SELF-ASSEMBLING NUCLEIC ACID SURFACES FOR BIOSENSOR APPLICATIONS

Abstract

The present document describes nucleic acid structures comprising a plurality of annealed motifs that are made from complementary oligonucleotides having domains with sequences complementary to other nucleotides of the motif. The annealed motifs may be anchored to surfaces, and functional elements may be attached to the annealed motifs. The nucleic acid structures may used to make sensors therefrom. The present document also describes methods to generate said nucleic acid structures.

Claims

1. A nucleic acid structure comprising a plurality of annealed motifs, each of said annealed motifs comprising at least three oligonucleotides, each of said at least three oligonucleotides comprising a respective first, second and third domain, each of said first domain of a respective oligonucleotide of said at least three oligonucleotides being complementary for base pairing with a single one of said second domain of another oligonucleotide of said at least three oligonucleotides, to form said annealed motifs; and each of said third domain of a respective oligonucleotide of said at least three oligonucleotides being complementary for base pairing with said third domain of another oligonucleotide from a different annealed motif, to form nucleic acid structure.

2. The nucleic acid structure of claim 1, wherein any one of said at least three oligonucleotides comprises at least three domains.

3. The nucleic acid structure claim 1, wherein any one of said at least three oligonucleotides has equal length.

4. The nucleic acid structure of claim 1, wherein any one of said first, second and third domain of any one of said at least three oligonucleotides has a different length.

5. The nucleic acid structure of claim 1, wherein any one of said at least three oligonucleotides are 18-180 nucleotides in length.

6. The nucleic acid structure of claim 1, further comprising a first anchoring moiety, for anchoring of said nucleic acid structure to a solid support.

7. The nucleic acid structure of claim 1, further comprising a second anchoring moiety, for anchoring a functional element to said nucleic acid structure.

8. The nucleic acid structure of claim 6, wherein said first anchoring moiety is a thiol group, an amide group, a diazonium group, an azido group, an alkyne group, a nanotube, a nanoparticle, a quantum dot, a metal, a silicon, an oligonucleotide, a peptide, a biotin, and combinations thereof.

9. (canceled)

10. The nucleic acid structure of claim 6, wherein said first anchoring moiety is attached to an oligonucleotide having a nucleotide sequence complementary for said first domain or said second domain of another oligonucleotide of said annealed motif.

11. The nucleic acid structure of claim 10, wherein said first anchoring moiety further comprises a functional element.

12. The nucleic acid structure of claim 7, wherein said functional element comprises a nucleic acid moiety, a protein moiety, a peptide moiety, a polysaccharide moiety, a microorganism moiety, a nanoparticle moiety, or combinations thereof.

13. The nucleic acid structure of claim 12, wherein said nucleic acid moiety is an aptamer domain, and/or at least one of said nucleic acid structure.

14. (canceled)

15. The nucleic acid structure of claim 1, wherein any one of said first, second and third domain, or a combination thereof, of any one of said at least three oligonucleotides further comprises an aptamer domain.

16.-17. (canceled)

18. The nucleic acid structure of claim 12, wherein said protein moiety is an antibody, an antigen binding domain thereof, or a fusion protein thereof.

19. The nucleic acid structure of claim 1, wherein an annealed motif from said plurality of annealed motifs forms a functional element.

20. The nucleic acid structure of claim 1, wherein an annealed motif from said plurality of annealed motifs further comprises a functional element incorporated in any oligonucleotide of said annealed motif.

21. (canceled)

22. The nucleic acid structure of claim 6, wherein said solid support is a metallic surface, a silicon surface, a polymer surface, and combinations thereof.

23.-47. (canceled)

48. The nucleic acid structure of claim 7, wherein said second anchoring moiety is a thiol group, an amide group, a diazonium group, an azido group, an alkyne group, a nanotube, a nanoparticle, a quantum dot, a metal, a silicon, an oligonucleotide, a peptide, a biotin, and combinations thereof.

49. The nucleic acid structure of claim 7, wherein said second anchoring moiety is attached to an oligonucleotide having a nucleotide sequence complementary for said first domain or said second domain of another oligonucleotide of said annealed motif.

50. The nucleic acid structure of claim 49, wherein said second anchoring moiety further comprises a functional element.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0085] Further features and advantages of the present disclosure will become apparent from the following detailed description, taken in combination with the appended drawings.

[0086] FIG. 1A illustrates a single oligonucleotide that may be used in the nucleic acid structure of the present invention.

[0087] FIG. 11B illustrates the general 3 oligonucleotides structural design allowing the annealed motif formation. In this example, the structure is made of short nucleic acid (e.g. DNA) oligonucleotides featuring (a) at least 3 contiguous or discontinuous sequences referred to as first, second and third domains: the third domain being a 30 bp sticky end region for base pairing to a complementary annealed motif's third domain, and two 40 bp sequences forming the main structure of the annealed motif (the first and second domains) producing binding between oligos A, B, and C as shown in FIG. 1B. The annealed motif structure based on the known properties of DNA measures 10.5 bp per turn, and 0.23-0.33 nm/bp (based on the conformation of A or B DNA). The diameter of the arms of the annealed motif is approximately 2.3 nm. Based on the 110 bp oligonucleotide length each oligonucleotide is around 25.3 nM in length. While this structure represents the general form used in the present invention, attachment of the annealed motif to the surface or to receptors/detection molecules requires one of the strands to be broken into shorter sequences of about 40 bp and 70 bp with the 40 bp sequence providing an anchor modification for attachment to the surface or an attachment sequence for receptor binding at the center of the Y junctions.

[0088] FIG. 2A illustrates assembled annealed motifs. annealed motifs A, as in FIG. 1 may act as an anchor structure on the sensor surface providing sticky ends for the binding of a second annealed motifs B. This larger structure depicts three annealed motifs B structures hybridized to an annealed motif A.

[0089] FIG. 2B illustrates the subsequent alternating additions of Y annealed motifs A and B which produce a larger honeycomb like structure. In embodiments, every annealed motifs B may have a receptor attachment site producing a radius of 63 nm between receptor attachment sites.

[0090] FIG. 3 illustrates annealed motifs for the production of uniform hexagonal honeycomb surface tiling. Schematic representation of the sequential additions required to form the nucleic acid structure for sensor surfaces.

[0091] FIG. 4A illustrates Atomic Force Microscopy showing assembly of hexagonal honey comb like structures as a regular DNA surface. The image suggests the proper assembly of the structured DNA surface.

[0092] FIG. 4B illustrates Atomic Force Microscopy showing assembly of hexagonal honey comb like structures as a regular DNA surface. The image is a zoomed in version to highlight the honeycomb like structure.

[0093] FIG. 5 illustrates the sequential annealed motifs additions building mass on the surface of a Surface Plasmon Resonance chip. Using a Surface Plasmon Resonance device to analyze a chip coated with the nucleic acid structure described herein, is showing the sequential addition of hexagonal DNA structure forming the honey comb nucleic acid structure.

