Oxadiazole derivatives for the treatment of genetic diseases due to nonsense mutations

Abstract

Are disclosed oxadiazole derivatives, their use as medicaments and in particular for the treatment of diseases associated with the presence of a nonsense mutation in the gene or a premature stop codon in the mRNA, pharmaceutical formulation comprising said oxadiazole derivatives and prodrug or mixture thereof and the methods for the preparation of said Oxadiazole derivatives.

Claims

1. A compound consisting of 2,3,4,5,6-pentafluoro-N-(5-(perfluorophenyl)-1,2,4-oxadiazol-3-yl)benzamide.

2. A method for the preparation of the compound of claim 1, the method comprising acylation with perfluorobenzoyl chloride of amine 2 according to the following reaction: ##STR00009##

3. A pharmaceutical composition comprising a pharmacologically effective amount of the compound of claim 1 or a prodrug thereof and pharmaceutically acceptable excipients.

4. A method for treating a disease caused by nonsense mutations comprising administering the pharmaceutical composition of claim 3 to a patient affected by a disease caused by nonsense mutations and in the need thereof.

5. A method for treating a disease caused by nonsense mutations comprising administering the compound of claim 1 to a patient affected by a disease caused by nonsense mutations and in the need thereof.

6. A pharmaceutical compositions comprising a pharmacologically effective amount of a compound selected from the group consisting of: 2,3,4,5,6-pentafluoro-N-(5-perfluorophenyl)-1,2,4-oxadiazol-3- yl)benzaminde, N-(5-methyl-1,2,4-oxadiazol-3-yl)acetamide, ethyl 5-phenyl-1,2,4-oxadiazole-3-carboxylate, a prodrug thereof, or a mixture thereof.

7. A method of treating a disease caused by nonsense mutation comprising administering the pharmaceutical composition of claim 6 to a patient affected by the disease caused by nonsense mutations and in the need thereof.

8. A method of treating a disease caused by nonsense mutation comprising administering a pharmacologically effective amount of a compound selected from the group consisting of: 2,3,4,5,6-pentafluoro-N-(5-(perfluorophenyl)-1,2,4-oxadiazol-3-yl)benzamide, N-(5-methyl-1,2,4-oxadiazol-3-yl)acetamide, ethyl 5-phenyl-1,2,4-oxadiazole-3-carboxylate, or mixture thereof to a patient affected by the disease caused by nonsense mutations and in the need thereof.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows in the left panel the test-set and in the right panel the training-set plots for Hypo.7.

(2) FIG. 2 shows a histogram showing luciferase (FLuc) activity after 24 h of exposition to ATALUREN and its analogues in HeLa FLuc-opal transfected cells.

(3) FIG. 3 shows a colony PCR.

(4) FIG. 4 shows a selective PCR.

(5) FIG. 5 shows in panel A the real time RT-PCR to visualize CFTR expression after Zeocin selection in FRT cells; in panel B the western blot analysis to detect CFTR protein in FRT transfected cells (CFTR wild type and nsCFTR (opal). Beta-tubulin was used as control for the protein loading.

(6) FIG. 6 shows the cell viability test for our compounds compared to Ataluren.

(7) FIG. 7 shows the percentages of dead cells and proliferating cells after treatment with 12 μM compounds and 12 μM ataluren.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

(8) Within the meaning of the present invention diseases caused by nonsense mutations means disease caused by a point mutation in the sequence of DNA resulting in a premature stop codon in the transcribed mRNA, and in a truncated, incomplete, and non-functional protein product, wherein stop codons in RNA are UAG (amber), UAA (ochre) and UGA (opal). Nonsense mutation generates UGA, UAA and UAG premature termination codons.

(9) The diseases caused by nonsense mutations can be CNS diseases, inflammatory diseases, neurodegenerative diseases, autoimmune diseases, cardiovascular diseases, pulmonary diseases. More specifically are cancer or other proliferative diseases, amyloidosis, Alzheimer's disease, atherosclerosis, giantism, dwarfism, hypothyroidism, hyperthyroidism, cystic fibrosis, aging, obesity, Parkinson's disease, Niemann Pick's disease, familial hypercholesterolemia, retinitis pigmentosa, Marfan syndrome, lysosomal storage disorders, muscular dystrophies, cystic fibrosis, hemophilia, or classical late infantile neuronal ceroid lipofuscinosis (LINCL), Cystic Fibrosis (CF), Duchenne Muscular Dystrophy (DMD), atherosclerosis, Alzheimer's disease, amyloidosis, retinitis pigmentosa, Usher's syndrome, ALS, multiple sclerosis.

(10) Within the meaning of the present invention pro-drug means a compound that, after administration, is metabolized into a pharmacologically active compound.

(11) Within the meaning of the present invention pharmaceutically acceptable excipients means any chemical alongside the active ingredient of a medication, such as, and not limited to, long-term stabilization agents, bulking agents, fillers, diluents, agents facilitating drug absorption, agents reducing viscosity, agents enhancing solubility, agents facilitating powder flowability or non-stick properties, agents aiding in vitro stability, agents preventing denaturation or aggregation, agents improving shelf life, depending also upon the route of administration and the dosage form, which can be selected by the person skilled in the art in view of his common general knowledge.

(12) Object of the invention is 2,3,4,5,6-pentafluoro-N-(5-(perfluorophenyl)-1,2,4-oxadiazol-3-yl)benzamide.

(13) An other object of the present invention is the method of preparation of 2,3,4,5,6-pentafluoro-N-(5-(perfluorophenyl)-1,2,4-oxadiazol-3-yl)benzamide by acylation with perfluorobenzoyl chloride of amine 2 according to the following reaction

(14) ##STR00002##
wherein an equal amount of perfluorobenzoyl chloride and pyridine are added to the amine dissolved in toluene, until consumption of starting material, followed by removal of the solvent and addition of water to the residue, then the final product is obtained by further purification.

