FUSION PROTEIN

20210386850 · 2021-12-16

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to fusion proteins, and to the use of fusion proteins (or genetic constructs or vectors encoding such fusion proteins) to vaccinate against viral infections. The invention extends to pharmaceutical compositions comprising such fusion proteins or constructs for preventing and treating viral infections, and to methods and uses thereof.

    Claims

    1. A fusion protein comprising an antigen, and a Paramyxovirus or Orthomyxovirus transmembrane domain (TMD) and/or a Paramyxovirus or Orthomyxovirus cytoplasmic tail (CT).

    2. The fusion protein according to claim 1, wherein the antigen is a viral antigen, and wherein the TMD and/or CT is derived from a different virus from that of the viral antigen.

    3. The fusion protein according to claim 1, wherein the antigen is derived from an envelope virus selected from the group consisting of: Retroviridae; Togaviridae; Arenaviridae; Flaviviridae; Orthomyxoviridae; Paramyxoviridae; Bunyaviridae; Rhabdoviridae; Filoviridae; Coronaviridae; Bornaviridae; and Arteriviridae.

    4. The fusion protein according to claim 1, wherein the Paramyxovirus is selected from the group consisting of: Rubulavirus; Parainfluenzavirus 5; Parainfluenzavirus 2; Parainfluenzavirus 3; Respirovirus; Morbillivirus; Henipavirus; Avulavirus; Pneumovirus; and Metapneumovirus and/or the orthomyxovirus is be selected from the group consisting of: influenza virus A; influenza virus B; and influenza virus C.

    5. The fusion protein according to claim 1, wherein the fusion protein comprises a viral antigen and a Parainfluenzavirus 5 or Rubulavirus TMD and a Parainfluenzavirus 5 or Rubulavirus CT.

    6. The fusion protein according to claim 1, wherein the fusion protein comprises an amino acid sequence substantially as set out in SEQ ID NO: 5, or a biologically active variant or fragment thereof, or is encoded by a nucleic acid comprising a nucleotide sequence substantially as set out in SEQ ID NO: 6, or a variant or fragment thereof.

    7. The fusion protein according to claim 1, wherein the fusion protein comprises an amino acid sequence substantially as set out in SEQ ID NO: 7, or a biologically active variant or fragment thereof, or is encoded by a nucleic acid comprising a nucleotide sequence substantially as set out in SEQ ID NO: 8, or a variant or fragment thereof.

    8. A fusion protein suitable for forming a virus like particle (VLP), the fusion protein comprising a Paramyxovirus or Orthomyxovirus matrix protein and a membrane targeting signal (MTS).

    9. The fusion protein according to claim 8, wherein the matrix protein is a paramyxovirus matrix protein selected from the group consisting of: Rubulavirus; Parainfluenzavirus 5; Parainfluenzavirus 2; Parainfluenzavirus 3; Respirovirus; Morbillivirus; Henipavirus; Avulavirus; Pneumovirus; and Metapneumovirus, or the matrix protein is a Orthomyxovirus matrix protein and is selected from the group consisting of: influenza virus A; influenza virus B; and influenza virus C.

    10. The fusion protein according to claim 8, wherein the MTS is selected from the group consisting of: SEQ ID No: 9; SEQ ID No: 10, SEQ ID No: 11 and SEQ ID No: 12, or a variant or fragment thereof.

    11. The fusion protein according to claim 8, wherein the fusion protein comprises an amino acid sequence substantially as set out in SEQ ID NO: 13, or a variant or fragment thereof, or is encoded by a nucleic acid comprising a nucleotide sequence substantially as set out in SEQ ID NO: 14, 15 or 16, or a variant or fragment thereof.

    12. The fusion protein according to claim 8, wherein the fusion protein comprises an amino acid sequence substantially as set out in SEQ ID No: 17, or a biologically active variant or fragment thereof, or is encoded by a nucleic acid comprising a nucleotide sequence substantially as set out in SEQ ID NO: 18, 19 or 20, or a variant or fragment thereof.

    13. A virus like particle (VLP) comprising the fusion protein according to claim 8.

    14. A method of producing a virus like particle (VLP) according to the claim 13, the method comprising expressing a nucleic acid encoding the fusion protein of claim 8 in a host cell.

    15-31. (canceled)

    Description

    [0164] For a better understanding of the invention, and to show how embodiments of the same may be carried into effect, reference will now be made, by way of example, to the accompanying Figures, in which:—

    [0165] FIG. 1 shows the MTS-M, HIV Env-F chimera and Virus-Like Particles (VLPs) structure. (A) Diagram representing the Env-F chimera protein using the extracellular domain of HIV-1 Envelope (Env) and the transmembrane domain (TMD) and cytoplasmic tail (CT) of Mumps or PIV5 for pseudotyped VLPs. (B) Schematic structure of the VLPs using 3 proteins on the left sketch and 2 on the right sketch. M, NP and MTS-M are derived from PIV5 or Mumps.

    [0166] FIG. 2 shows that MTS-Matrix+Env-F chimera is sufficient to produce VLPs. (A) Western blot analyses of Mumps VLPs produced in HEK293T.17 cells using different ratios (w:w) of plasmids expressing (see table on the left): Env-F 1086C-MuV; M, matrix; NP; nucleoprotein; pcDNA3 empty. Densitometry analyses was performed and results for Env specific signal is reported in the middle panel with n=2. AU: arbitrary unit. (B) Same as in (A) using different ratios (w:w) of MTS-M (membrane targeting signal-matrix) MuV and Env-F 1086C-MuV (n=1) (C) Western blot analysis of PIV5 and MuV pseudotyped VLPs. ConSOSLUFO.P1V5 (ConS.PIV5) was tested in combination with the matching M+NP or MTS-M from PIV5 as well as with MTS-M MuV and pcDNA3 empty. (D) Densitometry analysis of the Env specific and PIV5 matrix specific signal from the VLP western blot in (C), with n=3. Error bars represent means+/−SEM.

