Processes to Detect Coronaviruses
20210395810 · 2021-12-23
Inventors
Cpc classification
C12Q2521/107
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
C12Q2565/60
CHEMISTRY; METALLURGY
International classification
Abstract
Processes and devices are disclosed that detect RNA and DNA in a sample, including without limitation RNA from coronaviruses, with said processes generating a fluorescent signal if a segment of a specific RNA molecule is present in a sample.
Claims
1. A process to detect a segment of an RNA molecule presented in a biological sample, wherein said segment serves as a template for a displaceable probe reverse transcriptase loop amplification of said template in an amplification mixture, wherein (a)(1) said template has six regions, in the following order from the 3′-end to the 5′-end, termed F3c, F2c, F1c, B1, B2, and B3, (a)(2) said amplification mixture is provided an external primer, termed F3, that is substantially Watson-Crick complementary to F3c, (a)(3) said amplification mixture is provided a first internal primer that has two regions, one F1c towards its 5′-end and the other F2 towards its 3′-end, where the two regions are joined by a linking oligonucleotide, and where F1c is substantially Watson-Crick complementary to F1 and F2 is substantially Watson-Crick complementary to F2c, wherein polymerase-catalyzed extension of said first internal primer generates a first copy that comprises F1c, F2, F1, B1c, B2c, and B3c in the 5′- to 3′ direction, wherein F1c is substantially Watson-Crick complementary to F1, F2 is substantially Watson-Crick complementary to F2c, F1 is substantially Watson-Crick complementary to F1c, B1c is substantially Watson-Crick complementary to B1, B2c is substantially Watson-Crick complementary to B2, and B3c is substantially Watson-Crick complementary to B3, and then (a)(4) said amplification mixture is provided a second external primer, termed B3, which is substantially Watson-Crick complementary to B3c and (a)(5) said amplification mixture is provided a second internal primer that has two regions, one B1c towards its 5′-end and the other B2 towards its 3′-end, where the two regions are joined by a linking oligonucleotide, and where B1c is substantially Watson-Crick complementary to B1 and B2 is substantially Watson-Crick complementary to B2c, wherein polymerase-catalyzed extension of said second internal primer generates a second copy that comprises B1c, B2, B1, F1c, F2c, and F1 in the 5′- to 3′ direction, said second copy can form a structure having two loops, and (a)(6) said amplification mixture is provided a tagged primer that is a DNA molecule comprising two regions, the first tag region carrying a fluorescence quenching moiety at or near its 5′-end and the second tag region substantially Watson-Crick complementary to a region between B1 and B2 or a region between F1 and F2, and (a)(7) said amplification mixture is provided a displaceable probe that is a DNA molecule having a fluorescent moiety at or near its 3′-end, said displaceable probe being substantially Watson-Crick complementary to the first tag region, wherein said amplification mixture contains a reverse transcriptase, and (b) said biological sample is either as a nasal swab or a sample of saliva, with no sample preparation other than collection, transfer and dilution, and wherein detection comprises the observation of fluorescence arising from the displaceable probe either at the end of the amplification or during the amplification.
2. The process of claim 1, where said saliva sample is presented to said amplification mixture on a support having covalently attached quaternary ammonium salts.
3. The process of claim 1, wherein one or more of the nucleotides within said tagged primer and probe are selected from the nucleotide analogs shown in
4. The process of claim 1, wherein said primers comprise SEQ ID No 1 through SEQ ID NO 24.
5. The process of claim 1 wherein said primers comprise those substantially identical to SEQ ID No 1 through SEQ ID NO 24.
6. The process of claim 1, wherein one or more of the nucleotides within said tagged primer and probe are selected from the nucleotide analogs shown in
7. The process of claim 1, wherein said incubation temperature is 60-70° C.
8. The process of claim 1, wherein time to detection is less than 25 minutes with 100 template molecules per sample.
9. The process of claim 1, wherein excess B3 is added.
10. The process of claim 1, wherein the mixture is pre-incubated at 55° C. prior to incubation at 60-70° C.
11. The process of claim 1, wherein nasal swab is subjected to an extraction with a solution that has a pH of 5 and 7.
12. The process of claim 1, wherein nasal swab is subjected to an extraction with a solution that contains Chelex-100 without any heat step.
13. The process of claim 1, wherein 100 copies of template are detected per assay in less than 18 min.
14. The process of claim 1, wherein the detection is done by direct observation of the fluorescence with the human eye.
15. The process of claim 1, wherein two primer sets may detect two different templates in a biplexed DP-RT-LAMP reaction.
16. The process of claim 1, wherein the amplification mixture comprises lyophilized reagents.
17. A handheld device to generate and detect a fluorescent signal arising if a segment of an RNA molecule is present in a sample, wherein said device comprises (a) a slot wherein a disposable is placed, (b) a microprocessor that controls a heater, wherein (c) said heater warms a region of said disposable to a temperature between 50 and 70° C., wherein (d) said disposable contains reagents generate a fluorescent signal when viral RNA is present, (e) said device contains a light that illuminates the region of the disposable that generates the fluorescent signal, and (f) a port allows the user to visualize the fluorescent signal, wherein said fluorescent signal is generated by a process that involves the isothermal amplification of DNA molecules that contain segments substantially identical to, or substantially complementary to, said RNA molecule.
18. A kiosk that holds one or more slots that accepts a tube that contains a sample, and then delivers liquid to said tube and then warms a region of said tube to a temperature between 50 and 70° C., wherein tube and/or said liquid contains reagents generate a fluorescent signal when viral RNA is present in said sample, and wherein a light in said kiosk illuminates a region of said tube that generates the fluorescent signal, and said kiosk contains an element that detects the fluorescent signal. wherein said fluorescent signal is generated by a process that involves the isothermal amplification of DNA molecules that contain segments substantially identical to, or substantially complementary to, said RNA molecule.