(15) Preferably purification is performed by extraction with ethyl acetate and chromatographic separation on silica gel using mixtures of petroleum ether and ethyl acetate as eluent followed by crystallization.

(16) An other object of the present invention is 2,3,4,5,6-pentafluoro-N-(5-(perfluorophenyl)-1,2,4-oxadiazol-3-yl)benzamide for use as a medicament.

(17) An other object of the present invention is 2,3,4,5,6-pentafluoro-N-(5-(perfluorophenyl)-1,2,4-oxadiazol-3-yl)benzamide for use for the treatment of diseases caused by nonsense mutations.

(18) An other object of the present invention is a pharmaceutical composition comprising a pharmacologically effective amount of 2,3,4,5,6-pentafluoro-N-(5-(perfluorophenyl)-1,2,4-oxadiazol-3-yl)benzamide or its prodrug and pharmaceutically acceptable excipients.

(19) An other object of the present invention is N-(5-methyl-1,2,4-oxadiazol-3-yl)acetamide for use as a medicament.

(20) An other object of the present invention is N-(5-methyl-1,2,4-oxadiazol-3-yl)acetamide for use in the treatment of diseases caused by nonsense mutation.

(21) An other object of the present invention is a pharmaceutical composition comprising a pharmacologically effective amount of N-(5-methyl-1,2,4-oxadiazol-3-yl)acetamide or its prodrug and pharmaceutically acceptable excipients.

(22) An other object of the present invention is compound of formula (I)

(23) ##STR00003##

(24) Wherein

(25) R1 is selected from the group consisting of: amide derivatives, ester derivatives

(26) R2 is selected from the group consisting of: alkyl, perfluoroalkyl, aryl, polyfluoroaryl

(27) for use in the treatment of diseases caused by nonsense mutations.

(28) Preferably when R1 is amide derivative is selected from the group consisting of: alkyl amide, aryl amide, polyfluoroaryl amide. Preferably when R1 is ester derivative is polyfluoroaryl ester.

(29) More preferably R1 is selected from the group consisting of:

(30) ##STR00004##

(31) Preferably when R2 is alkyl is selected from the group consisting of: methyl, ethyl, propyl.

(32) Preferably when R2 is perfluoroalkyl is selected from the group consisting of: perfluoromethyl, perfluoropropyl, perfluoroheptyl.

(33) Preferably when R2 is aryl is phenyl.

(34) More preferably R2 is selected from the group consisting of:

(35) ##STR00005##
for use in the treatment of diseases caused by nonsense mutations and pharmaceutical.

(36) More preferably compounds of formula (I) are selected from the group consisting of: 2,3,4,5,6-pentafluoro-N-(5-(perfluorophenyl)-1,2,4-oxadiazol-3-yl)benzamide N-(5-methyl-1,2,4-oxadiazol-3-yl)acetamide ethyl 5-phenyl-1,2,4-oxadiazole-3-carboxylate

(37) An other object of the present invention are composition comprising a pharmacologically effective amount of at least one compound of formula (I) or its prodrug or mixture thereof and pharmaceutically acceptable excipients, for use in the treatment of diseases caused by nonsense mutations.

(38) Another object of the present invention is the method of preparation of ethyl 5-phenyl-1,2,4-oxadiazole-3-carboxylate by amidoxime route according to the following reaction

(39) ##STR00006##

(40) Wherein amidoxime 1 was dissolved in toluene, then equal amount of aroyl chloride and pyridine were added until consumption of starting material, followed by removal of the solvent and addition of water to the residue, then the final product is obtained by further purification.

(41) Preferably purification is performed by extraction with ethyl acetate and chromatographic separation on silica gel using mixtures of petroleum ether and ethyl acetate as eluent allowed to obtain the desired oxadiazole and further purification by crystallization.

(42) Preferably the disease caused by nonsense mutations is selected from the group consisting of: CNS diseases, inflammatory diseases, neurodegenerative diseases, autoimmune diseases, cardiovascular diseases, pulmonary diseases, proliferative diseases.

(43) More preferably the disease caused by nonsense mutations is selected from the group consisting of cancer, amyloidosis, Alzheimer's disease, atherosclerosis, giantism, dwarfism, hypothyroidism, hyperthyroidism, cystic fibrosis, aging, obesity, Parkinson's disease, Niemann Pick's disease, familial hypercholesterolemia, retinitis pigmentosa, Marfan syndrome, lysosomal storage disorders, muscular dystrophies, cystic fibrosis, hemophilia, or classical late infantile neuronal ceroid lipofuscinosis (LINCL), Cystic Fibrosis (CF), Duchenne Muscular Dystrophy (DMD), atherosclerosis, Alzheimer's disease, amyloidosis, retinitis pigmentosa, Usher's syndrome, ALS, multiple sclerosis.

(44) Even more preferably the disease caused by UGA nonsense mutations is Cystic Fibrosis (CF), Duchenne Muscular Dystrophy (DMD).

EXAMPLES

(45) 58 molecules have been synthetized, some of them identified by a virtual screening, and evaluate their activity by using different assays: the F-Luc assay using a vector containing a UGA in the cDNA of the F-Luc and epithelial rat cells transfected with a CFTR nonsense mutated cDNA.

(46) The tests were focused in particular on CFTR as a model, due to the lack of therapy and the wide diffusion of this genetic disease.

