Process for the enzymatic synthesis and amplification of nucleic acids
11203780 · 2021-12-21
Assignee
Inventors
- Dmitry Cherkasov (Marburg, DE)
- Norbert Basler (Gross Hansdorf, DE)
- Claus Becker (Oetigheim, DE)
- Hans-Joerg Hess (Berlin, DE)
- Andreas Mueller-Hermann (Munich, DE)
Cpc classification
C12Q2525/186
CHEMISTRY; METALLURGY
C12Q2525/155
CHEMISTRY; METALLURGY
C12Q2525/186
CHEMISTRY; METALLURGY
C12Q1/6848
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q2525/155
CHEMISTRY; METALLURGY
International classification
C12P19/34
CHEMISTRY; METALLURGY
C12Q1/6848
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
Abstract
A method for amplification of nucleic acids in which substantially use is made of the fact that a pre-defined nucleic acid chain (target sequence) can be multiplied/amplified in the presence of a target sequence-specific activator oligonucleotide. The target sequence-specific activator oligonucleotide causes the separation of re-synthesized complementary primer extension products by strand displacement, so that a new primer oligonucleotide can attach to the respective template strand. The thus formed complex of a primer oligonucleotide and a template strand can initiate a new primer extension reaction. The thus formed primer extension products in turn function as templates, so that an exponential amplification reaction results. Amplification of a particular target sequence takes place more efficiently in case of perfect match complementary base pair formation between the activator oligonucleotide and the corresponding target sequence. Mismatches between the activator oligonucleotide and a particular target sequence can result in less efficient amplification. The efficiency of synthesis of perfect match target sequences and mismatch sequences can be measured and compared.
Claims
1. A method for amplification of nucleic acids applied to at least two nucleic acid chains to be amplified, wherein a first nucleic acid chain comprises characteristic first target sequence (perfect match) and at least one other nucleic acid chain comprising characteristic other target sequence (mismatch), wherein the first target sequence differs from the at least one other target sequence in at least one sequence position, comprising the following steps: a) hybridizing a first primer oligonucleotide to the 3′ segment of a strand of said nucleic acid chains to be amplified, wherein the first primer oligonucleotide comprises: a first primer region in the 3′ segment of the first primer oligonucleotide that can sequence-specifically bind to a strand of a nucleic acid chain to be amplified, a second region that is directly or via a linker linked to the 5′ end of the first primer region of the first primer oligonucleotide and that comprises a polynucleotide tail which is suitable for binding an activator oligonucleotide and supporting strand displacement by the activator oligonucleotide, wherein the polynucleotide tail remains substantially uncopied by polymerase, b) extending the first primer oligonucleotide by means of a polymerase to form a first primer extension product comprising a sequence that is complementary to the target sequence of the nucleic acid chains to be amplified, c) binding the activator oligonucleotide to the polynucleotide tail of the second region of the first extended primer oligonucleotide, wherein the activator oligonucleotide comprises: a first single-stranded region that can bind to the polynucleotide tail of the second region of the first primer oligonucleotide, a second single-stranded region that is substantially complementary and can bind to the first region of the first primer oligonucleotide, a third single-stranded region that is substantially complementary to at least a segment of the extension product, which has been synthesized by polymerase, of the first primer extension product, which immediately follows the first primer region, of the first nucleic acid chain (perfect match) to be amplified, wherein the activator oligonucleotide does not serve as template for a primer extension of the first primer oligonucleotide, d) binding the activator oligonucleotide to the first primer region of the first extended primer oligonucleotide by displacing the strand of the nucleic acid chain to be amplified that is complementary to said first primer region, e) binding the activator oligonucleotide to the complementary segment of the extension product of the first extended primer oligonucleotide by displacing the strand of the nucleic acid chain to be amplified that is complementary to said extension product, wherein the 3′ segment of the first primer extension product becomes single-stranded, f) hybridizing a second oligonucleotide primer to the first primer extension product, wherein the 3′ segment of the second oligonucleotide primer comprises a sequence that can hybridize to the first primer extension product of said nucleic acid chains to be amplified; and g) extending the second oligonucleotide primer with polymerase to form a second primer extension product, wherein the extension takes place up to and including the first primer region of the first primer oligonucleotide and said first primer region is copied by the polymerase, wherein the polynucleotide tail of the second region remains uncopied, h) repeating steps a)-g) until the desired degree of amplification has been achieved.
2. The method according to claim 1, wherein the method is carried out substantially isothermal.
3. The method according to claim 1, wherein step (e) of the method is modified in that it comprises the binding of the activator oligonucleotide to the complementary segment of the extension product of the first extended primer oligonucleotide by displacing the strand of the nucleic acid chain to be amplified that is complementary to said extension product until said complementary strand of the nucleic acid to be amplified is detached from the first primer extension product, wherein the 3′ segment of the first primer extension product becomes single-stranded.
4. The method according to claim 1, wherein step (f) of the method is modified in that it comprises the hybridization of a second oligonucleotide primer to the first primer extension product, wherein at the same time there is at least a partial displacement of the activator oligonucleotide from the binding with the first extension product by strand displacement.
5. The method according to claim 1, wherein step (g) of the method is modified such that it comprises a displacement of the activator oligonucleotide from the binding with the first primer extension product with the participation of the polymerase.
6. The method according to claim 1, wherein step (h) of the method is modified in that it comprises the binding of the activator oligonucleotide to the uncopied polynucleotide tail of the first extended primer oligonucleotide and a displacement of the second primer extension product from the binding to the first primer extension product with the simultaneous formation of a complementary double strand with a segment of the first specific extension product of the first primer oligonucleotide.
7. The method according to claim 1, wherein it comprises the simultaneous amplification of the first and second primer extension products in an exponential reaction by using the first and second primer oligonucleotides and the activator oligonucleotide, wherein the formed primer extension products function as a template for the mutual synthesis.
8. The method according to claim 2, wherein it comprises the simultaneous amplification of the first and second primer extension products in an exponential reaction by using the first and second primer oligonucleotides and the activator oligonucleotide, wherein the formed primer extension products function as a template for the mutual synthesis.
9. The method according to claim 3, wherein it comprises the simultaneous amplification of the first and second primer extension products in an exponential reaction by using the first and second primer oligonucleotides and the activator oligonucleotide, wherein the formed primer extension products function as a template for the mutual synthesis.
10. The method according to claim 1, wherein step (h) of the method is modified in that it comprises repeating steps a)-g) until the desired degree of amplification of the first nucleic acid chain (perfect match) to be amplified has been achieved, which comprises substantially complementary target sequence to the third region of said activator oligonucleotide.
11. The method according to claim 1, wherein step (h) of the method is modified in that it comprises repeating steps a)-g) until the desired degree of amplification of the at least one other nucleic acid chain (mismatch) to be amplified has been achieved, which comprises at least one nucleotide sequence divergence to the third region of said activator oligonucleotide.
12. The method according to claim 1, wherein the method is modified in that the target sequence of the at least one other nucleic acid chain (mismatch) to be amplified comprises a sequence divergence compared to the target sequence of the first nucleic acid chain (perfect match) to be amplified, which is localized in sequence segments corresponding to extension product, which has been synthesized by polymerase, of the first primer extension product, which immediately follows the first primer region.
13. The method according to claim 1, wherein the third single-stranded region of the activator oligonucleotide comprises sequence divergence to at least a segment of the extension product, which has been synthesized by polymerase, of the first primer extension product, which immediately follows the first primer region, of the at least one other nucleic acid chain (mismatch) to be amplified.
14. The method according to claim 1, wherein the third single-stranded region of the activator oligonucleotide comprises at least one nucleotide divergence to the target sequence of the at least one other nucleic acid chain (mismatch) to be amplified.
15. The method according to claim 1, wherein the third single-stranded region of the activator oligonucleotide comprises at least one sequence position which is non complementary to the another target sequence of the nucleic acid to be amplified, so that binding of this third region to the target sequence of the another population results in at least one mismatch position between activator oligonucleotide and first primer extension product of the at least one other nucleic acid chain (mismatch) sequence.
16. The method according to claim 1, wherein step (h) of the method is modified in that it comprises amplification until detection of either the first nucleic acid chain (perfect match) or the at least one other nucleic acid chain (mismatch).
17. The method according to claim 1, wherein step (h) of the method is modified in that it comprises comparison of degree of amplification between the first nucleic acid chain (perfect match) and the at least one other nucleic acid chain (mismatch).
18. The method according to claim 1, wherein step (h) of the method is modified in that it comprises comparison of degree of amplification between the first nucleic acid chain (perfect match) and the at least one other nucleic acid chain (mismatch), wherein the comparison is done by counting the time necessary to achieve desired amount of amplified product.
19. The method according to claim 1, wherein step (h) of the method is modified in that it comprises comparison of amplification between the first nucleic acid chain (perfect match) and the at least one other nucleic acid chain (mismatch), wherein the comparison is conducted at same reaction conditions.
20. The method according to claim 1, wherein the method is modified in that it is conducted under reaction conditions allowing for preferential amplification of the first nucleic acid chain (perfect match).
21. The method according to claim 1, wherein the method is modified in that it is conducted under reaction conditions allowing for preferential amplification of the first nucleic acid chain (perfect match) until the amount of amplified target sequence of the first nucleic acid chain (perfect match) is higher than the amount of amplified target sequence of the at least one other nucleic acid chain (mismatch).
22. The method according to claim 1, wherein step (h) of the method is modified in that it is conducted under reaction conditions allowing for facilitation of amplification of the first nucleic acid chain (perfect match) and facilitation of amplification of the at least one other nucleic acid chain (mismatch).
23. The method according to claim 1, wherein step (h) of the method is modified in that it is conducted under reaction conditions allowing for facilitation of amplification of the first nucleic acid chain (perfect match) and suppression of amplification of the at least one other nucleic acid chain (mismatch).
24. The method according to claim 1, wherein step (h) of the method is modified in that it is conducted under reaction conditions allowing for preferential amplification of the first nucleic acid chain (perfect match) and less preferential amplification of the at least one other nucleic acid chain (mismatch), wherein mismatch between activator oligonucleotide and the at least one other target sequence results in less preferential amplification of nucleic acids comprising the at least one other target sequence.
25. The method according to claim 1, wherein step (h) of the method is modified in that it is conducted under reaction conditions allowing for preferential amplification of the first nucleic acid chain (perfect match) and disruption of amplification of the at least one other nucleic acid chain (mismatch), wherein mismatch between activator oligonucleotide and the at least one other target sequence results in disruption of amplification of nucleic acids comprising the at least one other target sequence.
Description
BRIEF DESCRIPTION TO DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21) The reaction designated with .fwdarw.1 corresponds to the employment of a template with perfect match (SEQ ID NO:26) in a concentration of 10 μmol/l.fwdarw.2 shows the reaction with a mismatch template (SEQ ID NO:27) in an amount of 10 μmol/l, and the reaction designated with .fwdarw.3 represents a negative control.
(22)
(23)
(24) In the method (
(25) A nucleic acid chain to be amplified, a first specific primer oligonucleotide, a second primer, and an activator oligonucleotide that takes part in the separation of the re-synthesized strands as well as a suitable polymerase and substrates such as dNTPs serve as components of the amplification system. The amplification takes place in a buffer solution under conditions that allow a primer extension reaction of both primers as well as support a strand displacement by the activator oligonucleotide for the separation of both primer extension products.
(26) In one embodiment, all the method steps are performed under conditions that do not allow a separation of synthesized primer extension products in the absence of a suitable activator oligonucleotide. For example, the temperature of the reaction solution is selected such that the Tm of a double strand of both primer extension products is significantly above the reaction temperature.
(27) Under these conditions a separation of both primer extension products takes places depending on the effect of the activator oligonucleotide. Said activator oligonucleotide is able to complementary bind to the first primer extension product and thereby displace the second primer extension product from its binding with the first primer extension product. In order to initiate said strand displacement reaction the first primer oligonucleotide is provided with a polynucleotide tail in its second region that can transiently bind to the activator oligonucleotide under reaction conditions and thus, causes a spatial proximity to other regions of the first primer extension nucleotide. After the initiation of the strand displacement by the activator oligonucleotide the second primer extension product is displaced from its binding with the first primer extension product. So, its 3-standing segment becomes free and is available for further binding of a first primer oligonucleotide.
(28) The polynucleotide tail of the first primer oligonucleotide preferably cannot be copied by a polymerase. This can be achieved either by using appropriate modifications in this region or by inserting a first blocking unit between the first primer region and the second primer region of the first primer oligonucleotide.
(29) The synthesis of the second primer extension product takes place after the second primer oligonucleotide has been bound to the first primer extension product in its 3′-standing segment. Said segment preferably does not bind to the activator oligonucleotide and is sufficiently long to bind the second primer oligonucleotide and support a successful primer extension reaction. The synthesis of the second primer extension product takes place by displacing the activator oligonucleotide from the binding with the first primer extension product. For example, this can be done by polymerase-dependent strand displacement or also by strand displacement by means of the second primer.
(30) Both primer extension products include copyable regions and mutually serve as a template. The activator oligonucleotide does not serve as a template. This can preferably be achieved by the use of nucleotide modifications that certainly can complementary bind to the first primer extension product, but are not accepted as a template by the polymerase. Examples of such nucleotide modifications are nucleotide compounds having modified phosphate sugar backbone portions, e.g., 2′-O-Alkyl-RNA modifications (e.g., 2′-OMe), LNA modifications, or morpholino modifications. In general, the presence of such modifications in a strand prevents a DNA-dependent polymerase from reading such a strand. The number of such modifications can be different, generally a few modifications (between 1 and 20) may be sufficient in order to prevent a polymerase from reading such a strand. Such nucleotide modifications can for example be used at or around the site of binding of the first primer oligonucleotide to the activator oligonucleotide and/or as constituents of the second region of the first primer oligonucleotide.
(31) Owing to the use of such modifications the polymerase function is locally hindered, so that certain segments of the structures used cannot be copied by the polymerase and mainly remain single-stranded. In this single-stranded form they can further bind reaction components and thus, exercise their function.
(32) Under reaction conditions that do not denaturate a double strand the use of the sequence-dependent nucleic acid-mediated strand displacement results in the sequence-specific separation of both primer extension products during the amplification reaction in the described method: a sufficient complementarity between re-synthesized extension fragments of the primer oligonucleotides with the sequence of an activator oligonucleotide given at the beginning of an amplification is a prerequisite for a successful strand displacement and thus, can have influence on the efficacy of the strand separation of a double strand (consisting of the first and second primer extension products). In case of minor divergences strand displacement and thus, also strand separation are decelerated. This can cause a deceleration of the entire reaction. With an increase in the difference in the sequence of the re-synthesized extension products and the sequence of the activator oligonucleotide given at the beginning of the reaction there is an increasing disability of the strand displacement that ultimately is no longer able to bring about a sufficient separation of both primer extension products. Both re-synthesized strands can no longer sufficiently be separated from each other, so that their binding sites are no longer accessible for primer oligonucleotides. In general, this leads to the termination of an amplification of sequences having sequence divergences.
(33) In summary, not only the specificities of the binding of both primers with their templates, but also the nature of the sequence segments between the primers can have influence on the amplification, namely in that these sections allow a sufficient strand displacement or not, in accordance with their matching in the sequence of the activator oligonucleotide given at the beginning of the reaction. Thereby, the described method possibly overall can have a higher specificity than the conventional amplification methods.
(34) Preferably, the method according to the invention does not use specific proteins that cause a strand substitution between the activator oligonucleotide and a double strand, e.g., RecA. Rather, the method according to the invention uses the temporal coupling between a strand displacement by means of a nucleic acid chain (activator oligonucleotide) given at the beginning of the reaction and a concurrent template-dependent strand polymerization by means of polymerase. This concurrent coupling of both processes is made possible on the one hand by sequence-specific structures of components (sequence-specific activator oligonucleotides and sequence-specific primers) as well as their specific combination. On the other hand, the activity of the polymerase is sequence-specifically controlled: for example, the activator oligonucleotide does not serve as a template and the synthesis of the second primer extension product is position-specifically stopped at the first primer oligonucleotide.
(35) The specific amplification further results by using the components at reaction conditions that preferably do not allow a spontaneous separation of re-synthesized primer extension products.
(36) Surprisingly, we have succeeded in suitably linking these processes, namely such that both processes (sequence-specific strand displacement and primer extension) preferably can proceed in one batch. In this way, a homogeneous amplification system can be arranged that comprises sequence-specific primer oligonucleotides, a sequence-specific activator oligonucleotide, polymerase, and nucleotide substrates (dNTP). With such an amplification system a nucleic acid to be amplified can be multiplied. The sequences of both primer oligonucleotides and the sequence of the activator oligonucleotide are matched with the nucleic acid to be amplified.
(37) The method (
(38) Also, combinations with other amplification methods are possible, e.g., with PCR, wherein the PCR for example first is performed over 1 to 10 cycles and subsequently, it is for example went on working under isothermal conditions.
(39) In an advantageous embodiment, the method for the specific amplification of nucleic acid chains comprises the following steps: a) hybridizing a first primer oligonucleotide to the 3′ segment of a strand of a nucleic acid chain to be amplified, wherein the nucleic acid chain to be amplified comprises a target sequence, wherein the first primer oligonucleotide comprises: a first primer region in the 3′ segment of the first primer oligonucleotide that can sequence-specifically bind to a strand of a nucleic acid chain to be amplified, a second region that is directly or via a linker linked to the 5′ end of the first primer region of the first primer oligonucleotide and that comprises a polynucleotide tail which is suitable for binding an activator oligonucleotide and supporting strand displacement (step c) by the activator oligonucleotide, wherein the polynucleotide tail remains substantially uncopied by polymerase under the selected reaction conditions, b) extending the first primer oligonucleotide by means of a polymerase to form a first primer extension product comprising sequence parts that are complementary to the target sequence and/or to the nucleic acid chain (a) to be amplified, c) binding the activator oligonucleotide to the polynucleotide tail of the second region of the first extended primer oligonucleotide, wherein the activator oligonucleotide comprises: a first single-stranded region that can bind to the polynucleotide tail of the second region of the first primer oligonucleotide, a second single-stranded region that is substantially complementary and can bind to the first region of the first primer oligonucleotide, a third single-stranded region that is substantially complementary to at least a segment of the extension product, which has been synthesized by polymerase, of the first primer extension product, wherein the activator oligonucleotide does not serve as template for a primer extension of the first primer oligonucleotide, d) binding the activator oligonucleotide to the first primer region of the first extended primer oligonucleotide by displacing the strand of the nucleic acid chain to be amplified that is complementary to said first primer region, e) binding the activator oligonucleotide to the complementary segment of the extension product of the first extended primer oligonucleotide by displacing the strand of the nucleic acid chain to be amplified that is complementary to said extension product, wherein the 3′ segment of the first primer extension product becomes single-stranded, f) hybridizing a second oligonucleotide primer to the first primer extension product, wherein the 3′ segment of the second oligonucleotide primer comprises a sequence that can hybridize to the first primer extension product; and g) extending the second oligonucleotide primer with polymerase to form a second primer extension product, wherein the extension takes place up to and including the first primer region of the first primer oligonucleotide and said first primer region is copied by the polymerase, wherein the polynucleotide tail of the second region remains uncopied, h) repeating steps a)-g) until the desired degree of amplification has been achieved.
(40) In one embodiment, the method is performed under conditions that do not allow a separation of complementary strands of the nucleic acid to be amplified in the absence of activator oligonucleotide.
(41) In one embodiment, copying the polynucleotide tail is caused in the second primer region by a stopping region for the polymerase that is arranged between the first and the second regions.
(42) In one embodiment, the third single-stranded region of the activator oligonucleotide is substantially complementary to the segment of the extension product, which has been synthesized by the polymerase, of the first primer extension product, which immediately follows the first primer region, wherein:
(43) In one embodiment, the third single-stranded region of the activator oligonucleotide is completely complementary to the mentioned 5′ segment of the extension product of the first primer extension product, wherein the length of said complementary sequence part comprises the following ranges: of at least 3 to 70 nucleotides, better of at least 5 to 50 nucleotides, preferably of 5 to 40 nucleotides, further preferably of 5 to 30 nucleotides, particularly preferred of 5 to 20 nucleotides.
(44) In a further embodiment, the sequences of the third single-stranded region of the activator oligonucleotide and the corresponding sequence of the mentioned 5′ segment of the extension product of the first primer extension product comprise complementary sequences except for one sequence position (a pair of nucleotides/bases) having a non-complementary base pairing (in the meaning of Watson-Crick base pairing) over a length of at least 3 to 70 nucleotides, better of at least 5 to 60 nucleotides, preferably of 10 to 40 nucleotides, particularly preferred of 10 to 20 nucleotides.
(45) In a further embodiment, the sequences of the third single-stranded region of the activator oligonucleotide and the corresponding sequence of the mentioned 5′ segment of the extension product of the first primer extension product comprise complementary sequences except for two sequence positions (a pair of nucleotides/bases) having a non-complementary base pairing (in the meaning of Watson-Crick base pairing) over a length of at least 3 to 70 nucleotides, better of at least 5 to 60 nucleotides, preferably of 10 to 40 nucleotides, particularly preferred of 10 to 20 nucleotides.
(46) In a further embodiment, the sequences of the third single-stranded region of the activator oligonucleotide and the corresponding sequence of the mentioned 5′ segment of the extension product of the first primer extension product comprise complementary sequences (in the meaning of Watson-Crick base pairing) over a length of at least 3 to 70 nucleotides, better of at least 5 to 60 nucleotides, preferably of 10 to 40 nucleotides, particularly preferred of 10 to 20 nucleotides, further said segments comprise non-complementary regions in at least three sequence positions, wherein said positions are within the 5′ segment of the third section of the activator oligonucleotide.
(47) In a further embodiment, the sequences of the third single-stranded region of the activator oligonucleotide and the sequence of the mentioned 5′ segment of the extension product of the first primer extension product comprise complementary sequences except for at least one and at most ten sequence positions having a non-complementary base pairing (in the meaning of Watson-Crick base pairing) over a length of at least 3 to 70 nucleotides, better of at least 5 to 60 nucleotides, preferably of 10 to 40 nucleotides, particularly preferred of 10 to 20 nucleotides, wherein in sequence positions having non-complementary base pairing (in the meaning of Watson-Crick base pairing) at least one modified nucleotide having modified nucleobases is involved. Such modified nucleobases comprise for example nucleobases with enhanced binding of natural nucleobases (e.g., 2-amino adenines), or with attenuated binding such as for example so-called universal bases such as inosines or 5-nitroindole. The modified nucleobases are preferably located in the third sequence region of the activator oligonucleotide.
(48) In a further embodiment of the method step (e) of the method is further modified and comprises:
(49) the binding of the activator oligonucleotide to the complementary segment of the extension product of the first extended primer oligonucleotide by displacing the strand of the nucleic acid chain to be amplified that is complementary to said extension product until said complementary strand of the nucleic acid to be amplified is detached from the first primer extension product, wherein the 3′ segment of the first primer extension product becomes single-stranded.
(50) In a further embodiment of the method step (f) of the method is further modified and comprises:
(51) the hybridization of a second oligonucleotide primer to the first primer extension product, wherein at the same time there is at least a partial displacement of the activator oligonucleotide from the binding with the first extension product by strand displacement.
(52) In a further embodiment of the method step (g) of the method is further modified and comprises a displacement of the activator oligonucleotide from the binding with the first primer extension product with the participation of the polymerase.
(53) In a further embodiment of the method step (h) of the method is further modified and comprises: optionally the binding of the activator oligonucleotide to the uncopied polynucleotide tail of the first extended primer oligonucleotide and a displacement of the second primer extension product from the binding to the first primer extension product with the simultaneous formation of a complementary double strand with a segment of the first specific extension product of the first primer oligonucleotide.
(54) In a further embodiment of the method the method is further modified and comprises: h) continuation of the reaction under conditions that allow a repletion of steps (a) to (g).
(55) In a further embodiment of the method the method is further modified and comprises: the simultaneous amplification of the first and second primer extension products in an exponential reaction by using the first and second primer oligonucleotides and the activator oligonucleotide, wherein the formed primer extension products function as a template for the mutual synthesis.
(56) Preferred Embodiments of a Start Nucleic Acid Chain:
(57) The nucleic acid chain employed or to be employed at the beginning of the amplification reaction can be referred to as a start nucleic acid chain (
(58) Its function can be seen in that it represents the initial template that permits a correct positioning of primers, the synthesis sections between both primers as well as the initiation of binding and extension processes. In a preferred embodiment, a start nucleic acid chain comprises a target sequence.
(59) By binding primers to their respective primer binding sites (PBS 1 and PBS 2) and initiating appropriate primer extension reactions first primer extension products are generated. These are synthesized as specific copies of the nucleic acid chain present at the beginning of the reaction.
(60) In one embodiment, this nucleic acid chain (start nucleic acid chain) to be used in the reaction mixture before the beginning of the amplification reaction can be identical to the nucleic acid chain to be amplified. By the amplification reaction only the amount of such nucleic acid chain is increased.
