RECOMBINANT EXPRESSION VECTOR APPLICABLE TO RAPID SCREENING FOR RECOMBINANT STRAIN AND APPLICATION

Abstract

The present invention relates to the field of genetic engineering, particularly to a recombinant expression vector for rapidly screening the high expression strains and a method for rapidly screening high expression strains. In the invention, an exogenous red fluorescent protein and Aspergillus fumigatus cell surface protein localization signal are fused and expressed, and the fusion gene (DsRed-AfMP1) is integrated into the genome of Trichoderma reesei, so as to construct a strain displaying red fluorescent protein on the surface of Trichoderma reesei. By sorting Trichoderma reesei strains with red fluorescent protein on the surface by flow cytometry, genes beneficial to the improvement of cellulase activity can be quickly isolated.

Claims

1. A recombinant expression vector for rapidly screening Trichoderma reesei highly expressing cellulase including the gene expression cassette comprising elements of cbh1 promoter, red fluorescent protein gene DsRed, cell surface protein anchor signal peptide gene AfMp1 and cbh1 terminator in order from upstream to downstream, wherein said DsRed gene has the nucleotide sequence of SEQ ID No.2, and said AfMp1 gene has the nucleotide sequence of SEQ ID No.3.

2. The recombinant Trichoderma reesei comprising the recombinant expression vector for rapidly screening Trichoderma reesei highly expressing cellulase of claim 1.

3. The application of the recombinant expression vector for rapidly screening Trichoderma reesei highly expressing cellulase of claim 1.

4. A method for rapidly screening recombinant Trichoderma reesei including the steps of (1) introducing the gene expression cassette comprising the elements of cbh1 promoter, red fluorescent protein gene DsRed, cell surface protein anchor signal peptide gene AfMp1 and cbh1 terminator into the plasmid to obtain the recombinant expression vector, wherein said DsRed gene has the nucleotide sequence of SEQ ID No.2, and said AfMp1 gene has the nucleotide sequence of SEQ ID No.3; (2) transforming the host cell with the recombinant vector constructed in the step (1) to obtain the recombinant strain; (3) cultivating the recombinant strain and inducing to express the red fluorescent protein on the surface of the recombinant strain; and (4) screening of recombinant strains showing the red fluorescence.

5. The method for rapidly screening recombinant Trichoderma reesei according to claim 4, wherein the recombinant strain displaying the red fluorescence on the surface is screened by flow cytometry in said step (4).

6. The method for the rapidly screening Trichoderma reesei highly expressing cellulase with high enzyme activity including the steps of (1) introducing the gene expression cassette comprising the elements of cbh1 promoter, red fluorescent protein gene DsRed, cell surface protein anchor signal peptide gene AfMp1 and cbh1 terminator into the plasmid to obtain the recombinant expression vector, wherein said DsRed gene has the nucleotide sequence of SEQ ID No.2, and said AfMp1 gene has the nucleotide sequence of SEQ ID No.3; (2) transforming the host cell with the recombinant vector constructed in step (1) to obtain the recombinant Trichoderma reesei; (3) introducing a protein secretion pathway related gene or inserting vectors or genes randomly into the recombinant Trichoderma reesei obtained in step 2 to obtain the mutant library of recombinant Trichoderma reesei; (4) screening of the recombinant Trichoderma reesei strongly showing the red fluorescence on its surface by flow cytometry; and (5) determining the cellulase activity of the recombinant Trichoderma reesei obtained in step (4), to obtain the recombinant Trichoderma reesei with improved cellulase activity.

7. The method for rapidly screening Trichoderma reesei highly expressing cellulase with high enzyme activity according to claim 6, wherein in the step 3, said protein secretion pathway related genes includes bip1 gene, hac1 gene, ftt1 gene, sso2 gene, sar1 gene or ypt1 gene.

8. The method for rapidly screening Trichoderma reesei highly expressing cellulase with high enzyme activity according to claim 6, wherein in the step 3, Agrobacterium tumefaciens is used to mediate transformation of Trichoderma reesei to obtain a Trichoderma reesei mutant library.