Example 1 Virtual Design and Synthesis

(47) Concerning the 3D-QSAR pharmacophore modelling, used processing procedures for the structures and models generation were as disclosed in [Almerico, A. M., Tutone, M., Lauria, A. 3D-QSAR pharmacophore modeling and in silico screening of new Bcl-xl inhibitors (2010) European Journal of Medicinal Chemistry, 45 (11), pp. 4774-4782; Lauria, A., Ippolito, M., Fazzari, M., Tutone, M., Di Blasi, F., Mingoia, F., Almerico, A. M. IKK-β inhibitors: An analysis of drug-receptor interaction by using Molecular Docking and Pharmacophore 3D-QSAR approaches (2010) Journal of Molecular Graphics and Modelling, 29 (1), pp. 72-81; Almerico, A. M., Tutone, M., Lauria, A. Receptor-guided 3D-QSAR approach for the discovery of c-kit tyrosine kinase inhibitors (2012) Journal of Molecular Modeling, 18 (7), pp. 2885-2895; Almerico, A. M., Tutone, M., Pantano, L., Lauria, A. A3 adenosine receptor: Homology modeling and 3D-QSAR studies (2013) Journal of Molecular Graphics and Modelling, 42, pp. 60-72; Perricone, U., Wieder, M., Seidel, T., Langer, T., Padova, A., Almerico, A. M., Tutone, M. A Molecular Dynamics-Shared Pharmacophore Approach to Boost Early-Enrichment Virtual Screening: A Case Study on Peroxisome Proliferator-Activated Receptorα(2017) ChemMedChem, 2017, 12, 1399-1407; Pibiri, I., Lentini, L., Tutone, M., Melfi, R., Pace, A., Di Leonardo, A. Exploring the readthrough of nonsense mutations by non-acidic Ataluren analogues selected by ligand-based virtual screening (2016) European Journal of Medicinal Chemistry, 122, pp. 429-435; Tutone, M., Pantano, L., Lauria, A., Almerico, A. M. Molecular dynamics, dynamic site mapping, and highthroughput virtual screening on leptin and the Ob receptor as anti-obesity target (2014) Journal of Molecular Modeling, 20 (5), Phase, version 4.3, Schrödinger, LLC, New York, N.Y., 2015. Dixon, S. L.; Smondyrev, A. M.; Knoll, E. H.; Rao, S. N.; Shaw, D. E.; Friesner, R. A., “PHASE: A New Engine for Pharmacophore Perception, 3D QSAR Model Development, and 3D Database Screening. 1. Methodology and Preliminary Results,” J. Comput. Aided Mol. Des., 2006, 20, 647-671. and Phase software was Phase, version 4.3, Schrödinger, LLC, New York, N.Y., 2015.

(48) Models generated were measured according appropriate measures of goodness-of-fit, robustness, and predictive capability.

(49) Used statistics for goodness-of fit are: R2, SD (standard deviation), F (Fisher test), p value, RMSE (rootmean square error), Pearson-R. Used statistics to measure robustness of the model are: Q2(eq.1).

(50) q 2 = 1 - .Math. i = 1 training ( y i - ) 2 .Math. i = 1 training ( y i - y _ ) 2 Eq . 1

(51) Where y.sub.icustom character are the actual and predicted activities of the ith molecule, respectively, and y is the average activity of all molecules.

(52) Predictive capability of the models generated was assessed by means of the external validation of the test set. Used statistics for external validation are: Q2ext (eq.2), Golbraikh and Tropsha parameters R20 e R′20, and k and k′[29], r2m metrics >0.65,

(53) q ext 2 = 1 - .Math. i = 1 test ( y i - ) 2 .Math. i = 1 test ( y i - y _ ) 2 Eq . 2

(54) Where y.sub.icustom character are the actual and predicted activities of the ith molecule, respectively, y.sub.tr is the average activity of all molecules in the training set.

(55) All solvents and reagents were commercially available. All synthesized compounds were purified by chromatography and analysed by IR, HRMS, GC-MS, and NMR. Purity of synthesized compounds was verified prior to biological tests by chromatographic analyses and NMR (see supplementary material) and in all the cases purity was higher than 95%. IR spectra have been registered with a Shimadzu FTIR-8300 spectrophotometer; melting points have been determined on a Reichart-Thermovar hotstage Kofler and are uncorrected. NMR spectra have been registered on a Bruker AVANCE DMX 300 using CDCl3 and DMSO as solvent. HRMS spectra were recorded by analysing a 50 ppm solution of the compound in a 6540 UHD Accurate-Mass Q-TOF LC/MS (Agilent Technologies) equipped with a Dual AJS ESI source. GC-MS spectra have been registered by using either an Agilent 7890B/7000C GC-MS-TQ or a GC-MS Shimadzu QP-2010 Instrument. Flash chromatography was performed by using silica gel (Merck, 0.040-0.063 mm) and mixtures of ethyl acetate and petroleum ether (fraction boiling in the range of 40-60° C.) in various ratios.

(56) The QikProp program (QikProp, version 4.4, Schrödinger, LLC, New York, N.Y., 2015) was used to obtain the ADME properties of our compounds, and ATALUREN. It predicts both physically significant descriptors and pharmaceutically relevant features, such as principal descriptors and physiochemical properties. It also evaluated the drug-like acceptability of the compounds, based on Lipinski's rule of five, essential for rational drug design.

(57) Molecular Design of the new molecules has been realized by a High Throughput Virtual Screening (HTVS) of an in-house library of about 30000 molecules (I. Pibiri, L. Lentini, R. Melfi, G. Gallucci, A. Pace, A. Spinello, G. Barone, A. Di Leonardo, Enhancement of premature stop codon readthrough in the CFTR gene by Ataluren (PTC124) derivatives, Eur. J. Med. Chem. 101 (2015) 236-244; Pibiri I., Lentini L., Tutone M., Melfi R., Pace A., Di Leonardo A. Exploring the readthrough of nonsense mutations by non-acidic Ataluren analogues selected by ligand-based virtual screening, Eur. J. Med. Chem. 122 (2016) 429-435).

(58) The results disclosed in (Pibiri I., Lentini L., Tutone M., Melfi R., Pace A., Di Leonardo A. Exploring the readthrough of nonsense mutations by non-acidic Ataluren analogues selected by ligand-based virtual screening. Eur. J. Med. Chem. 122 (2016) 429-435) have been refined with 3D-QSAR (quantitative structure-activity relationships) pharmacophore modelling. The endpoint to build QSAR models was the luciferase activity known data. These values were converted to pFLUC (−log FLUC) values. In order to find the common pharmacophore hypothesis, we divided the 24 compounds in three different classes of activity related to the FLUC values (Pharm set). We considered as active, compounds with FLUC values >4.52 (ATALUREN FLUC value), as inactives, compounds with FLUC values ≤4.00, and as moderate actives, compounds with 4.39≤FLUC values ≤4,51. Dataset was randomly split into a training set (19 compounds) for models generation, and test set (5 compounds) for the validation of developed models, as reported in Table 1.

