having shortened novel backbone)
[0119] The adenovirus vector having the shortened novel backbone of the present invention is a vector derived from adenovirus and is a recombinant adenovirus vector where a region having a length of more than 2685 base pairs lacks from an E3 region.
[0120] Such an adenovirus vector can be created based on an Ad5 vector by deleting in the E3 region of the Ad5, the 27982th base to the 30818th base adjacent to the cutting site by an ApaI restriction enzyme.
[0121] Deletion of this base sequence can be performed using a standard gene recombination technique that is usually used by persons skilled in the art.
[0122] The adenovirus vector having the shortened novel backbone can be amplified using, for example, cells that are usually used in combination with an Ad5 adenovirus vector (e.g., 293 cells).
(Nucleic Acid Vector Containing Five or More Guide RNA Expression Units)
[0123] The nucleic acid vector of the present invention containing five or more guide RNA expression units (expressing five or more Cas guide RNA) may be preferably a recombinant adenovirus vector or lentivirus vector.
[0124] A production method of the nucleic acid vector containing five or more guide RNA expression units is not particularly limited and may be appropriately selected depending on the intended purpose.
[0125] For example, a production method of an adenovirus vector containing five or more guide RNA expression units is not particularly limited. Preferably, it can be created by a method of inserting five or more guide RNA expression units each accompanied with gene expression regulatory sites into a cosmid vector containing part of adenovirus genome DNA and then transfecting the resultant vector into 293 cells to obtain the recombinant adenovirus vector (the full-length DNA introducing method: Fukuda et al., Microbiol. Immunol. 2006, Vol. 50, pp. 463-454).
[0126] A vector usable as the adenovirus vector is not particularly limited and may be various adenovirus-derived vectors.
[0127] In one aspect, it is desirable to use an Ad5 vector and a modified product thereof as the adenovirus vector. In one aspect, use of the adenovirus vector having the shortened backbone of the present invention can create an adenovirus vector containing a further larger number of guide RNA expression units.
[0128] Alternatively, the nucleic acid vector to be used may be other vectors such as a lentivirus vector. These vectors can be produced by a method that is usually performed by persons skilled in the art. In the case of a lentivirus vector, for example, it can be produced by a method described in Example 13 below.
[0129] In the nucleic acid vector of the present invention containing five or more guide RNA expression units, the number of the guide RNA expression units contained in the nucleic acid vector is not particularly limited as long as the number thereof is five or more but up to the number of the guide RNA expression units that can be contained in the nucleic acid vector, for example, may be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more. Specific examples of the embodiment of the “guide RNA expression unit” include an embodiment where it is “single guide RNA expression unit” and an embodiment where it is formed of “crRNA expression unit” and “tracrRNA expression unit”. Examples of the embodiment where the “guide RNA expression unit” is formed of “crRNA expression unit” and “tracrRNA expression unit” include an embodiment where the “tracrRNA expression unit” is two and the “crRNA expression unit” is six, an embodiment where the “tracrRNA expression unit” is four and the “crRNA expression unit” is four, an embodiment where the “tracrRNA expression unit” is six and the “crRNA expression unit” is two, and an embodiment where the “tracrRNA expression unit” is four and the “crRNA expression unit” is eight.
[0130] The nucleic acid vector containing five or more guide RNA expression units may further contain a donor DNA sequence to be knocked in. The donor DNA sequence usable may be those in the “integration-type Cas nucleic acid vector” described above.
(Nucleic Acid Vector Containing Cas Protein-Coding Gene and Guide RNA Expression Unit)
[0131] The nucleic acid vector of the present invention containing a Cas protein-coding gene and a guide RNA expression unit can be created based on various nucleic acid vectors. In one aspect, the nucleic acid vector is preferably an adenovirus vector or a lentivirus vector. When it is created based on the adenovirus vector, it is preferable to use the above full-length DNA introducing method for the creation thereof, but this method is non-limitative. When using the full-length DNA introducing method using 293 cells, the culturing period of the 293 cells is preferably continued for 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 days or longer. When the nucleic acid vector of the present invention is created based on the lentivirus vector, it can be created in the same manner as in the method described in Example 13 described below.
[0132] The positional relationship between the Cas protein-coding gene and the guide RNA expression unit may be appropriately selected. For example, the guide RNA expression unit may be positioned upstream of the Cas protein-coding gene, or the guide RNA expression unit may be positioned downstream of the Cas protein-coding gene.