[0094] FIG. 6 illustrates the alternating pattern of anchor Y junctions (comprising receptors/detection molecules) used for attachment of the structure to the sensor surface and annealed motifs used for receptor attachment. This construction allows the nucleic acid structure to covalently bind on the chip or sensor surface. Solidly anchored, the nucleic acid structure will maintain regularity and homogeneity to the detection device.

[0095] FIG. 7A shows representative images of the binding/anchoring structures on the annealed motif to bind the nucleic acid structure to the sensor surface.

[0096] FIG. 7B shows representative images of the binding/anchoring structures on the annealed motif to capture receptors/detection molecules such as antibodies, aptamers, oligonucleotides, chemical hooks, dyes, nanoparticles, etc. The receptors/detection molecules may be made of 4 oligonucleotides instead of three in this context, while preserving the basic functionality of the annealed motif. The fourth oligonucleotide may harbor overhanging elements such as, but not limited to nanotubes, quantum dots, metals, silicon, etc., using modifications such as, but not limited to an oligonucleotide, a peptide, a thiol, an amide, a diazonium, an azido, an alkyne, biotin, and receptors or linker element such as but not limited to an oligonucleotide, a peptide, a thiol, an amide, a diazonium, an azido, an alkyne, biotin, etc. to capture other nucleic acids, or any aptamers to take a specific conformation to bind, capture, link to specific molecules, or proteins, etc. to bind more or less complex molecules or microorganisms.

[0097] FIG. 8 illustrates using Surface Plasmon Resonance to monitor generating the nucleic acid structure, the antibodies attachment and the detection of a substrate, such as a bacteria. The surface plasmon resonance technology allowed monitoring the functionality and flexibility of the method, herein by capturing antibodies targeting specific substrates.

[0098] FIG. 9 illustrates a multilayered nucleic acid structure. It shows a means of amplifying the sensitivity through the generation of a multilayer nucleic acid structure where additional branched structures projecting from the surface could be used to dramatically multiply the number of detection elements.

[0099] FIG. 10A illustrates the detection of cocaine. A cocaine specific aptamer is integrated into the annealed motif of the self-assembled nucleic acid structure on the surface of a gold electrode demonstrating a change in signal versus non-functionalized surface.

[0100] FIG. 10B illustrates an AFM image of the single layer cocaine aptamer integrated scaffold system.

[0101] FIG. 11A illustrates using a specific aptamer for cocaine and neomycin detection. Using a specific aptamer attached to the annealed motif as shown in FIG. 10B, the overhanging aptamer is used in the binding and detection of free cocaine in a solution in one case, and free neomycin in a solution in the second case and as illustrated in FIG. 11A, shows the SPR device to monitor the binding of the different elements.

[0102] FIG. 11B illustrates the multilayer approach shown in FIG. 9, in which the addition of multilayers of the cocaine aptamer surface is used to increase the sensitivity and selectivity of neomycin SPR detection by lowering the detection limit and reducing nonspecific interactions.

[0103] FIG. 12 illustrates using the DNA surface to generate a homogenous assembly of PDGF-BB aptamer. Attaching the PDGF-BB aptamer to the honeycomb structure, the binding affinity could be precisely measured. In this case, the lower Kd registered and when compared with the reported value for the free aptamer confirmed that the invention is working properly.

[0104] It will be noted that throughout the appended drawings, like features are identified by like reference numerals.

DETAILED DESCRIPTION

[0105] In the current design, a number of different but partly homogenous sequences with a maximum length of 110 base pairs (bp) oligonucleotides are synthesized and purified. In this embodiment, two annealed motifs are formed, one which may be configured for surface attachment and one for receptor or detection molecule attachment. The nucleic acid structure and the annealed motifs self-assembly may be performed by mixing equimolar amounts of the oligonucleotides forming them. Initial covalent attachment may be achieved by seeding the sensor surface with a dilute anchor sequence. This is followed by the sequential addition of oligonucleotides that recognize the anchor sequence and build the seed annealed motifs. Pre-assembled annealed motifs may be subsequently incubated with the surface stepwise to produce a uniform nucleic acid structure tiling.

[0106] This unique design allows the positioning of recognition element uniformly and evenly distributed along the surface, with attachment sites that are made available for proper orientation and maximizing of binding receptors such as antibodies.

[0107] To provide an overall understanding of the systems, devices, process and methods described herein, certain illustrative implementations will be described. It is to be understood that the systems, process, and methods disclosed herein, while shown for use in a molecule detection systems for the detection of chemical, biological markers, cells and others may be applied to any systems that require analysis.

[0108] In this invention, a combination of self-assembled nucleic acid structures of DNA, RNA or PNA layers allows binding sites evenly spaced with regularity and well-structured in a controlled and predictable manner to bind different receptors or molecules developing a biological sensing device. Such construction allows an exact count of the binding detection material, for optimizing and calibrating the biosensor.

[0109] According to an embodiment, there is disclosed a nucleic acid structure comprising a plurality of annealed motifs, each of the annealed motifs comprising at least three oligonucleotides, each of the at least three oligonucleotides comprising a respective first, second and third domain, each of the first domain of a respective oligonucleotide of the at least three oligonucleotides being complementary for base pairing with a single one of the second domain of another oligonucleotide of the at least three oligonucleotides, to form the annealed motifs; and each of the third domain of a respective oligonucleotide of the at least three oligonucleotides being complementary for base pairing with the third domain of another oligonucleotide from a different annealed motif, to form nucleic acid structure.