9. The method for rapidly screening protein secretion pathway related genes for improving cellulase activity including the steps of (1) constructing the recombinant expression vector comprising DsRed-AfMp1 fusion gene comprising red fluorescent protein gene DsRed and cell surface protein anchor signal peptide gene AfMp1, wherein said DsRed gene has the nucleotide sequence of SEQ ID No:2, and said AfMp1 gene has the nucleotide sequence of SEQ ID No:3; (2) transforming the strain with the recombinant vector constructed in step 1 to obtain the recombinant strain; (3) introducing the target gene to be screened or inserting vectors or genes randomly into the recombinant strain obtained in step (2) to obtain the mutant library of recombinant strain; (4) screening the recombinant strain strongly showing the red fluorescence on its surface by flow cytometry; (5) determining the cellulase activity of the recombinant strain showing the red fluorescence on the surface obtained in step 4 to obtain the recombinant strain with improved cellulase activity; and (6) identifying the exogenous target gene or the disturbed endogenous gene in the recombinant strain with the improved cellulase activity, so as to obtain the protein secretion pathway related genes for improving cellulase activity.

10. The method for rapidly screening protein secretion pathway related gene for improving cellulase activity according to claim 9, wherein the recombinant strain is Trichoderma reesei.

11. The method for rapidly screening protein secretion pathway related gene for improving cellulase activity according to claim 9, wherein said protein secretion pathway related gene includes bip1 gene or hac1 gene.

Description

BRIEF DESCRIPTIONS OF THE DRAWINGS

[0039] FIG. 1 shows the colony of Trichoderma reesei, wherein the left picture shows the original strain SUS2, and the right picture shows the positive transformant SUS4 transferred into pDsRed-AfMP1 plasmid;

[0040] FIG. 2 shows the Trichoderma reesei hyphae under the fluorescence microscope, wherein the left picture shows the Trichoderma reesei hyphae displaying the red fluorescent protein on its surface, and the right picture shows the Trichoderma reesei hyphae observed under the fluorescent microscope in the bright field;

[0041] FIG. 3 is the flow cytometry sorting diagram of plasmid transformants related to secretory pathway;

[0042] FIG. 4 shows the colony PCR results of the secretory pathway related transformants, wherein FIG. 4-1 is hac1 colony PCR, FIG. 4-2 is bip1 colony PCR, FIG. 4-3 is ypt1 colony PCR, FIG. 4-4 is sso2 colony PCR, FIG. 4-5 is sar1 colony PCR, and FIG. 4-6 is ftt1 colony PCR;

[0043] FIG. 5 shows the results of determining EG enzyme activity in the shake flask fermentation broth of the original strain and the transformants related to secretion pathway;

[0044] FIG. 6 is the copy number identification map of the transformants related to the modifying secretion pathway;

[0045] FIG. 7 shows the colony PCR results of Ti-pyr4 plasmid transformed into Agrobacterium tumefaciens;

[0046] FIG. 8 shows the flow cytometry of Agrobacterium tumefaciens randomly inserted mutant library;

[0047] FIG. 9 shows the result of PCR validation of the randomly inserted transformant colonies of Agrobacterium tumefaciens screened by the flow cytometry; and

[0048] FIG. 10 shows the enzyme activity of Agrobacterium tumefaciens randomly inserted transformants.

EMBODIMENT

[0049] The invention is further described in detail in combination with the drawings, so that those skilled in the art can implement it with reference to the description.

[0050] The experimental methods used in the following embodiments are conventional methods unless otherwise specified.

[0051] The materials, reagents, etc. used in the following embodiments can be obtained from commercial sources without special instructions.

[0052] The ingredients of the MM medium in the following embodiment include (NH.sub.4).sub.2SO.sub.4 in the concentration of 5.0 g/L, KH.sub.2PO.sub.4 in the concentration of 15.0 g/L, MgSO.sub.4.7H.sub.2O in the concentration of 0.6 g/L, CaCl.sub.2.2H.sub.2O in the concentration of 0.6 g/L, CoCl.sub.2.6H.sub.2O in the concentration of 0.0037 g/L, FeSO.sub.4.7H.sub.2O in the concentration of 0.005 g/L, ZnSO.sub.4.7H.sub.2O in the concentration of 0.0014 g/L, MnSO.sub.4.H.sub.2O in the concentration of 0.0016 g/L, glucose or carbon sources such as Avicel in the concentration of 20 g/Land the water as the solvent used.