    [0167] FIG. 3 shows that MuV MTS-Matrix can produce VLPs with a native HIV-1 truncated Env. VLPs were produced using different ratios (w:w) of plasmids Env (ConSOSLUFO.750) and MTS-M MuV. Western blots were analysed by densitometry and Env specific and MTS-M specific signal are plotted and normalized to the 1:1 ratio condition. n=1 experiment.

    [0168] FIG. 4 shows that Env-F chimeras preserve the original HIV-1 Env ectodomain structure. (A) Flow cytometry analysis of HEK293T.17 cells transfected with Env-F chimera 1086C-PIV5 and 1086C-MuV or the matching wild type 1086C clade C HIV-1 Env truncated at position 712 (1086C.712) or full length Env (1086C gp160). Cells were stained with a panel of monoclonal antibodies (mAb) specific for different domains of Env and a negative control included (pcDNA3 empty). (B) Flow cytometry analysis of Env-F pseudotyped using a stabilized HIV-1 Env (ConSOSLUFO.750) that binds preferentially broadly neutralizing antibodies. The mean fluorescence intensity values were normalized to 2G12 mAb. mAb are found on the x-axis and organized by Env domain specificity. ConS.MuV_T2A_MTS.M.MuV co-expresses ConSOSL.UFO.MuV along with MTS-Matrix MuV from the same transcript where the two proteins are separated by a virally derived (T2A) self-cleavage peptide.

    [0169] FIG. 5 shows Env quantification and antigenic profile of the Env-F on VLPs. (A) Diagram representing the different type of VLPs. The red Env represents ConSOSLUFO.750. The Env-F and MTS-M (inner plain circles) are purple for MuV and yellow for PIV5. The ratio (w:w) used for transfection of HEK293T.17 cells when two vectors are used is indicated in brackets. (B) Quantification of the Env on the surface of the VLPs1-4 by capture ELISA using GNL for capture and ConSOSL.UFO.664 gp140 Env protein as stantard. (C) Evaluation of the VLP Env antigenicity by GNL capture ELISA for VLP1-4. 10E9 VLPs for each type of VLPs were captured and monoclonal antibodies specific for Env used at 10 μg/mL. (D) The VLP size distribution and number were characterized on a Nanosight instrument using Nanoparticle Tracking Analysis. The mean diameter of each type of VLP is indicated for the measurement displayed. (E) VLP1, VLP2, VLP4 and VLP5, as well as exosomes (from pcDNA3 empty vector transfected cells), from 6 triple layered T-175 flasks of transfected HEK293T.17 cells were purified by ultracentrifugation through a 20% sucrose cushion and their size analyse on a Nanosight. Particle size mean (black bars) and mode (white bars) in nm are depicted. Error bars represent mean±SEM with n≥3 for the VLPs and n=2 for the exosomes. (F) The total yields of VLPs and exosomes from the same productions as in part (E) are plotted. Error bars represent mean±SEM with n≥3 for the VLPs and n=2 for the exosomes, Welch's t-test with *p<0.05.

    [0170] FIG. 6 shows that the VLPs are immunogenic without adjuvant and induce a Th2 type response in a mouse model. For subparts A-C, groups of n=5 mice were immunized intramuscularly with VLP1 to 4 three times at 3 weeks intervals with different VLP doses: 10E8, 10E9, 10E10 and 20E10 particles/injection. Serum samples were collected before each injection and before culling the animals. (A) Env specific IgG titers were determined by ELISA using the matching ConSOSL.UFO.664 gp140 Env protein. (B) Env specific IgG1 and IgG2a responses were assessed by ELISA and reported here as the IgG2a:IgG1 ratio as a surrogate for determining the type of T helper response. (C) The serum specific IgG responses against matrix PIV5 and matrix MuV were determined by ELISA for VLP2, VLP3 and VLP4 immunized animals. (D) Group of n=5 mice were immunized intramuscularly 3 times at 3 weeks intervals with VLP1 (10E8, 10E9 and 10E10 particles) plus AddaVax adjuvant (1:1, v:v ratio). Dashes lines: VLP1+AddaVax; Plain lines: VLP1 no adjuvant.

    [0171] FIG. 7 shows that the IgG subtype response varies upon Env, MTS-Matrix or Env-T2A-MTS-Matrix DNA prime-VLP boost regimens and shows evidence of intrastructural help from MTS-Matrix DNA primed grouped. 9 groups of n=5 mice were primed twice at week 0 and week 3 with different DNA plasmids expressing Env (solube: Env 664; membrane-boud: Env 750), MTS-M MuV, MTS-M PIV5 or Env-F-T2A-MTS-M (PIV5 or MuV pseudotyped) and then received VLP boosts (10E10 particles+AddaVax adjuvant) at week 6 and 9, except one group receiving a total of 3 injections with ConS.MuV-T2A-MTS-M MuV (see immunization schedule in (B)). (A) Diagram of the different VLPs used with colour code as in FIG. 6A. (B) The IgG2a:IgG1 ratio for Env specific response is presented. It is used as a surrogate measure of the type T helper response induced by the different regimens throughout the immunization schedule. (C) Env specific IgG titers determined by ELISA. (D) Matrix specific IgG response for MuV (group 3, 4, 6, 7 and 9) and PIV5 (group 5 and 6). (E) IFNg specific Env ELISpost. Isolated splenocytes were stimulated with Env peptide pool for 16 hr. (F) IFNg specific matrix response. Isolated splenocytes were stimulated with either MuV matrix peptide pool or PIV5 matrix peptide pool for 16 hr. Grey arrows: immunization. (G) Comparison of the Env specific IgG response induced by VLP1 purified on a 100 kDa MWCO columns (VLP1 100 kDa) (10E10 particles+AddaVax) and VLP1 purified by ultracentrifugation (VLP1 UC) (10E10 particles+AddaVax) after 1 injection (left panel). The remaining 4 panels display the Env IgG titers of group 3 (Gp3), 4 (Gp4) and 5 (Gp5) following the 1st VLP injection which are compared to the Env specific IgG titers induced by 1 injection of VLP1 UC, VLP2 UC, VLP4 UC or VLP UC (10E10 particles+AddaVax). The same batch of VLPs UC were used for the DNA prime-VLP boost study and the VLP UC+AddaVax immunization