(59) TABLE-US-00001 TABLE 1 RLU values RLU values Compound Chemical name QSAR set Exp. Pred. Pharm Set Fitness ATALUREN 3-(5-(2- Test 4.528 4.58 Active 3.00 Fluorophenyl)-1,2,4- oxadiazol-3- yl)benzoic acid 1-NV1103 Methyl 3-(5-(2- Training 4.532 4.41 Active 2.94 [1] fluorophenyl)-1,2,4- oxadiazol-3- yl)benzoate) 2-NV1127 Methyl 3-(5-(3- Training 4.477 4.27 Moderate 2.79 [1] fluorophenyl)-1,2,4- oxadiazol-3- yl)benzoate) 3-NV1133 3-(5-(3- Training 4.628 4.64 Active 2.82 [1] Fluorophenyl)-1,2,4- oxadiazol-3- yl)benzoic acid 4-NV1128 Methyl 3-(5-(2,4,5- Test 4.397 4.40 Moderate 2.87 [1] trifluorophenyl)- 1,2,4-oxadiazol-3-yl) benzoate) 5-NV1173 3-(5-(2,4,5- Training 4.788 4.80 Active 2.90 [1] Trifluorophenyl)- 1,2,4-oxadiazol-3- yl)benzoic acid 6-NV1153 Methyl 3-(5-(4- Training 4.125 4.21 Inactive 2.78 [1] fluorophenyl)-1,2,4- oxadiazol-3- yl)benzoate) 7-NV1149 Methyl 3-(5-(2,3- Training 4.103 4.32 Inactive 2.91 [1] difluorophenyl)- 1,2,4-oxadiazol-3- yl)benzoate) 8-NV1170 Methyl 3-(5-(2,3- Training 4.311 4.42 Moderate 2.91 [1] difluorophenyl)- 1,2,4-oxadiazol-3- yl)ben zoate) 9-NV1175 Methyl 3-(5-(3,4- Training 4.269 4.23 Moderate 2.76 [1] difluorophenyl)- 1,2,4-oxadiazol-3- yl)ben- zoate) 10-NV1171 Methyl 3-(5-(2,4- Training 4.439 4.39 Moderate 2.90 [1] difluorophenyl)- 1,2,4-oxadiazol-3- yl)ben- zoate) 11-NV1174 Methyl 3-(5-(2,6- Training 4.414 4.31 Moderate 2.80 [1] difluorophenyl)- 1,2,4-oxadiazol-3- yl)ben- zoate) 12-NV1798 3-Toluyl, 5-(2- Training 4.178 4.18 Inactive 1.65 [1] fluorophenyl)-1,2,4- oxadiazole 13-NV1951 Methyl 3-(5- Training 4.008 4.09 Inactive 2.71 [1] (perfluorophenyl)- 1,2,4-oxadiazol-3- yl)benzoate) 14-NV1954 3-(5- Test 4.171 4.25 Inactive 2.74 [1] (Perfluorophenyl)- 1,2,4-oxadiazol-3- yl)benzoic acid 15-NV1859 3-(2′-pyridyl)-5-(3′- Training 4.363 4.25 Moderate 2.77 [2] cyanophenyl)-1,2,4- oxadiazole 16-NV1861 3-(4′-pyridyl)-5-(3′- Training 4.250 4.24 Moderate 2.76 [2] toluyl)-1,2,4- oxadiazole 17-NV1879 3-(3′-pyridyl)-5-(3′- Training 4.411 4.40 Moderate 2.78 [2] toluyl)-1,2,4- oxadiazole 18-NV1883 3-(3′-phenyl)-5-(3′- Training 4.428 4.37 Moderate 2.76 [2] toluyl)-1,2,4- oxadiazole 19-NV1894 3-(3-toluyl), 5-(2- Test 4.250 4.37 Moderate 2.78 [2] toluyl)-1,2,4- oxadiazole 20-NV1905 3-(3-toluyl), 5-(3- Training 4.181 4.19 Inactive 2.74 [3] toluyl)-1,2,4- oxadiazole 21-NV1898 3-(2-pyridyl)-5-(3′- Training 4.551 4.54 Active 2.76 [2] toluyl)-1,2,4- oxadiazole 22-NV1919 3-(4′-pyridyl)-5-(3′- Test 4.253 4.27 Moderate 2.80 [2] anisoyl)-1,2,4- oxadiazole 23-NV1940 3-(2-pyridyl)-5-(3′- Training 4.000 3.99 Inactive 1.66 [2] anisoyl)-1,2,4- oxadiazole

(60) In table 1 the compounds listed in the first column and labeled with the compounds named [1] are those disclosed in I. Pibiri, L. Lentini, M. Tutone, R. Melfi, A. Pace, A. Di Leonardo, “Exploring the readthrough of nonsense mutations by non-acidic Ataluren analogues selected by ligand-based virtual screening” Eur. J. Med. Chem., 2016, 122, 429-435.

(61) In table 1 the compounds listed in the first column and labeled with the compounds named [2] are those disclosed in I. Pibiri, L. Lentini, R. Melfi, G. Gallucci, A. Pace, A. Spinello, G. Barone, A. Di Leonardo, “Enhancement of premature stop codon readthrough in the CFTR gene by Ataluren (PTC124) derivatives”. Eur. J. Med. Chem., 2015, 101, 236-244.

(62) In table 1 the compounds listed in the first column and labeled with the compounds named [3] are unpublished data.

(63) Following Table 2 shows, wherein SD: standard deviation; F: Fisher test; P, significance level of variance ratio; RMSE: root mean square error.