[0110] Referring now to the drawings, and more particularly to FIG. 1B, a diagram illustrating a general nucleic acid structure comprised of at least 3 oligonucleotides allowing the formation of a Y junction (annealed motif). In embodiments, the at least three oligonucleotides may have equal lengths or any one of the at least three oligonucleotides may have different lengths. In this embodiment, the structure is comprised of short DNA oligonucleotides featuring (a) 3 contiguous sequences, one 30 base pair (bp) sticky end region for base pairing to a complementary annealed motif (D3) and two 40 bp sequences forming the main structure of the annealed motif (D2 and D1) providing binding between oligonucleotides A, B, and C as shown in FIG. 1B. The first, second, and third domain are oriented in a 5′ to 3′ orientation: i.e. 5′-D1-D2-D3-3′. According to an embodiment, the nucleic acid Y junction structure may be based on the known properties of DNA and measures 10.5 base pairs (bp) per turn, and 0.23-0.33 nm/bp (based on the conformation of A or B DNA). In embodiments, any one of the at least three oligonucleotides are from about 18 to about 180 nucleotides in length, or from about 20 to about 180, or from about 25 to about 180, or from about 30 to about 180, or from about 35 to about 180, or from about 40 to about 180, or from about 45 to about 180, or from about 50 to about 180, or from about 55 to about 180, or from about 60 to about 180, or from about 65 to about 180, or from about 70 to about 180, or from about 75 to about 180, or from about 80 to about 180, or from about 85 to about 180, or from about 90 to about 180, or from about 95 to about 180, or from about 100 to about 180, or from about 110 to about 180, or from about 120 to about 180, or from about 130 to about 180, or from about 140 to about 180, or from about 150 to about 180, or from about 160 to about 180, or from about 170 to about 180, or from about 18 to about 170 nucleotides in length, or from about 20 to about 170, or from about 25 to about 170, or from about 30 to about 170, or from about 35 to about 170, or from about 40 to about 170, or from about 45 to about 170, or from about 50 to about 170, or from about 55 to about 170, or from about 60 to about 170, or from about 65 to about 170, or from about 70 to about 170, or from about 75 to about 170, or from about 80 to about 170, or from about 85 to about 170, or from about 90 to about 170, or from about 95 to about 170, or from about 100 to about 170, or from about 110 to about 170, or from about 120 to about 170, or from about 130 to about 170, or from about 140 to about 170, or from about 150 to about 170, or from about 160 to about 170, or from about 18 to about 160 nucleotides in length, or from about 20 to about 160, or from about 25 to about 160, or from about 30 to about 160, or from about 35 to about 160, or from about 40 to about 160, or from about 45 to about 160, or from about 50 to about 160, or from about 55 to about 160, or from about 60 to about 160, or from about 65 to about 160, or from about 70 to about 160, or from about 75 to about 160, or from about 80 to about 160, or from about 85 to about 160, or from about 90 to about 160, or from about 95 to about 160, or from about 100 to about 160, or from about 110 to about 160, or from about 120 to about 160, or from about 130 to about 160, or from about 140 to about 160, or from about 150 to about 160, from about 18 to about 150 nucleotides in length, or from about 20 to about 150, or from about 25 to about 150, or from about 30 to about 150, or from about 35 to about 150, or from about 40 to about 150, or from about 45 to about 150, or from about 50 to about 150, or from about 55 to about 150, or from about 60 to about 150, or from about 65 to about 150, or from about 70 to about 150, or from about 75 to about 150, or from about 80 to about 150, or from about 85 to about 150, or from about 90 to about 150, or from about 95 to about 150, or from about 100 to about 150, or from about 110 to about 150, or from about 120 to about 150, or from about 130 to about 150, or from about 140 to about 150, or from about 18 to about 140 nucleotides in length, or from about 20 to about 140, or from about 25 to about 140, or from about 30 to about 140, or from about 35 to about 140, or from about 40 to about 140, or from about 45 to about 140, or from about 50 to about 140, or from about 55 to about 140, or from about 60 to about 140, or from about 65 to about 140, or from about 70 to about 140, or from about 75 to about 140, or from about 80 to about 140, or from about 85 to about 140, or from about 90 to about 140, or from about 95 to about 140, or from about 100 to about 140, or from about 110 to about 140, or from about 120 to about 140, or from about 130 to about 140, or from about 18 to about 130 nucleotides in length, or from about 20 to about 130, or from about 25 to about 130, or from about 30 to about 130, or from about 35 to about 130, or from about 40 to about 130, or from about 45 to about 130, or from about 50 to about 130, or from about 55 to about 130, or from about 60 to about 130, or from about 65 to about 130, or from about 70 to about 130, or from about 75 to about 130, or from about 80 to about 130, or from about 85 to about 130, or from about 90 to about 130, or from about 95 to about 130, or from about 100 to about 130, or from about 110 to about 130, or from about 120 to about 130, or from about 18 to about 120 nucleotides in length, or from about 20 to about 120, or from about 25 to about 120, or from about 30 to about 120, or from about 35 to about 120, or from about 40 to about 120, or from about 45 to about 120, or from about 50 to about 120, or from about 55 to about 120, or from about 60 to about 120, or from about 65 to about 120, or from about 70 to about 120, or from about 75 to about 120, or from about 80 to about 120, or from about 85 to about 120, or from about 90 to about 120, or from about 95 to about 120, or from about 100 to about 120, or from about 110 to about 120, or from about 18 to about 110 nucleotides in length, or from about 20 to about 110, or from about 25 to about 110, or from about 30 to about 110, or from about 35 to about 110, or from about 40 to about 110, or from about 45 to about 110, or from about 50 to about 110, or from about 55 to about 110, or from about 60 to about 110, or from about 65 to about 110, or from about 70 to about 110, or from about 75 to about 110, or from about 80 to about 110, or from about 85 to about 110, or from about 90 to about 110, or from about 95 to about 110, or from about 100 to about 110, or from about 18 to about 100 nucleotides in length, or from about 20 to about 100, or from about 25 to about 100, or from about 30 to about 100, or from about 35 to about 100, or from about 40 to about 100, or from about 45 to about 100, or from about 50 to about 100, or from about 55 to about 100, or from about 60 to about 100, or from about 65 to about 100, or from about 70 to about 100, or from about 75 to about 100, or from about 80 to about 100, or from about 85 to about 100, or from about 90 to about 100, or from about 95 to about 100, or from about 18 to about 95 nucleotides in length, or from about 20 to about 95, or from about 25 to about 95, or from about 30 to about 95, or from about 35 to about 95, or from about 40 to about 95, or from about 45 to about 95, or from about 50 to about 95, or from about 55 to about 95, or from about 60 to about 95, or from about 65 to about 95, or from about 70 to about 95, or from about 75 to about 95, or from about 80 to about 95, or from about 85 to about 95, or from about 90 to about 95, or from about 18 to about 90 nucleotides in length, or from about 20 to about 90, or from about 25 to about 90, or from about 30 to about 90, or from about 35 to about 90, or from about 40 to about 90, or from about 45 to about 90, or from about 50 to about 90, or from about 55 to about 90, or from about 60 to about 90, or from about 65 to about 90, or from about 70 to about 90, or from about 75 to about 90, or from about 80 to about 90, or from about 85 to about 90, or from about 18 to about 85 nucleotides in length, or from about 20 to about 85, or from about 25 to about 85, or from about 30 to about 85, or from about 35 to about 85, or from about 40 to about 85, or from about 45 to about 85, or from about 50 to about 85, or from about 55 to about 85, or from about 60 to about 85, or from about 65 to about 85, or from about 70 to about 85, or from about 75 to about 85, or from about 80 to about 85, or from about 18 to about 80 nucleotides in length, or from about 20 to about 80, or from about 25 to about 80, or from about 30 to about 80, or from about 35 to about 80, or from about 40 to about 80, or from about 45 to about 80, or from about 50 to about 80, or from about 55 to about 80, or from about 60 to about 80, or from about 65 to about 80, or from about 70 to about 80, or from about 75 to about 80, or from about 18 to about 75 nucleotides in length, or from about 20 to about 75, or from about 25 to about 75, or from about 30 to about 75, or from about 35 to about 75, or from about 40 to about 75, or from about 45 to about 75, or from about 50 to about 75, or from about 55 to about 75, or from about 60 to about 75, or from about 65 to about 75, or from about 70 to about 75, or from about 18 to about 70 nucleotides in length, or from about 20 to about 70, or from about 25 to about 70, or from about 30 to about 70, or from about 35 to about 70, or from about 40 to about 70, or from about 45 to about 70, or from about 50 to about 70, or from about 55 to about 70, or from about 60 to about 70, or from about 65 to about 70, or from about 18 to about 65 nucleotides in length, or from about 20 to about 65, or from about 25 to about 65, or from about 30 to about 65, or from about 35 to about 65, or from about 40 to about 65, or from about 45 to about 65, or from about 50 to about 65, or from about 55 to about 65, or from about 60 to about 65, or from about 18 to about 60 nucleotides in length, or from about 20 to about 60, or from about 25 to about 60, or from about 30 to about 60, or from about 35 to about 60, or from about 40 to about 60, or from about 45 to about 60, or from about 50 to about 60, or from about 55 to about 60, or from about 18 to about 55 nucleotides in length, or from about 20 to about 55, or from about 25 to about 55, or from about 30 to about 55, or from about 35 to about 55, or from about 40 to about 55, or from about 45 to about 55, or from about 50 to about 55, or from about 18 to about 50 nucleotides in length, or from about 20 to about 50, or from about 25 to about 50, or from about 30 to about 50, or from about 35 to about 50, or from about 40 to about 50, or from about 45 to about 50, or from about 18 to about 45 nucleotides in length, or from about 20 to about 45, or from about 25 to about 45, or from about 30 to about 45, or from about 35 to about 45, or from about 40 to about 45, or from about 18 to about 40 nucleotides in length, or from about 20 to about 40, or from about 25 to about 40, or from about 30 to about 40, or from about 35 to about 40, or from about 18 to about 35 nucleotides in length, or from about 20 to about 35, or from about 25 to about 35, or from about 30 to about 35, or from about 18 to about 30 nucleotides in length, or from about 20 to about 30, or from about 25 to about 30, or from about 18 to about 25 nucleotides in length, or from about 20 to about 25, or from about 18 to about 20 nucleotides in length.