    study. Box and whiskers, min to max. Mann-Whitney test with *p<0.05, **p<0.01, ns=non significant.

    [0172] FIG. 8 shows that VLPs can be produced from by mixing separate expressing vectors coding for Env-F and MTS-Matrix and also that VLPs can be produced from a single pDNA coding for a gene bearing both Env-F and MTS-Matrix (pDNA Env-F-T2A-MTS-Matrix). The advantage of pDNA Env-F-T2A-MTS-Matrix that it produced one transcript bearing both Env-F and MTS-Matrix coding sequence which once translated is self-cleaved to free the MTS-Matrix from the Env-F. This ensures that if delivered as a nucleic acid vaccine, both proteins will be expressed in the same cells and never separately.

    EXAMPLE

    Materials and Methods

    Plasmid DNA Vectors

    [0173] Plasmid DNA (pDNA) vectors expressing HIV-1 Env constructs, Env-F MuV chimera, Env-F PIV5 chimera, MuV matrix, PIV5 matrix, nucleoprotein (NP) MuV, NP PIV5, MTS-Matrix MuV and MTS-Matrix PIV5 were codon optimized for Homo sapiens expression and either created using published sequences or designed in silico, and cloned into pcDNA3.1(+) using GeneArt gene synthesis service (ThermoFisher Scientific). The different pDNA were transformed in chemically competent one shot TOP10 E. coli or DH5a bacteria (Invitrogen). 100 mL maxiprep cultures were grown in lysogeny broth (LB) media overnight at +37° C., 215 rpm. pDNA were then extracted using Plasmid Plus Maxi kits (Qiagen) following the manufacturer's instructions. pDNA were eluted from the Qiagen columns using molecular biology grade water HyClone (GE LifeSciences). The concentration was then measured on a NanoDrop instrument (Thermo Fisher Scientific) and pDNA stored at −20° C.

    HIV-1 Monoclonal Antibodies (mAbs)

    [0174] mAbs were obtained from their producers, purchased from commercial suppliers or produced in house. 2G12, PG9, PG16, b12, 447-52D, 5F3,4E10, 2F5 and F240 were acquired from Polymun Scientific (Austria); 17b was donated by James Robinson; 35O22 was obtained from the NIH AIDS Research and Reference Reagent Program; expression vectors for 39F, 19b, 3BC176, PGT121, PGT135, PGT145, F105 and b6 were obtained from the IAVI Neutralizing Ab Consortium and produced in house; expression vectors for VRC01 and PGTL51 were generated in house. In house mAbs were produced in HEK293T.17 cells (ATCC) and purified on HiTrap protein A HP column (GE LifeSciences) following the manufacturer's instructions.

    Flow Cytometry

    [0175] Surface expression of the HIV-1 Env construct and the Env-F chimeras was evaluated in HEK293T.17 cells. Cells were seeded in complete medium 30h prior to overnight transfection using PEI with a 1:3 pDNA:PEI ratio (w:w) in DMEM (Sigma)+2 mM glutamine (GIBCO) without antibiotics and without fetal bovine serum. Following the overnight incubation, the transfection media was removed and replaced by 293 FreeStyle medium (GIBCO). 48h later, cells were rinsed with 1×PBS, dissociated with cell dissociation buffer (GIBCO) then washed with FACS buffer (2.5% FBS, 1 mM EDTA, 25 mM HEPES in 1×PBS) and pelleted at 600×g for 5 min. Cells were resupended in FACS buffer and counted in an haemocytometer using trypan blue. Cells were then filtered (70 um filter), stained with aqua viability dye (1:400) for 20 min at room temperature (RT) in the dark, washed twice with FACS buffer and transferred in U bottom 96-well plates for the rest of the staining procedure. 10 ug/mL in 100 mL FACS buffer of primary human IgG anti-Env mAbs were used to stain 1×10.sup.6 cells per well for 30 min at RT in the dark. Cells were then washed twice with 125 uL FACS buffer and 0.1 ug secondary F(ab′)2-goat anti-human IgG Fc PE conjugated (Invitrogen) per 10.sup.6 cells added to the cells in 100 uL FACS buffer. Cells were incubated in the dark for 20 min, washed twice, resuspended in 100 uL PBS and fixed with an additional 100 uL 3% paraformaldehyde (Polysciences) to reach a final 1.5%. Samples were acquired on a LSRFortessa FC (BD) using FACSDiva (BD) and data interpreted using FlowJo v.10.1 software (Treestar). Live cells were gated and data presented either as traces or reported as mAb:2G12 ratio in order to normalize the data using the mean fluorescence intensity (MFI) values of the live cells—2G12 mAb gives among the highest binding signal on our ConSOSL.UFO.750 HIV-Env design. A pcDNA3 empty vector transfected HEK293T.17 cells control was included in each experiment to allow subtraction of each mAb background (the majority of these mAb have no background).