19. The kiosk of claim 18, wherein said sample is delivered on or near the surface of a ball that has been exposed to saliva.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
DESCRIPTION OF THE INVENTION
[0063] 1. The Biochemistry that Generates Fluorescent Signals
[0064] The displaceable probe LAMP (DP-LAMP), defined in U.S. patent application Ser. No. 15/826,126, is at the center of this invention. In its implementation to detect RNA viruses, it is initiated by a reverse transcriptase (RT), and is called here DR-RT-LAMP. In its classical form, DP-RT-LAMP uses six primers binding eight distinct regions within a target RNA (
[0065] In DP-RT-LAMP (as in DP-LAMP), signal is created by a displaceable probe, a short oligonucleotide carrying a 3′-fluorophore that is displaced from a complementary oligonucleotide as the desired amplification is completed. That complementary oligonucleotide has a 5′-quencher, and carries a tag that is a primer that binds to one of the loops in the initial LAMP double loop structure (
[0066] In the displaceable probe architecture, in the absence of target, no fluorescence is observed due to quenching of fluorophore by a quencher in the undisplaced duplex. In the presence of target, the single-stranded portion of the quencher probe binds to the target and is extended. Further polymerase extension by reverse primers displaces the quencher strand from the fluorescently labeled strand, allowing the emission of fluorescence and its analysis in real-time. As a consequence of the displacing process, “S-shaped” curves appear in a plot of fluorescence versus time, similar to RT-PCR and similar Ct (or Tt-threshold time) analyses (
[0067] The displaceable probes can have sequences that have no substantial similarity to the sequence of any portion of the target analyte. This allows totally independent selection of the duplex sequence. This, in turn allows the fluorescently tagged displaced probe to be captured, either during or after the amplification. The fluor is preferably fluorescein (FAM), but any of a wide ranges of fluors known in the art may be used. Signal arising from the unquenched fluorescein in these particular displaced probes emerge in ca. 20 min and visible to human eye. Signals can be visualized in an observation box that uses a blue LED to excite the fluorescein, and an orange filter to allow the emission light to be observed without interferences with the excitation light (
[0068] Multiple fluors can be incorporated with multiple targets. In one implementation, FAM was used for SARS-CoV-2 detection and the internal control targeting the human RNase P RNA (λ.sub.ex-λ.sub.em=495 nm-520 nm, color observed with excitation at 470 nm, green). JOE was used for RNase P gene for multiplexed LAMP experiments (λ.sub.ex-λ.sub.em=529 nm-555 nm, excitation at 470 nm, yellow). Iowa Black FQ was used as a common quencher with absorption range of 420-620 nm. This quencher is often used with fluorophores that emit in the green to pink.
[0069] One process of the instant invention used first experiments sought to measure the sensitivity of a specific DP-RT-LAMP primer set (CoV2-W3) that had been selected from three trial sets that targeted the spike region of the virus genome. Here, RNA targets were prepared by transcription of a DNA template (˜230 nt). Varying concentrations of RNA was used to determine assay sensitivity [Glushakova, L. G., Barry W. Alto, B. W., Kim, M. S., Bradley, A., Benner, S. A. (2017) Detection of chikungunya viral RNA in mosquitoes on cationic (Q) paper based on innovations in synthetic biology. J. Virol. Methods 246, 104-111. PMC5967251] [Yaren, O., Bradley, K. M., Moussatche, P., Hoshika, S., Shu, Z., Karst, S. M., Benner, S. A. (2016) A norovirus detection architecture based on isothermal amplification and expanded genetic systems. J. Virol. Methods 237, 64-71. PMID: 27546345].
[0070] With this target, limits of detection (LODs) were 5 copies/assay, giving a threshold time (Tt, equivalent of Ct) of 22.5 min (
TABLE-US-00001 TABLE 1 Sensitivity measurements in initial conditions RNA target made by Time to Time to transcription of threshold, RNA from threshold, synthetic DNA Tt (min) Twist Tt (min) 500 copies 12.71 10000 copies 23.2 50 copies 14.87 1000 copies 24.3 25 copies 17.88 100 copies 25.3 5 copies 22.46 10 copies indefinite NTC indefinite NTC indefinite
[0071] The sensitivity of the assay could be altered by changing conditions. These included:
[0072] (a) adding a second reverse transcriptase (SuperScript IV (SSIV) to the WarmStart reverse transcriptase (WS-RTx, NEB) already present.
[0073] (b) changing the reaction buffer,
[0074] (c) adding random hexamers (12 μM)
[0075] (d) adding excess reverse primer (B3 primer), and
[0076] (e) varying the incubation temperature (Table 2, Table 3)
TABLE-US-00002 TABLE 2 Improvement in the LOD using CoV2-W3 primer set and full-length RNA template (Twist) by modifying DP-RT-LAMP conditions. Twist RNA copies 10.sup.3 10.sup.2 10 NTC 10.sup.3 10.sup.2 10 NTC 5x Buffer Excess B3 10X Buffer Excess B3 only SSIV-RT + WS-RTx WS-RTx 55° C. 10 min, 55° C. 10 min, 65° C. 50 min 65° C. 50 min Tt (min) 16.6 19.3 37.1 40.6 17.3 19.9 18.8 — 5x Buffer IDT RH 10X Buffer IDT RH only SSIV-RT + WS-RTx WS-RTx 55° C. 10 min, 55° C. 10 min, 65° C. 50 min 65° C. 50 min Tt (min) 19.3 21.2 24.3 46-48* 20.1 27.2 29.3 — *Sporadic NTC issue.