[0133] The Cas protein is not particularly limited and may be various Cas proteins. Preferably, Cas9 nuclease or Cas9 nickase may be used.
[0134] The number of the guide RNA expression units contained in the nucleic acid vector of the present invention containing the Cas protein-coding DNA fragment and the guide RNA expression unit is not particularly limited as long as it is the number of the guide RNA expression units that can be contained in the nucleic acid vector. Preferably, three, four, five, six, seven, eight or more guide RNA expression units can be incorporated. Specific examples of the embodiment of the “guide RNA expression unit” include an embodiment where it is “single guide RNA expression unit” and an embodiment where it is formed of “crRNA expression unit” and “tracrRNA expression unit”. Examples of the embodiment where the “guide RNA expression unit” is formed of “crRNA expression unit” and “tracrRNA expression unit” include an embodiment where the “tracrRNA expression unit” is two and the “crRNA expression unit” is six, an embodiment where the “tracrRNA expression unit” is four and the “crRNA expression unit” is four, an embodiment where the “tracrRNA expression unit” is six and the “crRNA expression unit” is two, an embodiment where the “tracrRNA expression unit” is four and the “crRNA expression unit” is eight, and an embodiment where the “tracrRNA expression unit” is two and the “crRNA expression unit” is two. The nucleic acid vector of the present invention containing the Cas protein-coding DNA fragment and the guide RNA expression unit may be preferably a recombinant adenovirus vector or lentivirus vector.
[0135] The adenovirus vector of the present invention containing the Cas protein-coding DNA fragment and the guide RNA expression unit can be produced based on various adenovirus vectors. For example, use of the adenovirus vector having the shortened backbone structure of the present invention can further increase the number of guide RNA expression units to be contained.
[0136] The nucleic acid vector of the present invention containing the Cas protein-coding DNA fragment and the guide RNA expression unit can be produced and amplified in various host cells. The nucleic acid vector of the present invention containing the Cas protein-coding DNA fragment and the guide RNA expression unit can exhibit genome editing activity of the Cas protein in the host cells as well. Thus, it is preferable to culture under such culturing conditions under which this activity is less likely to occur. It is also desirable to culture under such culturing conditions under which expression of the Cas protein can be suppressed. In one aspect, by introducing to the culture cells, a vector expressing an siRNA to suppress the expression of the Cas protein, it is possible to suppress the expression of the Cas protein in the production step of the nucleic acid vector of the present invention. Preferably, the siRNA is used in two or more different regions of the Cas protein-coding gene, for example, in 2, 3, 4, 5, 6 or more regions thereof.
[0137] The nucleic acid vector or adenovirus vector of the present invention not only can be used in genome editing experiments by applying an effective amount thereof to culture cells, but also can be applied to, for example, genome editing experiments or treatments of diseases by administering an effective amount thereof to animals excluding human and treatments of diseases through genome editing by administering an effective amount thereof to human.
(Treatment Method)
[0138] In the present invention, examples of “administering” include oral administration to a subject, local contact, administration as a suppository, and intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal, or subcutaneous administration. The administration is by any route including parenteral and transmucosal routes (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal route). Examples of the parenteral administration include intravenous, intramuscular, intraarteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial administrations. Other manners of delivery include, but are not limited to, use of liposome preparations, intravenous injection, and transdermal patch.
[0139] In the present invention, “effective amount” or “sufficient amount” refers to an amount of an active substance enough to cause beneficial or desirable outcomes (e.g., Cas nuclease or guide RNA). A therapeutically effective amount can be varied depending on a subject under treatment and one or more of disease condition of the subject, the body weight and age of the subject, severity of the disease condition, a manner of administration, etc. The therapeutically effective amount can be determined by persons skilled in the art. A specific amount can be varied depending on one or more of the selected specific active substance, target cell type, location of the target cell in a subject, a regimen to follow, whether the selected specific active substance is administered in combination with other active substances, the timing of administration, and a physical delivery system for delivering it.
[0140] In the present invention, “pharmacologically acceptable carrier” refers to a substance that aids administration of an active substance (e.g., Cas nuclease or guide RNA) to cells, organisms, or subjects. Examples of the pharmacologically acceptable carrier include, but are not limited to, water, NaCl, physiological saline, Linger's lactate solution, the defined sucrose, the defined glucose, a binding agent, a volume expander, a disintegrating agent, a lubricant, a coating agent, a sweetening agent, a perfume, and a colorant.