[0111] The diameter of the arms of the nucleic acid Y junctions is approximately 2.3 nm. Based on the 110 bp oligonucleotide length, each sequence is about 25.3 nm in length. While this structure represents the general form used in the invention, attachment of the nucleic acid structure to surfaces or receptors may be achieved by having one of the strands to be broken into a sequence of 40 bp and 70 bp, with the 40 bp sequence comprising an anchoring modification for attachment to the surface or an attachment sequence for receptor binding, for example at the center of the Y junctions.

[0112] According to an embodiment, eight oligonucleotides with a maximum length of 110 bp are synthesized and purified. In embodiments, two annealed motifs according to the present invention are formed: one for surface attachment and the other for receptor attachment. The annealed motif self-assembly was performed by mixing equimolar DNA (each one of the individual oligonucleotides) component strands. Initial covalent attachment is achieved by seeding the sensor surface with a dilute anchor oligonucleotide. This is followed by the sequential addition of oligonucleotides that recognize the anchor oligonucleotides in high salt buffer and building the seed annealed motifs. Pre-annealed motifs are subsequently incubated with the surface stepwise in high salt buffer to produce a resulting nucleic acid structure having a “3-Y” shape joined at a central stem (See FIG. 2A) and which eventually form a uniform hexagonal honeycomb surface tiling (See FIG. 2B). FIGS. 1 and 2 show that the selection of 110 bp oligonucleotides is recommended to generate hexagonal honeycomb-like structures of the specific dimensions and of 63 nm diameter. According to an embodiment, it is acceptable and possible to use longer or shorter oligonucleotides as long as the at least three defined domains constituting the design of each oligonucleotides is respected to provide the desired assembly into annealed motifs and ultimately the nucleic acid structures. In embodiments, changing the total length of the oligonucleotides will change and customize the honeycomb structure radius.

[0113] Due to this unique design, recognition element-target interactions generate uniform evenly distributed attachment sites that are then made available for proper orientation and maximizing of binding receptors such as antibodies.

[0114] Now referring to FIG. 2, there is shown an embodiment of annealed motifs assembly. An annealed motif (See Y junction A in FIG. 2A) is initially formed through seed structures on the sensor surface, which provides attached ends for the binding of an annealed motif referred to as Y junction B, which when exposed to attached Y junction A, produces a structure composed of one Y junction A and three Y junction B (FIG. 2A). This is then exposed to a solution containing preassembled Y junction A which adds 6 Y junction A's to the structure and forms the initial hexagonal conformations of the seeds nucleic acid structures shown in FIG. 2B. As the surface is exposed to alternating solutions of annealed motifs Y junction A and B the honeycomb continues to grow and form links between the initial seed points on the sensor surface. With the sensor surface coverage every 63 nm harbors a binding site for DNA elements, aptamers, proteins, peptides, etc.

[0115] According to an embodiment, an important step in the forming of DNA surfaces is to assemble the Y junctions using sequential addition of the strands of annealed motif Y-junction A, which builds initially sparsely seeded Y-junction A and subsequently alternating the addition of pre-assembled Y-junctions B, to eventually produce the honeycomb like pattern; this pattern produces 7 attachment sites in a radius of approximately 63 nm. Now referring to FIG. 3, there is shown a summary of the nucleic acid structure self-assembling sensor surface.

[0116] Therefore, according to embodiments, the nucleic acid structure of the present invention may further comprise a first anchoring moiety, for anchoring of the nucleic acid structure to a solid support, such as the sensor surface.

[0117] According to another embodiment, the nucleic acid structure may further comprise a second anchoring moiety, for anchoring a functional element to the nucleic acid structure.

[0118] In embodiments, the first or second anchoring moiety may be a thiol group, an amide group, a diazonium group, an azido group, an alkyne group, a nanotube, a quantum dot, a metal, a silicon, an oligonucleotide, a peptide, a biotin, and combinations thereof. For example, the oligonucleotide may be a polyT(25), a polyA(25), or any oligonucleotides complementary to another oligonucleotide on the surface of the solid support and/or of the functional element that will be coupled to it. According to some embodiments, the first or second anchoring moiety may be attached to an oligonucleotide having a nucleotide sequence complementary for the first domain or the second domain of another oligonucleotide of the annealed motif. According to an embodiment, the first or the second anchoring moiety may further comprise a functional element.

[0119] According to another embodiment, the functional element may comprise a nucleic acid moiety, a protein moiety, a peptide moiety, a polysaccharide moiety, a microorganism moiety, or combinations thereof. For example, the nucleic acid moiety may be an aptamer domain.

[0120] According to another embodiment, any one of the first, second and third domain, or a combination thereof, of any one of the at least three oligonucleotides may further comprises an aptamer domain. According to an embodiment, the aptamer domain may be configured to bind to an antigen.

[0121] In an embodiment, the nucleic acid moiety may be a nucleic acid structure according to the present invention; the protein moiety may be an antibody, an antigen binding domain thereof, or a fusion protein thereof.

[0122] According to an embodiment, an annealed motif from the plurality of annealed motifs may form a functional element, and may therefore perform both a structural role as well as a functional role in the nucleic acid structure of the present invention. In another embodiment, an annealed motif from the plurality of annealed motifs may further comprise a functional element incorporated in any oligonucleotide of the annealed motif. In an embodiment, the functional element is an aptamer domain.