TABLE-US-00003 TABLE 3 Variety of DP-RT-LAMP components tested with full length RNA target (Twist). W3_LAMP (S gene) Components 1 Reaction 25 μL 5X Superscript IV Buffer 5.0 5.0 — — 100 μM B3 3.0 — 3.0 — 300 uM IDT RH (Random Hexamers) — 1.0 — 1.0 10X isothermal amplification buffer — — 2.5 2.5 10 mM dNTPs with dUTP 3.5 3.5 3.5 3.5 100 mM MgSO4 1.5 1.5 1.5 1.5 10X LAMP primers 2.5 2.5 2.5 2.5 Bst 2.0 warm-start NEB (8 U/μL) 1 1 1 1 WS-RTx NEB (15 U/μL) 0.5 0.5 1 1 RNase Inhibitor NEB (40 U/μL) 0.5 0.5 0.5 0.5 Superscript IV enzyme 1.0 1.0 — — Antarctic UDG NEB (1 U/μL) 0.5 0.5 0.5 0.5 0.1M DTT 1 1 1 1 Twist RNA (1000, 100 and 10) or 2 2 2 2 background RNA for NTC H.sub.2O 3.0 5.0 6.0 8.0
[0077] Samples were first incubated at 55° C. for 10 min, then at 65° C. for 50 min.
[0078] Each reaction mixture was pre-incubated at 55° C. for 10 min to ensure formation of sufficient cDNA by the warm start RT. This was then followed by incubation at 65° C.
[0079] These modifications improved sensitivity with the full-length RNA genome; LODs improved to 10 copies/assay. This compares favorably with SARS-CoV-2 colorimetric assay from New England Biolabs, which has a reported LOD of 500 copies/assay [Zhang Y, Odiwuor N, Xiong J, Sun L, Nyaruaba R O, Wei H, et al. Rapid Molecular Detection of SARS-CoV-2 (COVID-19) Virus RNA Using Colorimetric LAMP. medRxiv. 2020:2020.02.26.20028373. doi: 10.1101/2020.02.26.20028373]. However, use of 5× SSIV buffer gave fluorescent signal in the absence of target (no template controls, NTCs). This drove the choice of the presently preferred conditions that (i) use the original buffer, (ii) WS-RTx as the only reverse transcriptase, (iii) in the presence of random hexamers, and (iv) or excess B3. These conditions gave no “NTC problem” up to 60 minutes, with an LOD of 10 copies/assay. Refining these conditions further, better Tt values were observed with excess B3 than with random hexamers. Therefore, excess B3 primer was used in further DP-RT-LAMP experiments.
TABLE-US-00004 TABLE 4 Presently preferred conditions for the DP-RT-LAMP Condition 1 NEB Buffer, excess B3, WS-RTx, 55° C. 10 min, 65° C. 50 min Condition 2 SSIV-RT Buffer, Random hexamer, SSIV-RT + WS-RTX, 55° C. 10 min, 65° C. 50 min Condition 3 NEB Buffer, WS-RTx, 65° C. 50 min
Establishing DP-RT-LAMP Assay with High Sensitivity Using Heat-Inactivated Virus Isolate
[0080] The LOD was assessed using authentic, non-synthetic virus that had been heat-inactivated (SARS-CoV-2 isolate, inactivated at 65° C. for 30 minutes, BEI Resources). This was also used to “spike” sample from nasal swabs and saliva samples. Three conditions previously tested for the synthetic RNA (Twist Bioscience) were again tested for the BEI target. The best sensitivity (10 copies/assay) was achieved with “Condition 1”, using the NEB isothermal amplification buffer, excess B3 primer, and WS-RTx with incubation at 55° C. for 10 min (initially), followed by further incubation at 65° C. 50 min (
[0081] With the current modifications in DP-RT-LAMP protocol, another DP-RT-LAMP primer set was designed to target the N gene of SARS-CoV-2. We also designed a DP-RT-LAMP primer set to target the human RNase P gene. Detection of the amplicon from human RNAse P was intended to serve as an internal control to assess the adequacy of the sample collection.
[0082] The primer set targeting S gene (CoV2-W3) gave an LOD of 10 copies/assay within 16 min; the fluorescence signal arising from fluorescence was excited at 470 nm (typically an LED) and visualized through an orange filter to block the excitation light (
[0083] Table 6.
TABLE-US-00005 TABLE 5 Performance of DP-RT-LAMP for virus and human targets SARS-CoV-2 RNA (copy Tt values (min) number) 1000 100 50 25 10 5 2 NTC CoV2-W3 13.42 15.58 14.51 14.43 16.01 No No No signal signal signal CoV2-v2-4 10.86 12.01 11.66 12.34 No No No No signal signal signal signal Human RNA (copy Tt values (min) number) 4400 4400 440 440 44 44 NTC NTC RNaseP-2 11.18 11.84 16.78 14.48 15.51 15.80 No No (FAM) signal signal
TABLE-US-00006 TABLE 6 Performance of standard RT-PCR for virus and human targets TaqPath ™ RT-qPCR Mix Ct values (corresponding Tt in min) RNA copies/reaction 10,000 1000 100 10 NTC N Gene 26.7 (14.6) 29.8 (16.3) 32.9 (18.1) 36.9 (20.3) No signal RNase P Gene 21.2 (11.6) 24 (13.2) 28.1 (15.4) 31.8 (17.5) No signal
Simple Sample Preparation of Nasal Swabs and Saliva Samples
[0084] For a test to identify carriers who present a risk, sample preparation must be minimal, and instrumentation must be “field-deployable”. Several have sought low sample preparation workflows, as RNA purification from biological samples is time consuming and timely delivery of test results can be impaired due to limited supplies of sample purification kits [Rabe B A, Cepko C. SARS-CoV-2 Detection Using an Isothermal Amplification Reaction and a Rapid, Inexpensive Protocol for Sample Inactivation and Purification. medRxiv. 2020:2020. 04.23.20076877] [Bhadra S, Riedel T E, Lakhotia S, Tran N D, Ellington A D. High-surety isothermal amplification and detection of SARS-CoV-2, including with crude enzymes. bioRxiv. 2020:2020.04.13.039941][Joung J, Ladha A, Saito M, Segel M, Bruneau R, Huang M-1W, et al. Point-of-care testing for COVID-19 using SHERLOCK diagnostics. medRxiv. 2020:2020.05.04.20091231.][Kubota K, Jenkins D M, Alvarez A M, Su W W. Fret-based assimilating probe for sequence-specific real-time monitoring of loop-mediated isothermal amplification (LAMP). Biol Eng Trans 2011; 4:81-100][Anahtar M N, McGrath G E G, Rabe B A, Tanner N A, White B A, Lennerz J K M, et al. Clinical assessment and validation of a rapid and sensitive SARS-CoV-2 test using reverse-transcription loop-mediated isothermal amplification. medRxiv. 2020:2020.05.12.20095638][Dao Thi V L, Herbst K, Boerner K, Meurer M, Kremer L P M, Kirrmaier D, et al. Screening for SARS-CoV-2 infections with colorimetric RT-LAMP and LAMP sequencing. medRxiv. 2020:2020.05.05.20092288].