    Virus-Like Particle (VLP) Production

    [0176] HEK293T.17 cells were seeded 30h before transfection to reach 80-90% confluence for transfection. Cells were co-transfected with a combination of HIV-1 Env-F:Matrix:NP, Env-F:MTS-Matrix ratios for MuV and PIV5 VLP pseudotyping using PEI in a 1:3 DNA:PEI ratio (w:w) in DMEM+2 mM glutamine. The transfection media was left overnight on the cells at +37° C. and replaced after 16-17h by FreeStyle™ 293 medium (GIBCO). The supernatants containing the VLPs were harvested, cell debris pelleted at 2,000×g for 5 min and the supernatant filtered using 0.45 μm PES membrane filters (Corning).

    [0177] For the first VLP productions (FIG. 2) were from T-75 flasks transfections. These VLPs were concentrated on 300 kDa MWCO Vivaspin (Sartorius) columns at 3000×g. Once the volume of the VLP supernatants reached under 1 mL, VLPs were washed with 5 mL of 1×PBS and further concentrated down to 100 μL. Protease inhibitor cocktail was added to the collected fractions and the VLPs stored at −80° C. Later, we used 100 kDa MWCO Vivaspin (Sartorius) columns to concentrate the VLPs and produced VLPs from T-75 flasks (FIG. 3) and from triple layered T-175 flasks which were used for the first animal studies (FIG. 6). Finally, to achieve higher purity we further purified the 100 kDa MWCO Vivaspin concentrated VLPs using 20% sucrose cushion ultracentrifugation. VLPs were ultracentrifuged in polycarbonate thick wall tubes (Beckman Coulter) using a Beckman Coulter type 70 Ti rotor at 90,000×g for 4h at +4° C. The supernatant and sucrose cushion were then removed carefully, the pellets washed with 5 mL of 1×PBS and then resuspended in 200-500 uL 1×PBS. Right after resuspending the VLPs, 5 uL of VLPs were used to analyse and count the particles on the Nanosight. VLPs were then aliquoted and stored at −80° C. These VLPs were used for the DNA prime-VLP boost experiment (FIG. 7).

    HIV-1 Env Soluble Trimer and MTS-Matrix HIS Tagged Proteins

    [0178] ConSOSL.UFO.664 HIV-1 Env soluble trimers was produced in HEK293T.17 cells using polyethyleneimine (PEI) (Polysciences) for transfection with a 1:3 DNA:PEI (w:w) ratio. The supernatant of transfected cells was collected 48h post-transfection, spun to pellet cellular debris followed by filtration (0.22 um). The soluble HIV-1 Env trimers were concentrated and transferred in 1×phosphate buffer saline (PBS) using 100 kDa molecular weight cut-off (MWCO) Amicon ultrafiltration columns (Merck Millipore). Further purification steps include 2 rounds of size exclusion chromatography (SEC) on an NGC medium pressure liquid chromatography (MPLC) system (BioRad) using an Enrich SEC 650 column (BioRad) to isolate the protein from the trimer peak. Trimers were then aliquoted and stored at −80° C.

    [0179] MTS-Matrix MuV HIS tagged and MTS-Matrix PIV5 HIS tagged proteins were produced using the same DNA:PEI ratio and transfection conditions as for ConSOSL.UFO.664. Cells debris were pelleted then the supernatants filtered (0.45 um). The supernatant were concentrated on 10 kDa MWCO Vivaspin columns (Sartorius) to reduce the volume input for the affinity column. 0.02% Tween20 (v:v) was added to the concentrated supernatants and the proteins purified on HisTrap HP 1 mL columns following the manufacturer's instructions and adding the 0.02% Tween20 (v:v) to the buffer to equilibrate the columns. Eluted fractions were concentrated and protein transferred in 1×PBS using 10 kDa MWCO Vivaspin columns at 4,000×g. Concentrations were determined using a NanoDrop instrument and proteins stored at −20° C.

    VLP Characterization

    [0180] 1. Nanoparticle Tracking Analysis

    [0181] The VLP size was characterized using a NanoSight LM10 instrument (Malvern Instruments, UK) with a SCMOS camera. VLP samples were diluted in 1×PBS in order to reach the recommended concentration range of 10.sup.8 to 109 particles/mL for accurate measurements. The NanoSight NTA 3.0 software (Malvern Instruments, UK) was used to acquire the data using an automated syringe pump at speed 10. The slider shutter was set up at 470 and the slider gain at 350. 60 seconds videos were recorded 3 times for each samples and temperature recorded. Images were then analysed using a screen gain of 10, a detection threshold of 5 with the ‘blur’ function switched off.

    [0182] 2. Envelope Quantification by Capture ELISA

    [0183] MaxiSorp high binding ELISA plates were coated overnight at +4° C. with Galanthus Nivalis Lectin (GNL) (Sigma) at 5 ug/mL in 100 uL per well in 1×PBS. Plates were then emptied, tap dry, wash 3 times with 200 uL 1×PBS. VLPs were diluted at 10.sup.7, 10.sup.8, 10.sup.9 and 10.sup.10 particles in 50 uL/well 0.5× casein buffer (½CB) (Thermo Scientific). VLPs were loaded onto the GNL coated plates as well as the ConSOSL.UFO.664 gp140 standard starting at 10 ug/mL (1/5 dilution series) in 50 uL/well ½CB. The plates were incubated at +37° C. for 1h, washed twice with 200 uL/well 1×PBS then mAb 2G12 was added at 2.5 ug/mL in 100 uL/well ½CB. Following 1h incubation at +37° C., plates were washed twice with 200 uL/well 1×PBS and the secondary goat anti-human IgG Fc biotinylated Ab (Southern Biotech) added onto the plate at 1:10,000 in 100 uL/well ½CB, 30 min at +37° C. Plates were then washed twice as per the previous wash and poly-HRP40 (Fitzgerald) diluted 1:10,000 in 100 uL/well ½CB added for 20 min at +37° C. Plates were then washed 3 times with 200 uL/well 1×PBS, tapped dry and developed using 50 uL/well TMB (KPL) and the reaction stopped using 50 uL/well Stop solution (Insight Biotechnologies, UK). The absorbance was read on a KC4 Spectrophotometer at 450 nm (BioTek).