EXAMPLES
[0141] The present invention will be described below in more detail by way of Examples, which should not be construed as limiting the present invention thereto.
Example 1
[0142] Production of Adenovirus Vector Having Shortened Novel Backbone
[0143] A commercially available E1/E3 lacking-type Ad5 vector was used to produce a recombinant adenovirus vector lacking the 27982th base to the 30818th base as positions in an Ad5 vector in the E3 region.
[0144] A production method thereof is as follows. A SpeI (27082)-NdeI (31089) fragment was cloned into a plasmid from the adenovirus genome of commercially available pAxcwit2. This plasmid was subjected to dual cutting with ApaI (27984) and BglII (30819) and treated with a Klenow polymerase to blunt both ends, to thereby obtain a plasmid lacking 2837 base pairs from the E3 region. The following three fragments are simultaneously bonded to obtain plasmid pAxcw3dait2 including the above E3 region lacking and retaining the rest adenovirus DNA: i.e., a fragment obtained by cutting pAxcwit2 with SpeI and NdeI and lacking the cut region, and a NdeI-PmeI (13258) fragment and a PmeI-SpeI fragment each containing a plasmid portion from pAxcwit2. This plasmid was cut with NdeI to prepare a fragment including an E3-lacking region. After that, pAxc4wit2 (Suzuki et al., Gene Ther., 2015, Vol. 22, pp. 421-429) having a SwaI cloning site in an E4 region was similarly cut with NdeI to replace the E3 region, to thereby obtain plasmid pAxc3da4w for creating an adenovirus vector having the above lack in the E3 region and the SwaI cloning site in the E4.
[0145] Deletion of the E3 region was confirmed through comparison by PCR-amplifying a region of the commercially available pAxcwit2 corresponding to the region of the above pAxc3da4w having a sequence of the same region as the E3 region-lacking adenovirus vector (
[0146] The adenovirus vector was confirmed to be replicable in 293 cells.
[0147] A foreign gene expression unit was incorporated into this plasmid, and the both ends of the adenovirus genome were cut with PacI, followed by transfection into 293 cells, so that an adenovirus vector expressing the foreign gene could be obtained. One example thereof is illustrated in
Example 2
[0148] Genome Editing by Adenovirus Vector Simultaneously Expressing Two or more Guide RNA
[0149] The adenovirus genome is double-stranded linear DNA of about 36 kbp and has a unique structure in which 55 k proteins obtained by cutting E2B gene products are covalently bonded to both ends of the DNA strand. In order to create an adenovirus vector simultaneously expressing two or more guide RNA, properties of a lambda phage to incorporate only the 38 kb to 52 kb DNA fragment having a cos site were used to create a cosmid plasmid in which fragments of the adenovirus genome and four guide RNA expression units were connected in tandem. The full-length vector genome was cut out from the plasmid to transfect 293 cells (the full-length DNA introducing method) to create an adenovirus vector containing four guide RNA expression units (single guide RNA).
[0150] The guide RNA targets exon 1 of a mouse H2-Ac gene, and the multiple guide RNA expression units contained a first double-nicking guide coding DNA sequence formed of 5′-GCGGCATCCTGGTCTCTGGG-3′ (SEQ ID NO. 1) and 5′-GCAGCAGAGCTCTGATTCTG-3′ (SEQ ID NO. 2) and a second double-nicking guide coding DNA sequence formed of 5′-GAGGCTGAGATGGTGGTCA-3′ (SEQ ID NO. 3) and 5′-GGAGGTGAAGACGACATTGA-3′ (SEQ ID NO. 4) (
[0151] Each of the guide RNA expression units contained a U6 promoter (about 261 base pairs) and a scaffold portion for guide RNA (a sequence other than the target 20 base pairs) (about 83 base pairs) in addition to the above guide coding DNA sequence.
[0152] When an adenovirus vector (AdV) was created using the above-created cosmid having multiple guide RNA expression units, it was possible to create the adenovirus vector without deletion of the guide RNA expression units (
[0153] This AdV could be scaled-up to such an amount as to perform animal experiments. Utilizing the fact that most of the AdV infect the liver when the AdV is administered to mice from their veins, the AdV expressing four guide RNA was vaccinated to mice together with the AdV expressing Cas9 or Cas9 nickase, to analyze the genome editing efficiency of the target gene in the liver.