(61) In a further embodiment, the nucleic acid to be amplified and the start nucleic acid chain differ in that certainly the start nucleic acid chain prescribes the arrangement of individual sequence elements of the nucleic acid chain to be amplified, but the sequence composition of the start nucleic acid chain can differ from the sequence of the nucleic acid chain to be amplified. For example, in context of the primer binding and extension during an amplification new sequence contents (regarding the start nucleic acid chain) can be integrated into the nucleic acid chain to be amplified. Moreover, sequence elements of a nucleic acid chain to be amplified can differ from such sequence elements of a start nucleic acid chain in their sequence composition (e.g., primer binding sites or primer sequences). The start nucleic acid only serves as an initial template for the specific synthesis of the nucleic acid chain to be amplified. Said initial template can remain in the reaction mixture until the end of the amplification. However, by the exponential nature of the amplification the amount of the nucleic acid chain to be amplified at the end of an amplification reaction predominates the amount of a start nucleic acid chain to be added to the reaction.
(62) In a further embodiment, the start nucleic acid chain can comprise at least one sequence part that is not amplified. Thus, such a start nucleic acid chain is identical to the sequence to be amplified. Such sections not to be amplified can represent a sequence part of a start nucleic acid chain for example as a result of sequence preparing steps or as a result of previous sequence manipulation steps, respectively.
(63) In a preferred embodiment, the start nucleic acid chain to be added to the reaction mixture before the beginning of the reaction includes at least one target sequence.
(64) In a further embodiment, such a start nucleic acid chain includes at least one target sequence and still further sequences that are non-target sequences. During the amplification sequence segments comprising the target sequence are exponentially multiplied and thereby, other sequence segments either are not exponentially multiplied at all or only partially.
(65) Structure of a Start Nucleic Acid Chain
(66) An example of such a start nucleic acid chain is a nucleic acid chain that includes a target sequence and that comprises a sequence fragment A and that comprises a sequence fragment B.
(67) Sequence fragment A of the start nucleic acid chain comprises a sequence that has a significant homology with the sequence of one of both primers used in the amplification or is substantially identical to the copyable portion of the 3′ segment of the one primer. In the synthesis of a complementary strand to this segment a complementary sequence is generated that represents a respective primer binding site.
(68) Sequence fragment B of the start nucleic acid chain comprises a sequence suitable to complementary bind a corresponding further primer or its 3′ segment to form an extendable primer template complex, wherein sequence fragment A and sequence fragment B with respect to each other mainly/preferably are non-complementary.
(69) In a preferred embodiment, a start nucleic acid chain is added to the reaction mixture of an amplification method that has the following properties:
(70) Preferably, sequence fragment A is in the 5′ segment of the start nucleic acid chain. Preferably, said sequence fragment A forms a restriction of the nucleic acid chain strand in the 5′ direction.
(71) Preferably, sequence fragment B is downstream of sequence fragment A.
(72) In a preferred embodiment, said sequence fragment B forms a restriction of the nucleic acid chain strand in the 3′ direction. In a further embodiment, said sequence fragment B does not represent a restriction of the nucleic acid chain strand in the 3′ direction, but is flanked by further sequences from the 3′ side. Preferably, said sequences are no target sequences and do not participate in the exponential amplification.
(73) In one embodiment, the target sequence comprises at least one of both sequence fragment A or sequence fragment B. In a further embodiment, the target sequence is between sequence fragment A and sequence fragment B.
(74) In one embodiment, such a start nucleic acid chain can function as a template for the synthesis of a first primer extension product (
(75) During the initiation of the amplification the first primer at least with the 3′ segment of its first region can bind to such a start nucleic acid chain in segment 3 (
(76) In a preferred embodiment, thus a start nucleic acid chain comprises the following sequence fragments (
(77) In a further embodiment, such a start nucleic acid chain can function as a template for the synthesis of a second primer extension product (
(78) Here, the start nucleic acid chain for example during a primer extension reaction by using the first primer oligonucleotide can be provided as a sequence segment of a longer starting nucleic acid chain (
(79) During the initiation of the amplification the first primer at least with the 3′ segment of its first region can bind to such a start nucleic acid chain in segment 7 (
(80) In this preferred embodiment, a start nucleic acid chain comprises the following sequence fragments (
(81) Mode of Functioning of the Start Nucleic Acid Chain
(82) At the beginning of the amplification reaction the start nucleic acid chain functions as a template for the initial generation of respective primer extension products. Thus, it represents the starting template for the nucleic acid chain to be amplified. The start nucleic acid chain does not necessarily have to be identical to the nucleic acid chain to be amplified. By binding and extending both primers during the amplification reaction substantially both primers prescribe which sequences on both terminal segments of the nucleic acid chain to be amplified are generated during the amplification.
(83) In a preferred embodiment of the method reaction conditions that do not denaturize a double strand are maintained during the exponential amplification process. Hence, it is advantageous for the start nucleic acid chain to have a restriction in its 5′ sequence segment that can be extended by a polymerase, which results in a stop in the enzymatic extension of a respective primer (e.g., segments 1 or 5 or 9 or 12 in
(84) In a further preferred embodiment of the method reaction conditions that do not denaturize a double strand are used during initial synthesis steps (for example, initial one to ten synthesis repetitions) (e.g., temperature rising up to 90° C.), however, in subsequent repetitions of the synthesis steps non-denaturizing conditions are maintained during the exponential amplification process. For such a combination of temperature conditions it is not relevant whether or not the start nucleic acid chain has a restriction in its 5′ sequence segment. By initial denaturation separation of synthesized strands is independent of their length in analogy to PCR.
(85) Designing a Start Nucleic Acid Chain
(86) A start nucleic acid chain can be designed before an exponential amplification in a separate reaction process. A skilled person knows many methods how to design and use a nucleic acid chain comprising a target sequence as well as further prescribed sequence parts. In designing a start nucleic acid chain methods can be applied that comprise for example template-dependent primer extension steps, restriction enzyme digestion steps, ligation steps, polyadenylation steps. These process steps can be applied alone or in combination. During such reactions start nucleic acid chains can be designed that have different structures,
(87) In
(88) For example, a start nucleic acid chain to be prepared (
(89) Further, for example a start nucleic acid chain to be designed (
(90) Moreover, a start nucleic acid chain to be designed (
(91) Moreover, a start nucleic acid chain to be designed (
(92) During designing the resulting start nucleic acid chain can be present in a double-stranded or single-stranded form. According to the structure of the start nucleic acid chain and the method of its design it may be necessary to convert the start nucleic acid chain to the single-stranded form before the amplification. This can be done for example in a separate step or during a clean-up procedure of the start nucleic acid chain from accompanying components.
(93) For example, the start nucleic acid chain can be synthesized during a separate primer extension reaction using a primer used in der exponential amplification (e.g., the first primer oligonucleotide or the second primer oligonucleotide), a single-stranded DNA or RNA that comprises a target sequence as well as a polymerase and dNTPs. This results in a start nucleic acid chain that is bound to its template. For use in the exponential amplification such a start nucleic acid chain can be converted to the single-stranded form prior to exponential amplification. Thereby, a number of methods known can be applied, e.g., temperature-dependent denaturation, alkali denaturation, partial or complete strand degradation (e.g., by means of RNase H, or DNase, or 5′ exonuclease). Additionally, a further primer extension reaction can be performed with an additional primer that is positioned upstream (so-called bumper primer or outer primer), so that the start nucleic acid chain is converted to the single-stranded form by polymerase-dependent strand displacement.
(94) For the purpose of converting the start nucleic acid chain to a single-stranded form further enzymatic systems as well as their co-factors or energy source can be added to the amplification mixture that are able to convert double-stranded nucleic acid chains to a single-stranded form and thus, convert a start nucleic acid chain generated from a double-stranded stage to a single-stranded stage. Such enzymatic systems are for example helicases and recombinases (with ATP or dATP as an energy source). In a preferred embodiment, such enzymes are inactivated prior to an exponential amplification reaction so as not to cause a non-sequence-specific strand dissociation during the amplification reaction.
(95) In an advantageous embodiment, such a start nucleic acid chain is designed prior to the exponential amplification and does not need to be treated separately.
(96) In a further advantageous embodiment, the start nucleic acid chain is designed in the presence of components of an amplification reaction/reaction mixtures provided for amplification reactions. In this way, a start nucleic acid chain directly after having been designed can smoothly be transferred to the exponential amplification reaction. Such an embodiment permits design of a homogeneous assay format.
(97) In an advantageous embodiment, the starting material for such a start nucleic acid chain is selected from the following group: genomic DNA or fragments thereof, plasmid DNA or fragments thereof, mRNA or fragments thereof, microRNA or fragments thereof. The nucleic acid functioning as the starting material can be derived for example from a clinically relevant material source.
(98) In a preferred embodiment of the method the sequence of the start nucleic acid chain to be employed at the beginning of the amplification reaction is identical to the sequence of the nucleic acid chain to be amplified. Here, only one strand of the nucleic acid chain to be amplified (either as the first primer extension product or as the second primer extension product) or also both strands can be employed at the beginning of the amplification in the amplification batch.
(99) In one embodiment of the method a start nucleic acid chain to be added to the reaction preferably at least on one side is limited in its length such that in the synthesis of the complementary strand a double-stranded fragment is generated that can dissociate to single strands with cooperation of the activator oligonucleotide at the selected temperature.
(100) This can be achieved for example in that the start nucleic acid chain to be added to the amplification mixture includes at least one sequence fragment in its 5′ segment that corresponds to an amplification primer or a part of an amplification primer and includes a further sequence fragment downstream that corresponds to a primer binding site or functions as a primer binding site to which an appropriate primer can bind in the amplification method and is able to permit a polymerase-dependent synthesis reaction of a complementary strand to the start nucleic acid chain.
(101) Preferred Embodiments of the First Primer Oligonucleotide (Primer 1)
(102) The first primer oligonucleotide (primer 1) is a nucleic acid chain that includes at least the following regions (
(103) The total length of the first primer oligonucleotide is between 10 and 80, preferably between 15 and 50, better between 20 and 30 nucleotides or equivalents thereof (e.g., nucleotide modifications). The structure of the first primer oligonucleotide is adapted such that it is able to reversibly bind to the activator oligonucleotide under the selected reaction conditions. Moreover, the structure of the first primer oligonucleotide is adapted to its primer function. Moreover, the structure is adapted such that a strand displacement by means of the activator oligonucleotide can be performed. Altogether, structures of the first and second regions are adapted such that an exponential amplification can be performed.
(104) In an advantageous embodiment of the invention the first and second regions of the primer are coupled in a conventional 5′-3′ arrangement. In a further embodiment of the invention coupling of both sections is done via a 5′-5′ bond, so that the second region has an opposite direction to the first region.
(105) Coupling regions between each other/among each other is done preferably covalently. In one embodiment, coupling between the first and second regions is a 5′-3′ phosphodiester coupling that is conventional for DNA. In a further embodiment it is a 5′-5′ phosphodiester coupling. In a further embodiment, it is a 5′-3′ phosphodiester coupling, wherein between adjacent terminal nucleotides or nucleotide modifications of both regions at least one linker (e.g., a C3, C6, C12, or a HEG linker or an abasic modification) is positioned.
(106) Individual regions can include different nucleotide modifications. Here, individual elements of nucleotides can be modified: nucleobase and backbone (sugar content and/or phosphate content). Moreover, there can be used modifications that lack at least one component of the standard nucleotide building blocks or are modified, e.g., PNA.
(107) In a further embodiment, a second region of the first primer oligonucleotide comprises further sequences that do not bind to the activator oligonucleotide. These sequences can be used for other purposes, e.g., for binding to the solid phase. These sequences are preferably localized at the 5′ end of the polynucleotide tail.
(108) In a further embodiment, a first primer oligonucleotide can comprise a characteristic label. Examples of such a label are dyes (e.g., FAM, TAMRA, Cy3, Alexa 488 etc.) or biotin or other groups that can specifically be bound, e.g., digoxigenin.
(109) The First Primer Region of the First Primer Oligonucleotide
(110) The sequence length is between ca. 3-30 nucleotides, preferably between 5 and 20 nucleotides, wherein the sequence is mainly complementary to the 3′ segment of a strand of the nucleic acid chain to be amplified. In detail, said primer region has to be able to specifically bind to the complementary 3′ segment of a second primer extension product. Said first region is to be copyable in backward synthesis and also functions as a template for a 2nd strand. Preferably, the nucleotide building blocks are linked among each other via common 5′-3′ phosphodiester binding or phosphothioester binding.
(111) The first primer region preferably includes nucleotide monomers that do not or only marginally affect the function of the polymerase, these are for example: natural nucleotides (dA, dT, dC, dG etc.) or modifications thereof without altered base pairing modified nucleotides, 2-amino-dA, 2-thio-dT or other nucleotide modifications with diverging base pairing.
(112) In a preferred embodiment, the 3′-OH end of said region is preferably free from modifications and has a functional 3′-OH group that can be recognized by polymerase. The first primer region functions as an initiator of the synthesis of the first primer extension product in the amplification. In a further preferred embodiment, the first region comprises at least one phosphorothioate compound, so that no degradation of the 3′ end of the primers by 3′ exonuclease activity of polymerases can take place.
(113) The sequence of the first region of the first primer oligonucleotide and the sequence of the second region of the activator oligonucleotide are preferably complementary to each other.
(114) In one embodiment, the first primer region or its 3′ segment can bind to sequence segments of a target sequence.
(115) The Second Region of the First Primer Oligonucleotide
(116) The second region of the first primer oligonucleotide is preferably a nucleic acid sequence that comprises at least one polynucleotide tail that remains preferably uncopied by polymerase during the synthesis reaction and that can bind to the first region of the activator oligonucleotide. The segment of the second region that mainly binds to the activator oligonucleotide can be referred to as polynucleotide tail.
(117) Further, the second region of the first primer oligonucleotide not only has to specifically bind the activator oligonucleotide under reaction conditions, but also has to participate in the process of strand displacement by means of the activator oligonucleotide. Accordingly, the structure of the second region must be suitable for causing a spatial proximity between the activator oligonucleotide and the corresponding double strand end (in detail, the 3′ end of the second primer extension product).
(118) Configuration of the structure of the second region of the first primer oligonucleotide is illustrated in detail in several embodiments. Here, the arrangement of the oligonucleotide segments and modifications used are taken into account that lead to a stop in the polymerase-catalyzed synthesis.
(119) The length of the second region is between 3 and 60, preferably between 5 and 40, preferably between 6 and 15 nucleotides or equivalents thereof.
(120) The sequence of the second region may be chosen arbitrarily. Preferably, it is non-complementary to the nucleic acid to be amplified and/or to the second primer oligonucleotide and/or to the first region of the first primer oligonucleotide. Moreover, it preferably does not contain any self-complementary segments such as hairpins or stem loops.
(121) The sequence of the second region is preferably adapted to a sequence of the first region of the activator oligonucleotide, so that both sequences can bind under reaction conditions. In a preferred embodiment, said binding is reversible under reaction conditions: thus, there is an equilibrium between components bound to each other and unbound components.
(122) The sequence of the second region of the first primer oligonucleotide is preferably selected such that the number of complementary bases that can bind to the first region of the activator oligonucleotide is between 1 and 40, better between 3 and 20, preferably between 6 and 15.
(123) The function of the second region among others is to bind the activator oligonucleotide. In one embodiment, said binding preferably is specific, so that a second region of a first primer oligonucleotide can bind a specific activator oligonucleotide. In another embodiment, a second region can bind more than only one activator oligonucleotide under reaction conditions.
(124) In general, there is no need for a perfect match in the sequence between the second region of the first primer oligonucleotide and the first region of the activator oligonucleotide. The degree of the complementarity between the second region of the first primer oligonucleotide and the first region of the activator oligonucleotide can be between 20% and 100%, better between 50% and 100%, preferably between 80% and 100%. The respectively complementary regions can be positioned directly adjacent to each other or also comprise non-complementary sequence segments therebetween.
(125) In one embodiment, the second region of the first primer oligonucleotide can include at least one Tm-modifying modification. By incorporating such modifications the stability of the bond between the second region of the first primer oligonucleotide and the first region of the activator oligonucleotide can be modified. For example, Tm-rising modifications (nucleotide modifications or non-nucleotide modifications) can be used such as LNA nucleotides, 2-amino adenosines or MGB modifications. On the other hand, also Tm-decreasing modifications can be used such as for example inosine nucleotide. In the structure of the second region also linkers (e.g., C3, C6, HEG linkers) can be integrated.
(126) For strand displacement the activator oligonucleotide has to be brought in spatial proximity of the double strand end of the nucleic acid to be amplified. Said double strand end consists of segments of the first primer region of the first primer extension product and a correspondingly complementary 3′ segment of the second primer extension product.
(127) The polynucleotide tail mainly complementary binds the activator oligonucleotide under reaction conditions and thus, causes a transient approximation of the second region of the activator oligonucleotide and of the first region of an extended primer extension product, so that the complementary bond between said elements can be initiated during a strand displacement process.
(128) In one embodiment, binding of the activator oligonucleotide to the polynucleotide tail of the first primer oligonucleotide directly leads to such a contact. This means that the polynucleotide tail and the first primer region of the first primer oligonucleotide have to be directly coupled to each other. Owing to such an arrangement there may be a direct contact between complementary bases of the second region of the activator oligonucleotide and corresponding bases of the first primer region after an activator oligonucleotide has bound in its first region, so that a strand displacement can be initiated.
(129) In a further embodiment, there are other structures of the second region of the first primer oligonucleotide between structures of the polynucleotide tail and the first primer region. Thus, after an activator oligonucleotide has bound to the polynucleotide tail this is not directly positioned to the first primer region, but in a certain distance thereto. The structures between the non-copyable polynucleotide tail and the copyable first primer region of the primer oligonucleotide can generate such a distance. Said distance has a value that is between 0.1 and 20 nm, preferably between 0.1 and 5 nm, better between 0.1 and 1 nm.
(130) Such structures for example represent linkers (e.g., C3 or C6 or HEG linkers) or segments that are not complementary to the activator oligonucleotide (e.g., in the form of non-complementary, non-copyable nucleotide modifications). The length of these structures can generally be measured in chain atoms. Said length is between 1 and 200 atoms, preferably between 1 and 50 chain atoms, preferably between 1 and 10 chain atoms.
(131) In order to keep the polynucleotide tail of polymerase uncopyable under amplification conditions the second region of the first primer oligonucleotide generally comprises sequence-alignments or structures, respectively that lead to a stop of the polymerase in the synthesis of the second primer extension product after the polymerase has successfully copied the first primer region. Said structures are to prevent the polynucleotide tail of the second region from being copied. Thus, the polynucleotide tail preferably remains uncopied by the polymerase.
(132) In one embodiment, such structures are between the first primer region and the polynucleotide tail.
(133) In a further embodiment, the sequence of the polynucleotide tail can include nucleotide modifications that lead to a stop of the polymerase. In this way, a sequence segment of the second region of the first primer oligonucleotide can comprise both functions: it is both a polynucleotide tail and a sequence of nucleotide modifications leading to a stop of the polymerase.
(134) Modifications in the second region of the first primer oligonucleotide that lead to a synthesis stop and thus, leave the polynucleotide tail uncopied in this application are combined under the term “first blocking unit or a stop region”.
(135) In the Following, Further Embodiments of Structures are Given that can Lead to the Stop in the Synthesis of the Second Strand.
(136) Several building blocks in the oligonucleotide synthesis are known that hinder polymerase from reading the template and lead to termination of the polymerase synthesis. For example, non-copyable nucleotide modifications or non-nucleotide modifications are known. There are also synthesis types/alignments of nucleotide monomers within an oligonucleotide that lead to the stop of the polymerase (e.g., 5′-5 alignment or 3′-3′ alignment). Primer oligonucleotides having a non-copyable polynucleotide tail are also known in the prior art (e.g., Scorpion primer structures or primers for binding to the solid phase). Both primer variants describe primer oligonucleotide structures that are able to initiate the synthesis of a strand, so that a primer extension reaction can take place. The result is a first strand that also integrates the primer structure with tail in the primer extension product. In the synthesis of a complementary strand to the first primer extension product, e.g., during a PCR reaction, the second strand is extended to the “blocking unit/stop structure” of the primer structure. Both described primer structures are designed such that the 5′ portion of the primer oligonucleotide remains single-stranded and is not copied by the polymerase.
(137) In a further embodiment, the second region of the primer oligonucleotide comprises a polynucleotide tail that has a conventional alignment from 5′ to 3′ in its entire length and includes non-copyable nucleotide modifications. Such non-copyable nucleotide modifications are for example 2′-O-alkyl RNA modifications, PNA, morpholino. Said modifications can be differently distributed in the second primer region.
(138) Non-copyable nucleotide modifications in the polynucleotide tail can share between 20% and 100%, preferably more than 50% of the nucleotide building blocks. Preferably, these nucleotide modifications are in the 3′ segment of the second region and thus, border on the first region of the first primer oligonucleotide.
(139) In one embodiment, the sequence of the non-copyable nucleotide modifications is at least partially complementary to the sequence in the template strand, so that the primer binding to the template is done by including at last part of said nucleotide modifications. In a further embodiment, the sequence of the non-copyable nucleotide modifications is non-complementary to the sequence in the template strand.
(140) The non-copyable nucleotide modifications are preferably covalently coupled to each other and thus, represent a sequence segment in the second region. The length of this segment comprises between 1 and 40, preferably between 1 and 20 nucleotide modifications, more preferably between 3 and 10 nucleotide modifications.
(141) In a further embodiment, the second region of the first primer oligonucleotide comprises a polynucleotide tail that has a conventional alignment from 5′-3′ in its entire length and includes non-copyable nucleotide modifications (e.g., 2′-O-alkyl modifications) and at least one non-nucleotide linker (e.g., C3, C6, HEG linker). The function of a non-nucleotide linker is to covalently connect adjacent nucleotides or nucleotide modifications and at the same time to site-specifically interrupt the synthesis function of the polymerase.
(142) Such a non-nucleotide linker is not to space the structures of the polynucleotide tail and of the first primer region too far from each other. Rather, the polynucleotide tail is to be in a spatial proximity to the first primer region. A non-nucleotide linker are modifications that are not longer than 200 chain atoms in their length, even more advantageous not longer than 50 chain atoms, particularly preferred not longer than 10 chain atom. The minimum length of such a linker can be one atom. An example of such non-nucleotide linkers are straight or branched alkyl linkers having an alkyl chain that includes at least one carbon atom, advantageously at least 2 to 30, more preferably 4 to 18. Such linkers are sufficiently known in the oligonucleotide chemistry (e.g., C3, C6 or C12 linkers) and can be incorporated during solid phase synthesis of oligonucleotides between the sequence of the polynucleotide tail and the sequence of the first region of the first primer oligonucleotide. Another example of such non-nucleotide linkers are linear or branched polyethylene glycol derivatives. A known example in the oligonucleotide chemistry is hexaethylene glycol (HEG). A further example of such non-nucleotide linkers are abasic modifications (e.g., THF modification, as an analogue of dRibose).
(143) If one or more of such modifications are integrated in a second region they can effectively interfere with the copy function of a polymerase during its synthesis of the second primer extension product, so that downstream segments remain uncopied after such a modification. The number of such modifications in the second region can be between 1 and 100, preferably between 1 and 10, preferably between 1 and 3.
(144) The position of such non-nucleotide linker can be at the 3′ end of the second region and thus, represent the transition to the first region and the second region of the primer oligonucleotide.
(145) Also, the position of the non-nucleotide linker in the central segment of the second region can be used. Thus, a polynucleotide tail is divided into at least two segments. In this embodiment, the 3′ segment of the polynucleotide tail includes at least one, better more, e.g., between 2 and 20, preferably between 2 and 10 non-copyable nucleotide modifications. These non-copyable nucleotide modifications preferably are on the transition between the first and second regions of the primer oligonucleotide.
(146) In a further embodiment, the second region of the primer oligonucleotide comprises a polynucleotide tail that has an alignment from 5′ to 3′ in its total length and includes at least one nucleotide monomer in an “reverse” alignment from 3′ to 5′ and that are positioned at the transition between the first and second regions of the first primer oligonucleotide.
(147) In a further embodiment, the second region of the primer oligonucleotide comprises a polynucleotide tail, wherein such a polynucleotide tail completely consists of nucleotides that directly border on the first region of the first primer oligonucleotide in a reversed alignment, so that the coupling of the first and second regions is by the 5′-5′ position. An advantage of such an alignment is that the polymerase after having copied the first region encounters a “reverse” alignment of nucleotides, which typically leads to the termination of the synthesis at this site.
(148) In a “reverse” alignment of nucleotides in the total length of the polynucleotide tail preferably the 3′-terminal nucleotide of the polynucleotide tail is to be blocked at its 3′-OH end in order to prevent side reactions. Alternatively, also a terminal nucleotide can be used that has no 3′-OH groups at all, e.g., a didesoxynucleotide.
(149) In such an embodiment, of course also the corresponding nucleotide alignment in the activator oligonucleotide is to be adapted. In such a case, the first and second regions of the activator oligonucleotide have to be linked in a 3′-3′ alignment.
(150) In a further embodiment, the second region of the primer oligonucleotide comprises a polynucleotide tail that has a conventional alignment from 5′ to 3′ in its total length and includes at least one nucleotide modification that does not represent a complementary nucleobase to the polymerase if the synthesis is performed exclusively with natural dNTPs (dATP, dCTP, dGTP, dTTP, or dUTP).