Example 1 Display of Red Fluorescent Protein on the Surface of Trichoderma reesei Cells

[0053] 1. Constructing the Recombinant Plasmid pdsRed-AfMP1 Expressing the Fusion Gene DsRed-AfMP1 of the Red Fluorescent Protein and Aspergillus fumigatus Cell Surface Protein Anchored Signal Peptide

[0054] DsRed gene fragment was amplified from plasmid DsRed with the F-terminal primer comprising cbh1 gene signal peptide sequence of 51bp, AfMP1 gene fragment was amplified from plasmid AfMP1, and the two fragments were connected by overlap PCR.

[0055] Cbh1 promoter and terminator were amplified from the genome of T. reesei Tu6 to construct the expression cassette cbh1p-DsRed-AfMp-cbh1t, while being seamlessly spliced to the linearized pAPA plasmid and cbh1p-DsRed-AfMp-cbh1t expression cassette by homologous recombination in vivo, and then transformed into E. coli, following by selecting the positive transformants and extracting the plasmids.

[0056] 2. Expression of Fusion Gene pDsRed-AfMp1 in Trichoderma reesei SUS2

[0057] Trichoderma reesei SUS2 was inoculated on potato culture medium (PDA) plate, and incubated for 7 days at 30° C. until forming spores which were scraped off and inoculated into 100 mL of PDB medium containing uridine, followed by shaking overnight at 30° C. and 180 rpm. The germinating hyphae were collected by filtration with 12 layers of gauze and digested at 30° C. for 1 to 2 hours with 10 mg/mL of yeast breaking-wall enzyme to collect the protoplasts. And, pDsRed-AfMp1 plasmid was transformed into Trichoderma reesei SUS2 strain by PEG mediated protoplast transformation.

[0058] The transformants were grown and selected on MM-glucose agar medium containing 1 M sorbitol. The single clone was selected and inoculated on MM-lactose agar medium for 5 days in the incubator at 30° C. to observe the color change. As shown in FIG. 1, there is the red fluorescent protein which can by observed with the naked eye, displayed on the surface of the positive transformants successfully transforming and expressing pDsRed-AfMp1 plasmid, named as SUS4.

[0059] As shown in FIG. 2, the red fluorescent protein expressed on the cell surface of the obtained transformant can be observed under the confocal microscope, after being cultured in MM-Avicel for 24 hours.

Example 2 Screening of Cellulase with High Cellulase Activity

[0060] 1. Expression of Trichoderma reesei's Protein Secretion Pathway Related Genes in Trichoderma reesei SUS4

[0061] Six gene fragments related to the secretion pathway of Trichoderma reesei, bip1 gene, hac1 gene, ftt1 gene, sso2 gene, sar1 gene, and ypt1 gene, were selected and connected with the appropriate promoters and terminators to construct the expression cassettes eno1p-bip1-eno1t, eno1p-hac1-eno1t, pdc1p-ftt1-pdc1t, pdc1p-sso2-pdc1t, gpd1p-sar1-gpd1t, and gpd1p-ypt1-gpd1t respectively.

[0062] And, the six secretory pathway related recombinant plasmids, i.e., pAPA-eno1-bip1, pAPA-eno1-hac1, pAPA-pdc1-sso2, pAPA-pdc1-ftt1, pAPA-gpd1-sar1 and pAPA-gpd1-ypt1, were constructed by linearizing plasmid pAPA and seamless splicing with the above six gene fragments at a molar ratio of 1:2. The obtained recombinant plasmids were transformed into E. coli T competent cells, and colony PCR was performed to identify whether the six fragments were connected to the pAPA. The positive colonies identified by PCR were selected and inoculated into 1 mL of LB medium containing 100 μg/mL of ampicillin for shaking culture overnight at 37° C. and 220 rpm to extract the plasmids for transformation The above six secretion pathways related plasmids were mixed in equal volume and then transformed into Trichoderma reesei SUS4 strain by PEG mediated protoplast transformation.

[0063] The obtained transformants were selected and cultured on PDA at 28° C. until producing spores, wherein four transformants can be selected from each plate. 8 mL of sterile water was used to wash the spores of all transformants on the plate, and then the spores were evenly suspended at 10.sup.6 to 10.sup.8 spores, followed by being filtered into the sterile tip bottom centrifuge tube with the 200 mesh sieve, for being analyzed and sorted by flow cytometry.