[0154] As a result, gene disruption was observed in the liver with high efficiency, and deletion of a larger region was observed in the combination with the Cas9 nickase expression vector as compared with the combination with the Cas9 expression vector, suggesting that use of the Cas9 nickase expression vector achieved more complete gene disruption (
[0155] These results indicate that use of an adenovirus vector expressing many guide RNA can perform highly safe in vivo cancer gene disruption experiments and genome editing therapy experiments of genetic diseases.
Example 31
[0156] Creation of Adenovirus Vector Simultaneously Expressing Eight Guide RNA
[0157] The full-length DNA introducing method was used to attempt to create an adenovirus vector containing eight guide RNA expression units targeting the DR2 region in the X gene of HBV (single guide RNA) (see
TABLE-US-00001 SEQ ID NO. 5 GAAGCGAAGTGCACACGGTC SEQ ID NO. 6 GAGGTGAAGCGAAGTGCACA SEQ ID NO. 7 GGTTTCCATGCGACGTGCAG SEQ ID NO. 8 GGCAGATGAGAAGGCACAGA SEQ ID NO. 9 GAAGCGAAGTGCACACGGTC SEQ ID NO. 10 GAGGTGAAGCGAAGTGCACA SEQ ID NO. 11 GGTTTCCATGCGACGTGCAG SEQ ID NO. 12 GACCTGGTGGGCGTTCACGG
[0158] It is known that DNA introduced into cells causes homologous recombination, and knock-in is widely performed using this phenomenon. In the COS-TPC method which has traditionally been performed in the adenovirus genome, an expression unit-containing cosmid and a cut parental virus DNA-terminal protein complex (DNA-TPC) are co-transduced into 293 cells at the final stage, and homologous recombination occurring between the common sequences of the cosmid and the parental virus DNA-terminal protein complex is utilized to recover, as an adenovirus vector, a virus DNA-terminal protein complex containing the intended DNA fragment.
[0159] In view thereof, when creating an adenovirus vector containing eight guide RNA expression units, it was expected that part of these expression units would lack due to homologous recombination because they contained common DNA sequences.
[0160] Nonetheless, the results of the experiment surprisingly indicated that an adenovirus vector containing eight guide RNA expression units could be created without lacking of any expression unit (
[0161] A method commonly performed for creating an adenovirus vector includes transfecting 293 cells with the virus genome incorporating foreign DNA, and preparing the resultant viruses as a pool without individually separating them. As seen in
[0162] This first step of separating a virus stock gave a virus stock with the units deleted and a stock retaining the eight units as illustrated in
Example 4
[0163] Efficient Disruption of HBV-X Gene on the Chromosome by Adenovirus Vector Simultaneously Expressing Eight Guide RNA
[0164] A HBV-X gene is considered to involve the onset of liver cancer by this virus, and the X gene DNA is incorporated into liver cancer cells. As a model case of liver cancer therapy, HepG2 cell line Gx11 (Shintani, Saito, Koike et al., J. Gen. Virol. 1999, Vol. 80, pp. 3257-3265) incorporating the X gene on the chromosome thereof was co-infected with the adenovirus vector simultaneously expressing eight guide RNA created in Example 3 (eight guide expression vector) and the Cas9-expressing adenovirus vector in an attempt to disrupt the X gene.