(64) TABLE-US-00002 TABLE 2 ID SD R.sup.2 F P RMSE Pearson-R Hypo.7 0.1023 0.81 20.7 1.39E−02 0.0672 0.9482 Hypo.8 0.104  0.80 19.8 1.76E−02 0.0941 0.9077

(65) Following Table 3 shows the predictive capability values of models.

(66) TABLE-US-00003 TABLE 3 Hypo Q.sup.2 Q.sup.2ext R.sup.2 R.sup.2.sub.0 R.sup.′2.sub.0 R.sup.2.sub.m (R.sup.2—R.sup.2.sub.0/R.sup.2) (R.sup.2—R.sup.′2.sub.0/R.sup.2) k k′ Hypo.7 0.720 0.714 0.805 0.851 0.821 0.617 −0.064 −0.026 0.987 1.012 Hypo.8 0.451 0.611 0.798 1.263 0.708 0.253 −0.583 0.112 0.982 1.017

(67) The models have been robustly validated, and Hypo.7 showed the best predictive capability, as showed in FIG. 1 and in Table 3.

(68) Hypo.7 have been used as starting point to perform a new highthroughput virtual screening on an in-house database. From the top 5% of retrieved hits with the hypothesis, 58 Compounds have been prepared and tested.

(69) The synthesis has been realized by optimized synthetic protocols and the reactions have been monitored by TLC (Thin Layer Chromatography). All the new synthesized compounds have been purified by column preparative chromatography performed with silica gel (Merck, 0.040-0.063 mm), by using mixtures of petroleum (fraction boiling in the range 40-60° C.) and Ethyl acetate as eluent.

(70) Further purification was realized by crystallization. All the synthesized compounds have been analysed by spectroscopic techniques such as 1H-NMR, 13C-NMR, UV, IR, GC-MS, to assess their molecular structure and their purity grade.

(71) The synthesis and characterization of compounds NV914 2,3,4,5,6-pentafluoro-N-(5-(perfluorophenyl)-1,2,4-oxadiazol-3-yl)benzamide and NV930 ethyl 5-phenyl-1,2,4-oxadiazole-3-carboxylate is reported.

(72) The synthesis and crystal structure of NV848 (3-acetylamino-5-methyl-1,2,4-oxadiazole) has been reported in the literature by some of the inventors of the present invention (N. Vivona, M. Ruccia, G. Cusmano, M. L. Marino, D. Spinelli, The thermally degenerate mononuclear rearrangement of 3-acetylamino-5-methyl-1,2,4-oxadiazole, J. Heterocycl. Chem. 1975, 12, 1327-1328; A. Mugnoli, G. Barone, S. Buscemi, C. Z. Lanza, A. Pace, M. Pani, D. Spinelli, On the structure of 3-acetylamino-5-methyl-1,2,4-oxadiazole and on the fully degenerate rearrangements (FDR) of its anion: a stimulating comparison between the results of in-silicon chemistry’ and laboratory chemistry’, Journal of Physical Organic Chemistry (2009), 22(11), 1086-1093; A. Pace, I. Pibiri, A. Palumbo Piccionello, S. Buscemi, N. Vivona, G. Barone, Experimental and DFT Studies on Competitive Heterocyclic Rearrangements. Part 2:1 A One-Atom Side-Chain versus the Classic Three-Atom Side-Chain (Boulton-Katritzky) Ring Rearrangement of 3-Acylamino-1,2,4-oxadiazoles, Journal of Organic Chemistry (2007), 72(20), 7656-7666.).

(73) NV930, already reported in the literature, has been prepared by a different synthetic procedure: NV930 has been prepared by the classic amidoxime route: The amidoxime 1 (0.3 g) (prepared as reported in (P. S. Branco, S. Prabhakar, A. M. Lobo, D. J. Williams, “Reactions of hydroxylamines with ethyl cyanoformate. preparation of aminonitrones and their synthetic applications.” tetrahedron 1992, 48, 6335-6360)) was dissolved in 50 mL of toluene in a 250 mL round bottomed flask. Then, 1.2 eq. of the appropriate aroyl chloride and 1.2 eq. of pyridine were added and the reaction mixture was refluxed for 6-8 h monitoring the reaction by TLC until consumption of starting material. The solvent was removed under vacuum and water was added to the residue. Extraction with ethyl acetate and chromatographic separation on silica gel using mixtures of petroleum ether and ethyl acetate as eluent allowed to obtain the desired oxadiazole, further purified by crystallization.

(74) Reaction Yield 80%, MP 50-52° C., from Ethanol. 1H NMR (300 MHz, CDCl3) δ: 8.22 (d, J=7.2 Hz, 2H), 7.64 (t, J=7.4 Hz, 1H), 7.55 (t, J=7.4 Hz, 2H), 4.55 (q, J=7.1 Hz, 2H), 1.47 (t, J=7.1 Hz, 3H). FT-IR cm-1, 1720. HRMS for C11H10N2O3 found 219.0699 [M+H]+ (Calcd. 219.0691).

(75) ##STR00007##

(76) NV914 has been prepared by acylation with perfluorobenzoyl chloride of the amine 2, the latter reported in (Buscemi, Silvestre; Pace, Andrea; Pibiri, Ivana; Vivona, Nicolo; Caronna, Tullio, “Fluorinated heterocyclic compounds: an assay on the photochemistry of some fluorinated 1-oxa-2-azoles: an expedient route to fluorinated heterocycles” Journal of Fluorine Chemistry (2004), 125(2), 165-173, Buscemi, Silvestre; Pace, Andrea; Frenna, Vincenzo; Vivona, Nicolo “A generalized synthesis of 3-amino-5-aryl-, 3-amino-5-polyfluorophenyl-, and 3-amino-5-alkyl-1,2,4-oxadiazoles through ring-degenerate rearrangements” Heterocycles (2002), 57(5), 811-823; Buscemi, S.; Pace, A.; Calabrese, R.; Vivona, N.; Metrangolo, P.” Fluorinated heterocyclic compounds. A photochemical synthesis of 3-amino-5-perfluoroaryl-1,2,4-oxadiazoles” Tetrahedron (2001), 57(27), 5865-5871).