[0085] To meet these specs, we generated three protocols for SARS-CoV-2 testing. The behavior of the virus itself defines the sampling procedure. False negatives arising from defective sampling are often as problematic as (or more problematic than) false negatives arising from failure of the assay. Fortunately, the life cycle of SARS-CoV-2 appears to allow simple sampling, with even mid-turbinate sampling being adequate, as well as saliva sampling [Broughton J P, Deng X, Yu G, Fasching C L, Servellita V, Singh J, et al. CRISPR—Cas12-based detection of SARS-CoV-2. Nature Biotechnology. 2020; 38(7):870-4.] [Srivatsan S, Han P D, van Raay K, Wolf C R, McCulloch D J, Kim A E, et al. Preliminary support for a “dry swab, extraction free” protocol for SARS-CoV-2 testing via RT-qPCR. bioRxiv. 2020:2020.04.22.056283].
[0086] Therefore, a preferred protocol uses dry mid-turbinate or anterior nasal swabbing as a collection method, and relies on the positive control targeting human RNase P to ensure that the collection was adequately aggressive. Post sampling, swabs were eluted in various elution/inactivation buffers. An aliquot from the elution solution was added directly to the DP-RT-LAMP mixture, and analyzed in real-time and by visualization of end-point fluorescence (
[0087] Alternatively, saliva can be placed on “Q-paper”, a cellulose filter paper that carries quaternary ammonium groups. Q-paper has been previously used to capture arboviral RNA from single mosquitoes after a drop of ammonia is added to the carcasses [Yaren O, Alto B W, Gangodkar P V, Ranade S R, Patil K N, Bradley K M, et al. Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya. BMC Infectious Diseases. 2017; 17(1):293. doi: 10.1186/s12879-017-2382-0]. In this work, the Q-paper holding the viral RNA could be added directly to the DP-RT-LAMP mixture without any sample preparation. The fluorescence can be analyzed in real-time or by end-point visualization, again using blue LED excitation with fluorescence observed through an orange filter (
[0088] Real-time analyses of all methods tested were performed on a (Roche LightCycler® 480). However, performance was equally satisfactory when light readout was done on a portable Genie® II instrument, available from Optigene. Genie® II processes 16 samples simultaneously using the FAM-channel (483-533 nm). The data outputs are similar to those obtained with the more expensive real-time PCR instrument. Genie® II offers positive/negative results with Tt values as good as obtained with the PCR instrument, but at a fraction of the cost and useable in the lobby of a workplace, a courtroom, or a school (
[0089] Presently preferred workflows for 2019-nCoV are, with presently preferred volumes: [0090] (a) Dry nasal swabs are the sample method, obtained by mid-turbinate swabbing. [0091] (b) Swabs are eluted in a sample preparation buffer, typically 50-1000 μL. [0092] (c) An aliquot (typically 4 to 10 μL, maximum 25 μL) from the sample preparation buffer holding the eluate is added to a DP-RT-LAMP mixture. [0093] (d) The mixture is heated at 65° C. for 15-30 minutes. [0094] (e) End-point results are visualized using blue LED and orange filter.
[0095] As an alternative presently preferred workflow, saliva (typically 100-1000 μL) is spit into a tube, and a sample (typically 5-10 μL) is added directly to a portion of sample preparation buffer briefly. Here, aliquot of that mixture is added to the DP-RT-LAMP mixture (typically 25-100 μL). End-point results are visualized as with the nasal swab samples.
[0096] As an alternative presently preferred workflow, saliva (typically 10-50 μL) is placed onto a small square (typically 3-5 mm) of quaternary ammonium modified paper (Q-paper). The Q-paper coated with saliva is directly introduced into DP-RT-LAMP mixture (typically 50-200 μL) without further manipulation. End-point fluorescent signal is visualized using blue LED and orange filter, as before. The Q-paper square is observable, but does not hinder the analysis.
[0097] As an alternative presently preferred workflow, to replace end-point visualization, DP-RT-LAMP experiments are also run in real-time using a Genie® II (Optigene, UK) instrument. This allows the appearance of fluorescence arising from the displaced probes to be visualized as the amplification proceeds. Representative curves are shown in various drawings.
Validation of DP-RT-LAMP Assay with Contrived Nasal Swabs
[0098] Having established work-flow parameters, we tested various elution/inactivation buffers with or without a heat step to design the presently preferred protocol.