[0165] The eight guide RNA expressed by the eight guide expression vector is created based on the base sequence of the genome of a standard-strain virus (the base sequence of
[0166] An experiment was performed in which the eight guide expression vector and the Cas9-expressing vector were co-infected in different amounts. As a result of PCR performed using PCR primers containing this region, at a virus load of 3 (expressed as moi), reduction in the band of the intrinsic size (0.53 kb) was clearly observed as compared with the case of non-infection (a moi of 0). At a moi of 10, this band disappeared almost completely, and became a 0.42-kb band observable as a result of deletion of 110 bases (see
TABLE-US-00002 Forward primer: SEQ ID NO. 13 ACTGGATCCTGCGCGGGACGTCCTTTGTC Reverse primer: SEQ ID NO. 14 GAAAAAGATCTCAGTGGTATTTGTGAGCCAGG
Example 5
[0167] Disruption by Cutting of Replicating HBV Genome by Eight Guide Expression Vector Designed to Perform Four-Site, Double-Nicking Cutting
[0168] A HBV takes a form of the circular double-stranded DNA genome (ccc) during the process of replication. An eight guide RNA (single guide RNA) expression vector was created which performs double-nicking cutting at four sites of the replicating and amplifying HBV ccc genome. The presumed cutting sites are illustrated in the left-hand figure of
TABLE-US-00003 DN1 site: SEQ ID NO. 15 GACCTGGTGGGCGTTCACGG SEQ ID NO. 16 GTCTTATATAAGAGGACTCT DN2 site: SEQ ID NO. 17 GACATGAACATGAGATGATT SEQ ID NO. 18 GCTGTGCCTTGGGTGGCTTT DN3 site: SEQ ID NO. 19 GATTGAGACCTTCGTCTGCG SEQ ID NO. 20 GTCGCAGAAGATCTCAATCT DN4 site: SEQ ID NO. 21 GATATGGGTGAGGCAGTAGT SEQ ID NO. 22 GTCAATCTTCTCGAGGACTG
[0169] When the replicating HBV ccc genome undergoes double-nicking cutting at four sites, four DNA fragments are formed in the case of complete cutting. Each of the fragments is cyclized when both of the ends thereof are bonded to each other by the repair mechanism in cells (in the center figure of
TABLE-US-00004 Forward primer: SEQ ID NO. 23 TTAACTTCATGGGATATGTAATTGG Reverse primer: SEQ ID NO. 24 ACTCAAGATGTTGTACAGACTTGGC
[0170] In order to obtain the HBV replicating genome, HepG2 cells were infected at a moi of 3 with the replicative HBV genome-producing adenovirus vector Ax-CM103G-ΔpreS (Suzuki, Saito, et. al., 2017, Vol. 7, pp. 41851) in which part of the S gene of the HBV is deleted. Three days after (day 0), when the cyclic HBV genome was replicating, the cells were co-infected at a moi of 7 each, with the eight guide expression vector designed to perform double-nicking cutting at four sites and with Cas9 nickase (NC9)- or Cas9-expressing adenovirus vector. On day 3 and day 7 after the co-infection, the whole DNA of the cells was extracted, and cyclic DNA was detected using the primers illustrated at the rightmost end of
[0171] In
[0172] Another experiment in which the original Cas9 expression vector was used for co-infection instead of the Cas9 nickase expression vector was performed at the same time. In this case, simultaneous cutting of 4 pairs, 8 sites was performed by the original Cas9. However, its cutting efficiency was lower than in the case of performing double-nicking cutting at four sites (in the fifth and sixth lanes from the left without taking the marker (m) lane into consideration, comparison between NC9 and Cas9 on day 7). This result is considered to reflect the fact that the ends cut by the original Cas9 are blunt ends which are easily re-bonded to return to the original structure, whereas the ends of double-nicking cutting are hardly repaired as a result of formation of single-strand DNA having several tens of bases at the ends thereof.
[0173] Deletion of several tens of bases at the time of repair thereof can explain that the predicted 1.5 kb deleted DNA was detected in the original Cas9, whereas a shorter 1.4-kb band was detected in the double-nicking. The above result suggests that the eight guide expression adenovirus vector causing double-nicking cutting at four sites can have both high cutting efficiency and safety.