(151) For example, Iso-dG or Iso-dC nucleotide modifications can be integrated in the second region of the first primer oligonucleotide as single, but preferably several (at least 2 to 20) nucleotide modifications. Further examples of nucleobase modifications are various modifications of the extended genetic alphabet. Such nucleotide modifications preferably do not support a complementary base pairing with natural nucleotides, so that a polymerase (at least theoretically) does not insert a nucleotide from the series (dATP, dCTP, dGTP, dTTP, or dUTP). In reality, however there may be a rudimentary insertion, especially at higher concentrations of dNTP substrates and prolonged incubation times (e.g., 60 min or longer). Hence, preferably several of such nucleotide modifications positioned at adjacent sites are to be employed. The stop of the polymerase synthesis is effected by lacking appropriate complementary substrates for these modifications. Oligonucleotides having Iso-dC or Iso-dG can be synthesized with standard methods and are available from several commercial suppliers (e.g., Trilink-Technologies, Eurogentec, Biomers GmbH). Alternatively, also the sequence of the first region of the activator oligonucleotide can be adapted to the sequence of such a second primer region. Here, complementary nucleobases of the extended genetic alphabet can accordingly be integrated in the first region of the activator oligonucleotide during the chemical synthesis. For example, Iso-dG can be integrated in the second region of the first primer nucleotide, its complementary nucleotide (Iso-dC-5-Me) can be placed at the appropriate site in the first region of the activator oligonucleotide.
(152) In summary, the termination of the synthesis of polymerase in the second region may be achieved in different manners. However, this blockage preferably only takes place when the polymerase has copied the first region of the first primer oligonucleotide. In this way it is ensured that a second primer extension product has an appropriate primer binding site in its 3′ segment. This primer binding site is exposed during the strand displacement and thus, is available for a new binding of a further first primer oligonucleotide.
(153) In the synthesis of the complementary strand to the first primer extension product the primer extension reaction stops before the polynucleotide tail. Since in this way this polynucleotide tail remains single-stranded for interaction with the activator oligonucleotide and thus, is available for binding it supports the initiation of the strand displacement reaction by the activator oligonucleotide by bringing the corresponding complementary segments of the activator oligonucleotide in close proximity to the appropriate duplex end. In this way, the distance between the complementary part of the activator oligonucleotide (second region) and the complementary part of the extended primer oligonucleotide (first region) is reduced to a minimum. Such a spatial proximity facilitates the initiation of the strand displacement.
(154) In the context of a schematic illustration of a nucleic acid-mediated strand displacement reaction now a complementary sequence of an activator oligonucleotide is in close proximity of the appropriate duplex end. This results in competition for the binding to the first region of the first primer oligonucleotide between the strand of the activator oligonucleotide and the template strand complementary to the primer. By repetitively closing and forming base pairing between the primer region and the complementary segment of the activator oligonucleotide (second region of the activator nucleotide) or the complementary segment of the template strand, respectively initiation of the nucleic acid-mediated strand displacement process occurs.
(155) Generally, the yield of the initiation of the strand displacement is the higher the closer the corresponding complementary sequence part of the activator oligonucleotide is to the complementary segment of the primer region. However, when this distance is increased the yield of the initiation of the strand displacement decreases.
(156) In the context of the present invention it is not mandatory that the initiation of the strand displacement works at the maximum yield. Thus, distances between the 5′ segment of the first primer region of the first primer oligonucleotide, that binds to a complementary strand of the template and forms a complementary duplex, and a corresponding complementary sequence part in the activator oligonucleotide when bound to the polynucleotide tail of the second region of the first primer oligonucleotide may be in the following ranges: between 0.1 and 20 nm, better between 0.1 and 5 nm, even better between 0.1 and 1 nm. In the preferred case, said distance is less than 1 nm. Expressed in other units said distance corresponds to a track of less than 200 atoms, even better less than 50 atoms, even better less than 10 atoms. In the preferred case, said distance is one atom. The distance information is for orientation only and to illustrate that shorter distances between these structures are preferred. In many cases, said distance can only be measured by analyzing the exact structures of oligonucleotides and evaluating the measurement of sequence distances or linker lengths.
(157) The first primer may also comprise further sequence parts that are not needed for an interaction with the activator oligonucleotide or the template strand. Such sequence parts for example can bind further oligonucleotides that are used as detection probes or immobilization partners in the binding to the solid phase.
(158) Primer Function of the First Primer Oligonucleotide
(159) The first primer oligonucleotide may be used in several individual steps. First of all, it exerts a primer function in the amplification. Thereby, a primer extension reaction is performed using the second primer extension product as a template. In a further embodiment, the first primer oligonucleotide at the beginning of the amplification reaction can use the start nucleic acid chain as template. In a further embodiment, the first primer oligonucleotide can be used in designing/providing a start nucleic acid chain.
(160) During the amplification the first primer functions as an initiator of the synthesis of the first primer extension product using the second primer extension product as a template. The 3′ segment of the first primer comprises a sequence that can mainly complementary bind to the second primer extension product. The enzymatic extension of the first primer oligonucleotide using the second primer extension product as a template results in the formation of the first primer extension product. Such a first primer extension product comprises the target sequence or sequence portions thereof. In the course of the synthesis of the second primer extension product the sequence of the copyable portion of the first primer oligonucleotide is recognized by polymerase as a template and a corresponding complementary sequence is synthesized, so that a respective primer binding site results for the first primer oligonucleotide. Synthesis of the first primer extension product is up to and including the 5′ segment of the second primer oligonucleotide. Immediately following synthesis of the first primer extension product said product is bound to the second primer extension product and forms a double-stranded complex. The second primer extension product is sequence-specifically displaced from said complex by the activator oligonucleotide. Thereby, the activator oligonucleotide binds to the first primer extension product. Following a successful strand displacement by the activator oligonucleotide the second primer extension product in turn itself can function as a template for the synthesis of the first primer extension product. The now free 3′ segment of the first primer extension product can bind a further second primer oligonucleotide, so that a new synthesis of the second primer extension product can be initiated.
(161) Moreover, the first primer oligonucleotide can function as an initiator of the synthesis of the first primer extension product starting from the start nucleic acid chain at the beginning of the amplification. In one embodiment, the sequence of the first primer is completely complementary to the corresponding sequence segment of a start nucleic acid chain. In a further embodiment, the sequence of the first primer oligonucleotide is only partially complementary to the corresponding sequence segment of a start nucleic acid chain. However, said diverging complementarity is not to prevent the first primer oligonucleotide from starting a mainly sequence-specific primer extension reaction. The respective differences in complementarity of the first primer oligonucleotide to the respective position in the start nucleic acid chain are preferably in the 5′ segment of the first region of the first primer oligonucleotide, so that in the 3′ segment mainly complementary base pairing and initiation of the synthesis is possible. For the initiation of the synthesis for example especially the first 4-10 positions in the 3′ segment are to be completely complementary to the template (start nucleic acid chain). The remaining nucleotide positions may diverge from a perfect complementarity. Thus, the degree of a perfect complementarity in the remaining 5′ segment of the first region of the first primer oligonucleotide can comprise ranges between 50% to 100%, better between 80% and 100% of the base composition. According to the length of the first region of the first primer oligonucleotide the sequence divergences are 1 to at most 15 positions, better 1 to at most 5 positions. Thus, the first primer oligonucleotide can initiate a synthesis of a start nucleic acid chain. In a subsequent synthesis of the second primer extension product copyable sequence parts of the first primer oligonucleotide are copied by polymerase, so that in turn in subsequent synthesis cycles a completely complementary primer binding site is formed within the second primer extension product for the binding of the first primer oligonucleotide and is available in subsequent synthesis cycles.
(162) In a further embodiment, the first primer oligonucleotide can be used in the preparation of a start nucleic acid chain. Thereby, such a first primer oligonucleotide can mainly/preferably sequence-specifically bind to a nucleic acid (e.g., a single-stranded genomic DNA or RNA or equivalents thereof comprising a target sequence) and initiate a template-dependent primer extension reaction in the presence of a polymerase. The binding position is selected such that the primer extension product comprises a desired target sequence. Extension of the first primer oligonucleotide results in a nucleic acid strand that has a sequence complementary to a template. Such a strand can be detached from the template (e.g., by heat or alkali) and thus, converted to a single-stranded form. Such a single-stranded nucleic acid chain can function as a start nucleic acid chain at the beginning of the amplification. Such a start nucleic acid chain in its 5′ segment comprises the sequence portions of the first primer oligonucleotide, further it comprises a target sequence or equivalents thereof and a primer binding site for the second primer oligonucleotide. Further steps are explained in section “start nucleic acid chain”.
(163) The synthesis of the first primer extension product is a primer extension reaction and forms an individual step in the amplification. The reaction conditions during this step are accordingly adapted. Reaction temperature and reaction time are selected such that the reaction can successively take place. The preferred temperature in this step depends on the polymerase used and the binding strength of the respective first primer oligonucleotide to its primer binding site and comprises for example ranges of 15° C. to 75° C., better of 20 to 65° C., preferably of 25° C. to 65° C. The concentration of the first primer oligonucleotide comprises ranges of 0.01 μmol/l to 50 μmol/l, better of 0.1 μmol/l to 20 μmol/l, preferably of 0.1 μmol/l to 10 μmol/l.
(164) In one embodiment, all steps of the amplification proceed under stringent conditions that prevent or delay the formation of non-specific products/by-products. Such conditions are for example higher temperatures, for example above 50° C.
(165) If more than one specific nucleic acid chain is to be amplified in one batch, in one embodiment, preferably sequence-specific primer oligonucleotides are used for amplification of the corresponding target sequences.
(166) Preferably, sequences of the first, the second primer oligonucleotides and of the activator oligonucleotide are adapted to each other such that side reactions, e.g., primer dimer formation, are minimized. For that, for example the sequences of the first and second primer oligonucleotides are adapted to each other such that both primer oligonucleotides are not able to start or support, respectively an amplification reaction in the absence of an appropriate template and/or a target sequence and/or a start nucleic acid chain. This can be achieved for example in that the second primer oligonucleotide does not comprise a primer binding site for the first primer oligonucleotide and the first primer oligonucleotide does not comprise a primer binding site for the second primer oligonucleotide. Moreover, it is to be avoided that the primer sequences comprise extended self-complementary structures (self-complement).
(167) In one embodiment, the synthesis of the first and second primer extension products proceeds at the same temperature. In a further embodiment, the synthesis of the first and second primer extension products proceeds at different temperatures. In a further embodiment, synthesis of the first primer extension product and strand displacement by the activator oligonucleotide proceed at the same temperature. In a further embodiment, synthesis of the first primer extension product and strand displacement by the activator oligonucleotide proceed at different temperatures.
(168) Preferred Embodiments of the Activator Oligonucleotide
(169) An activator oligonucleotide (
(170) In general, the sequence of the third region of the activator oligonucleotide is adapted to the sequence of the nucleic acid to be amplified, since this is relevant as a template for the order of the nucleotides in the extension product of a first primer. The sequence of the second region of the activator oligonucleotide is adapted to the sequence of the first primer region. The structure of the first region of the activator oligonucleotide is adapted to the sequence of the second region of the first primer oligonucleotide, especially to the nature of the polynucleotide tail.
(171) An activator oligonucleotide can also include further sequence segments that do not belong to the first, second or third regions. These sequences can be attached for example as flanking sequences to the 3′ and 5′ end. Preferably, these sequence segments do not interfere with the function of the activator oligonucleotide.
(172) The structure of the activator oligonucleotide preferably has the following properties:
(173) The individual regions are covalently bound among each other. Binding for example can be via conventional 5′-3′ binding. For example, a phosphodiester binding or nuclease-resistant phosphothioester binding may be used.
(174) An activator oligonucleotide can bind to the polynucleotide tail of the first primer oligonucleotide by means of its first region, wherein binding is mainly mediated by hybridizing complementary bases. The length of said first region is 3-80 nucleotides, preferably 4-40 nucleotides, particularly preferred 6-20 nucleotides. The degree of sequence matching between the sequence of the first region of the activator oligonucleotide and the sequence of the second region of the first primer oligonucleotide can be between 20% and 100%, preferably between 50% and 100%, particularly preferred between 80% and 100%. Binding of the first region of the activator oligonucleotide preferably is to be specific to the second region of the first primer oligonucleotide under reaction conditions.
(175) The sequence of the first region of the activator oligonucleotide is preferably selected such that the number of complementary bases that can complementary bind to the second region of the first primer oligonucleotide is between 1 and 40, better between 3 and 20, preferably between 6 and 15.
(176) Since the activator oligonucleotide does not represent a template for polymerase it can include nucleotide modifications that do not support the polymerase function that can be both base modifications and/or sugar phosphate backbone modifications. The activator oligonucleotide in its first region can for example include nucleotide and/or nucleotide modifications that are selected from the following list: DNA, RNA, LNA (“locked nucleic acids” analogues with 2′-4′ bridge-type binding in the sugar residue), UNA (“unlocked nucleic acids” without a binding between 2′-3′ atoms of the sugar residue), PNA (“peptide nucleic acids” analogues), PTO (phosphorothioate), morpholino analogues, 2′-O-alkyl RNA modifications (such as 2′-OMe, 2′-0 propargyl, 2′-O-(2-methoxyethyl), 2′-O-propyl-amine), 2′-halo RNA, 2′-amino RNA etc. These nucleotides or nucleotide modifications are linked to each other for example by a conventional 5′-3′ binding or 5′-2′ binding. For example, a phosphodiester binding or nuclease-resistant phosphothioester binding can be used.
(177) The activator oligonucleotide in its first region can include nucleotides and/or nucleotide modifications, wherein the nucleobases are selected from the following list: adenine and analogues thereof, guanine and analogues thereof, cytosine and analogues thereof, uracil and analogues thereof, thymine and analogues thereof, inosine or other universal bases (e.g., nitroindol), 2-amino-adenine and analogues thereof, iso-cytosine and analogues thereof, iso-guanine and analogues thereof.
(178) The activator oligonucleotide in its first region can include non-nucleotide compounds that are selected from the following list: intercalating substances that can affect the binding strength between the activator oligonucleotide and the first primer oligonucleotide, e.g., MGB, naphthalene etc. The same elements can also be used in the second region of the first primer.
(179) The activator oligonucleotide in its first region can include non-nucleotide compounds, e.g., linkers such as C3, C6, HEG linkers that can link individual segments of the first region to each other.
(180) The activator oligonucleotide can bind to the first primer region of the first primer oligonucleotide by means of its second region, wherein binding is substantially mediated by the hybridization of complementary bases.
(181) The length of the second region of the activator oligonucleotide is adapted to the length of the first region of the first primer oligonucleotide and preferably corresponds to it. It is between ca. 3-30 nucleotides, preferably between 5 and 20 nucleotides. The sequence of the second region of the activator oligonucleotide is preferably complementary to the first region of the first primer oligonucleotide. The degree of matching in complementarity is between 80% and 100%, preferably between 95% and 100%, preferably 100%. The second region of the activator oligonucleotide preferably includes nucleotide modifications that prevent polymerase in the extension of the first primer oligonucleotide, but do not block or substantially prevent formation of complementary double strands, for example 2′-O-alkyl RNA analogues (e.g., 2′-O-Me, 2′-O-(2-methoxyethyl), 2′-O-propyl, 2′-O-propargyl nucleotide modifications), LNA, PNA or morpholino nucleotide modifications. Individual nucleotide monomers are preferably linked via a 5′-3′ binding, but alternatively also a 5′-2′ binding between nucleotide monomers can be used.
(182) The sequence length and its nature of the first and second regions of the activator oligonucleotide are preferably selected such that binding of said regions to the first primer oligonucleotide under reaction conditions at least in one reaction step of the method is reversible. That is, that the activator oligonucleotide and the first primer oligonucleotide certainly can specifically bind to each other, but this binding is not to result in the formation of a complex of both elements that is permanently stable under reaction conditions. Rather, an equilibrium between a bound complex form of activator oligonucleotide and first primer oligonucleotide and a free form of individual components is to be intended or enabled under reaction conditions at least in one reaction step. In this way it is ensured that at least part of the first primer oligonucleotides under reaction conditions is present in a free form and can interact with the template to initiate a primer extension reaction. On the other hand, in this way it is ensured that the respective sequence regions of the activator oligonucleotides are available for binding with an extended primer oligonucleotide.
(183) By selecting the temperature during the reaction the portion of free, single-stranded and thus, reactive components can be affected: by decreasing the temperature first primer oligonucleotides bind to the activator oligonucleotides, so that both participants bind a complementary double-stranded complex. In this way, the concentration of single-stranded forms of individual components can be reduced. An increase of the temperature can result in the dissociation of both components in a single-stranded form. In the range of the melting temperature of the complex (activator oligonucleotide/first primer oligonucleotide) ca. 50% of the components are present in the single-stranded form and ca. 50% as a double-stranded complex. Thus, by using appropriate temperatures the concentration of single-stranded forms in the reaction mixture can be affected.
(184) In embodiments of the amplification method that include a change in temperature between individual reaction steps the desired reaction conditions can be effected during the respective reaction steps. For example, by using temperature ranges of about the melting temperatures of complexes of activator oligonucleotide/first primer oligonucleotide portions of free forms of individual components can be affected. Here, the temperature used results in destabilization of complexes comprising activator oligonucleotide/first primer oligonucleotide, so that during this reaction step individual complex components at least transiently become single-stranded and thus, are enabled to interact with other reaction partners. For example, the first sequence region of the activator oligonucleotide can be released from the double-stranded complex with a non-extended first primer and thus, interact with the second sequence region of an extended first primer oligonucleotide and thus, initiate a strand displacement. On the other hand, the release of a first, non-extended primer oligonucleotide from a complex comprising activator oligonucleotide/first primer oligonucleotide results in that the first primer region becomes single-stranded and thus, can interact with the template, so that a primer extension by a polymerase can be initiated. Here, the temperature used must exactly correspond to the melting temperature of the complex of activator oligonucleotide/first primer oligonucleotide. It is sufficient if the temperature in one reaction step is used about in the range of the melting temperature. For example, the temperature in one of the reaction steps comprises ranges of Tm±10° C., better Tm±5° C., preferably Tm±3° C. of the complex of activator oligonucleotide/first primer oligonucleotide.
(185) Such a temperature can be adjusted for example during the reaction step that comprises a sequence-specific strand displacement by the activator oligonucleotide.
(186) In embodiments of the amplification method that do not comprise a change in temperature between individual reaction steps and where amplification proceeds under isothermal conditions reaction conditions are maintained for the entire duration of the amplification reaction under which an equilibrium between a complex form of activator oligonucleotide and the first primer oligonucleotide and a free form of individual components is possible.
(187) The ratio between a complex form of activator oligonucleotide and the first primer oligonucleotide and free forms of individual components can be affected both by reaction conditions (e.g., temperature and Mg2+ concentration) and by the structures and concentrations of the individual components.
(188) The sequence length and its nature of the first and second region of the activator oligonucleotide in one embodiment are selected such that under given reaction conditions (e.g., in the reaction step of a strand displacement by the activator oligonucleotide) the ratio between a portion of a free activator oligonucleotide and a portion of an activator oligonucleotide in a complex with a first primer oligonucleotide comprises the following ranges: of 1:100 to 100:1, preferably of 1:30 to 30:1, particularly preferred of 1:10 to 10:1. The ratio between a portion of a free first primer oligonucleotide and a portion of a first primer oligonucleotide in a complex with an activator oligonucleotide comprises ranges of 1:100 to 100:1, preferably of 1:30 to 30:1, particularly preferred of 1:10 to 10:1.
(189) In one embodiment, the concentration of the first primer oligonucleotide is higher than the concentration of the activator oligonucleotide. In this way, there is an excess of the first primer in the reaction and the activator oligonucleotide, for its effect, has to be released from the binding with the first primer by selecting appropriate reaction temperatures. In general, this is done by raising the temperature until sufficient concentrations of free forms of the activator oligonucleotide are present.
(190) In a further embodiment, the concentration of the first primer oligonucleotide is lower than the concentration of the activator oligonucleotide. In this way, there is an excess of the activator oligonucleotide and the first primer oligonucleotide, for its effect, has to be detached from the binding with the activator oligonucleotide by selecting appropriate reaction temperatures. In general, this is done by raising the temperature until sufficient concentrations of free forms of the first primer oligonucleotide are present.
(191) With isothermal conditions there is an equilibrium: certain portions of the first primer oligonucleotide and activator oligonucleotide are bound to each other, whereas others are present as a single-stranded form in the reaction.
(192) The activator oligonucleotide can bind to at least one segment of the specifically synthesized extension product of the first primer oligonucleotide by means of its third region (
(193) In order to support the strand displacement reaction the sequence of the third region preferably is to have a high complementarity to the extension product. In one embodiment, 100% of the sequence of the third region is complementary to the extension product.
(194) Preferably, the third region binds to the segment of the extension product that immediately follows the first region of the first primer oligonucleotide. Thus, the segment of the extension product preferably is in the 5′ segment of the total extension product of the first primer oligonucleotide.
(195) Preferably, the third region of the activator oligonucleotide is not bound over the entire length of the extension product of the first primer oligonucleotide. Preferably, one segment at the 3′ end of the extension product remains unbound. Said 3′-terminal segment is needed for the binding of the second primer oligonucleotide.
(196) The length of the third region is accordingly adapted such that the third region binds to the 5′-standing segment of the extension product, but does not bind the 3′-standing segment of the extension product.
(197) The total length of the third region of the activator oligonucleotide is 2 to 100, preferably 6 to 60, particularly preferred 10 to 40 nucleotides or equivalents thereof. The activator oligonucleotide can complementary bind to the segment of the extension product over this length and thus, displace this 5′-standing segment of the extension product from the binding with its complementary template strand.
(198) The length of the 3′-standing segment of the extension product that is not bound by the activator oligonucleotide comprises for example ranges between 5 and 60 nucleotides, preferably between 10 and 40, preferably between 15 and 30 nucleotides.
(199) Said 3′-standing segment of the extension product is not displaced by the activator oligonucleotide from the binding with the template strand. Also in case of a completely bound third region of the activator oligonucleotide to its complementary segment of the extension product the first primer extension product can remain bound with the template strand via its 3′-standing segment. The binding strength of said complex is preferably selected such that it can for example spontaneously dissociate under reaction conditions (step e)). This can be achieved for example in that the melting temperature of said complex of the 3′-standing segment of the extension product of the first primer oligonucleotide and its template strand is about in the range of the reaction temperature or below the reaction temperature in a respective reaction step (reaction step e). In case of a low stability of said complex in the 3′ segment of the extension product a complete binding of the third region of the activator oligonucleotide to the 5′-standing segment of the extension product results in a rapid dissociation of the first primer extension product from its template strand.
(200) Altogether, the activator oligonucleotide has an appropriate structure to exert its function: under the respective reaction conditions it is able to sequence-specifically displace the extended first primer oligonucleotide from the binding with the template strand, whereby the template strand is converted to the single-stranded form and thus, is available for further bindings with a new first primer oligonucleotide and its target sequence-specific extension by polymerase.
(201) In order to fulfill the function of the strand displacement the regions one, two and three of the activator oligonucleotide are mainly to be present in the single-stranded form under reaction conditions. Hence, double-stranded self-complementary structures (e.g., hairpins) in these regions are to be avoided, if possible, since they can lower the functionality of the activator oligonucleotide.
(202) In the method according to the invention the activator oligonucleotide is not to be present as a template, hence the first primer oligonucleotide, when attached to the activator oligonucleotide under reaction conditions, is not to be extended by polymerase.
(203) This is preferably achieved by the use of nucleotide modifications that prevent polymerase from copying the strand. Preferably, the 3′ end of the first primer oligonucleotide remains unextended if the first primer oligonucleotide binds to the activator oligonucleotide under reaction conditions.
(204) The extent of blockage/hindrance/deceleration/complication of the reaction can be between a full expression of this property (e.g., 100% blockage under given reaction conditions) and a partial expression of this property (e.g., 30-90% blockage under given reaction conditions). Preferred are nucleotide modifications that alone or coupled in series (e.g., as a sequence fragment consisting of modified nucleotides) can prevent the extension of a first primer more than 70%, preferably more than 90%, more preferably more than 95%, and particularly preferred 100%.
(205) The nucleotide modifications can comprise base modifications and/or sugar phosphate residue modifications. Sugar phosphate modifications are preferred, since by a combination with conventional nucleobases an arbitrary complementary sequence of an activator oligonucleotide can be arranged. The nucleotide with modifications in the sugar phosphate residue that can result in the hindrance or blockage of the synthesis of the polymerase, for example includes: 2′-O-alkyl modifications (e.g., 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-O-propyl, 2′-O-propargyl nucleotide modifications), 2′-amino-2′-deoxy-nucleotide modifications, 2′-amino-alkyl-2′-deoxy-nucleotide modifications, PNA, morpholino modifications etc.
(206) Blockage can be both by a single nucleotide modification or only by coupling several nucleotide modifications in series (e.g., as a sequence fragment consisting of modified nucleotides). For example, at least 2, preferably at least 5, particularly preferred at least 10 of such nucleotide modifications can be coupled next to each other in the activator oligonucleotide.
(207) An activator oligonucleotide can have a uniform type of nucleotide modifications or comprise at least two different types of nucleotide modification.