[0099] Despite its promise, this approach did not give reproducible results when nasal swabs were spiked with inactivated virus prior to the 95° C. heating step. A similar problem was observed when same buffer was combined with Chelex-100, in a workflow that incorporated two heating steps, one at 56° C. for 15 min and a second at 95° C. for 5 min. Dao Thi et al. [op. cit.] also report similar results when nasal swab elution mixtures were spiked with RNA, and then heated (95° C., 5 min). However, treatment of clinical samples using the method developed by Rabe and Cepko [op. cit.] with heating at 95° C. for 5 min did not cause a decrease in assay sensitivity.
[0100] To further simplify sampling work-flow, NaOH was replaced with sodium citrate (in a pH range of 5 to 7, preferably pH 6.5) and added TCEP, EDTA, LiCl and Chelex-100. Swabs were eluted at room temperature without any additional heating step. Here, 100 copies of viral RNA were detectable per assay within 16-18 min. In addition to real-time analysis, end-point fluorescent images were also visible to human eye at 100 copies/assay (
[0101] The sensitivity with nasal swab samples was analyzed using contrived nasal swabs. Here, 500 RNA copies/assay were detected consistently at 100%. Ca. 200 copies/assay were detected with 50% efficiency, and 100 copies of RNA/assay were detected at 20% efficiency. The internal control that targets the RNase P gene was detected at 100%, indicating that the sample collection was sufficiently aggressive (
Validation of DP-RT-LAMP Assay with Contrived Saliva Samples
[0102] Crude saliva was first added to DP-RT-LAMP without any treatment, with a saliva:LAMP reaction mixture ratio of 1:5. As shown in
[0103] Suspecting that RNA might be rapidly degraded in saliva, saliva samples spiked with DNA were tested (
[0104] As an alternative to this saliva sampling method, saliva was absorbed on to Q-paper, which was placed after a brief time (5 min) at room temperature (to simulate how processing might occur in a workplace lobby) directly into the DP-RT-LAMP mixture. Analogous to what is seen with mosquito carcasses [Yaren et al. 2017, op. cit.], 100 copies of viral RNA were detected by spotting SARS-CoV-2 RNA onto saliva coated Q-paper and directly amplified by DP-RT-LAMP. Visualization of positive signals was done in the 3-D printed box (
[0105] The sensitivities of the assay with two saliva sampling methods were further analyzed using contriving saliva samples. Here, 200 copies of RNA/assay could be detected by both methods with 100% detection rate with a small sample size (5 cases); 100 copies of RNA were detected with 50% efficiency using 100× inactivation solution, and with 40% efficiency using Q-paper for sampling. Additionally, the internal control targeting RNase P gene was detected at 100% in both methods (
TABLE-US-00007 TABLE 7 Performance of assay with whole coronavirus (BEI Resources) SARS-CoV-2 RNA copies/assay 5000 2000 1000 500 200 100 RNase P (IC) Nasal swabs mean Tt (min) 11.55 13.2 16.01 14.4 18.2 19.4 19.4 (Positive/Total) (5/5) (10/10) (32/32) (23/23) (5/10) (2/10) (44/44) SARS-CoV-2 RNA copies/assay 1000 200 100 RNase P (IC) Briefly processed saliva mean Tt (min) 17.03 (5/5) 18.9 (5/5) 19.3 (2/4) 18.9 (10/10) (Positive/Total) Saliva swabs using Q-paper mean Tt (min) 15.5 (5/5) 15.8 (5/5) 15.3 (2/5) 20.3 (15/15) (Positive/Total)
TABLE-US-00008 TABLE 8 Variety of DP-RT-LAMP components tested with full length RNA target (Twist). Threshold time (min) CoV2-W3 10.sup.8 10.sup.6 10.sup.5 10.sup.4 10.sup.3 10.sup.2 No primer set copies copies copies copies copies copies template DNA only 6.13 8.57 9.56 11.15 14.14 Not run No signal Saliva spiked 7.14 10.24 12.05 14.08 17.15 Not run No signal with DNA
Multiplex Detection of SARS-CoV-2 and RNase P
[0106] An assay robust for workplace entrance use must incorporate a signal to indicate that sampling is sufficiently aggressive. The DP architecture allows simultaneous detection of viral RNA and human RNase P gene in single tube. To show this, we spiked varying amounts of viral RNA into 440 copies of purified human RNA. Using the LightCycler® 480 and three fluorescent channels, 10 copies of SARS-CoV-2 RNA could be detected in the presence human RNA in two-plex format when equal amount of the two (virus and human) 10× LAMP primer sets were present.
[0107] When viral RNA was present in higher amounts, the signal for the positive control was delayed to 32.5 minutes, instead of appearing 21-23 min. This is presumed to reflect the two amplification processes competing for some of the same LAMP amplification resources.
[0108] A similar degree of sensitivity was achieved when viral RNA was ˜1000 copies/assay (
Lyophilization of DP-RT-LAMP Reagents
[0109] For workplace entry use, the reagents used must robustly survive transport and storage in amateur hands. Accordingly, lyophilized reagent mixtures were prepared and their performance tested.
[0110] The presently preferred process to create lyophilized reagents begins by removing glycerol from the commercial enzymes as delivered by various suppliers (including New England Biolabs). For this, an ultrafiltration column with a 10 kDa cut-off limit was loaded with the DP-RT-LAMP enzymes. The enzyme storage buffer containing glycerol was exchanged with glycerol-free version enzyme storage buffer. Then, 10× primers mix and dNTPs were added. The mixture was lyophilized for 4 to 6 hours, leaving dry reagents as a white fluffy powder (
2. The Device that Reads the Generated Fluorescent Signals
[0111] A schematic of the presently preferred implementation of the device invention is shown in
[0112] The utility of this device is apparent, as it will allow individuals to enter a dentist office, board an airplane, enroll for a semester at a university, or enter a workplace, with enhanced confidence that they will not contaminate fellow travelers, students, or workers. Its output may serve as an entry badge to public spaces
[0113] Also useful, the device may be used by individuals who have COVID who are self-quarantining. Through a cell phone app, they will deliver to epidemiologists who are working remotely daily reports of symptoms and viral loads. This will allow such individuals to constitute a distributed research lab to build a database of information about coronavirus biology.