Example 6
[0174] Creation of Adenovirus Vector Simultaneously Expressing 12 Guide RNA
[0175] In the same manner as in the creation of the adenovirus vector containing eight guide RNA expression units (see
TABLE-US-00005 SEQ ID NO. 39 GCAGAGGTGAAAAAGTTGCA SEQ ID NO. 40 GACATGAACATGAGATGATT SEQ ID NO. 41 GCTGTGCCTTGGGTGGCTTT SEQ ID NO. 42 GAAGCTCCAAATTCTTTATA
[0176] A cosmid used for creation of an adenovirus vector containing eight guide RNA expression units illustrated in
[0177] As a result of studying separated six independent adenovirus vector clones, as illustrated in the left-hand figure of
[0178] This virus stock is the 2nd-generation passaged stock obtained by passaging the primary virus stock once to amplify the vector. Amplification was further performed by passaging to assess whether the 12 guide RNA expression units would be stably maintained in the 3rd-generation passaged stock and the 4th-generation passaged stock. The result is presented in the right-hand figure of
Example 7
[0179] Efficient Disruption of HBV-X Gene on Chromosome by Adenovirus Vector Simultaneously Expressing 12 Guide RNA
[0180] The 4th- or 5th-generation passaged stock is generally used in experiments using normal culture cells. This vector stock was infected under the same experiment conditions to the same cells as those in which the vector having the eight guide expression units illustrated in
[0181]
Example 8
[0182] Creation of Integration-Type Adenovirus Vector Containing DNA Fragment Encoding Cas Protein and Guide RNA Expression Units
[0183] Using the full-length DNA introducing method, attempt was made on creation of an adenovirus vector containing a DNA fragment encoding a Cas9 protein and four guide RNA expression units (single guide RNA). The guide coding DNA sequences used were identical to SEQ ID NOs. 1 to 4. Two kinds of adenovirus vector were obtained, where one is an adenovirus vector (inward) where the DNA fragment encoding a Cas9 protein is located upstream of the four guide RNA expression units and the other is an adenovirus vector (outward) where the DNA fragment encoding a Cas9 protein is located downstream of the four guide RNA expression units. The upper part of
[0184] In the creation of an adenovirus vector using the full-length DNA introducing method, usually, a recombinant culture of 293 cells, which have been co-transduced with a cosmid at the final stage and a parental adenovirus vector, is cultured for 10 days after the transduction to obtain the target recombinant adenovirus vector.
[0185] This time, the target recombinant adenovirus vector could be obtained for the first time by continuing culturing for 20 to 24 days. In general, it is difficult to continuously culture 293 cells for 20 to 24 days. Further, production of an adenovirus vector containing only the DNA fragment encoding a Cas9 protein is not a simple process. In view of these, it is a surprising result that it was possible to obtain the adenovirus vector containing the DNA fragment encoding a Cas9 protein and the four guide RNA expression units.
[0186] As described above, the guide RNA expression units have common DNA sequences, and it is also an unexpected result that the four guide RNA expression units were retained after the long-term culturing of 20 to 24 days. The reason for this is unknown.
Example 9
[0187] Disruption In Vivo of Mouse H2Aa Gene Using Integration-Type Adenovirus Vector Designed to Percause Double Nicking at Two Site by Four Guide RNA
[0188]
TABLE-US-00006 Forward primer (F-primer) SEQ ID NO. 25 TTGGATCCAAGTCTGCAGCTGGCAACTTTGACG Reverse primer (R-primer) SEQ ID NO. 26 AAAGAATTCTACACTACAGGTACAAAGGGCTTCAG
[0189] The above-produced integration-type adenovirus vector, having both the four guide RNA expression units (single guide RNA) targeting the mouse H2Aa gene and the Cas9 nickase expression unit, was purified and intravenously injected to neonatal mice, to study gene disruption efficiency in vivo and whether the four guides functioned through T7E1 assay (
[0190] As a result, on day 7 after the administration of the vector, not only the 0.56-kb band indicating the unmodified genome fragment but also the band of about 0.33 kb and about 0.16 kb occurred after removal of the DN region with an enzyme, which were not observed in the control (administration of no vector, the second lane from the left without taking the marker lane into consideration (+ of Control)), were observed in all of the four mice (4g out-m1, 4g out-m2, 4g in-m3, and 4g in-m4). Also on day 15 after the administration of the vector, similar signals were observed (the lower row). In generally performed genome DNA cutting by a Cas9 enzyme and one guide RNA, the cut genome DNA forms minor insertions and deletions during repeating of end joining repairing and Cas9 cutting, and the reaction was terminated due to the resultant different sequences from the target 20-base sequence. T7E1 assay forms two bands by cutting a branched portion between single-stranded DNA and double-stranded DNA occurring as a result of thermal deformation of PCR fragments, which are double-stranded DNA, followed by pairing. Thus, the sizes of these two bands are only slightly different from the size of the uncut fragment. However, the inventors' experiments have revealed that in double nicking by Cas9 nickase, one-site cutting causes deletion of several tens of bases having random lengths in the target DNA site. The resultant DNA fragments are considered to lead to wide bands ranging from the upstream end to around the random DN cutting about 160-base downstream by guide 1 and guide 2 and ranging from around the random DN cutting to the downstream end about 330-base downstream by guide 3 and guide 4. Specifically, as a result of deletion and removal of the DNA between the two DN cuttings, the difference between these two band sizes is considered to indicate the size of the region removed. In the present experiment, the expected bands of 0.33 kb and 0.16 kb were observed, indicating that about 70 bases between the two DN cuttings were deleted and therefore all of the four guide RNA functioned. In the lanes of all of the eight mice, the deletion efficiency was found to be 17% and 19%. It was considered from these results that the four guide expression integration-type vector caused double-nicking cutting.