(77) 1.2 eq. of perfluorobenzoyl chloride and 1.2 eq. of pyridine were added to the amine dissolved in toluene, and the reaction mixture was refluxed for 4 h monitoring the reaction by TLC until consumption of starting material. The solvent was removed under vacuum and water was added to the residue. Extraction with ethyl acetate and chromatographic separation on silica gel using mixtures of petroleum ether and ethyl acetate as eluent allowed to obtain the desired product, further purified by crystallization.

(78) Reaction Yield 90%, MP 208-210° C., from Ethanol. 1H NMR (300 MHz, CDCl3) δ: 9.09 (s, 1H), FT-IR cm-1, 3290, 3180, 1750. HRMS for C15HF10N3O2 found 445.9917 [M+H]+ (Calcd. 445.9909).

(79) ##STR00008##

Example 2 In Vitro Tests

(80) To ascertain the effectiveness of the newly synthesized ataluren analogues in promoting the readthrough of premature termination codons was used the FLuc cell-based assay. To this aim HeLa cells were transfected transiently with the plasmids pFLuc-wild type (control) and pFLuc-opal (UGA stop mutation) (NIH Chemical Genomics Center, National Institutes of Health, Bethesda, USA). FLuc gene expression was then measured by luminescence. HeLa cells transfected with the pFluc-wild type plasmid showed high levels of luciferase activity confirming the functioning of the assay. pFluc-opal cells did not show any activity but, after 24 hours from transfection, they were treated, for additional 24 hours, with ataluren and 58 different ataluren analogues all at the same concentration of 12 μM. Following treatment a significant increase of luciferase activity, if compared to untreated, with: NV848, NV914, NV930 was observed as shown in FIG. 2.

(81) To work in a cell system containing exclusively nonsense mutations and in particular the more representative CFTR nonsense mutation, the G542X, FRT cells were engineered with a vector expressing nsCFTR (nonsense). To this aim, Site Directed Mutagenesis of the full-length CFTR cDNA cloned in the pTracer-Zeocin (pTCF-wild type) vector (Gaslini Hospital Genova, Italy) was performed (CFTR DNA available at NCBI Reference Sequence: NG_016465.4). To substitute the Glicine 542 coding codon GGA with a stop codon, was introduced a single nucleotide mutation. The first guanine of the codon, position 1624 of the cDNA, was changed in a thymine to introduce an opal nonsense mutation. We amplified the plasmid harbouring cDNA with the following primers:

(82) TABLE-US-00004 g1624tup (reverse) SEQ ID NO. 1: 5′-tgattccaccttctcaaagaactatattgtctttctctgcaaac-3′ g1624tdw (forward) SEQ ID NO.2: 5′-gtttgcagagaaagacaatatagttctttgagaaggtggaatca-3′

(83) Treatment with DpnI restriction enzyme (target: 5′Gm6ATC3′) removed methylated parental DNA (isolated from dam+ E. coli). Newly synthesized plasmids were transformed into XL1-Blue competent cells. We obtained 11 colonies, all confirmed to bring the pTracer-CFTR plasmid by colony PCR performed with two primers perfectly annealing to the template at 52° C.: SEQ ID NO. 3: 5′-ctaatgagaaacggtgtaag-3′ CFTRup2 reverse primer and: SEQ ID NO. 4: 5′-ggtgattatgggagaactgg-3′ CFTRdw1 forward primer, as shown in FIG. 3.

(84) clone1 was selected for further characterization by “selective PCR”. A forward primer SEQ. ID NO. 5 5′-gagaaagacaatatagttcttt-3′ CFTR1624opaldw, with 3′ termini matching only to mutant nucleotide allows amplification of the corresponding mutant target DNA and not of wild type DNA, when the right selective PCR conditions are used. We performed reactions with a thermostable DNA polymerase lacking 3′ to 5′ proofreading activity (DyNAzyme™ II DNA Polymerase), identical amount of purified plasmid DNA, either wild type or mutagenized, and the reverse primer SEQ. ID. NO. 3: 5′ ctaatgagaaacggtgtaag 3′ CFTRup2.

(85) To distinguish between mutant and wild type DNA, was used a gradient thermocycler and the following primer annealing temperatures: 44, 46, 48, 50 and 52° C. Positive controls (C+) were included where the same DNAs were amplified with the CFTRup2/CFTRdw1 primers (annealing T 52° C.)

(86) A DNA fragment of the correct size was amplified where expected, either in clone-1 or wild type DNA and in positive controls, as shown in FIG. 4.

(87) In the case of Clone1 when the selective forward primer was used, the amplification efficiency was the same at any annealing T. In the case of wild type DNA, amplification product amount decreased as the T raised, until it became almost undetectable at 52° C., thus suggesting that Clone1 was positive to mutagenesis. Successful mutagenesis was finally confirmed by sequencing (BRM genomics, Padova, Italy).

(88) To further evaluate the efficacy of NV914, NV848, NV930, FRT cells were transfected with the pTRACER vectors containing either the wild type CFTR or the nsCFTR(G542X-opal) cDNA and selected by Zeocin resistance. The advantage of the use of these cells is that they don't express cAMP dependent channels (as CFTR) or CFTR protein. The expression of the human CFTR wild type and nsCFTR(G542X-opal) in transfected FRT cells was evaluated by qRT-PCR and Western blot, as shown in FIG. 5.

(89) The same FRT cells were then treated with NV914, NV848, NV930 (12 μM), and ATALUREN (12 μM) (as positive control) for 24 hours and the expression of the human CFTR wild type and nsCFTR(G542X-opal) was again evaluated by immunofluorescence analysis. Immunofluorescence microscopy images allow to visualize CFTR localization at the cell membrane suggesting the occurrence of translation readthrough and proper localization also in this cell type after treatment.