    [0184] 3. VLP Env Antigenicity

    [0185] 10 ug/mL GNL was coated onto the MaxiSorp high binding ELISA plates. Following the same protocol as per the ‘Envelope quantification by capture ELISA’, 10.sup.9 particles per 50 uL/well ½CB were loaded onto the coated plate. Then different mAbs specific for Env extracellular domain were added at 10 ug/mL in 100 uL/well ½CB followed by secondary Ab, poly-HRP40 and development.

    Western Blotting

    [0186] Samples were prepared in reducing conditions using SDS sample buffer (Invitrogen) plus DTT, boiled for 5 min at +95° C., briefly cooled at +4° C. then loaded onto polyacrylamide Novex Tris-Glycine gels (Invitrogen). Gels were run for 40 min at 225 V in SDS running buffer (Invitrogen). Proteins were then followed by transfer into nitrocellulose membranes (Invitrogen), 80 min at 10 V in transfer buffer containing 10% methanol. Membranes were blocked in blocking buffer (2% (w/v) Bovine Serum Albumin (BSA) (Sigma), 0.05% Tween20 (v/v) in 1×PBS) for 1h at room temperature on a tube roller. Membranes were then washed 3 times 10 min with 15 mL 1×PBS+0.05% Tween20 (v/v). Primary antibodies: mouse Ab b13 specific for HIV-1 Env (0.5 μg/mL), mouse anti-PIV5 NP (Ab 214) and/or Matrix (Ab 198) at 1:2,000 (provided by Richard Randall, St Adrews University, UK) or mouse anti-Matrix MuV (1:3,000) were then added in blocking buffer. The membranes were incubated with the primary antibodies overnight at +4° C. on a tube roller. The membranes were then washed 3 times and secondary Goat anti-Mouse IgG Fc biotinylated Ab (Southern Biotech) added at 1:15,000 in blocking buffer. After another washing step, the membranes were incubated with streptavidin-HRP 1:500 (R&D Systems), then washed 3 times, dried, WB Luminata® Classico (Merck Millipore) applied and finally developed on Amersham Hyperfilm ECL (GE LifeSciences). Densitometry analyses were carried out using Image Studio Lite software v5.2.5 and ploted using GraphPad Prism v7.0.

    Animals and Immunization

    [0187] Animals were handled and procedures were performed in accordance with the terms of a project license granted under the UK Home Office Animals (Scientific Procedures) Act 1986.

    [0188] For the first immunogenicity study using 100 kDa MWCO concentrated VLPs, 4 groups of n=5 female BALB/c mice were injected intramuscularly in the quadriceps 3 times at 3-week interval with 10.sup.8, 10.sup.9, 10.sup.10 or 2×10.sup.10 particles dose of VLP1, VLP2, VLP3 or VLP4 without adjuvant in 50 uL 1×PBS. For the second study, groups of n=5 female BALB/c mice were injected intramuscularly with 10.sup.8, 10.sup.9 and 10.sup.10 particles dose of VLP1 with AddaVax adjuvant (1:1 ratio, v:v) in 50 uL. For the DNA prime-VLP boost study, 9 groups of n=5 mice per group were immunized twice at 3-week interval with 20 ug of pDNA (cf. FIG. 7) in 50 uL 1×PBS followed by electroporation (EP) using 5-mm electrodes using an ECM 830 square-wave electroporation system (BTX) (3 pulses of 100 V each followed by 3 pulses of the opposite polarity with each pulse (P.sub.ON) lasting 50 ms and an interpulse (P.sub.OFF) interval of 50 ms). 3 weeks later, mice were boosted with 50 uL of 10.sup.10 particles dose of the different VLPs purified by ultracentrifugation plus AddaVax adjuvant (1:1 ratio, v:v) according to the different groups in FIG. 7, except group 9 who received a 3.sup.rd DNA injection. The VLP boost was repeated 3 weeks later and mice sacrificed at week 12. For all animals, serum samples were collected at each immunization time point and spleens were collected and processed from the 3d immunization study.

    IFN-γ ELISpots

    [0189] IFN-γ T cell response was assessed using the Mouse IFN-γ ELISpotPLUS kit (Mabtech) following the manufacturer's instructions. Briefly, anti-IFN-γ pre-coated plates were blocked with DMEM+10% FBS for at 2h, then cells were added at 2.5×10.sup.6 cells/well. The negative control wells had media only, Env specific well had HIV-1 Env ConSOSL.UFO.750 peptide pool (2.5 μg/mL), Matrix specific wells had either MTS-Matrix MuV or MTS-Matrix PIV5 peptide pool in 200 μL final volume per well. The positive control wells contained 5×10.sup.5 cells/well in 200 μL final volume per well with 5 μg/mL of ConA. Plates were incubated overnight at 5% CO.sub.2, +37° C. incubator and developed as per the manufacturer's protocol. Once dried, plates were read using the AID ELISpot reader ELR03 and AID ELISpot READER software (Autoimmun Diagnostika GmbH, Ger).