Example 101
[0191] Creation of Integration-Type Adenovirus Vector Having Eight Guide RNA Expression Units and Cas9 Nickase Expression Units
[0192] The upper limit of the size of the adenovirus genome packaged in a virus particle is 38.0 kb, and the size of the vector genome whose E3 region had been shortened was found to be 30.2 kb. Thus, foreign DNA that can be incorporated is up to about 7.8 kb. The expression unit of the Cas9 nickase is 5.3 kb, and thus the length that can be used for a multiple guide expression unit is up to 2.5 kb. Meanwhile, the size of one normal guide expression unit is about 0.4 kb, and thus the length of eight units is 3.2 kb, which considerably exceeds 2.5 kb. A normal expression unit cannot be used for the creation.
[0193] In view thereof, attempt was made on shortening a U6 promoter in the expression unit.
TABLE-US-00007 Reverse primer containing the DSE sequence SEQ ID NO. 27 GCGTGTACAGTATATGCAAATATGAAGGAATCATGGG Forward primer containing part of the PSE sequence SEQ ID NO. 28 GCGTGTACAAAATGGACTATCATATGCTTACCGTAAC
[0194] As a result, the size of each guide RNA expression unit was shortened from 0.4 kb to about 0.28 kb, and the length of the eight guide expression units was about 2.3 kb, which was slightly below 2.5 kb; i.e., the upper limit of the size that can be incorporated into the vector. This led to the possibility for the capability of creating an integration-type vector having eight guide RNA expression units.
[0195]
TABLE-US-00008 SEQ ID NO. 29 GCGGCAGGGAGAAATTGAAG SEQ ID NO. 30 GCCGCCTGGCTTTGGCCACC SEQ ID NO. 31 GATGAAAGACCTTGCCCAGA SEQ ID NO. 32 GCTCTGGCCATCCTCATCTG SEQ ID NO. 33 GATACCGTACTGGGCCACTA SEQ ID NO. 34 GCCCCTCAGTGCTTTCCTTC SEQ ID NO. 35 GAGGTTCATGTCCCCCTTCA SEQ ID NO. 36 GGACCGAGGGTTAAGAGGAA
[0196] An integration-type adenovirus vector (the upper part of
Example 11
[0197] Disruption In Vitro of Mouse NTCP Gene Using Integration-Type Adenovirus Vector Designed to Perform Four-Site Simultaneous Cuttings by Double-Nicking Method
[0198] Studies were conducted for disruption of the target gene by an integration-type adenovirus vector designed to perform four-site, double-nicking cuttings. An adenovirus is a virus that infects humans, and as illustrated in
[0199] At the virus loads of 100 and 300, a smear region was observed at a position of 0.5 kb. This smear region was indicated to be denser as the infected virus load increased in the photograph of the same electrophoresis gel under long-term exposure (0.5 in the right-hand figure in
Example 12
[0200] Disruption In Vivo of Mouse NTCP Gene Using Integration-Type Adenovirus Vector Designed to Percause Double Nicking Cuttings at Four Sites by Eight Guide RNA
[0201] The above integration-type adenovirus vector designed to percause double nicking cuttings at four sites by eight guide RNA was intravenously injected to neonatal mice, to perform a disruption experiment in vivo of a mouse NTCP gene. The results are presented in
TABLE-US-00009 Primer mNTCPint1-BbsI SEQ ID NO. 37 GTCATGGACACAGCCTCTCCTGAAGACAGC Primer mNTCPint2-AlwI SEQ ID NO. 38 CCTTTACAGTGATCCTGTAGAGACTTCTGG
Example 131
[0202] Creation of Lentivirus Vector Having Eight Guide RNA Expression Units (Single Guide RNA) Designed to Perform Double-Nicking Cuttings at Four Sites
[0203] A lentivirus vector pLVSIN-EF1αPur (obtained from Takara Bio Inc.), having an EF1α promoter to express the target gene and expressing puromycin (Pur) was cut with EcoRI and SbfI and treated with a Klenow enzyme for blunting, followed by binding, to obtain plasmid pLVSINwPur in which the EF1α promoter region was deleted. This was cut with SgrDI, and a lentivirus vector fragment having a blunt end formed by the Klenow enzyme and a NheI end was cloned between SmaI and XbaI of charomid 9-36 (Saito et al., Proc. Natl. Acad. Sci., 1996, vol. 83, pp. 8664-8668), to obtain cosmid chLVpur-w. This cosmid was cut with BstXI and treated with a Klenow enzyme into a ring, to obtain 40.1-kb cosmid cassette chLVpurkx-w having no BstXI site. Similar to the cosmid for preparing the adenovirus vector having the eight guide expression units, by incorporating a multiple guide RNA expression unit fragment into a SwaI cloning site of the lentivirus vector, this cosmid was amplified, using an in vitro packaging of λ phage, in Escherichia coli. without deletion of the multiple guide RNA expression unit fragment.