(208) The position of such nucleotide modifications in the activator oligonucleotide preferably is to prevent the polymerase from extending the 3′ end of a first primer oligonucleotide bound to the activator oligonucleotide.
(209) In one embodiment, such nucleotide modifications are located in the second region of the activator oligonucleotide. In a further embodiment, such nucleotide modifications are located in the third region of the activator oligonucleotide. In a further embodiment, such nucleotide modifications are located in the second and in the third regions of the activator oligonucleotide.
(210) For example, at least 20%, preferably at least 50% of the positions of the second region of the activator oligonucleotide consist of such nucleotide modifications.
(211) For example, at least 20%, preferably at least 50% of the positions of the third region of the activator oligonucleotide consist of such nucleotide modifications.
(212) The sequence of the nucleobases of these nucleotide modifications is adapted to the demands on the sequence in the respective region.
(213) The rest are for example natural nucleotide or nucleotide modifications that do not hinder polymerase function at all or only marginally, e.g., DNA nucleotides, PTO nucleotides, LNA nucleotides, RNA nucleotides. Here, further modifications, for example base modifications such as 2-amino-adenosine, 2-aminopurines, 5-methyl-cytosines, inosines, 5-nitroindoles, 7-deaza-adenosine, 7-deaza-guanosine, 5-propyl-cytosine, 5-propyl-uridine or non-nucleotide modifications such as dyes, or MGB modifications etc. can be used e.g., to adjust binding strength of individual regions of the activator oligonucleotide. The individual nucleotide monomers can be coupled to each other via a conventional 5′-3′ binding or also else via a 5′-2′ binding.
(214) A segment of the activator oligonucleotide with nucleotide modifications that prevent an extension of the 3′ end of a first primer oligonucleotide bound to an activator oligonucleotide by polymerase is referred to as “second blocking unit”. The length of said segment can include between 1 to 50 nucleotide modifications, preferably between 4 and 30. Said segment can be located in the activator oligonucleotide for example such that the 3′ end of the bound first primer oligonucleotide is in this segment. Thus, this segment can span regions two and three.
(215) In one embodiment, preferably no linker structures or spacer structures such as C3, C6, HEG linkers are used to prevent extension of the 3′ end of a first primer oligonucleotide bound to the activator oligonucleotide.
(216) The activator oligonucleotide in addition to regions one, two and three can also comprise further sequence segments that flank the above-mentioned regions for example in the 5′ segment or 3′ segment of the activator oligonucleotide. Such sequence elements can be used for example for further functions such as for example interaction with probes, binding to solid phase etc. Such regions preferably do not interfere with the function of regions one to three. The length of these flanking sequences may be for example between 1 to 50 nucleotides. Moreover, an activator oligonucleotide can comprise at least one element for immobilization to a solid phase, e.g., a biotin residue. Moreover, an activator oligonucleotide can comprise at least one element for detection, e.g., a fluorescent dye.
(217) Effect of the Activator Oligonucleotide on Double Strand Separation by Sequence-Dependent Strand Displacement (Schematic Explanation)
(218) In the following, the mechanism of action of the activator oligonucleotide is to be schematically illustrated.
(219) Re-synthesized strands that comprise primer binding sites are bound to their templates immediately after they have been synthesized and thus, are substantially not accessible for direct binding of further primers. Only after separation or opening of the double strand or its sequence parts with a primer binding site, e.g., during or as a result of a strand displacement reaction or as a result of a double strand dissociation such a sequence part with a primer binding site can bind to a new primer oligonucleotide and thus, is available for another round of the synthesis reaction.
(220) Thus, conversion of re-synthesized sequence parts with primer binding sites to a single-stranded stage represents an essential prerequisite for the repetition of synthesis-processes and thus, also for an amplification. Factors that can have influence on said process can affect the amplification.
(221) Strand displacement of the second primer extension product according to the invention is done with cooperation/by binding of the activator oligonucleotide to the first primer extension product.
(222) Binding of the activator oligonucleotide to the first primer extension product goes beyond the sequence of the first primer. Here, the re-synthesized strand segment of the first primer extension product is bound by the activator oligonucleotide and can be displaced from the binding with its template strand, for example represented by the second primer extension product.
(223) This strand displacement leads to an opening of the double strand consisting of the first and second primer extension products. Said double strand opening can be locally (e.g., only in sequence segments that are directly displaced by the activator oligonucleotide) or go beyond segments, for example if the remaining double strand is destabilized by a further influencing factor, which can result in a complete separation of both primer extension products (complete detachment of the second primer extension product). Such factors can be for example temperature effect on the stability of the double strand under given reaction conditions. Further factors are for example enzymes that can destabilize or open a double strand (e.g., helicases or recombinases) or further oligonucleotides that can open a double strand by strand displacement.
(224) As a result of the strand displacement both primer binding sites are converted from their double-stranded stage to a single-stranded stage. Thus, their ability to bind further primers is restored.
(225) Factors that have influence on this process and affect amplification are for example a complete separation of both primer extension products.
(226) Complete dissociation/detachment of the second primer extension product from the first primer extension product (complete strand dissociation) can have a positive effect on the kinetics of individual steps. This is especially the case, if minor concentrations of both primer extension products are present in the reaction mixture. Re-association of both primer extension products to a double strand under these circumstances is decelerated and primer binding sites remain in their single-stranded stage for a longer period of time.
(227) Equilibrium/Reversibility of the Displacement by the Activator Oligonucleotide
(228) Binding of the activator oligonucleotide to the first primer extension product is conditional upon formation of complementary base pairs between both strands and thus, reversible under reaction conditions.
(229) Binding of the activator oligonucleotide to the first primer extension product can be undone by several factors. These are, for example: polymerase-dependent strand displacement during the synthesis of the second primer extension product up to the terminator in the first primer, strand displacement by the second primer extension product to form complementary strands between the first and second primer extension products, partial strand displacement by the 3′ segment of the second primer and its binding to the first primer extension product with displacement by the 5′ segment of the activator oligonucleotide.
(230) The second primer extension product can bind to the first primer extension product to form complementary base pairings and thereby displace the activator oligonucleotide. Thus, there is a competition between the activator oligonucleotide and the second primer extension product for the binding to the first primer extension product. As long as all three strands form a three-strand complex (here, the complex comprises the first primer extension product that is bound to the second primer extension product and the activator oligonucleotide via its complementary sequence parts) the strand displacement reaction can be in both directions: both the activator oligonucleotide can displace the second primer extension product and vice versa, the second primer extension product can displace the activator oligonucleotide. These strand displacement processes are in equilibrium. Here, strand displacement taking placing in the context of this complex can lead up to sequence positions that result in a complete dissociation/detachment of a strand from the three-strand complex under given reaction conditions (
(231) This is especially the case if reaction conditions participate in duplex destabilization (e.g., by the use of an appropriate reaction temperature, Mg2+ concentration and Tm-changing substances) and the construction of sequence parts favors such a detachment/dissociation, e.g., by adjusting the stabilities of the respective sequence parts. In this context, stabilities of complexes of sequence parts are important that comprise a complex of the first section of the activator oligonucleotide and the second section of the first primer and a complex of the 3′ segment of the first primer extension product with its primer binding site for the second primer oligonucleotide and accordingly the second primer oligonucleotide or the second primer extension product. Stability of both complexes can have influence on the equilibrium in the three-strand complex: a higher stability in the complex of the activator oligonucleotide and the first primer generally favors the strand displacement of the second primer extension product. In turn, a higher stability between the 3′ segment of the first primer extension product and the second primer oligonucleotide generally favors the displacement of the activator oligonucleotide.
(232) Stability of respective sequence parts can be affected for example in that the respective sequence parts are reduced or increased in their lengths. In general, extension of the first region of the activator oligonucleotide and of the corresponding second region of the first primer oligonucleotide results in an enhanced displacement of the synthesized second primer extension product. In turn, extension of the 3′ segment of the first primer extension product and accordingly of the second primer extension product results in an enhancement of the displacement of the activator oligonucleotide.
(233) During strand displacement processes within a three-strand complex intermediate stages can be achieved in which detachment/dissociation of one of the participants is particularly favored under given reaction conditions.
(234) In one case, the second primer extension product is completely detached from the binding with the first primer extension product, in another case the activator oligonucleotide can completely be detached from the binding with the first primer extension product.
(235) As long as all three strands are bound in context of a three-strand complex there is a certain equilibrium in the progress of the strand displacement in both directions.
(236) This equilibrium can be affected by several factors.
(237) These are for example strand detachment, degree of complementarity between individual structures or the presence of sequence divergences (e.g., mutations), use of nucleotide modifications or non-nucleotide modifications that have a stabilizing or destabilizing effect on a complementary binding of nucleic acid strands.
(238) Of particular importance for the described equilibrium is the degree of complementarity between the activator oligonucleotide and a double strand synthesized by polymerase: a sequence difference of only one nucleotide can result in a delay of the amplification and a difference of three nucleotides can cause stop of the amplification.
(239) In general, sequence differences between the activator oligonucleotide and the first primer extension product have a negative effect on the ability of the activator oligonucleotide to form a double strand with such a first primer extension product.
(240) In contrast, a second primer extension product is synthesized by polymerase generally as a perfect-match product using the first primer extension product. In general, in this way formation of a double strand is favored.
(241) If there is a sequence divergence between the activator oligonucleotide and the first primer extension product a shift in the equilibrium of the strand displacement can occur in the context of the three-strand complex.
(242) As a result of the competition for the binding to the first primer extension product formation of a perfect-match double strand between the first and second primer extension products is favored over the formation of a mismatch double strand. The result is deceleration or even prevention of the strand displacement of the second primer extension product. This can lead to the deceleration or reduction of yields or even to the prevention of the amplification.
(243) Shifting the equilibrium in strand displacement as a result of such a sequence-dependency (perfect-match vs. mismatch situation between the first primer extension product and the activator oligonucleotide) can influence the reaction. For example, rate of the reaction can be affected such that a perfect-match situation between the first primer extension product and the activator oligonucleotide is favored and mismatches can be excluded from amplification.
(244) Said influence of the sequences is illustrated in examples 1, 3, and 4.
(245) By changes in said equilibrium dissociation processes of both primer extension products can be accelerated, decelerated, or even cancelled. Thus, amplification becomes faster, slower, or possibly will even not take place at all.
(246) Thus, by the design of the sequence of the complementary portions in the activator oligonucleotide (during oligonucleotide design and chemical synthesis) nucleic acid chains can be amplified with predetermined sequences. Other nucleic acid chains that have a diverging sequence can be excluded from amplification or their amplification is kinetically disadvantaged, respectively.
(247) It was especially surprising that this sequence effect of the activator oligonucleotide was very distinct in its third region. The third region of the activator oligonucleotide according to the invention is to bind to the sequence part of the first primer extension product that is synthesized by polymerase. Thus, said sequence part of the first primer extension product is in the central segment of the nucleic acid chain to be amplified. For example, it can comprise the target sequence.
(248) Thus, amplification is subject to a constant control of the sequence contents in this sequence segment: strand displacement of the second primer extension product and thus, its conversion to the single-stranded form depends on the match in complementarity of the activator oligonucleotide and the first primer extension product.
(249) Thus, an activator oligonucleotide can exert a sequence control after each primer extension process.
(250) As a result of this control several states can be achieved: In case of a perfect match in the matching of the synthesized strands with the activator oligonucleotide successful strand displacement occurs that can proceed up to dissociation of the second primer extension product. Thereby, the corresponding sequence parts with primer binding sites are converted to the single-stranded state and conditions are created in that a further synthesis round can take place. In case of mismatches in the matching of the synthesized strands with the activator oligonucleotide (e.g., in sequences that do not correspond to a given alignment of the nucleotides in the third region of the activator oligonucleotide) strand displacement can be negatively affected: The equilibrium is on the side of the double strand formation between the first primer extension product and a respective template. The strand displacement process becomes slower or only partially takes place, what leads to a reduction of the availability of sequence parts with free primer binding sites. Altogether, thus mismatches can lead to the deceleration of the amplification or to the disruption of amplification.
(251) In this way, a control loop can be established after each synthesis repetition:
(252) After binding and extension of the primers double strands are formed that are sufficiently stable in the absence of the activator oligonucleotide under given reaction conditions, so that no spontaneous dissociation occurs. The sequence parts with primer binding sites in the context of double strands formed are prevented from an interaction with new primers. The system has reached a state in which no further synthesis can take place.
(253) In the presence of an activator oligonucleotide re-synthesized sequences are examined in view of their sequence contents by interaction with the activator oligonucleotide. In case of a correct matching with given sequence contents of the activator oligonucleotide strand displacement occurs, wherein the template strands are replaced by re-synthesized strands. Thereby, primer binding sites are converted to a single-stranded state and are available for a new interaction with primers and thus, for a further synthesis. Thus, the system of both primer extension products is put into an active state. Thus, the activator oligonucleotide has an activating effect on the system. In case of a lacking matching with given sequence contents of the activator oligonucleotide strand displacement of the template strands of re-synthesized strands is affected. Strand displacement and/or detachment either is quantitatively decelerated or completely cancelled. Thus, primer binding sites are not converted to the single-stranded state at all or less often. Thus, no primer binding sites at all or quantitatively less are available for a new interaction with primers. Thus, the system of both primer extension products is less often put into an active state or an active state is not achieved at all.
(254) Efficacy of the double strand opening of the re-synthesized primer extension products after each single synthesis step has an effect on the potentially obtainable yields in subsequent cycles: the less free/single-stranded primer binding sites are provided to a nucleic acid chain to be amplified at the beginning of a synthesis step, the smaller is the number of re-synthesized strands of the nucleic acid chain to be amplified in this step. In other words: The yield of a synthesis cycle is proportional to the amount of primer binding sites that are available for the interaction with the corresponding complementary primers. Altogether, in this way a control loop can be realized.
(255) Said control loop corresponds to a real-time/on-line control of synthesized fragments: sequence control is performed in the reaction mixture while the amplification takes place. Said sequence control is performed in accordance with a given pattern and the oligonucleotide system (by a strand-opening effect of the activator oligonucleotide) is able to distinguish between “correct” and “incorrect” states without external interventions. In the correct state the synthesis of sequences is continued, in the incorrect state synthesis is either decelerated or completely prevented. The resulting differences in the yields of “correct” and “incorrect” sequences after each step have an effect on the whole amplification that comprises a number of such steps.
(256) In an exponential amplification said dependency is exponential, so that even minor divergences in efficacy in one single synthesis cycle due to sequence divergences can mean a significant delay in time of the whole amplification or cause a complete absence of a detectable amplification in a given time frame.
(257) This effect of the real-time control of the re-synthesized nucleic acid chains is associated with the employment of the activator oligonucleotide and thus, the influence of the activator oligonucleotide during an amplification significantly goes beyond the length of primer oligonucleotides.
(258) Further Influencing Factors
(259) In general, factors that can have effect on strand displacement reaction, e.g., influence the extent, equilibrium, and/or rate of said process, can also have effect on the exponential amplification.
(260) Such factors are for example reaction conditions (e.g., temperature, Mg2+ concentration, DMSO, betaines, TPAC, buffer components), presence of secondary structures within the activator oligonucleotide (e.g., hairpin structures or G quadruplexes), use of nucleotide modifications in the activator oligonucleotide (that stabilize, e.g., 2-amino-dA or 5-propargyl-dC, LNA-nucleotides, or destabilize, e.g., inosine, the double strand) or non-nucleotide modifications that stabilize, e.g., MGB, or destabilize, e.g., sterically “bulky groups” that affect the geometry of the A form or B form of the nucleic acid strands (e.g., dyes or ligands coupled to nucleotide) the double strand, or intercalating substances, e.g., SYBR green, Eva green dyes.
(261) In individual cases such factors can be used to positively or negatively affect the equilibrium of the strand displacement and thus, favor or decelerate or prevent amplification of certain sequences. The extent of the influence can be determined experimentally.
(262) Reaction Conditions at Strand Displacement Reaction
(263) The displacement of the second primer extension product from the binding with the first primer extension product by means of a sequence-dependent strand displacement by the activator oligonucleotide forms an individual step in the amplification. The reaction conditions during said step are accordingly adapted. Reaction temperature and reaction time are selected such that the reaction can successfully take place.
(264) In a preferred embodiment strand displacement by the activator oligonucleotide is up to detachment/dissociation of the second primer extension product from the binding with the first primer extension product. Such a dissociation of the 3′ segment of the first primer extension product of complementary portions of the second primer extension product can be spontaneous during a temperature-dependent/temperature-related separation of both primer extension products. Such a dissociation has a favorable effect on the kinetics of the amplification reaction and can be affected by the choice of the reaction conditions, e.g., by means of temperature conditions. Therefore, temperature conditions are selected such that a successful strand displacement by complementary binding of the activator oligonucleotide favors a dissociation of the second primer extension product from the 3′ segment of the first primer extension product.
(265) The temperature in this step comprises for example ranges of 15° C. to 75° C., better of 30° C. to 70° C., preferably of 50° C. to 70° C.
(266) With a given length of the first region of the activator oligonucleotide and the second region of the first primer oligonucleotide (comprising for example ranges of 3 to 25 nucleotide monomers, better of 5 to 15 nucleotide monomers) a strand displacement reaction generally can successfully be initiated. In case of a complete complementarity of the activator oligonucleotide to the respective portions of the first primer extension product the activator oligonucleotide can bind to the first primer extension product except for the 3′ segment of the first primer extension product and displace the second primer extension product. Thus, the second primer extension product remains connected to the 3′ segment of the first primer extension product. The strength of said connection can be affected depending on temperature. When reaching a critical temperature this connection can disintegrate and both primer extension products can dissociate. The shorter the sequence of the 3′ segment, the more instable the connection and the lower the temperature that causes a spontaneous dissociation.
(267) A spontaneous dissociation can for example be achieved in the temperature range that is about the melting temperature. In one embodiment, the temperature of the steps of strand displacement by the activator oligonucleotide is about at the melting temperature (Tm±3° C.) of the complex comprising the 3′ segment of the first primer extension product that is not bound by the activator oligonucleotide and the second primer oligonucleotide or the second primer extension product, respectively.
(268) In one embodiment, the temperature of the steps of strand displacement by the activator oligonucleotide is at about the melting temperature (Tm±5° C.) of the complex comprising the 3′ segment of the first primer extension product that is not bound by the activator oligonucleotide and the second primer oligonucleotide or the second primer extension product, respectively.
(269) In one embodiment, the temperature of the steps of strand displacement by the activator oligonucleotide is above the melting temperature of the complex comprising the 3′ segment of the first primer extension product that is not bound by the activator oligonucleotide and the second primer oligonucleotide or the second primer extension product, respectively. Such a temperature comprises temperature ranges of about Tm+5° C. to Tm+20° C., better of Tm+5° C. to Tm+10° C. By using a higher temperature the equilibrium in said reaction step can be shifted toward dissociation. Thereby, the kinetics of the reaction can favorably be influenced. Using too low temperatures in the step of strand displacement by means of the activator oligonucleotide can lead to a significant deceleration of the amplification.
(270) The temperature of the strand displacement steps by the activator oligonucleotide can also be estimated approximately and adapted to the dissociation temperature.
(271) In a further embodiment, a first primer extension product comprises a 3′ segment that is not bound by the activator oligonucleotide and that comprises sequence lengths of 4 to about 8 nucleotides. In this embodiment, a spontaneous dissociation in general can already be achieved with temperature ranges between 15° C. and 50° C. Also higher temperatures lead to dissociation.
(272) In one embodiment, a first primer extension product comprises a 3′ segment that is not bound by the activator oligonucleotide and that comprises sequence lengths of 9 to about 18 nucleotides. In this embodiment, a spontaneous dissociation in general can already be achieved with temperature ranges between 40° C. and 65° C. Also higher temperatures lead to dissociation.
(273) In one embodiment, a first primer extension product comprises a 3′ segment that is not bound by the activator oligonucleotide and that comprises sequence lengths of 15 to about 25 nucleotides. In this embodiment, a spontaneous dissociation in general can already be achieved with temperature ranges between 50° C. and 70° C. Also higher temperatures lead to dissociation.
(274) In one embodiment, a first primer extension product comprises a 3′ segment that is not bound by the activator oligonucleotide and that comprises sequence lengths of 20 to about 40 nucleotides. In this embodiment, a spontaneous dissociation in general can already be achieved with temperature ranges between 50° C. and 75° C. Also higher temperatures lead to dissociation.
(275) The composition of the 3′ segment of the first primer extension product and optionally adding melting temperature-affecting oligonucleotide modifications (e.g., MGB) or reaction conditions (e.g., TPAC, betaines) can have effect on the choice of the temperature. A corresponding adjustment can therefore be made.
(276) In one embodiment, all steps of the amplification proceed under stringent conditions that prevent or decelerate the formation of non-specific products/by-products. Such conditions are for example higher temperatures, for example above 50° C.
(277) In one embodiment, the individual steps of strand displacement by the activator oligonucleotides proceed at the same temperature such as the synthesis of the first and second primer extension products. In a further embodiment, the individual steps of strand displacement by the activator oligonucleotides proceed at a temperature that differs from the temperature of the respective synthesis of the first and second primer extension products. In a further embodiment, the synthesis of the first primer extension product and strand displacement by the activator oligonucleotide proceed at the same temperature. In a further embodiment, synthesis of the second primer extension product and strand displacement by the activator oligonucleotide proceed at the same temperature.
(278) The concentration of the activator oligonucleotide comprises ranges of 0.01 μmol/l to 50 μmol/l, better of 0.1 μmol/l to 20 μmol/l, preferably of 0.1 μmol/l to 10 μmol/l.
(279) Preferred Embodiments of the Second Primer Oligonucleotide (Primer 2):
(280) An oligonucleotide that with its 3′ segment is able to bind to a substantially complementary sequence within the nucleic acid to be amplified or equivalents thereof and to initiate a specific second primer extension reaction (
(281) The second primer oligonucleotide is to be copyable upon backward synthesis and also functions as a template itself during the synthesis of the first primer extension product.
(282) The length of the second primer oligonucleotide can be between 15 and 100 nucleotides, preferably between 20 and 60 nucleotides, particularly preferred between 30 and 50 nucleotides. The nucleotide building blocks are preferably linked to each other via common 5′-3′ phosphodiester binding or phosphothioester binding. Such a primer oligonucleotide can be chemically synthesized in the desired manner.
(283) In one embodiment, the second primer oligonucleotide can include nucleotide monomers that do not or only insignificantly influence the function of polymerase, these are for example: natural nucleotides (dA, dT, dC, dG etc.) or their modifications without changed base pairing modified nucleotides, 2-amino-dA, 2-thio-dT or other nucleotide modifications with diverging base pairing (e.g., universal base pairs such as for example inosine 5-nitroindole).
(284) In a preferred embodiment, the 3′-OH end of this region is preferably free from modifications and has a functional 3′-OH group that is recognized by polymerase and can be extended dependent on a template. In a further preferred embodiment, the 3′ segment of the second primer comprises at least one phosphorothioate compound, so that the 3′ end of the primer cannot be degraded by the 3′ exonuclease activity of polymerases.
(285) The second primer oligonucleotide can be used in several individual steps. First, it exerts a primer function in the amplification. Thereby, a primer extension reaction using the first primer extension product as a template is performed. In a further embodiment, the second primer oligonucleotide can use the start nucleic acid chain as a template at the beginning of the amplification reaction. In a further embodiment, the second primer oligonucleotide can be used in designing/providing a start nucleic acid chain.
(286) During the amplification the second primer functions as an initiator of the synthesis of the second primer extension product using the first primer extension product as a template. The 3′ segment of the second primer comprises a sequence that can mainly complementary bind to the first primer extension product. The enzymatic extension of the second primer oligonucleotide using the first primer extension product as a template leads to the formation of the second primer extension product. Such a synthesis typically takes place in parallel to the displacement of the activator oligonucleotide from its binding with the first primer extension product. Said displacement mainly is by polymerase and can partially be done by the second primer oligonucleotide. Such a second extension product comprises the target sequence or segments thereof. In the course of the synthesis of the second primer extension product the sequence of the copyable portion of the first primer oligonucleotide is recognized by polymerase as template and a respective complementary sequence is synthesized. Said sequence is in the 3′ segment of the second primer extension product and comprises a primer binding site for the first primer oligonucleotide. The synthesis of the second primer extension product is up to the stop position in the first primer oligonucleotide. Immediately after the synthesis of the second primer extension product this product is bound to the first primer extension product and forms a double-stranded complex. The second primer extension product is sequence-specifically displaced from said complex by the activator oligonucleotide. After a successful strand displacement by the activator oligonucleotide the second primer extension product itself in turn can function as a template for the synthesis of the first primer extension product.