[0064] Flow cytometry was used to analyze the sporozoites of the transformants with the sample pressure of 1000 EPS, i.e. 1000 signal particles per second, wherein the area and width map of forward angle scattering light was used to remove the adhesion and miscellaneous signals, the fluorescence signal was excited by 488 nm of laser, the voltage was set by the negative control strain expressing RFP to distinguish the expressed sporozoites, and the positive spore region was determined according to the signal difference between the positive and negative spores. All samples were analyzed in the same way. The spores with the strongest fluorescence signal were directly sorted into the 6-well plate containing PDA, and the total 36 transformants were sorted and cultured until producing the spores, as shown the flow sorting diagram of FIG. 3.

[0065] The selected transformants were inoculated in 25 mL of liquid MM-glucose and shaken at 30° C. and 180 rpm for 1 day. Genomic DNA was extracted and PCR was used to verify whether the recombinant plasmids were successfully transformed into Trichoderma reesei cells.

[0066] The transformants screened by flow cytometry were used for colony PCR with 6 pairs of primers related to secretion pathway to determine what kind of secretion pathway related plasmids were contained in the selected transformants with the enhanced red fluorescence. The primers used are shown in the table below, the PCR fragment size is about 200 bp, and the electrophoresis results are shown in FIG. 4.

TABLE-US-00004 TABLE 1 Primer sequence Primer 5′.fwdarw.3′ Usage Peno (F) GGCTTCACTTTCGATGTCGT Screening of bip1 and hac1 transformants Pbip1 (R) GTTGAGGGGGGGTATCTTTG Screening of bip1 transformants Phac1 (R) TTGAGTCGGCGAAGAGGGAT Screening of hac1 transformants Pgpd (F) CTCCTCCCTCTCTCCCTCTC Screening of sar1 and ypt1 transformants Psar1 (R) TCGCATCAGGTAAGCTGTTG Screening of sar1 transformants Pypt1 (R) GCAATCAAGCGACGGAGGAC Screening of ypt1 transformants Ppdc (F) AGAGTGTCGTCACCAGTATA Screening of ftt1 and sso2 transformants Pftt1 (R) GACGGGAGGGAGGATACGTA Screening of ftt1 transformants Psso2 (R) AAGGAGCCATCTCTACTGCG Screening of sso2 transformants

[0067] As shown in FIG. 4, 31 transformants were obtained by colony PCR from the 36 transformants screened by flow cytometry, of which 22 transformants comprised had gene and 9 transformants contained bip1 gene, being confirmed by sequencing, whereas the other four secretion pathway related plasmid sequences were not amplified.

[0068] The results showed that had gene and bip1 gene could enhance the cellulase production ability of DsRed-AfMP1 transformants, whereas the overexpression of the other four secretion related genes could not promote the cellulase secretion and expression under the present strain and culture conditions.

[0069] 2. Determination of Cellulase Activity of the Recombinant Plasmid Transformants Related to Secretion

[0070] (1) Inducing and Culturing the Selected Transformants

[0071] 1×10.sup.7 spores screened from the spores of the original strain and spores separated by flow cytometry were inoculated into 100 mL of MM-glucose medium, for shaking culture at 30° C. and 180 rpm for 1 day, the mycelium was filtered with 12 layers of gauze, collected and washed with a large amount of sterile water to remove the residual glucose.

[0072] 500 mg of mycelium was weighed in the same amount and inoculated in 100 mL of MM-Avicel liquid medium, wherein the original strain and each transformant were set in three parallels, to induce cellulase production by shaking at 30° C. and 180 rpm for 168 h wherein the fermentation broth was collected every 24 h since 72 h and stored in a refrigerator at 4° C. for standby.

[0073] (2) Determining Cellulase Activity

[0074] Extraction of Cellulase

[0075] 2 mL of fermentation broth collected in each time period was centrifuged at 8000 rpm to obtain the supernatant.

[0076] Determination of Cellulase Activity

[0077] The enzyme activities of the original strain SUS4 and the 31 transformants identified by colony PCR were determined, wherein the fermentation broth from 3 to 6 d was taken to determine the activity of endocellulase (CMC enzyme activity).