[0123] According to another embodiment, the covalent immobilization of antibodies (as functional elements) on various surfaces have been reported ranging from silane linkers on hydroxylated surfaces and thiol monolayers on gold to functional polymers and hydrogels. More recently, various DNA nanostructures have emerged as surface supports. Several strategies have been used to bind proteins at specific locations on DNA nanoscaffolds, such as biotin-streptavidin interaction; antibody-antigen interaction; aptamer binding, Ni(II)-NTA-hexahistidine interaction, and hybridization with DNA-tethered proteins. However, even for antibodies labeled at a specific site, the high flexibility of linkers offers very limited control over the orientation of the antibody. Hence, the development of methods to control the local orientation of antibodies would offer great advances for sensing, structure determination and studies of multivalent interactions.

[0124] According to another embodiment there is disclosed that 2 separate annealed motifs (Y-junctions) that bind each other, one annealed motifs that contains a thiol group for Au attachment, and another annealed motifs contains a poly T(25) for aptamer attachment. The specific sequence was generated with a random sequence generator and the sequences were linked together and submitted to the RNA Vienna software to confirm complementarity.

[0125] In embodiments, the deposition of the annealed motifs is associated with thiolated DNA anchor for initial annealed motif, then sequential addition of complementary annealed motifs in 1M NaCl buffer is provided as each addition is allowed to hybridize for at least an hour.

[0126] According to another embodiment, the solid support on which the nucleic acid structure may be deposited may be a metallic surface, a silicon surface, a polymer surface, and combinations thereof. Examples of metallic surface include a gold surface, a platinum surface, an iron surface, a steel surface, a copper surface, or combinations thereof. Examples of silicon surfaces include a quartz surface, a glass surface, a polymerized siloxane surface, or combinations thereof. Examples of polymer surfaces include a cellulose surface, a starch surface, a nitrocellulose surface, a chitin surface, a plastic surface. The cellulose may be a carboxymethyl cellulose surface.

[0127] According to another embodiment, there is disclosed a surface comprising a solid support and a nucleic acid structure according to the present invention attached thereon.

[0128] The surface may be a metallic surface, a silicon surface, a polymer surface, and combinations thereof. Examples of metallic surface include a gold surface, a platinum surface, an iron surface, a steel surface, a copper surface, or combinations thereof. Examples of silicon surfaces include a quartz surface, a glass surface, a polymerized siloxane surface, or combinations thereof. Examples of polymer surfaces include a cellulose surface, a starch surface, a nitrocellulose surface, a chitin surface, a plastic surface. The cellulose may be a carboxymethyl cellulose surface.

[0129] Now referring to FIG. 4, Atomic Force Microscopy is used to visualize the assembled nucleic acid structure FIG. 4A illustrates the general view of the biosensor and FIG. 4B illustrates the honeycomb like surface coverage. This observation confirms the efficacy of the method in generating a single layer of honeycomb-like deoxyribonucleic acid (DNA) structures on the surface of the sensor tool. This method may allow the observation of each antibody attached on the DNA scaffold while it is binding a visible marker.

[0130] Now referring to FIG. 5 there is show Surface Plasmon Resonance analysis of DNA tiles addition confirming the structure assembly on the surface. A scaffold is formed from a single layer of a nucleic acid structure of the present invention, which is shown by the shift of SPR resonance over time of addition.

[0131] Now referring to FIG. 6, the figure illustrates an alternating pattern of annealed motifs where the junctions of the formed nucleic acid structure are used for attachment of the nucleic acid structure to the sensor surface and other annealed motifs are used for receptor (e.g. antibodies, peptides, or other protein elements) attachment.

[0132] Now referring to FIG. 7, the figure illustrates embodiments of the nucleic acid structure to a surface. FIG. 7A shows, using the symbol of a leaf, that chemical groups may be used to bind the nucleic acid structure on the sensor's surface. FIG. 7B shows the branching symbol as representing the different moieties that may be conjugated to the nucleic acid structure of the present invention, including without limitations receptors, normally but without limitation, using a overhanging oligonucleotide fragment that can be, but not limited to, an oligonucleotide poly(T) strand, an aptamer, or others.

[0133] Now referring to FIG. 8, the figure illustrates the use of Surface Plasmon Resonance to monitor generating the nucleic acid structure, the attachment of antibodies as well as the detection of a substrate, such as a bacteria. In this experiment, one may observe that at each step of the nucleic acid structure's assembly, including the addition of the receptor molecules (here antibodies have been used), and the final binding of a substrate bacteria to be detected, and SPR response wavelength shift is observed, clearly demonstrating the efficacy of the method.

[0134] Now referring to FIG. 9, the figure illustrates how the sensitivity of the nucleic acid structure of the present invention may be amplified by the generation of multilayer surfaces and/or multidimensional, as demonstrated in FIG. 11B, from which branched structures based on attached nucleic acid structures of the present invention projecting from the surface to dramatically multiply the number of binding or reacting detection elements.

[0135] The use of elements that can link together by hybridization, using specific and unique sequences allows the construction of complex nanostructures with large number of detection sites that can be easily multiplied, thereby greatly increasing the sensitivity of such biosensor.

[0136] Therefore, according to another embodiment, there is disclosed a method for producing a nucleic acid structure from at least first and second annealed motifs, each annealed motif comprising at least a first, second and third oligonucleotide each comprising a respective first, second and third domain, each of the first domain of a respective oligonucleotide of the at least a first, second and third oligonucleotide being complementary for base pairing with a single one of the second domain of another of the at least first, second or third oligonucleotide, to form the annealed motif; and at least one of the third domain of a respective oligonucleotide of the at least first, second or third oligonucleotide of the first annealed motif being complementary for base pairing with at least one third domain of one of the at least first, second or third oligonucleotide from the second annealed motif, to form nucleic acid structure, the method comprising step a): [0137] a) mixing in alternation an amount of the first annealed motif with the second annealed motif for a time sufficient to form the nucleic acid structure.

[0138] According to an embodiment, one of the first or the second annealed motif may be an anchored annealed motif, anchored to a solid support.

[0139] In an embodiment, the anchored annealed motif is anchored to the solid support by step a′) before step a): [0140] a′) deposition on the solid support of an oligonucleotide C′ having a first domain and a first anchoring moiety, for anchoring of the oligonucleotide C′ to a solid support configured to react with the first anchoring moiety, [0141] followed by mixing of an oligonucleotide A having a second domain complementary for base pairing with the first domain of oligonucleotide C′, [0142] followed by mixing of an oligonucleotide B having a second domain complementary for base pairing with a first domain of oligonucleotide A, and [0143] followed by mixing of an oligonucleotide C″ having a second domain complementary for base pairing with a first domain of oligonucleotide B, [0144] to form the anchored annealed motif;
wherein each of the oligonucleotide A, B and C″ have a respective third domain complementary for base pairing with at least one third domain of another oligonucleotide from a different annealed motif.

[0145] According to an embodiment, the annealed motif from the at least first and second annealed motifs may form a functional element.

[0146] According to another embodiment, the annealed motif from the at least first and second annealed motifs may further comprise a functional element incorporated in any oligonucleotide of the annealed motif.