(90) The results showed that the exposition of nsCFTR(G542X-opal) FRT cells to the compounds induced the CFTR full-length expression and membrane localization, in particular for compounds NV930 and NV914.

(91) HeLa cells were used to determine the possible cytotoxic effects of our compounds and the impact on cell proliferation. In FIG. 7 are reported the percentages of dead cells and proliferating cells after treatment with 12 μM compounds and 12 μM ATALUREN. The results showed that the compounds and ATALUREN induce alight increase in dead cells at 24 h (ATALUREN: 4%; NV848: 7; NV914: 5; NV930: 2) and 72 h (ATALUREN: 7%; NV848: 6; NV914: 2; NV930: 4 that was constant in the time. Was observed that HeLa cells proliferate as untreated cells when treated daily (every 24 h) for 10 days with our compounds.

(92) In the attempt to predict absorption, distribution, metabolism, and excretion (ADME) for the compounds, these was submitted to Qikprop calculations.

(93) Regarding ADME predictions the final result is expressed in terms of #stars, Number of property or descriptor values that fall outside the 95% range of similar values for known drugs large number of stars suggests that a molecule is less drug-like than molecules with few stars. The following properties and descriptors are included in the determination of #stars: MW, dipole, IP, EA, SASA, FOSA, FISA, PISA, WPSA, PSA, volume, #rotor, donorHB, accptHB, glob, QPpolrz, QP log PC16, QP log Poct, QP log Pw, QP log Po/w, log S, QPLogKhsa, QP log BB, #metabol, as shown in the following Table 4 wherein all the calculated values for the compounds were compared with the calculated values for ataluren.

(94) TABLE-US-00005 TABLE 4 #stars MW Dipole IP(eV) EA(eV) SASA FOSA FISA molecule (0-5) (130-725) (1.0-12.5) (7.9-10.5) (−0.9-1.7) (300-1000) (0-750) (7.0-330) PTC124 1 284.246 1.915 9.725 1.341 520.123 0 154.63 NV 0848 0 141.129 4.608 9.956 0.619 345.739 178.407 146.87 NV 0914 3 445.176 4.123 10.476  2.313** 591.639 0 101.555 NV 0930 1 218.212 2.767 9.953 1.238 478.415 140.814 115.047 PISA WPSA PSA Volume #rotor donorHB accptHB Glob molecule (0-450) (0-175) (7-200) (500-2000) (0-15) (0-6) (2-20) (0.75-0.95) PTC124 333.429 32.065 85.12 866.815 1 1 5 0.8453 NV 0848 20.461 0 80.17 518.729 1 1 5.5 0.90305 NV 0914 117.841 372.242 71.024 1002.895 2 1 5.5 0.81899 NV 0930 222.554 0 74.776 764.735 2 0 5 0.84534 QPpolrz QPlogPC16 QPlogPoct QPlogPw QPlogPo/w QPlogKhsa QPlogBB #metab molecule (13-70) (4-18) (8-35) (4-45) (−2.0-6.5) (−1.5-1.5) (−3.0-1.2) (1-8) PTC124 31.078 9.63 14.802 10.471 2.6 −0.174 −0.861 0 NV 0848 14.159 4.306 9.061 8.351 −0.567 −0.884 −0.697 1 NV 0914 33.823 6.818 17.188 9.207 4.127 0.192 0.347 0 NV 0930 25.292 7.491 10.819 7.651 1.733 −0.584 −0.63 0

(95) In table 4 MW, molecular weight; IP, PM3 calculated ionization potential (negative of HOMO energy); EA, PM3 calculated electron affinity (negative of LUMO energy); SASA, Total solvent accessible surface area (SASA) in square angstroms using a probe with a 1.4 Å radius; FOSA, Hydrophobic component of the SASA (saturated carbon and attached hydrogen); FISA, Hydrophilic component of the SASA (SASA on N, O, H on heteroatoms, carbonyl C); PISA, (carbon and attached hydrogen) component of the SASA; WPSA, Weakly polar component of the SASA (halogens, P, and S); Volume, Total solvent-accessible volume in cubic angstroms using a probe with a 1.4 Å radius; #rotor, number of rotatable bonds; donorHB, number of h-bond donor, accptHB, number of H-bond acceptor; glob, Globularity descriptorcustom character (4=2) custom character (SASA) custom character where r is the radius of a sphere with a volume equal to the molecular volume; QPpolrz, Predicted polarizability in cubic angstroms, QP log PC16, Predicted hexadecane/gas partition coefficient; QP log Poct, Predicted octanol/gas partition coefficient; QP log Pw, Predicted water/gas partition coefficient; QP log Po/w, Predicted octanol/water partition coefficient; QP log Khsa, Prediction of binding to human serum albumin; QP log BB, Predicted brain/blood partition coefficient; #metab, Number of likely metabolic reactions.

(96) Furthermore, the compounds respect the Lipinski's rule of five, and they have a predicted human oral absorption between 70 and 100%.

(97) It was also evaluated the production of FRT cells expressing nonsense-CFTR (nsCFTR) and the CFTR expression and functionality after treatment with NV848, NV914 and NV930.

(98) FRT cells transfected with a pTracer nsCFTR-G542X-opal vector the treated with NV848, NV914, NV930 (12 μM), and ATALUREN (12 μM) as positive control, for 24 hours and the expression of the human CFTR wild type and nsCFTR (nsCFTR-G542X-opal) was evaluated by immunofluorescence analysis.

(99) In details, immunofluorescence analysis was used to detect the CFTR protein following the readthrough of the UGA stop codon in nsCFTR(opal) FRT cells untreated, treated with G418 as positive contro) and with PTC124 and NV848, Nv914, NV930 for 24 h. CFTR protein was revealed by a specific antibody targeting its first external portion and a secondary antibody (SC2092-red). Nuclei (blue) were DAPI stained.