    Antigen Specific ELISA

    HIV-1 Env Specific ELISA

    [0190] MaxiSorp high binding plates where coated with ConSOSL.UFO.664 protein at 1 ug/mL, 100 uL/well in 1×PBS and 1:1,000 dilution of each of the capture goat anti-Kappa and anti-Lambda was used to coat the standard wells (Southern Biotech). After an overnight incubation at +4° C., plates were washed 4 times with 1×PBS-0.05% Tween20 then blocked with in ELISA buffer (1% BSA+0.05% Tween20 in 1×PBS) with 200 uL/well and incubated for 1h at +37° C. The plates were then washed as describe above, incubated with samples diluted 1:100, 1:1,000 and 1:10,000 in ELISA buffer and the standard IgG, IgG1 and IgG2a added to the standard wells (start at 1 10 ug/mL then 1:5 dilution series). Following a 1h incubation at +37° C., plates were washed, incubated with 1:2,000 secondary goat anti-IgG-HRP, IgG1-HRP or IgG2a-HRP (Southern Biotech) for 1h at +37° C. Finally, plates were washed and developed using 50 uL/well TMB substrate then stopped with 50 uL Stop solution and read on a spectrophotometer.

    Matrix specific ELISAs

    [0191] Plates were prepared and handle as above except that the antigens used to code the plates are MTS-Matrix MuV HIS tagged protein (1 ug/mL) or MTS-Matrix PIV5 HIS tagged protein (1 ug/mL).

    Example 1

    [0192] To demonstrate the potential of generating VLPs pseudotyped with viral glycoproteins, the inventors used the external domain of HIV Env GP (the portion that is external to the viral membrane and the key target for antibody responses). They evaluated the potential of MuV and PIV5 TMD+CT Fusion chimera (Env-F) to retain HIV Env extracellular domain epitope properties (FIG. 1A). VLPs were produced in HEK293T.17 cells and characterized by western blot, ELISA and Nanoparticle Tracking Analysis (Figure B). In addition, VLPs can be produced when encoded in a DNA vector either with matrix and glycoprotein components delivered on separate plasmids or where the matrix and glycoprotein components are encoded in the same sequence separated by a T2A cleavage sequence (RRRRRRGSGEGRGSLLTCGDVEENPGP SEQ ID No:19).

    [0193] The MuV TMD may be encoded by a nucleic acid having a nucleotide sequence comprising

    TABLE-US-00023 SEQ ID No: 31 GTGCTGAGCATCATTGCCATCTGCCTGGGCAGCCTGGGCCTGATCCTGA TCATTCTGCTGAGCGTGGTCGTG. 

    [0194] The MuV CT may be encoded by a nucleic acid having a nucleotide sequence comprising

    TABLE-US-00024 SEQ ID No: 32 TGGAAACTGCTGACAATCGTGGTGGCCAACCGGAACCGGATGGAAAACT TCGTGTACCACAAG. 

    [0195] The PIV5 TMD may be encoded by a nucleic acid having a nucleotide sequence comprising

    TABLE-US-00025 SEQ ID No: 33 GCCATCATTGTGGCCGCTCTGGTGCTGAGCATCCTGTCCATCATCATCT CCCTGCTGTTCTGCTGCTGGGCCTACGTG. 

    [0196] The PIV5 CT may be encoded by a nucleic acid having a nucleotide sequence comprising

    TABLE-US-00026 SEQ ID No: 34 GCCACCAAAGAGATCAGACGGATCAACTTCAAGACCAACCACATCAACA CCATCAGCTCCAGCGTGGACGACCTGATCAGATAC. 

    [0197] The inventors have shown that MuV/PIV5 MTS-M+Env-F is sufficient to produce VLPs (FIG. 2). In addition, the inventors have shown that MuV MTS-M can produce VLPs when co-expressed with the PIV5 Env-F chimera as well as with a HIV Env GP truncated at amino acid 750 (FIG. 3). Furthermore, using a panel of highly characterised anti-HIV Env antibodies the inventors found that the designed chimeric HIV Envs, using a wild type Env sequence (FIG. 4A) as well as a stabilized Env sequence developed by the inventors (FIG. 4B), preserve the quaternary structure and broadly neutralizing antibody (bNAb) binding profile of the matching HIV Env.

    Example 2

    [0198] The inventors then quantified the amount of Env that was expressed on each of the VLP versions and analysed the antigen profile using a panel of well characterised anti-HIV Env antibodies (FIG. 5B-C). All the VLP versions expressed high levels of the recombinant HIV Env protein, much more than the levels observed on an HIV virion, demonstrating a clear advantage over the native virus. They also characterized the size distribution of the VLPs using Nanoparticle Tracking Analysis performed on a Nanosight instrument (FIG. 5D). For the 5 types of VLPs, >90% of the measured particles had a diameter between 90-250 nm, with a mean diameter of laying between 120-150 nm. These data demonstrate that particles are formed and have a similar size to the HIV virion.

    Example 3

    [0199] The inventors next evaluated the immunogenicity in a mouse model of VLP1 to 4 and showed that the VLPs where immunogenic without the addition of a separate adjuvant from a dose of 10E9 particles (FIG. 6A, C). VLPs containing a MTS-M component showed mounted an antibody response against the matrix, response which appears to be one log lower than for Env. These VLPs induced a predominant Th2 response with a very low IgG2a:IgG1 ratio observed (FIG. 6B). In addition, they evaluated the potential of VLP1, which contains no matrix, in combination with a conventional adjuvant. The serum IgG response was efficiently boosted as expected (FIG. 6D). These data demonstrate the high immunogenic potential of the VLPs generated using the inventor's production method.