[0147] According to another embodiment, the one of the at least first or the second annealed motif is an anchorage annealed motif further comprises a second anchoring moiety, for anchoring a functional element to the nucleic acid structure.

[0148] For example, the functional element may be an aptamer domain. Other examples of functional element comprise a nucleic acid moiety, a protein moiety, a peptide moiety, a polysaccharide moiety, a microorganism moiety, or combinations thereof.

[0149] According to another embodiment, there is disclosed a method for preparing an anchorage annealed motif is prepared by step a″ [0150] a″) mixing an oligonucleotide D′ having a first domain and a second anchoring moiety, for anchoring a functional element to the oligonucleotide D′, [0151] followed by mixing of an oligonucleotide E having a second domain complementary for base pairing with the first domain of oligonucleotide D′, [0152] followed by mixing of an oligonucleotide F having a second domain complementary for base pairing with a first domain of oligonucleotide E, and [0153] followed by mixing of an oligonucleotide D″ having a second domain complementary for base pairing with a first domain of oligonucleotide F, [0154] to form the anchorage annealed motif, [0155] wherein each of the oligonucleotide D″, E and F have a respective third domain complementary for base pairing with at least one third domain of another oligonucleotide from a different annealed motif.

[0156] The first or the oligonucleotide C′ or the oligonucleotide D′ may further comprises a functional element.

[0157] The functional element may comprises a nucleic acid moiety, a protein moiety, a peptide moiety, a polysaccharide moiety, a microorganism moiety, a nanoparticle moiety, or combinations thereof.

[0158] According to an embodiment, there is disclosed sensor for the detection of an analyte comprising the nucleic acid motif of the present invention, or the surface of any one of the present invention, in communication with a system for detecting a physical change when the analyte interacts with the nucleic acid motif or the surface. Examples of systems include without limitations surface plasmon resonance (SPR), electrochemical detection using electrodes, colorimetric (such as dip tests like pregnancy tests), spectrometric (requiring a spectrophotometer to detect changes), fluorometric, luminescent, acoustic metric, densitometry, etc. The physical changes that may be detected include without limitations SPR wavelength shift (light interacting with the functionalized metal surface), electrochemical (conductivity, impedance, etc.), colorimetric, fluorometric, and luminescent (changes in light absorption emittance which can be detected visually or with equipment), acoustic metric (change in the penetration/transmission of acoustic waves), densitometry (changes in density at a surface that affect signal transmission such as light), and more.

[0159] The physical change may be a change in surface plasmon resonance, a change in electrical signal, a change in fluorescence signal, and a change, and combinations thereof.

[0160] According to an embodiment, there is disclosed method of detecting an analyte comprising detecting a physical change with a sensor comprising the nucleic acid motif of the present invention, or the surface of any one of the present invention, in communication with a system for detecting the physical change.

[0161] The physical change may be a change in surface plasmon resonance, a change in electrical signal, a change in fluorescence signal, and a change, and combinations thereof.

[0162] Now referring to FIG. 10A, the figure illustrates the detection of cocaine. A cocaine specific aptamer is incorporated in the one of the annealed motif of the self-assembled nucleic acid structure on the surface of a gold electrode. The passage of a solution comprising 0.1 mg/ml of cocaine shows a change in signal versus non-functionalized surface.

[0163] To further demonstrate the usefulness of the present invention, experimental models have been used, using a biosensor surface coated with a multilayer of nucleic acid structures of the present invention on which have been bound aptamers specific to cocaine and neomycin (See FIG. 11), as well as the nucleic acid structure bound with antibodies for the detection of E. coli bacteria. These experiments measured binding using a surface plasmon resonance apparatus, or using an electrochemical measurement system, and demonstrates a better signal detection associated with higher sensitivity in detecting molecules and microorganisms in the environment.

[0164] The present invention will be more readily understood by referring to the following examples which are given to illustrate the invention rather than to limit its scope.

Example 1

Cocaine Detection on Gold Electrochemical Electrode

[0165] Combining self-assembling nucleic acid structures of the present invention and aptamers for cocaine detection, FIG. 10 illustrates the detection of cocaine using a cocaine specific aptamer incorporated in an annealed motif of the self-assembled nucleic acid structure on the surface of a gold electrode. The signal obtained clearly showed a change in signal versus non-functionalized surface.

[0166] The Cocaine aptamer surface was designed by initially producing the sequence for two annealed motifs based on three 55 bp oligonucleotides, where 18 bp domains were used to stabilize the internal structure of the annealed motif (i.e. as first and second domains) and 19 bp domains were used as third domains (i.e. sticky ends) for binding to the other annealed motif. Once the nucleic acid structure was designed, one of the annealed motif was used as the attachment/anchor structure by splitting one of the 55 bp oligonucleotide at the center of the Y junction to create an 18 bp oligonucleotide sequence and a 37 bp oligonucleotide sequence. The 18 bp oligonucleotide sequence was subsequently modified at the 3′ end with a thiol group to allow attachment to a gold surface. The center of the other annealed motif was then replaced with the sequence of the cocaine aptamer to integrate the aptamer into the structure of the DNA scaffold.

TABLE-US-00001 TABLE I Sequences of DNA Aptamers on Scaffold elements Annealed motif A cocaine apt Seq ID No: 1 Seq1a YJA CocaApt GGCGTGCGCGTTCCATG-SH Seq ID No: 2 Seq1b YJA CocaApt AAACCTGTCATAACTTACTGTCCTGATCGGAAGGATC Seq ID No: 3 Seq2 YJA CocaApt GTAAGTTATGACAGGTTTCTAGATCTTTGCTCACGCTGTCC TGATCGGAAGGATC Seq ID No: 4 Seq3 YJA CocaApt GCGTGAGCAAAGATCTAGACATGGAACGCGCACGCCTGTC CTGATCGGAAGGATC Annealed motif B cocaine apt Seq ID No: 5 Seq1 YJB CocaApt CTGTAGTGAGTTCGAGACAAGGACCATTGCATGCGAGATC CTTCCGATCAGGACA Seq ID No: 6 Seq2 YJB CocaApt TCGCATGCAATGGTCCTTCAATGATATCCCTGGATGGATCC TTCCGATCAGGACA Seq ID No: 7 Seq3 YJB CocaApt CATCCAGGGATATAGTGGGTCGAGAACTCACTACAGGATC CTTCCGATCAGGACA

[0167] In the example, using the oligonucleotides of Table I, the surface deposition is according the following steps. Mix 2 mL 100 mM aqueous thiolated Y-junction A seq 1a (SEQ ID NO:1), with 4 mL 50 mM TCEP and incubate for 1 hour at room temperature. Dilute 1/500 with H.sub.2O twice and then mix at a ratio of 6 mL to 394 mL 10 mM citrate buffer 0.5 M NaCl (pH 3) to produce 400 mL of deposition solution per cm.sup.2 (˜2×10.sup.8 molecules/cm.sup.2). Deposit on gold substrate and incubate for 30 min. Wash with H.sub.2O followed by washing with 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA. Add an equivalent volume approximately 400 μl/cm.sup.2 Y-junction A sequence 3 (SEQ ID NO:4) in 50 nM in 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA, and incubate for 1 hour. Wash with 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA. Add 400 μl/cm.sup.2 Y-junction A sequence 2 (SEQ ID NO:3), 50 nM in 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA, and incubate for 1 hour. Wash with 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA. Add 400 μl/cm.sup.2 Y-junction A sequence 1B (SEQ ID NO:2), 50 nM in 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA, and incubate for 1 hour to complete the deposition of the annealed motif A seeding structures.