(287) Moreover, the second primer oligonucleotide can function as an initiator of the synthesis of the second primer extension product starting from the start nucleic acid chain at the beginning of the amplification. In one embodiment, the sequence of the second primer is completely complementary to the corresponding sequence segment of a start nucleic acid chain. In a further embodiment, the sequence of the second primer oligonucleotide is only partially complementary to the corresponding sequence segment of a start nucleic acid chain. However, said diverging complementarity is not to prevent the second primer oligonucleotide from starting a mainly sequence-specific primer extension reaction. The respective divergences in complementarity of the second primer oligonucleotide to the respective position in the start nucleic acid chain are preferably in the 5′ segment of the second primer oligonucleotide, so that in the 3′ segment mainly complementary base pairing and initiation of the synthesis are possible. For the initiation of the synthesis for example particularly the first 4-10 positions in the 3′ segment are to be fully complementary to the template (start nucleic acid chain). The remaining nucleotide positions can diverge from perfect complementarity. Thus, the degree of a perfect complementarity in the 5′ segment can comprise ranges of 10% to 100%, better between 30% and 100% of the base composition. Depending on the length of the second primer oligonucleotide these divergences from a full complementarity in the 5′ segment comprise from 1 to 40, better 1 to 20 nucleotide positions. In a further embodiment, the second primer oligonucleotide binds to the start nucleic acid chain only with its 3′ segment, but not with its 5′ segment. The length of such a 3′ segment of the second primer oligonucleotide that is completely complementary to the start nucleic acid chain comprises ranges between 6 and 40 nucleotides, better between 6 and 30 nucleotides, preferably between 6 and 20. The length of a corresponding 5′ segment of the second primer oligonucleotide that is non-complementary to the start nucleic acid chain comprises ranges between 5 and 60, better between 10 and 40 nucleotides. Thus, the second primer oligonucleotide is able to initiate the synthesis of a start nucleic acid chain. In a subsequent synthesis of the first primer extension product sequence parts of the second primer oligonucleotide are copied by polymerase, so that in turn in subsequent synthesis cycles a completely complementary primer binding site is formed within the first primer extension product for binding of the second primer oligonucleotide and is available in subsequent synthesis cycles.
(288) In a further embodiment, the second primer oligonucleotide can be used during the preparation of a start nucleic acid chain. Here, such a second primer oligonucleotide can mainly/preferably sequence-specifically bind to a nucleic acid (e.g., a single-stranded genomic DNA or RNA or equivalents thereof comprising a target sequence) and initiate a template-depending primer extension reaction in the presence of a polymerase. The binding position is selected such that the primer extension product comprises a desired target sequence. Extending the second primer oligonucleotide results in a strand that has a sequence complementary to the template. Such a strand can be detached by the template (e.g., by heat or alkali) and so converted into a single-stranded form. Such a single-stranded nucleic acid chain can function as a start nucleic acid chain at the beginning of the amplification. Such a start nucleic acid chain comprises in its 5′ segment the sequence portions of the second primer oligonucleotide, moreover it comprises a target sequence or equivalents thereof and a primer binding site for the first primer oligonucleotide. Further steps are explained in section “start nucleic acid chain”.
(289) In a preferred embodiment, the second primer oligonucleotide at least in its 3′ segment comprises sequence portions that can complementary and sequence-specifically bind to a sequence segment of a target sequence and initiate/support a successful primer extension reaction by polymerase. The length of such a sequence segment comprises ranges of 6 and 40 nucleotides, better of 8 to 30 nucleotides, preferably of 10 to 25 nucleotides.
(290) In one embodiment, the second primer oligonucleotide in its 3′ and 5′ segment comprises copyable sequence parts that are copied by polymerase in the synthesis of the first primer extension product. Thus, all sequence parts of the second primer are copied by polymerase. This leads to the formation of a primer binding site in the 3′ segment of the first primer extension product.
(291) In a further embodiment, the second primer oligonucleotide flanking its 5′ segment with copyable sequence parts can comprise a further sequence segment that comprises non-copyable portions. Such a primer can be used for example as a “scorpion primer” in the detection. In such an embodiment, the second primer oligonucleotide comprises modifications that upset polymerase in copying said flanking sequence segment. Such modifications comprise for example C3 linkers or HEG linkers or other modifications that lead to the stop of polymerase. Further examples of such modifications are described in section “embodiments of the first primer oligonucleotide”, see there.
(292) In one embodiment, the second primer oligonucleotide with its copyable portions in their length corresponds to the 3′ segment of the first primer extension product that is not bound by the activator oligonucleotide (
(293) In a further embodiment, the second primer oligonucleotide with its copyable sequence portions is shorter than the 3′ segment of the first primer extension product that is not bound by the activator oligonucleotide (
(294) In a further embodiment, the second primer oligonucleotide with its copyable portions is longer than the 3′ segment of the first primer extension product that is not bound by the activator oligonucleotide (
(295) The binding strength of the second primer oligonucleotide to its primer binding site depends on the length of the primer. Generally, longer second primer oligonucleotides can be employed with higher reaction temperatures.
(296) Preferably, sequences of the first and second primer oligonucleotides and of the activator oligonucleotide are adapted to each other such that side reactions, e.g., primer dimer formation, are minimized. For that, for example the sequence of the first and second primer oligonucleotides are adapted to each other such that both primer oligonucleotides are not able to start an amplification reaction in the absence of an appropriate template and/or a target sequence and/or a start nucleic acid chain. This can be achieved for example in that the second primer oligonucleotide does not comprise a primer binding site for the first primer oligonucleotide and the first primer oligonucleotide does not comprise a primer binding site for the second primer oligonucleotide. Moreover, it is to be avoided that the primer sequences comprise extended self-complementary structures (self-complement).
(297) The synthesis of the second primer extension product is a primer extension reaction and forms an individual step in the amplification. The reaction conditions during this step are accordingly adapted. Reaction temperature and reaction time are selected such that the reaction can successfully take place. The preferred temperature in this step depends on the polymerase used and the binding strength of the respective second primer oligonucleotide to its primer binding site and comprises for example ranges of 15° C. to 75° C., better of 20 to 65° C., preferably of 25° C. to 65° C. The concentration of the second primer oligonucleotide comprises ranges of 0.01 μmol/to 50 μmol/l, better of 0.1 μmol/l to 20 μmol/l, preferably of 0.1 μmol/l to 10 μmol/l.
(298) In one embodiment, all steps of the amplification proceed under stringent conditions that prevent or decelerate the formation of non-specific products/by-products. Such conditions are for example higher temperatures, for example above 50° C.
(299) If more than one specific nucleic acid chain has to be amplified in one batch, so in one embodiment preferably sequence-specific primer oligonucleotides are used for the amplification of the respective target sequences.
(300) In one embodiment, the synthesis of the first and second primer extension products proceeds at the same temperature. In a further embodiment, the synthesis of the first and second primer extension products proceeds at different temperatures. In a further embodiment, synthesis of the second primer extension product and strand displacement by the activator oligonucleotide proceed at the same temperature. In a further embodiment, synthesis of the second primer extension product and strand displacement by the activator oligonucleotide proceed at different temperatures.
(301) Exponential Vs. Linear Amplification
(302) If both complementary strands (the first primer extension product and the second primer extension product, wherein both primer extension products can be templates for the syntheses of the complementary strands) are synthesized substantially in parallel to each other in the same batch an exponential propagation of both primer extension products can occur during such a reaction.
(303) The primer extension products re-synthesized during a synthesis process close the respective complementary sequence parts to primers used, so that new primer binding sites are generated. In this way, re-synthesized strands themselves can function as templates in the subsequent synthesis processes.
(304) If substantially only one primer extension product is synthesized as a result of cyclically repeated synthesis processes, so a linear amplification of said primer extension product occurs.
(305) The rate of an exponential amplification generally can be higher than the rate of a linear amplification, especially at the beginning of an amplification, if the initial amounts of start nucleic acid chains are very low and the influence of reaction products on the reaction kinetics is still negligibly low. In general, the rate of the reaction decreases with an increase in the amount of synthesis products, so that a deceleration of the amplification has to be expected. In detail, efficiency and rate of individual process steps have an effect on the total rate of the method according to the invention. By changing/adapting the efficiency of individual steps the method of amplification according to the invention can be influenced in its rate and efficiency.
(306) In the following, a preferred embodiment of the method is explained in detail as an example, namely an exponential amplification of a nucleic acid chain to be amplified.
(307) An exponential synthesis reaction (amplification) results in an accumulation of both re-synthesized primer extension products that are regarded as the nucleic acid chain to be amplified. It is conditional upon a cyclic repetition of synthesis processes of both primer extension products and strand displacement processes (with the result of an opening of the respective primer binding site) that are at least partially conditional upon the sequence-specific strand displacement of the second primer extension product via the activator oligonucleotide.
(308) Thereby, strand displacement of a second primer extension product mediated by the complementary binding of the activator oligonucleotide to the first primer extension product can lead to a permanent or transient separation of the first and second primer extension products. Said separation can be done completely or partially with the sequence-specific cooperation of the activator oligonucleotide.
(309) If the activator oligonucleotide has successfully bound to the first primer extension product the number of complementary base pairings between the first and the second primer extension products is reduced. At the given reaction conditions thereby preferably the stability of the binding between the first and second primer extension products is reduced to such an extent that both primer extension products can be detached (e.g., the reaction temperature in this step is close to the melting temperature of the remaining complex of the first and second primer extension products). This results in a complete dissociation of a first primer extension product and a second primer extension product.
(310) Due to low concentrations of synthesized primer extension products at the beginning of the reaction the re-association kinetics of said strands is significantly decelerated. The concentration of the synthesis products may for example range from sub-femtomolar up to nanomolar concentration ranges. It is known that in these concentration ranges re-association of complementary strands is slow. In this way, a complete detachment of the second primer extension product from the first primer extension product can have a positive effect on the reaction kinetics. By the molar excess of the first and second primers these bind to respective primer binding sites that have become free and thus, in a new synthesis can play an initiating role.
(311) In a preferred embodiment, strand displacement of the second primer extension product by the activator oligonucleotide up to its separation from the first primer extension product is performed at reaction conditions that advantageously support a temperature-dependent strand detachment in the region of the 3′ segment of the first primer extension product.
(312) However, such reaction conditions are selected such that there is no complete strand dissociation between the first and second primer extension products, if the activator oligonucleotide does not or only incomplete bind to the first primer extension product.
(313) By the complete detachment of the two primer extension products now this strand is present in the single-stranded form in the reaction solution, so that new first primer has substantially unhindered access to its respective primer binding site in this strand. In general, this has a positive effect on the reaction kinetics of the initiation of the synthesis reaction of the first primer extension product.
(314) That is, in some cases, there results a advantageous combination of reaction conditions during the step of the strand displacement process by the activator oligonucleotide and the progress/extent of strand displacement of the second primer extension product up to the positions in its sequence at which the remaining double strand of the 3′ segment of the first primer extension product and the second primer extension product increasingly becomes instable and very likely degrades under such reaction conditions, so that a complete detachment from the first primer extension product occurs.
(315) Due to low concentrations of synthesis products at the beginning of the reaction and the associated almost negligible re-association of both synthesized strands a positive effect is exerted on the rate of the synthesis of such strands.
(316) With increasing concentrations of re-synthesized strands generally reaction rate decreases. This effect is at least partially attributed to the accelerated re-association of both primer extension products, which results in a reduced exposition of primer binding sites.
(317) By changing reaction conditions that suppress such a re-association the rate of the reaction can be favored. For example, the concentration of the second primer can be increased, which can lead to a competitive occupation of the second primer binding site. On the other hand, the temperature of the method can be increased with an increasing progress of the reaction.
(318) In an advantageous embodiment of the method both primers are employed substantially in equally high concentrations or in concentration ranges that are approximately equally high.
(319) In a further advantageous embodiment of the method at least one of both primers is employed in a higher concentration than its partner primer. Here, the differences in concentrations may be in ranges that are between 1:2 to 1:50, advantageously between 1:2 to 1:10.
(320) This can result in an asymmetric amplification reaction in which the concentration of a primer extension product is accordingly higher than that of the other strand.
(321) The examples cited below are to be stated only to demonstrate the method and are not to be interpreted as being limiting.
(322) The structures, sequences, and reaction conditions given in the examples are only to represent and illustrate the mode of function of the method and do not function as a limitation.
EXAMPLES
(323) Material and Methods:
(324) Reagents were commercially purchased from the following suppliers: unmodified and modified oligonucleotides (Eurofins MWG, Eurogentec, Biomers, Trilink Technologies, IBA Solutions for Life Sciences) polymerases NEB (New England Biolabs) dNTPs: Jena Bioscience intercalating Eva green dye: Jena Bioscience buffer substances and other chemicals: Sigma-Aldrich plastic goods: Sarstedt
(325) Solution 1 (buffer solution 1): potassium glutamate, 50 mmol/l, pH 8.0 magnesium acetate, 10 mmol/l Triton X-100, 0.1% (v/v) EDTA, 0.1 mmol/l TPAC (tetrapropylammonium chloride), 50 mmol/l, pH 8.0 Eva green dye (the dye was employed in accordance with the manufacturer's instructions in dilution of 1:50).
(326) Solution 2 (amplification reaction solution 2) (standard reaction): potassium glutamate, 50 mmol/l, pH 8.0 magnesium acetate, 10 mmol/l dNTP (dATP, dCTP, dTTP, dGTP), 200 μmol/l each polymerase (Bst 2.0 WarmStart, 120,000 U/ml NEB), 12 units/10 μl Triton X-100, 0.1% (v/v) EDTA, 0.1 mmol/l TPAC (tetrapropylammonium chloride), 50 mmol/l, pH 8.0 Eva green dye (the dye was employed in accordance with the manufacturer's instructions in dilution of 1:50) primer 1: 10 μmol/l primer 2: 10 μmol/l activator oligonucleotide: 10 μmol/l template strand—variable concentrations such as indicated in the examples.
(327) All concentrations are indications of the final concentrations in the reaction. Deviations from the standard reaction are indicated accordingly.
(328) The melting temperature (Tm) of the participating components was determined upon concentration of 1 μmol/l of the respective components in solution 1. Deviating parameters are indicated respectively.
(329) General Information on Reactions
(330) Primer extension reactions and amplification were performed at a reaction temperature of 65° C. in a standard manner. Deviations are indicated.
(331) The reaction was started by heating the reaction solutions to the reaction temperature since Bst 2.0 polymerase Warmstart at lower temperatures is mainly inhibited in its function by a temperature-sensitive oligonucleotide (according to the manufacturer's specifications). The polymerase becomes increasingly more active from a temperature of ca. 45° C., at a temperature of 65° C. no differences between polymerase Bst 2.0 and Bst 2.0 Warmstart could be observed. In order to prevent the extensive formation of by-products (e.g., primer dimer) during the preparation phase of a reaction polymerase Bst 2.0 Warmstart was used. Deviations are specifically indicated.
(332) The reaction was stopped by heating the reaction solution to above 80° C., e.g., 10 min at 95° C. At this temperature polymerase Bst 2.0 is irreversibly denaturized and the result of synthesis reaction cannot be changed later.
(333) The reactions were carried out in a thermostat having a fluorimeter. For that, a commercial Real-Time PCR apparatus was used, StepOne Plus (Applied Biosystems, Thermofischer). The reaction volume by default was 10 μl. Deviations are indicated.
(334) Both end-point detection and kinetic observations have been made. In end-point detections the signal was recorded for example by a nucleic acid-bound dye, e.g., by TMR (tetramethyl rhodamine, also referred to as TAMRA) or by FAM (fluorescein). The wavelengths for exciting and measuring the fluorescence signals of FAM and TMR are stored as the factory settings in the StepOne Plus Real-Time PCR apparatus. Also, an intercalating dye (Eva green) was used in end-point measurements, e.g., in measuring the melting curve). Eva green is an intercalating dye and an analogue of the frequently employed SYBR green dye, however, with a slightly less inhibition of polymerases. The wavelengths for exciting and measuring the fluorescence signals of SYBR green and Eva green are identical and stored as the factory settings in the StepOne Plus Real-Time PCR apparatus. Fluorescence can continuously be detected by means of built-in detectors, i.e. “online” or “real-time”. Since the polymerase during its synthesis synthesizes a double strand this technique could be used for kinetic measurements (real-time monitoring) of the reaction. Due to a certain cross-talk between color channels in the StepOne Plus apparatus a partially increased basal signal intensity was observed in measurements in which e.g., TMR-labeled primers were used in concentrations of more than 1 μmol/l (e.g., 10 μmol/l). It was observed that the TMR signal in the SYBR green channel leads to increased basic values. These increased basic values were taken into account in calculations.
(335) The kinetic observations of courses of reactions were routinely recorded by means of fluorescence signals of fluorescein (FAM-TAMRA Fret pair) or intercalating dyes (Eva green). Time-dependence of the signal course was detected (real-time signal detection in the StepOne plus PCR apparatus). An increase of the signal during a reaction compared to a control reaction was interpreted depending on the structure of the batch. For example, an increase in the signal using EVA green dye was interpreted as an indication of an increase in the amount of double-stranded nucleic acid chains during the reaction, and thus, judged to be the result of a synthesis by DNA polymerase.
(336) In some reactions a melting curve determination was performed following the reaction. Such measurements allow to draw conclusions about the presence of double strands that for example can absorb intercalating dyes and this way significantly enhance signal intensity of dyes. With the rising temperature the proportion of double strands decreases and also the signal intensity decreases. The signal depends on the length of the nucleic acid chains and on the sequence composition. Said technique is well known to the skilled person.
(337) When using melting curve analysis in context with reactions that contained significant proportions of modified nucleic acid chains (e.g., activator oligonucleotides or primers) it was found that the signal of the Eva green dye can behave different for example between the B form of the DNA and the A form of modified nucleic acid chains. For example, in the B form of the double-stranded nucleic acid chains (usually taken on for classical DNA sections) a higher signal intensity was observed than with double-stranded nucleic acid chains having the same sequence of nucleobases that can take on an A-form-like conformation (e.g., by several 2′-O-Me modifications of nucleotides). This observation was taken into account when intercalating dyes were employed.
(338) As needed, the reaction was analyzed by means of capillary electrophoresis and the length of fragments formed was compared to a standard. In preparation for the capillary electrophoresis the reaction mixture was diluted in a buffer (Tris-HCl, 20 mmol/l, pH 8.0, and EDTA, 20 mmol/l, pH 8.0) such that the concentration of labeled nucleic acids was ca. 20 nmol/l. Capillary electrophoresis was performed at GATC-Biotech (Konstanz, Germany) as contractual service. In accordance with the specifications of the supplier the capillary electrophoresis was performed on an ABI 3730 Cappilary Sequencer under standard conditions for Sanger sequencing using a POP7 gel matrix at ca. 50° C. and a constant voltage (ca. 10 kV). The conditions used resulted in the denaturation of double strands, so that in the capillary electrophoresis the single-stranded form of nucleic acid chains was separated. Electrophoresis is a standard technique in the genetic analysis. The automated capillary electrophoresis is employed routinely in Sanger sequencing to this day. The fluorescence signal is continuously recorded during the capillary electrophoresis (usually using virtual filters), so that an electrophoretogram is generated in which the signal intensity correlates to the duration of the electrophoresis. With shorter fragments, e.g., unused primers, there is observed an early signal peak, with extended fragments there is a temporal shift of the signals proportional to the length of the extended regions. Thanks to controls with known lengths the length of extended fragments can be measured. Said technique is known to a skilled person and is also employed by default in fragment length polymorphism.
Example 1
(339) Nucleic Acid-Dependent Strand Displacement Under Isothermal Conditions
(340) The example demonstrates the basic ability of single-stranded complementary nucleic acid chains of a nucleic acid-dependent, mainly sequence-specific strand displacement in the absence of strand-separating proteins or enzymes (e.g., helicases or recombinases) and without consuming chemically stored energy in the form of ATP. It is demonstrated that a double strand (formed of strands here referred to as A1 and B1, so that a A1:B1 double strand results) that is stable under reaction conditions can be opened by single-stranded nucleic acid chain (here referred to as C1 oligonucleotide) that is substantially complementary to certain segments of strand A1. As a result of this double strand opening strand B1 is converted to the single-stranded form, at the same time a new A1:C1 double strand is formed. The sequence of the C1 nucleic acid chains used in this example was constructed such that a nucleic acid chain-mediated sequence-specific strand displacement reaction can take place on a double-stranded DNA fragment under isothermal conditions. In this example no polymerase was added to the reaction, thus, no new nucleic acid strands were synthesized and no amplification of nucleic acid chains took place.
(341) To detect strand displacement and separation of a pre-formed double strand both strands to be separated were labeled with fluorophores, so that a FRET pair (consisting of fluorescein and TAMRA) was formed. The fluorophores were positioned at an end of the A1:B1 double strand, i.e. at complementary ends of both strands. The nucleic acid strands used here were chemically synthesized, the fluorophores were chemically coupled to the corresponding strand ends during the chemical synthesis. The distance between fluorophores, when both strands are complementary to each other, were selected such that an effective quenching of the fluorescein fluorescence by a TAMRA dye can take place. If the strands are separated by any effect, e.g., by temperature or strand displacement, the distance between individual fluorophores is increased, so that the intensity of the fluorescence signal of the fluorescein marker is increased. The maximum intensity of the fluorescein marker is achieved if both strands (A1 and B1) are completely separated. By observing the intensity of the fluorescence and its dependence on the action of various parameters (e.g., temperature, addition of complementary or non-complementary sequences for strand displacement etc.) it is possible to draw conclusions as to the amount of the labeled strands still bound to each other.
(342) In example 1 the principle of the nucleic acid-dependent sequence-specific strand displacement reaction is illustrated. Both kinetics of the strand displacement reaction and temperature-dependence of the opening of the pre-formed double strand (A1:B1) were observed by recording the fluorescence signal during the course of the reaction. Both isothermal reaction conditions and conditions with a temperature gradient were tested.
(343) Preparation of the Starting Material:
(344) For the individual sequences also the laboratory's internal designations were indicated in addition to the sequence and SEQ ID NO.
(345) Double Strand (A1:B1)
(346) The sequences for double strand A1:B1 are artificial sequences that were randomly selected, wherein attention was paid to the absence of extensive hairpins and long G segments or C segments, respectively. Both strands are able to form a complementary double strand. A double strand has a Tm of ca. 75° C. (a further double strand has a Tm of ca. 77° C. s.b.) that is higher than the reaction temperature of 65° C. Thus, such a double strand is stable under reaction conditions. Strand A1 is longer than the respective strand B1, so that a 5′ overhang is generated. Said 5′ overhang on the A1 strand was designed in analogy to the polynucleotide tail of a first primer extension product. However, to facilitate the synthesis said 5′ overhang did not contain modifications that block polymerase activity. Since in the present example no polymerase was present in the reaction absence/presence of such modifications played a subordinate role. Said 5′ overhang is complementary to the first region of the single-stranded nucleic acid chain (C1), so that a specific binding of the C1 nucleic acid chain to said overhang can take place under reaction conditions. Thanks to said binding a sufficient spatial proximity between one end of the A1:B1 double strand and corresponding complementary segments of the single-stranded C1 nucleic acid chains is caused, so that a strand displacement reaction can take place. As the result of this reaction a new double strand A1:C1 can be generated and the B1 strand can be converted to its single-stranded form.
(347) TABLE-US-00001 ES-10-3504 A1 strand TMR SEQ ID NO: 1 5′ CCGAAGCTCGCAGGAACTCAGAGTGTGGAGAGGACGATAGCTA GTCAGATGATGAAGTT 3′ The sequence consists of DNA. A 3′-terminal TAMRA modification (terminal TMR modification) was already attached during the synthesis. T-A6P-10-3506 B1 strand 5′ FAM SEQ ID NO: 2 5′ CATCATCTGACTAGCTATCGTCCTCTCCACACTCTGAGTTCCT GCGAG 3′ T-A6P-10-307 B1 strand 5′ FAM SEQ ID NO: 3 5′ CATCATCTGACTAGCTATCGTCCTCTCCACACTCTGAG TTCCTGC 3′
(348) Both strands consist of DNA. A 5′-terminal fluorescein dye modification (terminal FAM modification) was selected as the reporter and was already attached to the respective strand during the synthesis with conventional methods of the oligonucleotide chemistry.
(349) Two variants of the double strand were generated. Variant 1 contains a double strand with a shorter overhang in the 5′ segment of the A1 strand (6 nucleotides), said double strand consists of SEQ ID NO: 1 and SEQ ID NO: 2), variant 2 contains a double strand with a longer overhang in the 5′ segment of the A1 strand (9 nucleotides), said double strand consists of SEQ ID NO: 1 and SEQ ID NO: 3), the respective complementary segments are underlined. Overhangs on the 3′ segment of the A1 strand were designed for synthetic reasons and in this example play a subordinate role.
(350) TABLE-US-00002 A1:B1 double strand (variant 1) TMR SEQ ID NO: 1 3′ ttGAAGTAGTAGACTGATCGATAGCAGGAGAGGTGTGAGAC TCAAGGACGCTCGAAGCC FAM SEQ ID NO: 2 5′ CATCATCTGACTAGCTATCGTCCTCTCCACACTCTGAGTTC CTGCGAG A1:B1 double strand (variant 2) TMR SEQ ID NO: 1 3′ ttGAAGTAGTAGACTGATCGATAGCAGGAGAGGTGTGAGAC TCAAGGACGCTCGAAGCC FAM SEQ ID NO: 3 5′ CATCATCTGACTAGCTATCGTCCTCTCCACACTCTGAGTTC CTGC
(351) Single-Stranded Nucleic Acid Chains (C1 Oligonucleotides):
(352) A single-stranded nucleic acid chain (in this example referred to as C1 oligonucleotide) under certain conditions can lead to a strand displacement reaction on strand A1:B1 with the simultaneous formation of a new double strand with A1 (A1:C1 double strand). Here, strand B1 is at least partially converted to its single-stranded form. In extreme cases, a strand displacement can lead to a complete dissociation of A1:B1, so that the B1 strand is completely separated from the A1 strand.