    [0200] The inventors further tested VLP immunogenicity in the context of DNA prime-VLP boost regimens (FIG. 7). They found that priming with a DNA expressed membrane bound Env induced a Th1 response which was maintained following VLP1 boosts. Interestingly, priming with DNA expressed soluble Env induced a strong Th2 skew which was not reverted or balanced with a Th1 response, although the IgG2a:IgG1 increase slightly following VLP1 boosts. DNA MTS-M primed grouped showed either a balanced Th1/Th2 response or a Th2 skewed response with VLP2, 3 and 4 boosts. In addition, DNA prime with co-expressing vector ConSOSL.UFO.MuV-T2A-MTS-M MuV induced a Th1 skewed or Th1/Th2 balanced response which was maintained following the VLP2 and VLP5 immunization. In contrast, the PIV5 version of this DNA vector induced a Th2 skewed response. Strikingly, when no Env was used for DNA prime there was no Env IFN-gamma response observed (Group 3,4 and 5—FIG. 7F) whereas priming with DNA membrane-bound Env (group 1) gave a strong response in mark contrast with priming with DNA soluble Env (group 2). Interestingly, the inventors observed an increase of Env serum IgG titer for group 3 compared to VLP1+AddaVax after the first boost, and, without being bound to any particular theory, suggests intrastructural help from the MTS-M specific T helper cells induced by DNA priming which could potentially be recalled with VLP2 boosting (FIG. 7E). Moreover, VLP2 present less Env on its surface than VLP1 and the animals were injected with VLPs normalized to the number of VLPs and not Env.

    Discussion

    [0201] The majority of commercialized vaccines generate protection against infectious viruses through the induction of protective antibodies. These protective antibodies typically target the viral glycoproteins arrayed on the surface of the viral particle (virus spikes). The correct display of these surface glycoproteins is thought to be advantageous to evoke the right type of protective antibodies. To avoid the inclusion of whole viruses (either infectious or inactivated) within potential vaccines, researchers are increasingly looking to use engineered “virus-like particles” or VLPs, that provide the same particulate structure as a virus, but are non-infectious. However, this is usually performed by modifying individual viruses for each vaccine (i.e. a VLP for HIV, a different VLP for Ebola etc.). The inventors have therefore generated generic platforms for the production of VLPs that can contain viral glycoproteins from a wide range of different viruses. This versatility provides distinct advantages over current virus specific approaches. The present invention relies on the combination of two technical innovations, i.e. (i) core technology to generate VLPs, and (ii) technology to incorporate viral glycoproteins of the inventor's choice into the surface membrane of the engineered VLP.

    [0202] The core technology to generate VLPs is based on the modification of the Mumps Virus matrix proteins to generate non-infectious VLPs. The Mumps virus matrix protein by itself is unable to form VLP. However, the incorporation of the membrane targeting sequence (MTS) leads to very efficient virus particle release. The MTS is derived from another protein known as Fyn-like protein kinase (19). Without wishing to be bound to any particular theory, the inventors believe that the use of this sequence in conjunction with the Mumps matrix protein with the express intention to generate VLPs is a non-obvious step. The inventors have shown that the matrix protein of a second closely related virus, Parainfluenza Virus 5 (PIV5), can be similarly modified by the same membrane targeting sequence to efficiently generate VLPs.

    [0203] The technology for incorporating viral glycoproteins of choice into the generated VLPs, known as “pseudotyping” is mediated by fusing the external viral glycoprotein sequence of a chosen target glycoprotein (for examples HIV, Ebola, Rabies etc.) to the protein sequence of the Mumps viral glycoprotein that embeds (or inserts) itself within the viral particle, known as the “transmembrane domain”. This means that the external surface of the VLP exposes the external domain of the glycoprotein of choice but is tethered to the VLP by the inclusion of the common Mumps transmembrane domain and cytoplasmic tail. The inventors have shown that the transmembrane domains and cytoplasmic tail of Mumps and PIV5 can be interchanged for this purpose.

    [0204] Whilst the fusion proteins of the present invention may comprise a TMD, this can be achieved by co-expression of any membrane protein that co-localises with the assembly of the matrix protein at the plasma membrane through passive incorporation into the budding VLP. This is generally applicable to any protein with a transmembrane domain, although typically viral, with or without a cytoplasmic tail. An example of this is the incorporation of HIV envelope protein (ConSOSL.UFO.750) into mumps matrix VLPs (FIG. 5A (VLP2) and FIG. 5B). A variant of this approach is to exchange the transmembrane domain of the WT envelope protein to that of a paramyxovirus. An example of this is shown diagrammatically in FIG. 1A. Experimental data to support this approach is shown in FIG. 5. Where that native protein does not naturally assemble with the matrix derived VLP, the swapping of WT transmembrane domain for that of the paramyxovirus matched to the matrix protein may be advantageous to maximise VLP incorporation. This approach can be readily applied to a wide range of viral glycoproteins such as Nipah virus, Rabies virus, SARS coronavirus, Lassa fever virus, and Ebola virus etc.

    [0205] Nevertheless, and while not wishing to be bound to any particular theory, the approach is not limited to proteins that encode transmembrane domains and linkage of any protein to the glycoprotein transmembrane domain of paramyxovirus would result in incorporation into matrix derived VLPs.

    [0206] The combination of these two steps allows for the generation of VLPs displaying multiple copies of the viral glycoprotein of our choice. These can be manufactured using mammalian cell culture platforms to generate VLPs that then form the vaccine for injection. Thus, the inventors are able to produce VLPs containing either the Mumps or PIV5 matrix proteins but displaying viral glycoproteins of choice, e.g. HIV or other viruses. When used as a vaccine this facilitates the induction of antibodies to the target vial glycoprotein. The inventors are also able to encode the required sequences as DNA or RNA vaccines that can then be injected as a vaccine to generate VLPs within the injected tissue (typically the skin or muscle), either with matrix and glycoprotein components delivered on separate constructs or the matrix and glycoprotein components delivered as a contiguous single sequence separated by a T2A cleavage sequence. This provides an alternative mechanism for delivering vaccine.