[0204] The below-described fragment containing eight guide RNA expression units containing guide coding DNA sequences in eight guide RNA designed to perform double-nicking cuttings at four sites to target the X gene was prepared to obtain 43.2-kb cosmid chLVpurk-g8DNHBxKK incorporated into the SwaI site of chLVpurkx-w. This cosmid has unnecessary spacer sequence of about 30 kb and thus is not suitable for obtaining a lentivirus vector through transfection. In view thereof, the spacer was removed with PhsAI that cuts the spacer sequence. Then, a 43.2-kb triangular cosmid having the obtained three 14.4-kb fragments linked together, each of the fragments contains the eight guide RNA expression units and the lentivirus vector, was created by the method of Nakanishi et al. (Nakanishi et al., J. Gene Med., 2019, e3115). This cosmid can be amplified in Escherichia coli. without deletion of the multiple guide RNA expression unit. This DNA was cut with ApaI to be linear and then was transfected to 293T cells, to obtain lentivirus vector LVpur-g8DNHBxKK.
[0205]
TABLE-US-00010 SEQ ID NO. 43 AGACAAAGGACGTCCCGCGC SEQ ID NO. 44 GACCCGTCTCGGGGCCGTTT SEQ ID NO. 45 GCCGGAACGGCAGATGAAGA SEQ ID NO. 46 GGGGCGCACCTCTCTTTACG SEQ ID NO. 47 GGTCTCCATGCGACGTGCAG SEQ ID NO. 48 GACCACCGTGAACGCCCACC SEQ ID NO. 49 GTCCTCTTATGTAAGACCTT SEQ ID NO. 50 GATGTCAACGACCGACCTTG
[0206] A forward primer used for PCR for studying deletion was that set forth in the following SEQ ID NO. 51 present in a Neo gene used for introducing X gene expression units into the chromosome upstream the X gene.
TABLE-US-00011 Forward primer: SEQ ID NO. 51 ATCTTATCATGTCTGGATCAAATCCGAACGC
[0207] A reverse primer used was the primer set forth in SEQ ID NO. 14 used for amplifying the X gene in Example 4.
[0208] Use of these two primers generates a 0.66-kb fragment containing the X gene for performing double-nicking cuttings in four different ways. However, the 5′ end of the guide RNA set forth in SEQ ID NO. 43 and generated by the U6 promoter (guide RNA indicated by “1” in
[0209] The lentivirus vector incorporated into the cell chromosomal DNA expresses eight guide RNA. It was considered that when Cas9 or Cas9 nickase was supplied thereto by an adenovirus vector, they recognized the target sequences on the X gene DNA on the chromosome to cause cutting at eight sites (Cas9) or double-nicking cuttings at four sites (Cas9 nickase) (
[0210]
[0211] From the results of the present experiment, the cutting efficiency of the target gene does not seem to be high, but is not necessarily so. In usual experiments using a lentivirus vector, a puromycin-resistant gene is incorporated into a vector to express it, and only the cells whose chromosomes incorporate the lentivirus vector are selected. The lentivirus vector used in the present experiment is also allowed to express a puromycin-resistant enzyme, but puromycin selection is not performed in this experiment. It is therefore considered that the efficiency seems to be very low because most of the cells do not have this lentivirus vector. In general experiments involving puromycin selection, therefore, the gene cutting disruption efficiency is considered to be much higher than the results of the present experiment.