(353) C1 oligonucleotides and the activator oligonucleotides have a similar function: they mediate nucleic acid-dependent strand displacement on the respective double strand. The designation C1 oligonucleotide is used in the present example. Because of the absence of the polymerase in said example certainly also C1 oligonucleotides can comprise polymerase-blocking nucleotide modifications, however, presence of said modifications is not a prerequisite to demonstrate strand displacement (s.b.). The designation activator oligonucleotide is used in examples in which the reaction mixture comprises a polymerase and which demonstrate an exponential amplification. Unlike C1 oligonucleotides activator oligonucleotides have to include polymerase-blocking nucleotide modifications.
(354) Due to the similar function of C1 oligonucleotides and the activator oligonucleotides the sequence composition of C1 oligonucleotides is designed similar to the structure of activator oligonucleotides. The C1 oligonucleotides have to comprise the segments complementary to the A1 strand in order that strand displacement can run. C1 oligonucleotides have a single-stranded first, second, and third region (see, structure of activator oligonucleotides). With the first region C1 oligonucleotides can bind to the single-stranded 5′ overhang of the A1 strand, regions two and three bind the inner segments of the A1 strand, like with the binding of an activator oligonucleotide and a first primer extension product.
(355) In this example also the ability of activator oligonucleotide structures for an effective strand displacement is to be demonstrated. For this reason some C1 nucleic acid chains have been designed identically to activator oligonucleotides (e.g., SEQ ID NO: 4, 5, 6, and 7). Other C1 nucleic acid chains (SEQ ID NO: 8, 9, and 10) have only been used in this example for demonstration purposes of the strand displacement, they consist of DNA and do not contain internal modifications that can block polymerase activity. Since in the present example no polymerase was present in the reaction absence/presence of such modifications in this example played a subordinate role. The structures of the respective single-stranded nucleic acid chains (C1 oligonucleotides) are summarized below:
(356) C1 Oligonucleotides (Group 1, Oligonucleotides Having the Structure of Activator Oligonucleotides):
(357) The following four C1 oligonucleotides can optionally be present as activator oligonucleotides.
(358) TABLE-US-00003 Numbering from 5′ to 3′ A6 8504-001 SEQ ID NO: 4 5′-[CGUCCUCUCCACACUCUGAGUUCCUG]CGAGCTTCGGTAC AAG-3′ A6 8504-002 SEQ ID NO: 5 5′-[AAAACAAACUAGCUAUCGUCCUCUCCACACUCUGAGUUCC UG]CGAGCTTCGGTACAAG-3′ A6 8507 SEQ ID NO: 6 5′-CTAGCTATCGTCCTCTCCACA[CUCUGAGUUCCUG]CGAGC TTCGGTACAAG-3′ A26-1000-103 (negative control) SEQ ID NO: 7 5′-[AUUCAAAUGUGUUCUCAACGUCCUCUACUCAUGUUCCUG] CGAGCTTCGGTACAAAA-3′
(359) Numbering from 5′ to 3′
(360) The sequence with SEQ ID NO 4, 5, 6, and 7 have been constructed as activator oligonucleotides. They comprise 2′-O-Me nucleotide modifications (indicated in [ ] brackets) and DNA nucleotide (in the 3′ segment and optionally in the 5′ segment), the 3′-OH group of the 3′-terminal nucleotide was blocked by a phosphate residue. Oligonucleotides were chemically synthesized by a commercial supplier. The underlined segment of the sequence can complementary bind to the A1 strand. The nucleic acids with SEQ ID NO 4, 5, and 6 in their regions one, two, and three are complementary to the sequence of strand A1 (complementary sequences of the second region merge into the complementary sequences of the third region). Such a continuous alignment of complementary nucleobases is to support a strand displacement.
(361) The nucleic acid with SEQ ID NO 7 is complementary in regions one and two (from positions 33 to 49), but it contains a sequence that is non-complementary to A1 (positions 1-18 and 27-32). Part of this non-complementary sequence is directly placed on the 5′ segment of the second region in order to prevent progress of the strand displacement beyond this region. The nucleic acid chain functions as a negative control.
(362) C1-Oligonucleotides (Group 2, No Activator Oligonucleotides):
(363) The following three oligonucleotides were also employed in the strand displacement reaction.
(364) TABLE-US-00004 Numbering from 5′ to 3′ A6 8510 SEQ ID NO: 8 5′-TTTTTCTAGCTATCGTCCTCTCCACACTCTGAGTTCCTGCG AGCTTCGGTACAAG 3′ A6 8512 SEQ ID NO: 9 5′ TTTTTCTAGCTATCGTCATCTCCACACTCTGAGTTACTGCG AGCTTCGGTACAAG 3′ A6 8514-1 SEQ ID NO: 10 5′ TTTTTCTAGCTATCGTCCTCTCCACA CTGAGTTCCTGCGA GCTTCGGTACAAG 3′
(365) Numbering from 5′ to 3′
(366) The sequence with SEQ ID NO 8-10 has been construed in its nucleobase composition similar to the above-mentioned activator oligonucleotides. However, no groups leading to polymerase blockage have been inserted at the respective sites in the inner segment of the oligonucleotides: there are no modifications of the sugar phosphate backbone (polymerase-blocking modifications) in the inner region of the sequence as well as a 3′-blocking group. Said C1 oligonucleotides completely consist of DNA nucleotides. Oligonucleotides were chemically synthesized by a commercial supplier. The underlined segment of the sequence can complementary bind to the A1 strand. Here, SEQ ID NO 8 contains a throughout complementary segment. This segment corresponds to a first, second, and third region in an activator oligonucleotide. The nucleic acids with SEQ ID NO 9 and 10 each comprise two sequence divergences of throughout complementary sequences to A1 strand. SEQ ID NO 9 in positions 18 and 36 each contains an A nucleotide instead of its C nucleotide. Nucleotides in these positions do not represent a complementary nucleobase to the respective positions in strand A1. Nucleic acid chain with SEQ ID NO 10 has a divergence in complementarity in the form of a deletion: between positions 26 and 27 2 nucleotides are lacking (CT). This divergence leads to a disruption of a complementary row with the formation of an A1:C1 double strand.
(367) First Primer Oligonucleotide (Primer 1).
(368) The first primer oligonucleotide was employed in the reaction to initiate a temperature-dependent start of the strand displacement.
(369) TABLE-US-00005 A6P-10-1001 Numbering from 5′ to 3′ SEQ ID NO: 11 5′-GTA[CCGAAGC]T*[CG]CAGGAAC-3′
(370) The first primer oligonucleotide comprises 2′-O-Me nucleotide modifications (indicated in [ ] brackets) and DNA nucleotide (in the 3′ segment and optionally in the 5′ segment), the 3′-OH group of the 3′-terminal nucleotide is free. The oligonucleotide in its position 11 has a dT nucleotide modified with a TAMRA dye (shown as T.sup.+ in the sequence). The oligonucleotide was chemically synthesized by a commercial supplier. The primer with its sequence can complementary bind to C1 oligonucleotides. Thanks to this binding between primer 1 and the C1 oligonucleotide certain sequence segments of the respective C1 oligonucleotide are double-stranded during the assembling of the reaction mixture (performed under room temperature) and cannot interact with the single-stranded overhang of the A1 strand.
(371) Preparation of a Complementary Double Strand (A1 and B1)
(372) Both complementary strands of nucleic acids (A1 and B1) were combined in concentrations of 1 μmol/l each in the buffer solution 1 (without Eva green dye), short-term heated and left at room temperature for cooling, so that a double strand (A1:B1) can be formed over the complementary region. This results in two variants of double strands:
(373) Variant 1 contains sequences with SEQ ID NO: 1 and SEQ ID NO: 2
(374) Variant 2 contains sequences with SEQ ID NO: 1 and SEQ ID NO: 3
(375) Preparation of single-stranded nucleic acid chain (C1), (without primer 1 complex) The respective single-stranded nucleic acid chain (C1) was presented in buffer solution 1 (without Eva green dye) in a concentration of 10 μmol/l.
(376) Preparation of C1:Primer 1 Complexes of Single-Stranded Nucleic Acid Chain (C1) and Primer 1
(377) In order to reversibly block the first and second regions of the single-stranded nucleic acid chain (C1) primer 1 was added to the respective C1 oligonucleotide in equimolar concentration, so that a partially double-stranded C1:primer 1 complex could be formed. Primer 1 specifically binds to the first and second regions of the C1 oligonucleotide and thus, blocks a sequence segment that can interact with the overhang of the A1 strand during the preparation phase of the reaction mixture (under room temperature). Said complex is stable at room temperature and can only dissociate to its component parts under reaction conditions, so that the first and second regions of the C1 oligonucleotide become single-stranded and thus, can interact with corresponding structures of the double strand (A1:B1). The complexes of C1 oligonucleotide and primer 1 were also presented in buffer solution 1 (without Eva green dye) in a concentration of 10 μmol/l.
(378) Preparation of the Reaction Mixture, Start of the Reaction and Reaction Conditions
(379) The reaction mixture was prepared by combining equal volumes (5 μl each) of a solution with a double strand (A1:B1) and a solution with a C1 oligonucleotide or C1 primer 1 complex to be tested at room temperature. In the resulting reaction mixture the individual strands are present in the following concentrations:
(380) double strand A1:B1 in a concentration of 0.5 μmol/l
(381) single strand (C1) or complex C1-primer 1 in a concentration of 5 μmol/l
(382) single strand 81 (as FAM signal control) in a concentration of 0.5 μmol/l.
(383) Observation of the Course of the Strand Displacement Under Isothermal Conditions of 65° C.
(384) The thus prepared reaction mixture was transferred to an appropriate reaction vessel (microwell plate) in a thermostat with a fluorescence detection function. As the thermostat a real-time PCR apparatus (“StepOne Plus”, StepOne Software v2.1 ABI, Themorfischer) was used. The reaction mixture was pre-heated to a temperature of first 50° C. for ca. 50 sec (cycles 1 to 5) and subsequently heated to 65° C. This temperature was maintained for ca. 10 min (cycles 6 to 30 were recorded), so that a strand displacement reaction could proceed under isothermal conditions and be observed. The fluorescence signal of FAM was recorded depending on time (real-time function of the apparatus). Thanks to the use of the real-time PCR apparatus a software program with the appropriate FAM filter adjustments supplied by the manufacturer could be used. The minimum time interval between two measurements intended by the manufacturer was 10 sec (minimum adjustable time interval), which in total resulted in an apparatus-related measuring cycle of ca. 15 to 18 sec. The course of the FAM signal was recorded with this maximum recording rate.
(385) Observation of the Separation of A1 and B1 During a Thermal Gradient (50° C.-95° C.) in the Presence/Absence of C1 Oligonucleotides.
(386) In a further experiment, the reaction mixture was continuously heated from 50° C. to 95° C. (temperature gradient). During this heating phase also the FAM signal was detected, wherein a FAM signal measurement was made every 0.5° C. of rise in temperature. This resulted in a thermo profile of the reaction mixture in which the signal intensity of the FAM report was recorded depending on the temperature. Also this experiment was performed by means of the real-time PCR apparatus (StepOne Plus), wherein the program was used for the melting curve determination (pre-installed by the supplier, software version StepOne v2.1).
(387) Both experiments were evaluated for the respective reaction mixture and the results are represented in the following. The composition of individual reactions is indicated in the appropriate places.
(388) Result:
(389) 1. Test of the Detection System:
(390) The functionality of the FRET pair of FAM and TAMRA was examined in two control batches. The first control batch contained only a B1 strand labeled with a FAM dye (
(391) Arrows 1 and 2 also in the following
(392) 2. Strand Displacement by a Single-Stranded Complementary Oligonucleotide
(393) In case of a throughout complementary composition of the sequences of the C1 oligonucleotides and A1 strands (e.g., reaction between A1:B1 variant 2 and C1 oligonucleotide SEQ ID NO 5 A6 8504) strand displacement of the B1 strand sometimes was so fast that a significant part of the B1 strands was present in the single-stranded form already during the preparation of the reaction mixture or even before the start of the recording. This can be seen from the increased signal intensity in
(394) Replacement of the C1 oligonucleotide by another throughout complementary C1 oligonucleotide (e.g., SEQ ID NO 4, 6, or 8) basically shows a similar behavior. The high intensity of the fluorescence signal of the FAM reporter already at the beginning of the measurement indicates the presence of the B1 strand in the single-stranded form even before the first measurement. This behavior of the respective C1 oligonucleotides shows that the optionally present differences in the composition of the sugar phosphate backbone (DNA vs. 2′-O-methyl modifications) in the present example caused only insignificant differences as a result of the strand displacement by single C1 oligonucleotides. Both oligonucleotides with longer 2′-O-Me segments and oligonucleotides that completely consist of DNA lead to the same result. The continuous order of complementary bases especially in regions two and three of the C1 oligonucleotides provides for a strand displacement with high yields.
(395) The use of the C1 strand with SEQ ID NO: 4 (8504 short) with a continuous complementary composition of individual regions, however with a shorter complementary third region, led to the result illustrated in
(396) Shortening the C1 sequence at its 5′ end (corresponds to the third region of an activator oligonucleotide) (SEQ ID NO: 4) resulted in the fact that a longer sequence part in the 3′ segment of the A1 strand is not complementary bound by the C1 oligonucleotide, so that this 3′-standing segment of the A1 strand can remain in contact with the 5′ segment of the B1 strand (positions 1 to 18 of the 5′ segment of the B1 strand). This double-stranded fragment is sufficiently stable at 50° C., so that the A1:B1 double strand on its labeled end sufficiently keeps contact also at 50° C. and the signal of FAM at this temperature is sufficiently quenched (arrow 3, cycles 1 to 5,
(397) 3. Strand Displacement by a Single-Stranded Oligonucleotide with Divergences in the Sequence Composition
(398) Testing the influence of sequence divergences was performed with C1 oligonucleotides that in their composition of the nucleobases comprised two or more non-complementary bases that were in the second or third region of the C1 oligonucleotide. This diverging base composition of C1 resulted in the fact that no continuous complementary order of base pairings would be generated in a double strand, to be expected, of A1 and C1.
(399) In
(400) A further increase in the number of deviations in the nucleobase composition resulted in a complete cancelation of the strand displacement. The C1 oligonucleotide with SEQ ID NO: 7 comprises a continuously complementary nucleobase sequence in the first and second region, however has significant divergences in the third region of its sequence. These sequence divergences are partially in the 3′ segment of the third region of the C1 oligonucleotide (positions 26-32) and thus, are directly located on the second region. The addition of such a C1 oligonucleotide to the presented A1:B1 double strand did not result in a measurable change in the fluorescence of the FAM reporter below 65° C.; the signal has remained on the level of the intact A1:B1 double strand. That is, that even though the C1 oligonucleotide was able to complementary bind to the A1 strand with its first and second regions (these regions comprise complementary sequences between the C1 and A1 strands) the divergence of the sequence composition in the third region resulted in a complete cancelation of a successful strand displacement under given reaction conditions, the A1:B1 double strand has mainly remained intact. This is seen in context with the stability of the remaining A1:B1 double strand. In case of a complementary binding of the first and second regions of the C1 oligonucleotide to the A1 strand the A1 strand and the B1 strand remain complementary bound to each other via a significantly long segment. Under given conditions this stability of this remaining, not displaced double-stranded segment (A1:B1) is sufficiently high to hold both strands together and to prevent a measurable separation of the B1 from A1. The equilibrium of the reaction in this case is completely on the side of the A1:B1 double strand, no measurable separation of these strands occurs.
(401) 4. Kinetics of the Strand Displacement
(402) For the measurement of the kinetics of the strand displacement C1:primer 1 complexes and prepared A1:B1 double strands were used. The advantage with the use of C1-primer 1 complexes is that primer 1 could already bound to complementary regions of the C1 oligonucleotide in advance, which resulted in a double strand that is stable at room temperature. Thanks to this reaction arrangement a strand displacement could not be started until primer 1 has been separated from C1 strands under reaction conditions, e.g., when raising the reaction temperature to 65° C. (corresponds about the Tm of primer 1 (Tm plus/minus 5° C.). By releasing the complementary regions in the C1 oligonucleotide this could now interact with the A1:B1 double strand under reaction conditions and optionally result in strand displacement.
(403) In order to demonstrate the kinetics of the sequence-dependent strand displacement variant 1 of the A1:B1 strand was contacted with the C1-primer 1 complex (consisting of SEQ ID NO 5 and 11) and first heated to 50° C. (cycles 1-5) and then to 65° C. (cycle 6 and further), as illustrated above. The course of the signal from the FAM reporter is seen in
(404) The difference between variants 1 and 2 of the A1:B1 double strand first of all is in the length of the 5′ overhang of the A1 strand with which the A1 strand comes in initial contact with the C1 oligonucleotide. The B1 strand of variant 1 is longer than in variant 2, the thus resulting difference results in a 5′ overhang in variant 1 of 6 nucleotides in length and a 5′ overhang in variant 2 of 9 nucleotides in length. By the complementary compositions of respective segments in the C1 oligonucleotide it is to be assumed that the binding to the 9-nucleotide overhang is somewhat more stable than the binding to a 6-nucleotide overhang.
(405) A comparison of the kinetics of the increase in fluorescence between variant 1 and variant 2 of the A1:B1 double strand resulted in the conclusion that the length of the 5′ overhang on the A1 strand and thus, also stability of an intermediate complex, that is formed during the reaction and consists of an A1 overhang and a C1 oligonucleotide, may be relevant: the more stable this complex of an A1 overhang and a C1 oligonucleotide, the more effective or faster strand displacement can take place with otherwise the same parameters. This intermediate complex of an A1 overhang and the first region of the C1 oligonucleotide brings the C1 oligonucleotide in sufficient spatial proximity to the corresponding duplex end of the A1:B1 oligonucleotide, so that a strand displacement can take place. In the present batch a complex binding between the C1 oligonucleotide and the 5′ overhang of the A1 strand results in an approximately identical spatial proximity of the complexed C1 oligonucleotide to the duplex end of the A1:B1 double strand both with variant 1 and variant 2. However, the differences in the kinetics of the strand displacement show that a higher stability of the binding of the intermediate complex with the same spatial proximity can lead to an increase in efficacy of the process of strand displacement. The equilibrium can be shifted faster.
(406) In the following examples individual embodiments of an exponential amplification are illustrated. These examples are for illustration of the function of individual elements of the exponential amplification and are not to be understood as a limitation. The method is demonstrated using isothermal conditions.
(407) During an exponential amplification a polymerase-dependent nucleic acid synthesis simultaneously proceeds with the nucleic acid-dependent strand displacement. The reaction batches comprise polymerases and dNTPs as substrates. Instead of a C1 oligonucleotide activator oligonucleotides are used that comprise nucleotide modifications in their strands that lead to a local blockage of the polymerase activity, so that activator oligonucleotides do not act as a template during amplification. Two primers each are employed in one amplification: the first primer oligonucleotide and the second primer oligonucleotide. The first primer oligonucleotide comprises a polynucleotide tail that can specifically bind activator oligonucleotides and so bring about spatial proximity to the duplex end of a nucleic acid to be amplified, so that a strand displacement of the second primer extension product can take place. The second primer oligonucleotide can bind to the 3′ segment of the first primer extension product and thus, initiates the synthesis of the second primer extension product.
Example 2
(408) This example demonstrates an exponentially proceeding amplification of an artificial DNA fragment under isothermal conditions. Here, the re-synthesized strands function as templates for the later synthesis of the complementary partner strands. The synthesis takes place depending on the presence of a specific template. Multiplication of nucleic acids to be amplified is by approx. factor 10.sup.9 based on the initial amount of the template employed.
(409) Starting Material:
(410) Template:
(411) As part of a nucleic acid to be amplified a single-stranded DNA template was used. The sequence of template 001 (SEQ ID NO 12) was randomly selected and examined in view of avoiding too large elongation (more than 6 bases) that leads to a double strand formation within the same strand in order to prevent formation of so-called hairpins. This DNA sequence was artificially synthesized by a commercial supplier. The DNA sequence does not bear any nucleotide modifications. The 3′ end of the template strand is open and not blocked. This template is to function as an example of a single-stranded nucleic acid to be amplified.
(412) TABLE-US-00006 Template 001: T35-4401-601 (order of numbering: 1-48) (SEQ ID NO 12) 5′-ATACTACAATGTCACTTACGTCCTCTCCACACTCTGAGTTC CTGCGAG-3′
(413) (order of numbering: 1-48)
(414) The measured melting temperature of a DNA double strand that includes template 001 as a strand is 77° C. (Tm measured in solution 1).
(415) Primer 1 (First Primer Oligonucleotide)
(416) TABLE-US-00007 Primer 001-01: A6P-10-1001 numbering from 5′ to 3′ SEQ ID NO: 13 5′-GTA[CCGAAGC]T*[CG]CAGGAAC-3′
(417) The first primer oligonucleotide comprises 2′-O-Me nucleotide modifications (indicated in [ ] brackets) and DNA nucleotides (in the 3′ segment and optionally in the 5′ segment), the 3′-OH group of the 3-terminal nucleotide is free. The oligonucleotide in its position 11 has a dT nucleotide modified with TAMRA dye (shown as T.sup.+ in the sequence).
(418) Primer 2 (Second Primer Oligonucleotide)
(419) TABLE-US-00008 Primer 001-02: PA6-35-4401-608 (order of numbering: 1-27) (SEQ ID NO 14) 5′-AAAAAAAC ATACTACAATGTCACTTAC-3′
(420) This primer is needed to initiate the synthesis of the 2.sup.nd strand. The nucleotides in positions 9-27 are identical to template 001.
(421) Activator Oligonucleotide 001-01
(422) TABLE-US-00009 Activator oligonucleotide 001-01: A6 8505 (order of numbering: 1-50) (SEQ ID NO 15) 5′-[CUAGCUAUCGUCCUCUCCACACUCUGA GUUCC]TGCGAG CTTCGGTACAAG X-3′
(423) The activator oligonucleotide comprises 2′-O-Me nucleotide modifications (indicated in [ ] brackets) and DNA nucleotides (in the 3′ segment). The 3′-OH group of the 3-terminal nucleotide was blocked by a phosphate residue (here designated with X). The oligonucleotide was chemically synthesized by a commercial supplier. The underlined segment of the sequence can complementary bind to the first primer extension product. This continuous alignment of complementary nucleobases is to support a strand displacement. The nucleotides and nucleotide modifications are linked to each other with phosphodiester binding.
(424) The activator oligonucleotide includes three regions:
(425) first region=positions 35-50
(426) second region=positions 28-34
(427) third region=positions 1-27
(428) These components were used as follows in the reaction mixture: template 001 2 μmol/l activator oligonucleotide 001-01: 10 μmol/l primer 001-01: 10 μmol/l primer 001-02: 10 μmol/l
(429) Further components of the reaction were used as amplification reaction solution 2: potassium glutamate, 50 mmol/l, pH 8.0 magnesium acetate, 10 mmol/l dNTP (dATP, dCTP, dTTP, dGTP), 200 μmol/each polymerase (Bst 2.0 WarmStart, 120,000 U/ml NEB), 12 units/10 μl Triton X-100, 0.1% (v/v) EDTA, 0.1 mmol/l TPAC (tetrapropylammonium chloride), 50 mmol/l, pH 8.0 Eva green dye (the dye was employed in accordance with the specifications of the manufacturer in dilution 1:50).
(430) Start of the Reaction and Reaction Conditions
(431) The preparation of the reaction mixture took place at room temperature. The template was added to the reaction batch as the last component. A control batch contained no template.
(432) The thus prepared reaction mixtures were transferred in one suitable reaction vessel each (microwell plate) in a thermostat having a fluorescence detection function. As the thermostat a real-time PCR apparatus (“StepOne Plus”, StepOne Software v2.1 ABI, Themorfisher) was used. The reaction was started by heating the reaction mixture to 65° C.
(433) The reaction temperature was held constant throughout the amplification (40 min) at 65° C. (isothermal amplification). Subsequently, the reaction was heated to 95° C. for 10 min. During the reaction the intensity of the fluorescence signal of Eva green dye was recorded. The measuring intervals between adjacent measurements were one minute each.
(434) Evaluation:
(435) The Primer Extension Products to be Expected:
(436) The first primer extension product 001-01 to be expected after the first primer extension on template 001: (SEQ ID NO 16)
(437) TABLE-US-00010 (order of numbering: 1-57) 5′-GTACCGAAGCTCGCAGGAACTCAGAGTGTGGAGAGGACGTA AGTGACATTGTAGTAT-3′
(438) Underlined regions are illustrated by 2′-O-Me modifications of the first primer oligonucleotide. Not underlined regions are 2′-deoxynucleotides (DNA).
(439) This first primer extension product can complementary bind the second primer oligonucleotide in the 3′ region and thus, itself function as a template for the synthesis of the second primer product.