    REFERENCES

    [0207] (1) Plotkin S A. Correlates of protection induced by vaccination. Clin Vaccine Immunol. 2010; 17:1055-1065. [0208] (2) Lauring A S, Jones J O, Andino R. Rationalizing the development of live attenuated virus vaccines. Nat Biotechnol. 2010; 28:573-9. [0209] (3) Berkhout B, Verhoef K, van Wamel J L, Back N K. Genetic instability of live, attenuated human immunodeficiency virus type 1 vaccine strains. J Virol.1999; 73:1138-45. [0210] (4) Hastie, K. M., Zandonatti, M. A., Kleinfelter, L. M., Heinrich, M. L., Rowland, M. M., Chandran, K., Branco, L. M., Robinson, J. E., Garry, R. F., and Saphire, E. O. (2017). Structural basis for antibody-mediated neutralization of Lassa virus. Science 356, 923-928. (5) Klasse, P. J. (2012). The molecular basis of HIV entry. Cell Microbiol 14, 1183-1192. [0211] (6) Lee, J., Nyenhuis, D. A., Nelson, E. A., Cafiso, D. S., White, J. M., and Tamm, L. K. (2017). Structure of the Ebola virus envelope protein MPER/T M domain and its interaction with the fusion loop explains their fusion activity. Proc Natl Acad Sci USA 114, E7987-E7996. [0212] (7) Sarkar, A., Bale, S., Behrens, A. J., Kumar, S., Sharma, S. K., de Val, N., Pallesen, J., Irimia, A., Diwanji, D. C., Stanfield, R. L., et al. (2018). Structure of a cleavage-independent HIV Env recapitulates the glycoprotein architecture of the native cleaved trimer. Nat Commun 9, 1956. [0213] (8) Sanders, R. W., and Moore, J. P. (2017). Native-like Env trimers as a platform for HIV-1 vaccine design. Immunol Rev 275, 161-182. [0214] (9) Gao, Y., Wijewardhana, C., and Mann, J. F. S. (2018). Virus-Like Particle, Liposome, and Polymeric Particle-Based Vaccines against HIV-1. Front Immunol 9, 345. [0215] (10) Mohan, T., Berman, Z., Luo, Y., Wang, C., Wang, S., Compans, R. W., and Wang, B. Z. (2017). Chimeric virus-like particles containing influenza H A antigen and GPI-CCL28 induce long-lasting mucosal immunity against H3N2 viruses. Sci Rep 7, 40226. [0216] (11) Storcksdieck genannt Bonsmann, M., Niezold, T., Temchura, V., Pissani, F., Ehrhardt, K., Brown, E. P., Osei-Owusu, N. Y., Hannaman, D., Hengel, H., Ackerman, M. E., et al. (2015). Enhancing the Quality of Antibodies to HIV-1 Envelope by GagPol-Specific Th Cells. J Immunol 195, 4861-4872. [0217] (12) Ramirez, A., Morris, S., Maucourant, S., D'Ascanio, I., Crescente, V., Lu, I. N., Farinelle, S., Muller, C. P., Whelan, M., and Rosenberg, W. (2018). A virus-like particle vaccine candidate for influenza A virus based on multiple conserved antigens presented on hepatitis B tandem core particles. Vaccine 36, 873-880. [0218] (13) Elsayed, H., Nabi, G., McKinstry, W. J., Khoo, K. K., Mak, J., Salazar, A. M., Tenbusch, M., Temchura, V., and Uberla, K. (2018). Intrastructural Help: Harnessing T-Helper Cells Induced by licensed Vaccines for Improvement of HIV Env Antibody Responses to Virus-Like Particle Vaccines. J Virol. [0219] (14) Zhu, P., Liu, J., Bess, J., Jr., Chertova, E., Lifson, J. D., Grise, H., Ofek, G. A., Taylor, K A., and Roux, K. H. (2006). Distribution and three-dimensional structure of AIDS virus envelope spikes. Nature 441, 847-852. [0220] (15) L, M., Schmitt, P. T., Li, Z., McCrory, T. S., He, B., and Schmitt, A. P. (2009). Mumps virus matrix, fusion, and nucleocapsid proteins cooperate for efficient production of virus-like particles. J Virol 83, 7261-7272. [0221] (16) Terrier, O., Rolland, J. P., Rosa-Calatrava, M., Lina, B., Thomas, D., and Moules, V. (2009). Parainfluenza virus type 5 (PIV-5) morphology revealed by cryo-electron microscopy. Virus Res 142, 200-203. [0222] (17) Ludwig, K., Schade, B., Bottcher, C., Korte, T., Ohlwein, N., Baljinnyam, B., Veit, M., and Herrmann, A. (2008). Electron cryomicroscopy reveals different F1+F2 protein States in intact parainfluenza virions. J Virol 82, 3775-3781. [0223] (18) Cox, R. M., and Plemper, R. K. (2017). Structure and organization of paramyxovirus particles. Curr Opin Virol 24, 105-114. [0224] (19) Wang D, Harmon A, Jin J, Francis D H, Christopher-Hennings J, Nelson E, Montelaro R C, Li F. The lack of an inherent membrane targeting signal is responsible for the failure of the matrix (M1) protein of influenza A virus to bud into virus-like particles. J Virol. 2010 Mav:84(9):4673-81.