(100) Immunofluorescence microscopy images allowed to visualize CFTR localization at the cell membrane suggesting the occurrence of translation readthrough and proper localization also in this cell type after treatment, and the results showed that the exposition of nsCFTR(G542X-opal) FRT cells to the NV848, NV914, NV930 compounds induced the CFTR full-length expression and membrane localization.

(101) Moreover, by Western blot analysis was detected the amount of CFTR protein after translation readthrough in nsCFTR(G542X-opal) FRT cells treated with NV848, NV914, NV930 (12 μM). In details, Western blot analysis was used to detect CFTR protein in bronco-epithelial BE (cells and in transfected FRT cells (FRT-CFTR(gG542X-opal) untreated and treated with PTC124 and and NV848, NV914, NV930, for 24 hours and β-tubulin was used as control for the protein loading.

(102) To ascertain the functionality of the re-expressed CFTR protein, produced after exposure to the compounds, a quench-EYFP assay was performed. This assay is based on iodide-mediated quenching rates of an ectopically expressed mutant form of the Yellow fluorescent protein (YFP). To this aim, nsCFTR(G542X-opal) FRT-cells were transfected with the plasmid pCDNA3.1 EYFP (M148Q; I152L) and selected for the resistance to the G418 antibiotic. Cells were plated in a 6 well plate one day before the experiment, they were stimulated with forskolin (20 μM) for 20 min and placed in a buffer containing iodide (PBS1× similar buffer, NaCl is replaced by equimolars of NaI). Changes in fluorescence intensity were monitored by a Zeiss fluorescence microscope and the images were recorded every 1.5 s with a CCD digital camera (AxioCam, Zeiss). The same analysis was performed by measuring the changes in fluorescence intensity by a fluorimeter confirming the activity of the CFTR channel in these cells.

(103) FRT cells were also engineered with a vector expressing nsCFTR (nonsense). To this aim, Site 15 Directed Mutagenesis of the full-length CFTR cDNA cloned in the pTracer Zeocin (pTCF-wild type) vector (provided by Gaslini Hospital Genova, Italy) was performed, the CFTR DNA is available at NCBI Reference Sequence NG_016465.4. With the aim of introducing in the CFTR cDNA single base mutations c1654t or c1657t to convert, respectively, Glycin 552 (caa>taa ochre) or Arginine 553 (cga>tga opal) in nonsense codons, site-directed mutagenesis of the full-length cDNA cloned in the pTracer Zeocin (pTCF-wild type) vector (provided by Gaslini Hospital Genova, Italy) was performed (CFTR DNA available at NCBI Reference Sequence: NG_016465.4). The pTCF-wild type vector was amplified by PCR with the following primers:

(104) TABLE-US-00006 Q552X och dw forward, SEQ. ID No. 6 gaatcacactgagtggaggttaacgagcaagaatttcttta Q552X och up reverse SEQ. ID No. 7 taaagaaattcttgctcgttaacctccactcagtgtgattc or R553X op dw forward, SEQ. ID No. 8 aatcacactgagtggaggtcaatgagcaagaatttctttag R553X op up reverse SEQ. ID No. 9 ctaaagaaattcttgctcattgacctccactcagtgtgatt

(105) Treatment with DpnI restriction enzyme (target: 5′Gm6ATC3′) removed methylated parental DNA (isolated from dam+ E. coli). Newly synthesized plasmids were transformed into XL1-Blue competent cells. We obtained 11 colonies from Q552X reaction and 12 from R553X. All were confirmed to bring the pTracer-CFTR plasmid by colony PCR, performed with two primers perfectly annealing to the template at 56° C.:

(106) TABLE-US-00007 CFTRup2 reverse primer SEQ. ID No. 10 Ctaatgagaaacggtgtaag and CFTRdw1 forward primer SEQ. ID No. 11 ggtgattatgggagaactgg

(107) Q552X clone 1 and R553X clone 18 were selected for further characterization by selective PCR, based on the use of the CFTRup2 reverse primer SEQ. ID No. 9 paired with the following selective forward primers:

(108) TABLE-US-00008 c1654tdw for Q552X SEQ. ID No. 12 aatcacactgagtggaggtt or c1657tdw for R553X SEQ. ID No. 13 cacactgagtggaggtcaat

(109) They harbor a 3′ termini matching only to mutant nucleotides, which allow the amplification of the mutant target DNA and not of wt DNA by a thermostable DNA polymerase lacking 3′ to 5′ proofreading activity (DyNAzyme™ II DNA Polymerase). Primer annealing temperatures ranging from 48 to 56° C. were used. Amplification efficiency, of mutant clones 1 and 18 was the same at any annealing T (Ta) while in the case of wt template DNA, it decreased as the Ta raised (380 bp amplicon became almost undetectable at 56° C.). This suggested that both clones were positive to mutagenesis. A DNA fragment of 608 bp was amplified in positive controls, as expected. Successful mutagenesis was confirmed by sequencing (BRM genomics):

(110) To further evaluate the efficacy of NV848, NV914 and NV930 FRT cells were transfected with the pTracer vectors containing either the WT-CFTR (CFTRWT) or the R553X-CFTR and the Q552X-CFTR (nsCFTR-R553X-opal, nsCFTR-Q552X ochre) human cDNA and selected by Zeocin resistance. The expression of the CFTRWT and nsCFTR CFTR (nsCFTR-R553X-opal, nsCFTR-Q552X ochre) in transfected FRT cells was evaluated by qRT-PCR. The nsCFTR-Q552X ochre, nsCFTR-R553X-opal FRT transfected cells were treated with NV848, (12 μM), and ATALUREN (12 μM) as positive control, for 24 hours and the expression of the human CFTR was evaluated by immunofluorescence analysis. Immunofluorescence microscopy images showed that the exposition of the nsCFTR-R553X-opal, nsCFTR-Q552X ochre FRT cells to the NV848, NV914, NV930 compounds induced the CFTR full-length expression and membrane localization.