EXAMPLES
[0114] These examples illustrate several presently preferred embodiments of the instant invention. Alternatives may be substituted as is presently understood in the art.
Example 1. Presently Preferred of the DP-RT-LAMP Primers and Displaceable Probes
[0115]
TABLE-US-00009 TABLE 9 Presently preferred LAMP primers and probe sequences CoV2-W3 set targeting S gene CoV2-W3-F3 GAATCTCTCATCGATCTCC SEQ ID NO 1 CoV2-W3-FIP AGCAAAGCATAATTGTCACCTTTTTGGCCATGGTACATTTGG SEQ ID NO 2 CoV2-W3-LF GGCAATCAAGCCAGCTAT SEQ ID NO 3 CoV2-W3-LB TGTGGATCCTGCTGCAA SEQ ID NO 4 CoV-2W3-BIP GTCTCAAGGGCTGTTGTTCTTTTTGCTCAGAGTCGTCTTC SEQ ID NO 5 CoV2-W3-B3 GACTCCTTTGAGCACTG SEQ ID NO 6 CoV2-W3-LB-tail12-5IBFQ /5IABRFQ/GTGTCAAGAGCTCCGAGCCTCGTCGTTCATGCAATAGCGC- SEQ ID NO 7 TGTGGATCCTGCTGCAA CoV2-tail12-40-Comp3FAM GCGCTATTGCATGAACGACGAGGCTCGGAGCTCTTGACAC/36-FAM/ SEQ ID NO 8 CoV2-v2-4 set targeting N gene CoV2-v2-4-F3 ATGACGTTCGTGTTGTT SEQ ID NO 9 CoV2-v2-4-FIP CTCCATTCTGGTTACTGCCATTTTTATCAGCGAAATGCACC SEQ ID NO 10 CoV2-v2-4-LF TCTGAGGGTCCACCAAAC SEQ ID NO 11 CoV2-v2-4-LB ATACTGCGTCTTGGTTCAC SEQ ID NO 12 CoV2-v2-4-BIP CGGCCCCAAGGTTTACCTTTTTCCATGTTGAGTGAGAGC SEQ ID NO 13 CoV2-v2-4-B3 GGTGTTAATTGGAACGC SEQ ID NO 14 CoV2-v2-4-LF-tail12-5IBFQ /5IABRFQ/GTGTCAAGAGCTCCGAGCCTCGTCGTTCATGCAATAGCGC- SEQ ID NO 15 TCTGAGGGTCCACCAAAC CoV2-tail12-40-Comp3FAM GCGCTATTGCATGAACGACGAGGCTCGGAGCTCTTGACAC/36-FAM/ SEQ ID NO 16 RNaseP-2 set targeting RNase P gene (internal control) RNaseP-2-F3 GGAGAGTGAGTTGATCAG SEQ ID NO 17 RNaseP-2-FIP ATAGCCCTCCTAGGCTCCTTTTTCCCTCTATCTGCAACTTG SEQ ID NO 18 RNaseP-2-LF AGGCTTGCTTACCTCCAG SEQ ID NO 19 RNaseP-2-LB CAGAGGCACCTAGGATTGG SEQ ID NO 20 RNaseP-2-BIP TGGTGACCTGAACTAGGGTTTTTGTGCTGTGATCTGTCC SEQ ID NO 21 RNaseP-2-B3 CTTTCCCTCATCCTTCTC SEQ ID NO 22 RNaseP-2-LB-tail13-5IBFQ /5IABRFQ/GCAGCGGACGTCATAGGGACAATATCTTTCTCGCGCGGGA- SEQ ID NO 23 CAGAGGCACCTAGGATTGG RNaseP-2-tail13-40- TCCCGCGCGAGAAAGATATTGTCCCTATGACGTCCGCTGC/36-FAM/ SEQ ID NO 24 Comp3FAM RNaseP-2-tail13-40- TCCCGCGCGAGAAAGATATTGTCCCTATGACGTCCGCTGC/3Joe_N/ SEQ ID NO 24 Comp3JOE
[0116] LAMP primers and strand displaceable probes were purchased from Integrated DNA Technologies (IDT, Coralville, Iowa) (Table 9). Strand-displaceable probes were 5′-quencher labeled with Iowa Black-FQ (IBFQ). Fluorescently labeled displaceable probes partially complementary to the quencher labeled probes were 3′-labeled with FAM. Alternatively, for multiplexing purposes, internal control probes targeting the human RNase P gene were 5′-labeled with IBFQ and 3′-labeled with JOE.
[0117] Underlined sequences are double strand segments of strand-displacing probes. FAM was used for SARS-CoV-2 detection and internal control targeting RNase P gene (λ.sub.ex-λ.sub.em=495 nm-520 nm, color observed with excitation at 470 nm, green), JOE was used for RNase P gene for multiplexed LAMP experiments (λ.sub.ex-λ.sub.em=529 nm-555 nm, color observed with excitation at 470 nm, yellow). Iowa Black FQ was used as a common quencher with absorption range of 420-620 nm. This quencher is typically used with fluorophores that emit in green to pink range of the visible spectrum. Presently preferred primers are listed in Table 9. Substantially identical primers are those that do not differ by more than two nucleotides within them, or by more than two nucleotides in length. The standard nucleotides in these primers may be replaced by their SAMRS equivalents.