(440) The synthesis of the second primer extension product is up to the modified region of the first primer oligonucleotide. Here, polymerase can be stopped either immediately before the modified region or only after some nucleotide modifications have been copied. The second primer extension product 001-02 (SEQ ID NO 17) to be expected using the first primer extension product as a template:
(441) TABLE-US-00011 (order of numbering: 1-56) 5′-AAAAAAACATACTACAATGTCACTTACGTCCTCTCCACACT CTGAGTTCCTGCGAG-3′
(442) Here, the four underlined 3′-standing nucleotides are indicated as an assumed maximum extension of the second primer extension product on the sequence of the first primer extension product. These nucleotides form complementary positions to some 2′-O-Me modified nucleotides of the first primer oligonucleotide. Polymerase can also synthesize shorter strands under reaction conditions, so that a mixture of primer extension products can result, since polymerase synthesis can be stopped already before the modified region of the first primer oligonucleotide or only after some modifications have been copied. Such primer extension products are accordingly shorter (they include for example positions 1 to 52 or 1 to 53 or 1 to 54 or 1 to 55). The exact position of the termination of the synthesis of the second primer extension product and thus, the exact length of the second primer extension product at its 3′ end at this point is of minor interest as long as all amplifiable second primer extension products are able to bind the first primer oligonucleotide and themselves appear as template for the synthesis of the first primer extension product. The polymerase-dependent copy of the second primer extension product leads to the generation of a further first primer extension product that also includes a complementary sequence to the 5′ segment of the second primer oligonucleotide.
(443) As a result of an exponential amplification two primer extension products are generated that can form a complementary double strand.
(444) The structure to be expected of the double strand that consists of both maximum extended primer extension products is illustrated in the following:
(445) TABLE-US-00012 (SEQ ID NO 18) 5′-GTACCGAAGCTCGCAGGAACTCAGAGTGTGGAGAGGACGTA AGTGACATTGTAGTATGTTTTTTT-3′ (SEQ ID NO 19) 3′-GAGCGTCCTTGAGTCTCACACCTCTCCTGCATTCACTGTAA CATCATACAAAAAAA-5′
(446) In the course of the exponential amplification there is an accumulation of these primer extension products that represent the main product of the exponential amplification. The thus amplified strands represent the nucleic acid to be amplified. They include the sequence of the template employed in the reaction. Underlined regions are illustrated by 2′-O-Me modifications. Not underlined regions are 2′-deoxynucleotides (DNA).
(447) The double strand generated during the reaction can bind Eva green dye, so that the signal intensity of the dye can increase with progressing reaction.
(448) The result of the course of the signal intensity is seen in
(449) In
(450) TABLE-US-00013 (SEQ ID NO 20) 5′-GTACCGAAGCTCGCAGGAACTCAGAGTGTGGAGAGGACGTA AGTGACATTGTAGTATGTTTTTTT-3′
(451) (the first extension product of the first primer oligonucleotide to be expected is underlined)
(452) The intensity of the signal in peak (2) shows that less than 50% of the initially employed primer 001-01 were extended in the reaction. The concentration of the generated product was estimated at about 1 μmol/l to 2 μmol/l, starting from the signal intensity of the consumed primer. Thus, the yield was ca. 10-20% as measured after primer 001-01 consumption.
(453) Thus, in the exponential amplification a template-induced multiplication of the sequence to be amplified occurs, wherein the initial concentration of template 001 corresponded to 2 μmol/l and the concentration of the product of the amplification reaction was estimated at ca. 1 to 2 μmol/l. Thus, the multiplication factor calculated therefrom is ca. 5×10[to 10]. The exponential amplification proceeded under isothermal conditions.
(454) The result of the exponential reaction depends on the presence of the template and activator oligonucleotide as well as primer 1, primer 2, polymerase, dNTPs and appropriate buffer conditions. Further, the reaction depends on the sequence composition of individual participating nucleic acid components: activator oligonucleotide and primer 1 and primer 2. In the following it is dealt with the structure-effect principle of these components.
(455) Explanations on the Design of Sequences
(456) Template:
(457) The sequence of the nucleic acid to be amplified serves as the starting point for the design of the sequences of primer 1, primer 2, and activator oligonucleotide. This nucleic acid to be amplified comprises a target sequence that has to be specifically amplified.
(458) The sequence length of the extension product of the first primer oligonucleotide to be expected is 45 nucleotides. The total length of the first primer extension product is 65 nucleotides. The length of the extension product to be expected is between 25 and 29 nucleotides. The total length of the second primer extension product is between 52 and 56 nucleotides (according to the position of the terminator of the polymerase during the synthesis of the second primer extension product). The length of the complementary double strand of the nucleic acid to be amplified consists of the first primer extension product and the second primer extension product, thus is between 52 and 56 nucleotides. The first primer extension product in its 5′ segment has a single-stranded region that corresponds to the polynucleotide tail of the first primer oligonucleotide.
(459) The sequence length of the nucleic acid to be amplified in the present example is sufficiently large, so that the melting temperature of the specific double strand formed during the reaction of the first and second primer extension products is ca. 78° C. and thus, is above the reaction temperature of 65° C. It is assumed that the double strand formed during the reaction is substantially stable and does not spontaneously dissociate to its single strands.
(460) Primer 1
(461) The first primer oligonucleotide includes a first primer region and a second region with a polynucleotide tail that is not copied by polymerase and is able to bind an activator oligonucleotide.
(462) First Primer Region:
(463) Positions 14-20 form the first primer region of the first primer oligonucleotide.
(464) These 3′-standing nucleotides of primer 001-01 (positions 14-20) are to specifically bind to the template and permit a primer extension reaction. Therefore, the sequence of these positions is adapted to template 001 (positions 38-44). These seven 3′-terminal nucleotides are DNA nucleotides and are linked by means of phosphodiester compounds. This segment initiates the primer extension by a polymerase in the synthesis of the first strand and functions as a template in the synthesis of the second strand by the polymerase, so that a strand complementary to this segment can be formed.
(465) Second Primer Region:
(466) The second region on the 5′ side is attached to the first primer region (positions 1-13). The structures in the second region inter alia are to hinder polymerase in the synthesis of the second strand from copying the polynucleotide tail. Moreover, these structures are to be able to bind activator oligonucleotide and support it in the strand displacement. For this reason mainly 2′-O-methyl nucleotide modifications were used (positions 4 to 10 and 12 to 13) that are linked to each other via a 5′-3′ phosphodiester binding. These 2′-O-methyl nucleotide modifications are examples of modifications that are able to hinder polymerase from copying the polynucleotide tail.
(467) The sequence of 5′-standing nucleotides of primer 001-01 (positions 1-9) is randomly selected, wherein care has been taken that this sequence has no extensive self-complementary segments, further no complementary binding sites in the template to be amplified as well as no multiple G nucleotides that stand in adjacent positions and thus, can form G quadruplexes. Positions 10 to 13 are complementary to template 001 and inter alia are to support binding of the first region to the template.
(468) The sequence (positions 1-9) functions as the polynucleotide tail and during the reaction is to be able to bind the activator oligonucleotide and thereby cause spatial proximity to the duplex end, so that strand displacement can take place. Positions 1 to 3 are illustrated by DNA nucleotides, positions 4 to 9 are 2′-O-Me nucleotide modifications. All nucleotides and nucleotide modifications are linked to each other via phosphodiester binding.
(469) The transition between the first primer region and the second region with the polynucleotide tail in this example is smooth: the second region is directly coupled to the first region via phosphodiester binding. This creates favorable requirements for the initiation of a strand displacement to a duplex end by an activator oligonucleotide. Both regions are aligned in the same direction: from 5′ to 3′. The second region with the polynucleotide tail is in the 5′ segment, the first primer region is in the 3′ segment.
(470) In the synthesis of the second complementary strand the polymerase from position 13 of the first primer oligonucleotide is confronted with 2′-O-methyl nucleotide modifications that block or complicate further synthesis. Certainly, a single 2′-O-Me nucleotide modification (if inserted into the template strand) does not necessarily lead to the complete blockage of the polymerase synthesis, so the further synthesis is complicated or decelerated, respectively. Thanks to the sequential coupling of several nucleotide modifications polymerase is successfully inhibited in its synthesizability and is not able to copy the remaining polynucleotide tail. It is of secondary importance whether the complete inhibition of the polymerase in the region of the second region of the primer oligonucleotide already appears after a single 2′-O-methyl nucleotide modification has been copied or only after several 2′-O-methyl nucleotide modifications have been copied as long as sufficient uncopied nucleotides or nucleotide modifications remain in the second region (polynucleotide tail) and can bind to the activator oligonucleotide under reaction conditions to initiate a successful strand displacement.
(471) For reasons of illustration and not as a limitation it is hereby noted that the polymerase can copy up to and including position 10 of the first primer oligonucleotide. That is, that the segment of the second region adjoining the first primer region is partially copied by the polymerase. Hence, in the diagram four nucleotide positions of the second region are considered to be copied by the polymerase. The residual nucleotide positions of the second region remain uncopied and permit a specific binding of the activator oligonucleotide.
(472) Primer 2:
(473) Primer 2 is necessary for the initiation of the synthesis of the second strand. The nucleotides in positions 9-27 are identical to template 001. Said positions are to complementary bind to the 3′ segment of the first primer extension product at the beginning of the amplification and thus, initiate the synthesis of the second strand. Primer 2 consists of DNA nucleotides that are linked to each other via conventional 5′-3′-phosphodiester bindings. The 5′ segment of the second primer in this example first forms an overhang (position 1 to 8), which however can be copied by polymerase. In the course of the reaction the nucleic acid chain to be amplified is extended by the 5′ overhang of the second primer.
(474) Primer 2 uses the first primer extension product as a template, so that copyable portions of the first primer extension product are copied by the polymerase. Thereby, the second primer is extended and a double strand is formed in the copyable segment of the first primer extension product. However, the polynucleotide tail of the second region of the first primer remains uncopied. The primer extension product in its 3′ segment includes a sequence that is able to complementary bind the first primer oligonucleotide.
(475) Activator Oligonucleotide:
(476) First Region:
(477) The first region (positions 35-50) includes a sequence (positions 35-47) complementary to the second region of the first primer oligonucleotide (positions 1-13). The three 3′-terminal nucleotides form a 3′ overhang and in the present example do not have functional meaning. The first region in this example consists of 2′-deoxynucleotides that are coupled via a conventional 5′-3′-phosphodiester binding. The terminal 3′-OH group is blocked by a phosphate residue and thus, cannot be extended by the polymerase.
(478) Second Region:
(479) The second region of the activator oligonucleotide includes a sequence (positions 28-34) complementary to the first region of the first primer oligonucleotide (positions 14-20). The second region of the activator oligonucleotide in its 5′ segment includes 2′-O-methyl nucleotide modifications (positions 28-32). Positions 34 and 35 are formed by 2′-deoxynucleotides. The individual nucleotides and nucleotide modifications are coupled to each other via a conventional 5′-3′-phosphodiester binding. The first and second regions of the activator oligonucleotide are smoothly coupled to each other via a conventional 5′-3′-phosphodiester binding.
(480) Sequence length and nature of the first and second regions of the activator oligonucleotide are adapted to complementary regions of the first primer oligonucleotide, so that the first primer oligonucleotide can reversibly bind to the activator oligonucleotide under reaction conditions. Thus, there is equilibrium between the free, single-stranded and the bound, double-stranded form between these two components.
(481) Third Region:
(482) The third region of the activator oligonucleotide includes a sequence (positions 9-27) complementary to a segment of the first primer extension product (positions 21-39) to be expected that is to be synthesized by polymerase during the amplification. The third region along its entire length consists of 2′-O-methyl nucleotide modifications (positions 1-27). The individual nucleotide modifications are coupled to each other via a conventional 5′-3′-phosphodiester binding. The second and third regions of the activator oligonucleotide are smoothly coupled to each other via a conventional 5′-3′-phosphodiester binding. The eight 5′-terminal nucleotide modifications form a 5′ overhang that is non-complementary to the first primer extension product.
(483) The sequence of the activator oligonucleotide is made up such that it is able to form a complementary double strand with its positions 9-47 with part of the first primer extension product (positions 1 to 39). Positions 1 to 9 and positions 48-50 do not participate in the formation of a double strand with the first primer extension product. At the same time the sequence of the activator oligonucleotide is made up such that it can form a complementary double strand with its nucleotide positions 28-47 with the first primer oligonucleotide. Thereby, the 3′ end of the first primer can complementary bind to the activator oligonucleotide. In order to prevent the extension of the 3′ end of the first primer oligonucleotide by a polymerase the activator oligonucleotide includes nucleotide modifications that prevent the synthetic effect of the polymerase. In this example these are 2′-O-methyl nucleotide modifications. In this example the activator oligonucleotide in positions 1-32 consists of 2′-O-methyl nucleotide modifications. In this way the 3′ end of the first primer in case of a correct hybridization binds in the sequence segment that comprises nucleotide modifications. Such an arrangement of the interaction between the activator oligonucleotide and the first primer oligonucleotide is to prevent an undesired extension of the first primer oligonucleotide once it has complementary bound to the activator oligonucleotide. Thanks to modifications in the third region of the activator oligonucleotide also preventively the possibility of a non-specific extension by polymerase is generally reduced. In order to promote strand displacement sequences have been used in the respective segments of the activator oligonucleotide that are complementary to their binding partners in the first primer extension product. Since both sequence mismatches and chain disruptions by modifications without nucleobases (e.g., C3 linkers or C18 linkers) can reduce efficacy of a strand displacement and/or its rate such structure variants have been avoided in this example.
(484) The activator oligonucleotide is to contact the double strand of the nucleic acid to be amplified under reaction conditions via binding to the polynucleotide tail of the first primer extension product. In this example, preferably the binding is reversible under reaction conditions. Thereby, the double strand at the beginning of the reaction consists of the first primer extension product and template 001 and later in the reaction of the first and second primer extension products.
(485) Nature and length of the activator oligonucleotide are to be sufficient to perform a strand displacement that leads to a separation of the primer extension products in sufficient yields. The sufficient separation of both primer extension products is to ensure that sequence segments of both primer extension products with the respective sequence parts having primer binding sites become accessible for binding of the respective complementary primer oligonucleotides. In the present example, the length of the activator oligonucleotide is 50 nucleotides (deoxynucleotides plus nucleotide modifications), wherein 39 of them can complementary bind to the first primer extension product. Therefore, the activator oligonucleotide was able to first at least partially displace template 001 and later in the reaction also the second primer extension product from the binding with the first primer extension product under reaction conditions by means of strand displacement.
(486) Thereby, template 001 and the second primer extension product, respectively became completely or partially single-stranded, so that a new first primer oligonucleotide could bind to the accordingly complementary sequence segment and could be extended by means of the polymerase. In the present example, the third region only binds a 5′-standing segment of the first primer extension product. In the present example, the length of this complementary segment is 19 nucleotides.
(487) The 3′-standing sequence portions of the first primer extension product were not bound by the activator oligonucleotide. This 3′-standing segment of the first primer extension product in its single-stranded form is to be able to bind the second primer oligonucleotide to permit a primer extension reaction. In order that during the reaction a further second primer oligonucleotide can bind to the first primer extension fragment the 3′-standing segment of the first primer extension product has to be converted to the single-stranded form and separated from the binding with the template or with a second primer extension product. In the present example, this is achieved by separating both synthesized strands under reaction conditions during an isothermal reaction. During the strand displacement by the activator oligonucleotide an intermediate product of the strand displacement reaction is formed that consists of a first primer extension product, the activator oligonucleotide, and a second primer extension product. The second primer extension product in this intermediate product is complementary bound to the 3′-standing segment of the first primer extension product. However, the stability of this resulting double strand is significantly reduced compared to a completely bound second primer extension product. Under reaction conditions a spontaneous separation of this double strand (dissociation of the first and second primer extension products) occurs, so that the second primer extension product is completely detached from the first primer extension product. The 3′ segment of the first primer extension product is single-stranded immediately after the separation from the second primer extension product.
(488) The single-stranded 3′-terminal segment of the first primer extension product both can contact the template or the second primer extension product, respectively and bind to the second primer oligonucleotide. Due to a molar excess of the second primer oligonucleotide used the possibility of contact with the second primer oligonucleotide is much higher. Especially, this is the case at the beginning of the reaction: in the present example the template is employed in a concentration of 1 fmol/l. During the first replication cycles of the exponential amplification the concentration of synthesized second primer extension products remains significantly below the value of 1 μmol/l for a longer period of time. In contrast, the second primer oligonucleotide is used in a concentration of 10 μmol/l. Thus, it results an excess of 10.sup.10 of second primer oligonucleotides over the template and over the synthesized second primer extension products, especially during the initial phases of the exponential amplification. In later phases of the amplification now the second primer extension product present in higher concentrations competes for the binding to the 3′ segment of the first primer extension product, so that the reaction can be decelerated.
Example 3
(489) Verification of the Specificity of the Amplification Reaction
(490) In this example, influence of a change in sequence in the template on the amplification has been investigated. Three nucleotides from the central region of the template were removed. The peripheral regions that are crucial for binding primers were identically designed as in example 2. When the first primer oligonucleotide is extended a complementary strand is formed that has a sequence complementary to the template and thus comprises these divergences in the sequence. In this way it was to be verified which effect such a mismatch between a first primer extension product generated thereby and an activator oligonucleotide has on the amplification. Designing the sequences took place like in example 2.
(491) The following templates have been used: template (SEQ ID NO 21) with a sequence composition that leads to a first primer extension product with a perfect-match in matching with activator oligonucleotide:
(492) TABLE-US-00014 T-A6P-15-4401 5′ GTAGTTCTCACTTACGTCCTCTCCACACTCTGAGTTCCTGCGAG 3′
(493) The binding sequence for the first primer oligonucleotide is underlined. template (SEQ ID NO 22) with a sequence composition that leads to a first primer extension product with a mismatch with the activator oligonucleotide:
(494) TABLE-US-00015 T-A6P-15-4401-5 5′ GTAGTTCTCACTTACGTCCTCTCCCTCTGAGTTCCTGCGAG 3′
(495) The binding sequence for the first primer oligonucleotide is underlined.
(496) In both templates respective primer binding sites are identical, so that it is expected that with primer oligonucleotides a successful first primer extension reaction can be initiated.
(497) Both templates differ only in one point:
(498) TABLE-US-00016 T-A6P-15-4401 (SEQ ID NO 21) 5′ GTAGTTCTCACTTACGTCCTCTCCACACTCTGAGTTCCTGCGAG 3′ T-A6P-15-4401-5 (SEQ ID NO 22) 5′ GTAGTTCTCACTTACGTCCTCTCC_CTCTGAGTTCCTGCGAG 3′ The point of difference is underlined
(499) Thus, also differences in respective primer extension products of the first and second primer oligonucleotides have to be expected. The point of difference is in the 5′ segment of the extension product of the first primer oligonucleotide.
(500) The following primers have been used: the first primer oligonucleotide (SEQ ID NO 23):
(501) TABLE-US-00017 A6P-10-1002 TMR7 5′ 7765567876 CAGGAAC 3′
(502) A=2′-deoxy-adenosine
(503) C=2′-deoxy-cytosine
(504) G=2′-deoxy-guanosine
(505) T=2′-deoxy-thymidine (thymidine)
(506) Modifications:
(507) 5=2′-O-Me A (2′-O-methyl-adenosine)
(508) 6=2′-O-Me G (2′-O-methyl-guanosine)
(509) 7=2′-O-Me C (2′-O-methyl-cytosine)
(510) 8=dT-TMR the second primer oligonucleotide (SEQ ID NO 24):
(511) TABLE-US-00018 PA6-15-4401-10 5′ CACGAGTAGTTCTCACTTAC 3′
(512) The following activator oligonucleotide 002-01 (SEQ ID NO 25) has been used:
(513) TABLE-US-00019 A6 8504 5′-CTAGCTAT CGTCCTCT CCACACT CTGA GTTCCTGCGAG CTTC GGTAC AAG X 3′ 68576858 67866868 6656568 6875 7886687CGAG CTTC GGTAC AAG
(514) A=2′-deoxy-adenosine
(515) C=2′-deoxy-cytosine
(516) G=2′-deoxy-guanosine
(517) T=2′-deoxy-thymidine (thymidine)
(518) 5=2′-O-Me A (2′-O-Methyl-adenosine)
(519) 6=2′-O-Me C (2′-O-Methyl-cytosine)
(520) 7=2′-O-Me G (2′-O-Methyl-guanosine)
(521) 8=2′-O-Me U (2′-O-Methyl-urdine)
(522) X=3-phosphate group for blocking a possible extension by polymerase.
(523) The nucleotides and nucleotide modifications are linked to each other with a phosphodiester binding. The 3′ end is blocked with a phosphate group to prevent a possible extension by the polymerase.
(524) The template of perfect match sequence composition was employed in concentrations of 1 nmol/l, 1 μmol/l, and 1 fmol/l.
(525) The template of mismatch sequence composition was used in a concentration of 1 nmol/l.
(526) In the control reaction no template was employed. Other reaction conditions were as in example 2.
(527) When using a perfect match template (SEQ ID NO 21) a complementary strand of a primer extension product is synthesized. This extension product both is complementary to the perfect-match template and to the activator oligonucleotide used. This constellation was illustrated in detail in example 2. It serves as a basis for a successful amplification.
(528) In contrast, when using a mismatch sequence (SEQ ID NO 22) in the synthesis of the first primer extension product a complementary strand of the extension product is generated that certainly is completely complementary to the mismatch template, but in this way deviates from being complementary to the third region of the activator oligonucleotide. This deviation takes place in the 5′-standing segment of the extension product that is to react with the activator oligonucleotide so that the strand displacement process can progress. As shown in the present example the absence of three nucleotides in respective positions interferes with a strand displacement by the activator oligonucleotide.
(529)
(530) The control reactions with a perfect match template (arrows 1-3) showed a concentration dependency of the amplification. With decreasing concentration the reaction took longer time to synthesize a sufficient amount of the nucleic acid to be amplified so that the signal increases above the level of the baseline.
(531) The negative control reaction without a template also showed an increase in the signal, but in a significantly later time interval with respect to reactions with a perfect-match template.
(532) The arrows in
(533) perfect match template (SEQ ID NO 21) 1 nmol/l concentration (arrow 1)
(534) perfect match template (SEQ ID NO 21) 1 μmol/l concentration (arrow 2)
(535) perfect match template (SEQ ID NO 21) 1 fmol/l concentration (arrow 3)
(536) negative control: no template in the reaction (arrow 4) (2 control reactions are indicated, both without template)
(537) mismatch template (SEQ ID NO 22) 1 nmol/l concentration (arrow 5)
(538) This result illustrates the meaning of the base composition in the activator oligonucleotide: Deviations from the complementarity between the activator oligonucleotide and the primer extension product can lead to a deceleration or even disruption of the amplification.
(539) It was shown in this example that both sequence ends of the perfect match template and the mismatch template completely match and thus, the potential for binding both primer oligonucleotides was equal, both reactions proceeded completely different: in case of a complete complementarity between the activator oligonucleotide and the 5′ segment of the extension product of the first primer oligonucleotide the amplification proceeded as planned. Disruption of the strand displacement by a sequence divergence (in this case three nucleotides were absent in the 5′ segment of the extension product of the first primer) resulted in the strong suppression of the amplification.
Example 4
(540) Use of Another Template Sequence with Another Suitable Activator Oligonucleotide
(541) First, an artificial sequence of 49 nucleotides was synthetically generated (Eurofins) that includes a sequence of the MIP gene of Legionella pneumophila between primer 1 and primer 2 (SEQ ID NO 26), template 003-01. As a control template 003-02 (SEQ ID NO 27) of a sequence composition was synthetically generated (Eurofins) that results in a first primer extension product with a mismatch with the activator oligonucleotide (5 nucleotides). For the amplification of such a new template 003 two primers (primer 1, first primer oligonucleotide (identical to SEQ ID NO 13 in example 2) and primer 2, second primer oligonucleotide (SEQ ID NO 28) as well as an activator oligonucleotide (SEQ ID NO 29) that is suitable for template 003-01 have been generated. Designing the sequences was as described in example 2.
(542) The following templates have been used: template 003-01 (SEQ ID NO 26) of a sequence composition that leads to a first primer extension product with a perfect match in matching with the activator oligonucleotide:
(543) TABLE-US-00020 LP-T1-1000-103 5′ CTACAATGTCACTTACACGTTCTTAACAAGTTTCAGCCGTTCC TGCGAG 3′
(544) The sequence segment of the MIP gene of L. pneumonia is underlined.
(545) The template consists of DNA nucleotides. template (SEQ ID NO 27) of a sequence composition that leads to a first primer extension product with a mismatch with the activator oligonucleotide:
(546) TABLE-US-00021 LP-T1-1001-118 5′ CTACAATGTCACTTACACGTTCTTAACAAGTTTGTTCCTGCGAG 3′
(547) The sequence segment of the MIP gene of L. pneumonia is underlined (this segment is shorter than in SEQ ID NO 26 by 5 nucleotides).
(548) The template consists of DNA nucleotides.
(549) In both templates the respective primer binding sites are identical, so that it can be expected that a successful first primer extension reaction by primer oligonucleotides each can be initiated.