[0168] Subsequent additions involve the addition of preassembled annealed motifs which were produced by premixing Seq1a YJA CocaApt (SEQ ID NO:1), Seq1b YJA CocaApt (SEQ ID NO:2), Seq2 YJA CocaApt (SEQ ID NO:3), Seq3 YJA CocaApt (SEQ ID NO:4) to produce Y-junction A at a concentration of 50 nM in 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA and premixing Seq1 YJB CocaApt (SEQ ID NO:5), Seq2 YJB CocaApt (SEQ ID NO:6) and Seq3 YJB CocaApt (SEQ ID NO:7) to produce annealed motif B at a concentration of 50 nM in 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA.

[0169] Continue by washing the surface with 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA. Followed by the addition of the incubation of 400 μl of annealed motif B, 50 nM in 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA, for 1 hour. Wash with 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA. Add 400 μl annealed motif A, 50 nM in 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA, and incubate for 1 hour. Wash with 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA. These steps of annealed motif B and annealed motif B addition are repeated in alternation another 3 times, and then motif B again one last time. Wash with 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA and optionally add 400 μl 50 mM TCEP and incubate for 1 hour.

[0170] The sensing surface was washed with 10 mM phosphate buffer 100 mM NaCl pH 7.4. Detection of cocaine or neomycin was performed in the same buffer where the surface was exposed to increasing concentrations of the ligands and response was recorded.

Example 2

PDGF-BB SPR Detection

[0171] Attaching the PDGF-BB aptamer to the Honeycomb structure resulted in a binding affinity of 28+/−2 nM.

[0172] The hexagonal DNA surface was designed by initially producing the sequence for two annealed motifs based on three 110 bp oligonucleotides, where oligonucleotides sequence lengths of 40 bp domains were used to stabilize the internal structure of the annealed motifs (i.e. as the first and second domains) and 30 bp domains were used as third domains (i.e. sticky ends) for binding to the other annealed motif. Once the nucleic acid structure was designed, one of the annealed motifs was used as the attachment or anchor structure by splitting one of the 110 bp oligonucleotide sequences at the center of the annealed motifs to create a 40 bp oligonucleotide sequence and a 70 bp oligonucleotide sequence. The 40 bp oligonucleotide sequence was subsequently modified at the 3′ end with a thiol group to allow attachment to a gold surface at the center of the annealed motifs. The other annealed motif was used for receptor attachment where one of the 110 bp oligonucleotide sequences was split at the center of the annealed motifs to create a 40 bp oligonucleotide sequence and a 70 bp oligonucleotide sequence. The 40 bp oligonucleotide sequence was subsequently modified at the 3′ end with a 25 bp oligonucleotide poly T sequence to provide complement binding for receptor attachment.

TABLE-US-00002 TABLE II Sequences of DNA Scaffold elements Y-junction A Seq ID No: 8 Seq1a YJA HEX CTCTCAAAGTATTATGCAGGACGGCGTGCGCGTTCCATG- SH Seq ID No: 9 Seq1b YJA HEX AAACCTGTCATAACTTACCTGAGACTAGTTGGAAGTGTGG CATAGCTTTCATGTCCTGATCGGAAGGATC Seq ID No: 10 Seq2 YJA HEX CCACACTTCCAACTAGTCTCAGGTAAGTTATGACAGGTTTC TAGATCTTTGCTCACGCATCTAGTCGGTCCACGTTTGGTC ATAGCTTTCATGTCCTGATCGGAAGGATC Seq ID No: 11 Seq3 YJA HEX ACCAAACGTGGACCGACTAGATGCGTGAGCAAAGATCTAG ACATGGAACGCGCACGCCGTCCTGCATAATACTTTGAGAG CATAGCTTTCATGTCCTGATCGGAAGGATC Y-junction B HEX Seq ID No: 12 Seq1a YJB HEX GTTGGCGCCCGACCCTCAGACTCTGTAGTGAGTTCTATGT TTTTTTTTTTTTTTTTTTTTTTTTT Seq ID No: 13 Seq1b YJB HEX CCGAGCCATTGCATGCGAGATCGGTAGATTGATAGGGGA TGATCCTTCCGATCAGGACATGAAAGCTATG Seq ID No: 14 Seq2 YJB HEX ATCCCCTATCAATCTACCGATCTCGCATGCAATGGCTCGG ACAGAATATCCCTGGATGCAATAGACGGACAGCTTGGTAT GATCCTTCCGATCAGGACATGAAAGCTATG Seq ID No: 15 Seq3 YJB HEX ATACCAAGCTGTCCGTCTATTGCATCCAGGGATATTCTGT ACATAGAACTCACTACAGAGTCTGAGGGTCGGGCGCCAA CGATCCTTCCGATCAGGACATGAAAGCTATG

[0173] In the example, using the oligonucleotides of Table II, the surface deposition followed, mix 2 μl 100 mM aqueous thiolated Y-junction A seq1a HEX (SEQ ID NO:8), with 4 μl 50 mM TCEP and incubate for 1 hour at room temperature. Dilute 1/500 with H.sub.2O twice and then mix at a ratio of 6 μl to 394 μl 10 mM citrate buffer 0.5 M NaCl (pH 3) to produce 400 μl of deposition solution per cm.sup.2 (˜2×10.sup.8 molecules/cm.sup.2). Deposit on gold substrate and incubate for 30 min. Wash with H.sub.2O followed by washing with 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA. Add an equivalent volume approximately 400 μl/cm.sup.2 Y-junction A sequence 3 HEX (SEQ ID NO:11) in 50 nM in 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA, and incubate for 1 hour. Wash with 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA. Add 400 μl/cm.sup.2 Y-junction A sequence 2 HEX (SEQ ID NO:10), 50 nM in 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA, and incubate for 1 hour. Wash with 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA. Add 400 μl/cm.sup.2 Y-junction A sequence 1B HEX (SEQ ID NO:9), 50 nM in 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA, and incubate for 1 hour to complete the deposition of the first annealed motif seeding structures.

[0174] Subsequent additions involve the addition of preassembled annealed motifs which were produced by premixing Seq1a YJA HEX (SEQ ID NO:8), Seq1b YJA HEX (SEQ ID NO:9), Seq2 YJA HEX (SEQ ID NO:10), Seq3 YJA HEX (SEQ ID NO:11) to produce annealed motif A at a concentration of 50 nM in 10 mM Tris pH 7.4, 1 M NaCl and 1 mM EDTA, and premixing Seq1a YJB HEX (SEQ ID NO:12), Seq1b YJB HEX (SEQ ID NO:13), Seq2 YJB HEX (SEQ ID NO:14) and Seq3 YJB HEX (SEQ ID NO:15) to produce annealed motif B at a concentration of 50 nM in 10 mM Tris pH 7.4, 1 M NaCl and 1 mM EDTA.