Example 2. Targets to Validate the Invention with SARS-CoV-2 RNA as the Target IVT RNA Fragment Preparation
[0118] Target RNA was generated from synthetic DNA fragments of the viral genes of interest. Synthetic DNA gene fragments were ordered from IDT as gBlocks. An initial PCR introduced the T7 promoter. Next, 150 nM of PCR product was used in T7 RNA transcription reaction (50 μL total volume); the reaction mixture was incubated at 37° C. for 16 h. DNA templates were removed by digestion with DNase I, the mixture was phenol-CHCl.sub.3 extracted, and the RNA was recovered by EtOH precipitation. The product RNA was quantified using a Nanodrop UV spectroscopy, and reference materials with known concentrations were prepared in serial dilutions in TE buffer (10 mM Tris pH 7.0, 1 mM EDTA) and aliquots were stored at −80° C.
Fully Synthetic SARS-CoV-2 RNA
[0119] Synthetic SARS-CoV-2 RNA Control was from Twist Bioscience (MT007544.1, 1×10.sup.6 RNA copies/μL). It was used for initial limit of detection (LOD) studies. Appropriate dilutions were made in 1 mM Na citrate pH 6.5, 0.4 U/μL RNase inhibitor (NEB, Ipswich, Mass.) and aliquots were stored at −80° C.
Heat-Inactivated SARS-CoV-2 Isolate
[0120] Authentic SARS-CoV-2, isolate USA-WA 1/2020, was obtained through BEI Resources (cat no. NR-52286, 1.16×10.sup.9 genome equivalents/mL). This virus has been inactivated by heating at 65° C. for 30 minutes. Target dilutions were made in 1 mM Na citrate pH 6.5, 0.4 U/μL RNase inhibitor (NEB, Ipswich, Mass.) supplemented with 0.15 ng/μL human RNA and aliquots (100 μL) were stored at −80° C. This target was used to determine final LODs and spike-in experiments where minimal sample preparation methods were sought for nasal swab and saliva sampling.
Example 3. The Presently Preferred DP-RT-LAMP Assay for 2019-nCoV
[0121] 12.5 μL of 2× WarmStart LAMP master mix (NEB) was combined with 2.5 μL of 10× LAMP primer set, 1 μL of excess B3 primer (300 μM), 0.175 μL of dUTP (100 mM, Promega), 0.5 of Antarctic Thermolabile UDG (1 U/μL, NEB), 0.5 μL of RNase inhibitor (40 U/μL, NEB), 2 μL of template RNA or inactivated virus isolate, μL and 6 μL of nuclease-free water (or briefly processed nasal/saliva samples) to bring the final reaction volume to 25 μL.
[0122] 10× LAMP primer set consists of 16 μM each of FIP and BIP, 2 μM each of F3 and B3, 5 μM LF (or LB for CoV2-v2-4 set), 4 μM LB (or LF for CoV2-v2-4 set), 150 nM quencher-bearing probe, and 100 nM of fluorophore-bearing probe.
[0123] Reactions were monitored in real-time using either a LightCycler® 480 (Roche Life Science, US) or a Genie® II (Optigene, UK) instrument. 8-strip PCR tubes were first incubated at 55° C. for 10 min followed by incubation at 65° C. for 45-60 min. During the 65° C. incubation, fluorescence signal was recorded every 30 seconds using FAM/SYBR channel of the instrument.
[0124] End-point observation of the fluorescence signal generated by strand displaceable probes was enabled by blue LED light (excitation at 470 nm) through orange filter of SafeBlue Illuminator/Electrophoresis System, MBE-150-PLUS (Major Science, US) or 3D printed observation box (Firebird Biomolecular Sciences, US).
Example 4. The Preferred Process from Nasal Swabs
Mid-Turbinate and Anterior Nasal Swab Sampling
[0125] CleanWIPE Swab, 3″ Semi-Flexible bulb tip (HT1802-500, Foamtec International) is used for nasal sampling. Each nostril is swabbed for at least 10 seconds using the same swab. The swab is placed in sterile 15 mL falcon tube and stored at 4° C. until processing.
[0126] The nasal swab was eluted in 100 μL of buffer solution (1 mM Na citrate pH 6.5, 2.5 mM TCEP, 1 mM EDTA, 10 mM LiCl, 15% Chelex-100) by brief vortexing. Swabs were then removed and elution solution was briefly spun down. 6 μL of sample elution was combined with 2 μL of inactivated virus (BEI resources) or water (no template control) and added to 17 μL of DP-RT-LAMP reaction mixture (12.5 μL of 2× WarmStart LAMP master mix, 2.5 μL of 10× LAMP primer set, 1 μL of excess B3 primer (300 μM), 0.175 μL of dUTP (100 mM), 0.5 μL of Antarctic Thermolabile UDG (1 U/μL, NEB), 0.5 μL of RNase inhibitor (40 U/μL, NEB). Samples were then incubated and analyzed in real-time as described above.
[0127] Other methods were tested. Thus, we initially tested TE buffer (10 mM Tris-HCl pH 7.0, 1 mM EDTA) for eluting nasal swabs. Another method involved use of an inactivation buffer containing 10 mM NaOH, 2.5 mM TCEP and 1 mM EDTA followed by incubation at 95° C. for 5 min..sup.27 Same buffer solution was then coupled with 15% Chelex-100 and extended heating (56° C. 15 min and 95° C. 5 min).