(550) TABLE-US-00022 LP-T1-1000-103 (SEQ ID NO 26) 5′ CTACAATGTCACTTACACGTTCTTAACAAGTTTCAGCCG TTCCTGCGAG 3′ LP-T1-1001-118 (SEQ ID NO 27) 5′ CTACAATGTCACTTACACGTTCTTAACAAGTTT GTTCC TGCGAG 3′
(551) Binding site for primer 1 underlined.
(552) Both templates only differ in one position:
(553) TABLE-US-00023 LP-T1-1000-103 (SEQ ID NO 26) 5′ CTACAATGTCACTTACACGTTCTTAACAAGTTTCAGCCGTTCC TGCGAG 3′ LP-T1-1001-118 (SEQ ID NO 27) 5′ CTACAATGTCACTTACACGTTCTTAACAAGTTT_GTTCCTGCG AG 3′
(554) The point of difference between the templates is underlined.
(555) This position is in the region that is synthesized by polymerase in the synthesis of the first primer extension product. The point of difference is in the 5′ segment of the extension product of the first primer oligonucleotide. Thus, also differences in the respective primer extension products of the first and second primer oligonucleotides are to be expected.
(556) The following primers have been used:
(557) The first primer oligonucleotide (SEQ ID NO 13) is identical to primer 1 in example 2:
(558) Primer 1
(559) Primer 001-01 (20 nucleotides):
(560) The sequence of the first primer oligonucleotide:
(561) TABLE-US-00024 A6P-10-1001 (SEQ ID NO 13) 5′ GTACCGAAGCTCGCAGGAAC 3′ (order of numbering: 1-20)
(562) Underlined regions are illustrated by 2′-O-Me modifications. Non-underlined regions are 2′-deoxynucleotides (DNA). the second primer oligonucleotide SEQ ID NO 28):
(563) TABLE-US-00025 LP-P2-1000-211 5′ CTACAATGTCACTTAC ACGTTCTTAACAAGTTT 3′ (SEQ ID NO 17):
(564) The first and the second primer oligonucleotides can bind both templates (SEQ ID NO 26 and 27) to respective primer binding sites.
(565) The following activator oligonucleotide 003 (SEQ ID NO 29) has been used:
(566) TABLE-US-00026 LP-A1-1000-104 5′-A*A*A*A*C*A*A*A[AACCGAACA CAAAUGAAAGACGUUC UUAACAAGUUUCAGCCGUUCCUG]CGAGCTTCGGTACAAG X 3′
(567) The sequence at the 3′-standing segment consists of DNA nucleotides
(568) A=2′-deoxy-adenosine
(569) C=2′-deoxy-cytosine
(570) G=2′-deoxy-guanosine
(571) T=2′-deoxy-thymidine (thymidine)
(572) The sequence in square brackets [ ], positions 9-58, consists of 2′-O-Me nucleotide modifications that are linked via phosphodiester binding: 2′-O-Me A (2′-O-methyl-adenosine), 2′-O-Me C (2′-O-methyl-cytosine), 2′-O-Me G (2′-O-methyl-guanosine), 2′-O-Me U (2′-O-methyl-uridine).
(573) Connections between 5′-standing nucleotides (positions 1-8) are linked via phosphorothioate connections (PTO); the respective positions are designated with (*).
(574) X=3-phosphate group for blocking a possible extension by polymerase.
(575) The 3′ end is blocked with a phosphate group to prevent a possible extension by the polymerase.
(576) The concentration of templates at the beginning of the reaction was 10 μmol (for perfect match and mismatch). In a further control reaction no template was employed. The reaction was carried out for 60 min at 65° C. Other reaction conditions were kept as in example 1.
(577) Results
(578) The course of the reaction is shown in
(579) Evaluation:
(580) The increase in the signal in
(581) This difference is attributed to the following situations:
(582) When using a perfect match template (SEQ ID NO 26) a complementary strand of a primer extension product is synthesized. This extension product both is complementary to the perfect match template and to the corresponding positions of the activator oligonucleotide (SEQ ID NO 29) used. This constellation was illustrated in detail in example 1. It serves as a basis for a successful amplification.
(583) In the following, sequences are compared and respective segments labeled that form a complementary double strand with appropriate reaction partners under the reaction:
(584) Templates
(585) TABLE-US-00027 LP-T1-1000-103 (SEQ ID NO 26) 5′ CTACAATGTCACTTACACGTTCTTAACAAGTTTCAGCCGTTC CTGCGAG 3′ LP-T1-1001-118 (SEQ ID NO 27) 5′ CTACAATGTCACTTACACGTTCTTAACAAGTTT GTTCCTGC GAG 3′ binding site for primer 1 underlined
(586) Primer 1 and Primer 2:
(587) TABLE-US-00028 primer 1: A6P-10-1001 (SEQ ID NO: 13) 5′ GTACCGAAGCTCGCAGGAAC 3′ binding site to template underlined
(588) TABLE-US-00029 primer 2: LP-P2-1000-211 (SEQ ID NO 28) 5′ CTACAATGTCACTTAC ACGTTCTTAACAAGTTT 3′
(589) (It is underlined the 5′ segment of the second primer oligonucleotide that can complementary bind to the 3′ segment of the first primer extension product, wherein said 3′ segment of the first primer extension product is non-complementary to the third region of the activator oligonucleotide.)
(590) Activator Oligonucleotide
(591) TABLE-US-00030 LP-A1-1000-104 (SEQ ID NO 29) 5′- A*A*A*A*C*A*A*A[AACCGAACA CAAAUGAAAGACGUUCUUAACAAG UUUCAGCCGUUCCUG ]CGAGCTTCGGTACAAG X 3′
(592) (Positions of the third region of the activator oligonucleotide that perfectly match the extension product of the first primer oligonucleotide on the template 003-01 (SEQ ID NO 14) are underlined.)
(593) TABLE-US-00031 LP-A1-1000-104 (SEQ ID NO 29) 5′- A*A*A*A*C*A*A*A[AACCGAACA CAAAUGAAAGACGUUCUUAACAAG UUUCAGCCGUUCCUG ]CGAGCTTCGGTACAAG X 3′
(594) (Positions of the activator oligonucleotide that perfectly match the primer extension product of the first primer oligonucleotide on template 003-01 (SEQ ID NO 14) are underlined.) This fragment is longer than the fragment that interacts with the extension product of the first primer oligonucleotide, since the whole primer extension product consists of the first primer oligonucleotide and the extension product.
(595) It is seen that there is no smooth transition in the complementarity between the first primer extension product (that was synthesized to the perfect match template 003-01) and the segments of the second region and the third region of the activator oligonucleotide. This constellation supports the formation of the new double strand between the activator oligonucleotide and the first primer extension product, so that a sufficient strand displacement of the template strand or a second primer extension product can take place. Altogether, this leads to a positive amplification result.
(596) In contrast, when using a mismatch sequence (SEQ ID NO 15) in the synthesis of the first primer extension product a complementary strand of the extension product is generated that however is completely complementary to the mismatch template, but that way deviates from being complementary to the third region of the activator oligonucleotide. This deviation takes place in the 5′-standing segment of the extension product that is to react with the activator oligonucleotide so that a strand displacement process can progress. As shown in the present example, absence of fife nucleotides in the respective positions interferes with a strand displacement by the activator oligonucleotide, which leads to a disturbance of the amplification.
(597) TABLE-US-00032 LP-A1-1000-104 (SEQ ID NO 29) 5′- A*A*A*A*C*A*A*A[AACCGAACA CAAAUGAAAGACGUUCUUAACAAG UUUCAGCCGUUCCUG ]CGAGCTTCGGTACAAG X 3′
(598) (Positions of the third region of the activator oligonucleotide that perfectly match the extension product of the first primer oligonucleotide on template 003-02 (SEQ ID NO 26) are underlined.)
(599) TABLE-US-00033 LP-A1-1000-104 (SEQ ID NO 29) 5′- A*A*A*A*C*A*A*A[AACCGAACA CAAAUGAAAGACGUUCUUAACAAG UUUCAGCCGUUCCUG ]CGAGCTTCGGTACAAG X 3′
(600) (Positions of the activator oligonucleotide that perfectly match the extension product of the first primer oligonucleotide on template 003-01 (SEQ ID NO 27) are underlined.)
(601) It is seen an expected interruption of the binding of a complementary double strand between the activator oligonucleotide 003 and the first primer extension product that was formed on the mismatch template. This interruption corresponds to the portion of the primer extension product of template 003-02 (SEQ ID NO 27) that corresponds to the omitted segment of template 003-02. This position is between the second and third regions of the activator oligonucleotide.
(602) Such a difference in the complementarity of the double strand potentially to be expected between the activator oligonucleotide 003 (SEQ ID NO 29) and the first primer extension product of a perfect match template 003-01 or the first primer extension product of a mismatch template 003-02 can lead to differences in the strand displacement reaction that result in a hindrance of the amplification.
(603) This result demonstrated the meaning of the base composition in the activator oligonucleotide: deviations from complementarity between the activator oligonucleotide and the primer extension product can lead to interruption of the amplification.
(604) In this example it was shown that even though sequence ends of the perfect match template and the mismatch template completely match and thus, the potential for binding both primer oligonucleotides was equal, both reactions proceeded completely different: in case of a complete complementarity between the activator oligonucleotide and the 5′ segment of the extension product of the first primer oligonucleotide amplification proceeded as planned. Such an interruption of the strand displacement by a sequence divergence (in this case, fife nucleotides were absent in the 5′ segment of the extension product of the first primer) resulted in the suppression of the amplification.
Example 5
(605) It is shown in this example that further structure variants of the first primer oligonucleotide are able to support an exponential amplification of a nucleic acid chain to be amplified. These structure variants differ in the group used to stop the polymerase in the synthesis of the second primer extension product. One modification each was used as a group leading to the stop of the polymerase: C3 linker, C18 linker (also known as HEG linker, hexaethylene glycol linker), or Iso-dC-5-Me.
(606) Moreover, it is shown in this example that a primer 2 with its 3′ segment complementary to the first primer extension product is able to partially displace the activator oligonucleotide from the binding to the first primer extension product and can support a successful amplification.
(607) For testing purposes the same nucleic acid to be amplified was used as described in example 2.
(608) TABLE-US-00034 Template 001-01: T35-4401-601 (SEQ ID NO 12) 5′-ATACTACAATGTCACTTACGTCCTCTCCACACTCTGAGTTCCTGC GAG-3′ (order of numbering: 1-48)
(609) Activator oligonucleotide:
(610) The same activator olignucleotide 001-01 was used as described in example 2:
(611) TABLE-US-00035 Activator oligonucleotide 001-01: A6 8505 (SEQ ID NO: 15) 5′- [CUAGCUAUCGUCCUCUCCACACUCUGA GUUCC] TGCGAGCTTCG GTACAAG X -3′ (order of numbering: 1-50)
(612) The activator oligonucleotide comprises 2′-O-Me nucleotide modifications (indicated in [ ] brackets) and DNA nucleotides (in the 3′ segment). The 3′-OH group of the 3′-terminal nucleotide was blocked by a phosphate residue (here designated with X).
(613) The following variants of the first primer oligonucleotides have been used:
(614) TABLE-US-00036 P-1001-100 TMR C3 (SEQ ID NO 30) 5′- 6T57765568 CTCGCAGGAAC - 3′ 8 = C3 linker P-1001-103 TMR C18 (SEQ ID NO 31) 5′- 6T57765568 7T76CAGGAAC - 3′ 8 = C18 linker (HEG linker, hexaethylene glycol) P-10-1002-IsoC4 (SEQ ID NO 32) 5′- 7765568TCGCAGGAAC - 3′ 8 = Iso-dC-5-Me (modification)
(615) Further positions have been occupied as follows:
(616) A=2′-deoxy-adenosine
(617) C=2′-deoxy-cytosine
(618) G=2′-deoxy-guanosine
(619) T=2′-deoxy-thymidine (thymidine)
(620) Modifications:
(621) 5=2′-O-Me A (2′-O-methyl-adenosine)
(622) 6=2′-O-Me G (2′-O-methyl-guanosine)
(623) 7=2′-O-Me C (2′-O-methyl-cytosine)
(624) 5′ of first primer oligonucleotides has been modified with TAMRA dye. (TMR-modification).
(625) The respective second region of each first primer oligonucleotide is underlined.
(626) Conventional 5′-3′ links between adjacent nucleotides and nucleotide modifications have been selected. Also modifications have been attached in a 5′-3′ alignment. All sequences have been synthesized by commercial suppliers with standard synthesis chemistry (phosphoroamidite chemistry).
(627) The following second primer oligonucleotide has been used:
(628) TABLE-US-00037 Primer 001-02: PA6-35-4401-604 (SEQ ID NO: NN 33) 5′- GCTCATACTACAATGTCACTTACGTCCTCT - 3′ (order of numbering in 5′-3′: 1-30)
(629) The second primer consists of DNA.
(630) The composition of the reaction mixture and the start of the reaction were carried out as described example 2.
(631) These components have been employed in the reaction mixture as follows: template 001-01: 10 μmol/l activator oligonucleotide 001-01: 10 μmol/l the respective primer 1: 10 μmol/l primer 001-02: 10 μmol/l
(632) Further components of the reaction have been employed as amplification reaction solution 2: potassium glutamate, 50 mmol/l, pH 8.0 magnesium acetate, 10 mmol/l dNTP (dATP, dCTP, dTTP, dGTP), 200 μmol/l each polymerase (Bst 2.0 WarmStart, 120,000 U/ml NEB), 12 units/10 μl Triton X-100, 0.1% (v/v) EDTA, 0.1 mmol/l TPAC (tetrapropylammonium chloride), 50 mmol/l, pH 8.0 Eva green dye (dye was employed in accordance with the specification of the manufacturer in dilution 1:50).
(633) The reaction was carried out in the amplification reaction solution 2 under isothermal reaction conditions at 65° C. for the period (as indicated). The fluorescence signal of Eva green was recorded during the reaction as described in example 2. The result of the recordings of the signal intensity during the reaction is illustrated in
(634) Evaluation:
(635) By using the listed first primer oligonucleotides generation of the following first primer extension products is to be expected:
(636) TABLE-US-00038 (SEQ ID NO: NN 34) 5′- XXXXXXX TCAGAGTGTGGAGAGGACGTAAGTGACATTGTAGTATG AGC - 3′
(637) The respective sequence of the corresponding first primer oligonucleotide is marked with “XXXXXXX”. Directly afterwards the sequence of the first extension product to be expected is given (41 NT). The extension product is underlined.
(638) Different primer 1 structures were tested for their ability to support an exponential amplification under isothermal conditions. Thereby, different groups leading to the stop of the polymerase have been integrated in the second region of the first primer oligonucleotide: C3 linker, C18 linker (also known as HEG linker, hexaethylene glycol linker), or Iso-dC-5-Me. In the synthesis of the second primer extension product the synthesis of the second primer extension product is position-specifically interrupted, so that the polynucleotide tail of the second region remains uncopied.
(639) The respective signal profile of the reaction is shown in
(640) Reaction with primer 1 (C3 linker) with SEQ ID NO: 30 is shown in
(641) Reaction with primer 1 (C18 linker) with SEQ ID NO: 31 is shown in
(642) Reaction with primer 1 (Iso-dC-5-Me) with SEQ ID NO: 32 is shown in
(643) All listed structure variants of the first primer oligonucleotide resulted in a successful exponential amplification. In designing the first primer oligonucleotides the following aspects were taken into account: First primer region of the first primer oligonucleotide has to be able to specifically bind to the nucleic acid to be amplified and initiate a detectable primer extension reaction by the polymerase used. First primer region of the first primer oligonucleotide has to complementary bind to the second region of the activator oligonucleotide so that a strand displacement reaction can effectively take place. Second region of the first primer oligonucleotide comprises a polynucleotide tail that is to specifically bind the first region of the activator oligonucleotide. Between the first region and the polynucleotide tail of the second region of the first primer oligonucleotide first blocking unit leading to the blockage of the polymerase-dependent synthesis or termination or to the stop of the polymerase-dependent synthesis is integrated that hinders polymerase from copying the polynucleotide tail. Binding between the first primer oligonucleotide and the activator oligonucleotide is to be reversible under the isothermal conditions used. Altogether, there is to be equilibrium between a single-stranded form of the first primer oligonucleotide and a form of the first primer oligonucleotide that is complementary bound to the activator oligonucleotide under the selected reaction conditions.
(644) In selecting the sequence length and sequence composition of the second primer oligonucleotide the following aspects were taken into account: Primer length comprises 30 nucleotides. Positions 5-30 of the sequence of the second primer oligonucleotide are complementary to the sequence-specific first primer extension product that is already generated after the first primer extension reaction. Thus, primer 2 can initiate a primer extension reaction for the second primer extension product. The 3′ segment (positions 23-30) of the second primer oligonucleotide in the present example competes for the binding to the first sequence-specific primer extension product with the activator oligonucleotide. Said 3′ segment can lead to a nucleic acid-dependent strand displacement of the corresponding segment of the activator oligonucleotide. In such a strand displacement the 3′-terminal nucleotide of the second primer oligonucleotide contacts the first sequence-specific primer extension product, so that the polymerase can initiate an effective sequence-specific second primer extension reaction that leads to the synthesis of the second sequence-specific strand. This synthesis takes place with simultaneous strand displacement of the activator oligonucleotide by the polymerase. The length of said 3′ segment in this example was selected such that no overlapping of complementary sequence parts with the first primer oligonucleotide can take place. In the present example, the 5′ segment (22 nucleotides, positions 1 to 22) of the second primer oligonucleotide can complementary bind to the 3′ segment of the sequence-specific first primer extension product. Said 5′ segment does not compete with the activator oligonucleotide for the binding to the first primer extension product and thus, does not lead to a strand displacement of the activator oligonucleotide from the binding to the first primer extension product. The Tm of said 5′ segment of the second primer oligonucleotide is selected such that a temperature-induced spontaneous strand separation between a first sequence-specific primer extension product and a second sequence-specific primer extension product is favored in case of a complete binding of the activator oligonucleotide to the first sequence-specific primer extension product. Separation of both strands results in a single-stranded form of the 3′ segment of the first primer extension product.
Example 6
(645) Influence of Individual Nucleotide Changes in the Template on the Rate of the Amplification Reaction
(646) In this example the influence of a change in sequence in the template on the amplification was investigated, wherein individual nucleotide monomers were replaced by other nucleotide monomers. The peripheral regions that are relevant for the binding of primers have been designed identically. In this way it was to be verified which effect such mismatch positions between a first primer extension product generated thereby and a given activator oligonucleotide has on the amplification. Designing the sequences was in the same manner like in examples 2 and 3.
(647) The following templates have been used: template (SEQ ID NO 21) with a sequence composition that leads to a first primer extension product with a perfect match in matching with the activator oligonucleotide:
(648) TABLE-US-00039 T-A6P-15-4401 (SEQ ID NO: 21) 5′ GTAGTTCTCACTTACGTCCTCTCCACACTCTGA GTTCCTGCGAG 3′
(649) The binding sequence for the first primer oligonucleotide is underlined.
(650) Moreover, further templates (SEQ ID NO 36-38) with a sequence composition that leads to a first primer extension product with a mismatch with the activator oligonucleotide have been used:
(651) TABLE-US-00040 T-A6P-15-4401-1 (SEQ ID NO: 35) 5′ GTAGTTCTCACTTACGTCCTCTCCACACT TGA GTTCCTGCGAG 3′ T-A6P-15-4401-2 (SEQ ID NO: 36) 5′ GTAGTTCTCACTTACGTCCTCTCCA
ACTCTGA GTTCCTGCGAG 3′ T-A6P-15-4401-3 (SEQ ID NO: 37) 5′ GTAGTTCTCACTTACGTCCT
TCCACACTCTGA GTTCCTGCGAG 3′ T-A6P-15-4401-4 (SEQ ID NO: 38) 5′ GTAGTTCTCACTTACGT
CTCTCCACACTCTGA GTTCCTGCGAG 3′
(652) The binding sequence for the first primer oligonucleotide is underlined.
(653) Diverging bases (to SEQ ID NO 21) are marked BOLD ITALICS.
(654) In all templates (with a perfect match in matching and integrated mismatches) the respective primer binding sites are identical, so that a successful first primer extension reaction by the primer oligonucleotides each could be initiated.
(655) By the amplification with the polymerase there are differences in the amplified sequences over the unchanged templates (SEQ ID NO:21). The corresponding points of differences are in the 5′ segment of the extension product of the first primer oligonucleotide.
(656) The following primers have been used: the first primer oligonucleotide (SEQ ID NO 23):
(657) TABLE-US-00041 (A6P-10-1002 TMR7) 5′ 7765567876 CAGGAAC 3′
(658) having the meaning of:
(659) A=2′-deoxy-adenosine
(660) C=2′-deoxy-cytosine
(661) G=2′-deoxy-guanosine
(662) T=2′-deoxy-thymidine (thymidine) and the
(663) modifications:
(664) 5=2′-O-Me A (2′-O-methyl-adenosine)
(665) 6=2′-O-Me G (2′-O-methyl-guanosine)
(666) 7=2′-O-Me C (2′-O-methyl-cytosine)
(667) 8=dT-TMR the second primer oligonucleotide (SEQ ID NO 24):
(668) TABLE-US-00042 (PA6-15-4401-10) 5′ CACGAGTAGTTCTCACTTAC 3′
(669) The following activator oligonucleotide 002-01 (SEQ ID NO 25) has been used:
(670) TABLE-US-00043 A6 8504 5'- CTAGCTAT CGTCCTCT CCACACT CTGA GTTCCTGCGAG CTTC GGTAC AAG X 3' 68576858 67866868 6656568 6875 788668 7CGAG CTTC GGTAC AAG
(671) having the following meaning:
(672) A=2′-deoxy-adenosine
(673) C=2′-deoxy-cytosine
(674) G=2′-deoxy-guanosine
(675) T=2′-deoxy-thymidine (thymidine)
(676) 5=2′-O-Me A (2′-O-methyl-adenosine)
(677) 6=2′-O-Me C (2′-O-methyl-cytosine)
(678) 7=2′-O-Me G (2′-O-methyl-guanosine)
(679) 8=2′-O-Me U (2′-O-methyl-urdine)
(680) X=3-phosphate group for blocking a possible extension by polymerase.
(681) The nucleotides and nucleotide modifications are linked to each other by a phosphodiester binding. The 3′ end is blocked with a phosphate group to prevent a possible extension by the polymerase.
(682) The template with a perfect match sequence composition was employed in concentrations of 1 nmol/l, 1 μmol/l, and 1 fmol/l. The template with a mismatch sequence composition was used in a concentration of 1 nmol/l.
(683) In the control reaction no template was used. The other reaction conditions were kept as in example 2.
(684) When using a perfect match template (SEQ ID NO 21) a complementary strand of a primer extension product is synthesized. Said extension product is complementary both to the perfect match template and to the activator oligonucleotide used. This constellation has been explained in detail in example 2. It serves as a basis for a successful amplification.
(685) In contrast, when using mismatch sequences (SEQ ID NO 35-38) in the synthesis of the first primer extension product a complementary strand of the extension product is generated that certainly is completely complementary to the mismatch template, but in this way deviates from being completely complementary to the third region of the activator oligonucleotide. This deviation in complementarity are in the 5′-standing segment of the extension product of the first primer extension product that is to react with the activator oligonucleotide so that the strand displacement process can progress. As is shown in the present example, mismatches between corresponding sites can interfere with the strand displacement by the activator oligonucleotide. The amplification therefore proceeds slower overall.
(686)
(687) The control reactions with a perfect match template (arrows 1-3,
(688) The negative control reaction without a template also showed an increase in the signal, but in a significantly later time interval with respect to reactions with a perfect-match template.
(689) The arrows in
(690) perfect match template (SEQ ID NO 21) 1 nmol/l concentration (arrow 1)
(691) perfect match template (SEQ ID NO 21) 1 μmol/l concentration (arrow 2)
(692) perfect match template (SEQ ID NO 21) 1 fmol/l concentration (arrow 3)
(693) negative control: no template in the reaction (arrow 4)
(694) The arrows in
(695) perfect match template (SEQ ID NO 21) 1 nmol/l concentration (arrow 1)
(696) negative control: no template in the reaction (arrow 4)
(697) mismatch template (SEQ ID NO 35) 1 nmol/l concentration (arrow 5) T-A6P-15-4401-1
(698) mismatch template (SEQ ID NO 36) 1 nmol/l concentration (arrow 6) T-A6P-15-4401-2
(699) mismatch template (SEQ ID NO 37) 1 nmol/l concentration (arrow 7) T-A6P-15-4401-3
(700) mismatch template (SEQ ID NO 38) 1 nmol/l concentration (arrow 8) T-A6P-15-4401-4
(701) This result illustrates the meaning of the base composition in the activator oligonucleotide: Divergences from the complementarity between the activator oligonucleotide and the primer extension product by only one complementary base in some cases can lead to a significant delay in the exponential amplification.
(702) It was shown in this example that, even though terminal sequence segments of a perfect match template and a mismatch template completely match and thus, the potential for binding both primer oligonucleotides during the exponential amplification was equal, both reactions proceeded different: in case of a complete complementarity between the activator oligonucleotide and the 5′ segment of the extension product of the first primer oligonucleotide the amplification proceeded as planned. The presence of individual mismatches between the activator oligonucleotide and a primer extension product can lead to a deceleration of an exponential amplification reaction.