[0175] Continue by washing the surface with 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA. Followed by the addition of the incubation of 400 μl of annealed motif B, 50 nM in 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA, for 1 hour. Wash with 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA. Add 400 μl annealed motif A, 50 nM in 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA and incubate for 1 hour. Wash with 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA. These steps of annealed motif B and annealed motif B addition are repeated in alternation another 3 times, and then motif B again one last time.

[0176] The sensing surface was then exposed to the Platelet-derived growth factor aptamer which had been modified, as in Table III (SEQ ID NO:16), to include a 25 bp poly A tail at a concentration of 50 nM in 10 mM Tris pH 7.4 1 M NaCl 1 mM EDTA and incubated for an hour.

TABLE-US-00003 TABLE III Sequences of DNA Modified Aptamer Seq ID No: 16 CACAGGCTACGGCACGTAGAGCATCACCA TGATCCTGTGAAAAAAAAAAAAAAAAAAA AAAAAA

[0177] The sensing surface was washed with 10.1 mM Na.sub.2HPO.sub.4, 1.8 mM KH.sub.2PO.sub.4, 137 mM NaCl and 2.7 mM KCl, 1 mM MgCl2, pH 7.4. Detection of PDGF was performed in the same buffer where the surface was exposed to increasing concentrations of the ligands and response was recorded.

Example 3

Neomycin Detection on SPR

[0178] Combining self-assembling surfaces and a cocaine aptamer also known to bind neomycin, using the sensing capabilities of the Surface Plasmon Resonance made neomycin detectable (MW 614) with an affinity of Kd 10.5 μM. Sufficiently sensitive results.

[0179] These results are illustrated in FIGS. 10 and 11. As shown in FIG. 11, the increasing intensity over time is a representation of the different binding levels of neomycin on the DNA scaffold.

[0180] Multilayered structures produced in FIG. 11B were produced using a modified version of the single layer cocaine aptamer surface (example 1). In this iteration of the structure the annealed motifs used to anchor the structure was modified to include a third domain (sticky end) for attachment of the second layer. Once the monolayer was produced a second layer was added by introducing a new annealed motif which contained a third domain (sticky end) for attachment to the first layer, three third domain (sticky ends) (as described for the first layer) for binding the annealed domain containing the cocaine aptamer and a new third domain (sticky end) for attaching a third layer. Once this connection nucleic acid structure was added, the layer was completed with the addition of the cocaine aptamer containing annealed motif. The third layer could then be added by introducing a new annealed motif which contained a third domain (sticky end) for attachment to the second layer, three third domains (sticky ends) for binding the annealed motif containing the cocaine aptamer and the same third domain (sticky end) that was used to connect the first layer to the second layer. This repetition of third domains (sticky ends) allowed for subsequent layers to be built by alternation of the connection nucleic acid structures between addition of cocaine aptamer containing annealed motifs.

TABLE-US-00004 TABLE 4 Sequences of DNA used to construct multilayer structures Replacement sequence (Seq ID 2) for surface attachment Y junction and odd layers addition Seq ID No: 17 Seq1b YJC CocaApt CTGAACATCCACACTTTAGTAAACCTGTCATAACTTACT GTCCTGATCGGAAGGATC Replacement sequences (Seq ID 1 & 2) Sequences used in connection  Y junction for even layers Seq ID No: 18 Coca 2nd layer Seq1a GGCGTGCGCGTTCCATGTCTGAATCGATGCGCGGCTT YJA CocaApt C Seq ID No: 19 Coca 2nd layer Seq1b ACTAAAGTGTGGATGTTCAGAAACCTGTCATAACTTACT YJA CocaApt GTCCTGATCGGAAGGATC Replacement sequence (Seq ID 1) Sequence used with Seq 17 in connection Y junction for odd layers Seq ID No: 20 Coca 3rd layer Seq1a GGCGTGCGCGTTCCATGTGAAGCCGCGCATCGATTCA YJA CocaApt G

[0181] In this example the construction of the initial monolayer was prepared as described previously but with the initial seed annealed motif structures, and subsequent annealed motif additions containing the replacement sequence (Seq ID NO: 17) in annealed motif A. The addition of the second layer was achieved by adding a new annealed motif constructed from SEQ ID NOs: 3, 4, 18 and 19 (annealed motif C) 400 μL 50 nM in 10 mM Tris pH 7.4, 1 M NaCl, 1 mM EDTA, for 1 hour. This was washed with 10 mM Tris pH 7.4, 1 M NaCl, 1 mM EDTA followed by the addition of 400 μL annealed motif B, 50 nM in 10 mM Tris pH 7.4, 1 M NaCl, 1 mM EDTA for 1 hour. With the completion of the second layer a third was constructed through the addition of a new annealed motif constructed from SEQ ID NOs: 3, 4, 17, 20 (annealed motif D) 400 μL 50 nM in 10 mM Tris pH 7.4, 1 M NaCl, 1 mM EDTA, for 1 hour. This was washed with 10 mM Tris pH 7.4, 1 M NaCl, 1 mM EDTA followed by the addition of 400 μL annealed motif B, 50 nM in 10 mM Tris pH 7.4, 1 M NaCl, 1 mM EDTA for 1 hour. With the addition of layer three, additional layers could be constructed by using the previously described steps alternating the addition of annealed motifs C and D. To determine the effect increasing layers has on the sensitivity of the sensor, measurements against neomycin were compared using 1, 2, 4 and 8 layers (FIG. 11B).

Example 4

DNA Mesh as PCR Fragment Selection Tool

[0182] As FIG. 2B shows, the distance between the annealed motif distance composing the hexagonal DNA structure, being measurable, adjustable, and known, the addition of single stranded oligonucleotide fragment will allow the capture of PCR fragments of specific length, and discriminating from the shorter fragment(s). Consequently, incomplete PCR fragments can be discriminated from the full length fragment. This technology was tested during quantitative real-time polymerase chain reaction (QRT-PCR), to refine and quantify the product amplification.

[0183] qPCR may be used to quantitatively measure the amplification of DNA using fluorescent dyes, this method is particularly novel and efficient to improve the qPCR method, greatly improving its accuracy. In this experiment, a 371 bp PCR fragment may be bound to determine the exact concentration as compared with the qPCR reading and a Urea gel, which will demonstrate the number of sub-fragments and a more accurate qPCR read may be extrapolated. The same experiments may be performed with a 200 bp PCR fragment (which was too short to properly bind), and no variation of qPCR reading should be noticeable, as opposed to the 371 bp fragment where a clear quantification should be possible.

[0184] While preferred embodiments have been described above and illustrated in the accompanying drawings, it will be evident to those skilled in the art that modifications may be made without departing from this disclosure. Such modifications are considered as possible variants comprised in the scope of the disclosure.