Saliva to DP-RT-LAMP Testing
[0128] Saliva samples are collected before brushing the teeth or 1 hour after brushing the teeth. A sample of saliva is preferably −1 mL, collected in sterile 5 mL falcon tube and stored at 4° C. until processing and samples processed within 1 hour. Alternatively the saliva may be collected by having a saliva provider suck on a ball. This ball may optionally be semi-porous, or be flavored. 100 μL of 15% Chelex-100 in 1.6 mL microcentrifuge tube was spun down briefly and supernatant was removed. To that, 100 μL of saliva mixed with 1 μL of concentrated sample preparation solution (0.1 M Na citrate pH 6.5, 1M LiCl, 0.25 M TCEP, 0.1 M EDTA) was added. Each sample was briefly vortexed and spun down to settle Chelex-100 down. 6 μL of saliva sample was combined with 2 μL of inactivated virus (BEI resources) or water (no template control) and added to 17 μL of DP-RT-LAMP mixture and the reaction was done as previously described.
Collecting Saliva on Q-Paper and DP-RT-LAMP Testing
[0129] Q-Paper Preparation
[0130] Whatman filter paper (1 gram) was immersed in 50 mL of 1.8% aq. NaOH solution for 10 min. Treated paper was collected by filtration and immersed in aq. EPTMAC (2,3-epoxypropyl) trimethylammonium chloride) solution for 24 h at RT. The mass ratio of EPTMAC to filter paper was 0.28 to 1. Cationic (Q) paper was collected by vacuum filtration and neutralized with 50 mL of 1% AcOH. Final product was washed three times with ethanol (96%) and dried at 55° C. for 1 h. Q-paper sheets were cut into small rectangles (˜0.5×0.2 cm) for saliva collection.
Saliva on Q-Paper
[0131] Q-paper is first dipped into saliva samples and soaked for 5 seconds, then air dried for 5 min. Q-paper containing saliva is directly inserted into 50 μL of DP-RT-LAMP mixture (25 μL of 2× WarmStart LAMP master mix, 5 μL of 10× LAMP primer set, 2 μL of excess B3 primer (300 μM), 0.35 μL of dUTP (100 mM), 1 μL of Antarctic Thermolabile UDG (1 U/μL, NEB), 1 μL of RNase inhibitor (40 U/μL, NEB) and 16 μL of nuclease-free water) and reaction was proceeded as described above.
Example 5. Biplexed DP-RT-LAMP to Detect SARS-CoV-2 and RNase P (Internal Control)
[0132] BEI 2019-nCoV Thermally Inactivated Virus in Human RNA Background
[0133] Varying amounts (10.sup.5, 10.sup.4, 10.sup.3, 10.sup.2, 10 and 5 copies) of heat-inactivated SARS-CoV-2 (BEI resources) spiked with 440 copies of human RNA, 1.25 μL of 10× CoV2-W3 LAMP primer set (FAM-labeled probe) and 1.25 μL of 10× RNaseP-2 LAMP primer set (JOE-labeled probe) were added to DP-RT-LAMP mixture (25 μl total volume).
[0134] Multiplexed reaction mixtures were pre-incubated at 55° C. for 10 min, then 65° C. for 50 min and the fluorescence signals from three channels were recorded every 30 seconds using LightCycler® 480 (Roche Life Science, US) during 65° C. incubation. Channel 483-533 is specific to FAM-labeled SARS-CoV-2 probe, channel 523-568 is an intermediate channel for both FAM- and JOE-probes, and channel 558-610 is specific to JOE-labeled RNase P probe.
BEI 2019-nCoV Thermally Inactivated Virus Spiked into Nasal Swab Samples
[0135] 6 μL of briefly processed nasal swab was combined with 2 μL of heat-inactivated SARS-CoV-2 isolate to give 10.sup.6 to 10.sup.3 RNA copies per assay. Nasal samples spiked with targets were added to DP-RT-LAMP mixture containing CoV2-W3 and RNAseP-2 LAMP primers in equal amounts (1.25 μL each of 10× LAMP primer sets) to give a total 25 μL assay volume. Real-time analysis was performed as mentioned above using LightCycler® 480 with three fluorescence channels.
Example 6. Use of Lyophilized Reagents in DP-RT-LAMP
Dialysis Example for 10 LAMP Reactions
[0136] 10 μL of Bst 2.0 WarmStart® DNA Polymerase (8 U/μL, NEB), 10 μL of WarmStart® RTx Reverse Transcriptase (15 U/μL, NEB), 5 μL of Antarctic Thermolabile UDG (1 U/μL, NEB), 5 μL of RNase inhibitor (40 U/μL, NEB) was combined with 170 μL of dialysis buffer (10 mM Tris-HCl pH 7.5, 50 mM KCl, 1 mM DTT, 0.1 mM EDTA, 0.1% Triton X-100). 200 μL mixture was then placed in an ultrafiltration membrane (10 kDA cut-off limit, Millipore, Billerica, Mass.). Samples were centrifuged at 13,000 rpm for 8 min, then further washed with 250 μL of dialysis buffer twice to concentrate glycerol free enzyme mix down to 30 μL. 30 μL of enzyme mix was combined with 25 μL of 10× LAMP primer set, 10 μL of 300 μM B3 primer, 35 μL of dNTP mix (10 mM each of dATP, dCTP, dGTP and 5 mM each of dTTP and dUTP) and 25 μL of 1M D-(+)-trehalose. Combined mixture was then distributed into 8-strip PCR tubes as 12.5 μL aliquots. Samples were frozen by liquid nitrogen and lyophilized for 4-6 h. Lyophilized reagents were stored at RT and tested within 7 days.
Reconstitution of Lyophilized LAMP Reagents
[0137] 6 μL of sample (nasal swab/saliva or RNA template) is mixed 19 μL of reconstitution buffer (2.5 μL 10× isothermal amplification buffer (NEB), 1.5 μL 100 mM MgSO.sub.4 and 15 μL of nuclease-free water) and added into lyophilized reagents. DP-RT-LAMP reactions are monitored in real-time using Genie II and fluorescence signal is visualized as described in previous sections.