[0078] Sodium carboxymethyl cellulose (CMC) was used as the substrate for determining endocellulase activity by adding citric acid disodium hydrogen phosphate buffer in 0.05 M with pH 5.0 to 1000 mg of sodium carboxymethyl cellulose until 50 mL to obtain 2% sodium carboxymethyl cellulose solution.

[0079] And, the enzyme activity of endocellulase was determined by adding 100 μL of enzyme solution into 10 mL of citric acid disodium hydrogen phosphate buffer in 0.05 M with pH 5.0 to obtain the enzyme solution diluted 101 times, adding 2% of sodium carboxymethyl cellulose solution and citric acid disodium hydrogen phosphate buffer solution of 0.45 mL to each tube respectively, in water bath equilibrium at 50° C., adding 0.1 mL of the diluted enzyme solution wherein the blank wasn't added, for shaking and mixing evenly to be kept in water bath at 50° C. for 30 min and rapid cooling, followed by adding 1.5 mL of DNS reagent to each test tube, adding 0.1 mL enzyme solution to the blank, and mixing evenly for putting into boiling water for 10 minutes and cooling quickly, so as to determine the absorbance at 540 nm taking No. 0 tube as reference, wherein the amount of enzyme required to hydrolyze sodium carboxymethyl cellulose to produce 1 μmol reducing sugar (glucose) per hour at 50° C. and pH 5.0 by 1 mL of liquid enzyme was defined as one enzyme activity unit (U).

[0080] The enzyme activity test results are shown in FIG. 5, wherein the enzyme activity of seven transformants was improved, including three transformants containing hac1 gene, named as SUS4-H7, SUS4-H28, and SUS4-H43 respectively, and four transformants with bip gene, named as SUS4-B3, SUS4-B5, SUS4-B26 and SUS4-B31 respectively.

[0081] 3. Identification of Copy Number of Transformants

[0082] The qRT PCR was used to identify the copy number of transformants taking 1 μl of diluted temple and the primer as below, wherein the genomes of the above transformants were selected as template and diluted 5 times, and actin gene was used as internal reference gene

TABLE-US-00005 RTQactF (5′-TGAGAGCGGTGGTATCCACG-3′) RTQactR (5′-GGTACCACCAGACATGACAATGTTG-3′) RTQbacF (5′-ACAACGTCCTGCAGTGTCAA-3′) RTQbacR (5′-TAGCGATCTGCATCAAGGGC-3′) RTQbipF (5′-AAGAAGGTTACCCACGCCG-3′) RTQbipR (5′-ATCAAAGGTACCACCACCGAG-3′)

[0083] The copy number of Bgl3p1 gene was quantified by 2.sup.−ΔΔ.sup.Ct method, and the results of copy number identification of transformants are shown in FIG. 6A and FIG. 6B, wherein quantitative PCR analysis showed that one or two copies of HAC1 and BIP1 genes were integrated into the chromosome.

Example 3 Constructing Gene Mutant Library to Screen Transformants Highly Expressing the Cellulase with the High Activity

[0084] 1. Construction of Plasmid pTi-Pyr4 from Agrobacterium tumefaciens

[0085] Pyr4 gene was amplified from Trichoderma reesei and the plasmid pTi-pyr4 transforming Agrobacterium tumefaciens was constructed.

[0086] Agrobacterium tumefaciens competent AGL1 was transformed with the constructed plasmid pTi-pyr4d containing a Trichoderma transformation screening marker gene pyr4, and left arm (LB) and right arm (RB) for Agrobacterium tumefaciens random insertion.

[0087] After the transformant colony grows, the single colony was select for verifying the target gene pry4 by colony PCR. As shown in FIG. 7, the size of the amplified target fragment is 500 bp, being consistent with the size of the pre-verified fragment, and is conformed by sequencing.

[0088] 2. Construction of Agrobacterium pTi-Pyr4 Random Insertion Mutant Library of Trichoderma reesei 3 μL of Agrobacterium tumefaciens 0 transferred with the target plasmid pTi-pyr4 was inoculated into 3 mL of LB liquid containing 50 μg/mL of kanamycin and 25 μg/mL of rifampicin and cultured at 220 rpm and 28° C. in the shaking table.

[0089] Spore suspension of Trichoderma reesei SUS4 was prepared and coated on CM plate covered with cellophane for pre-germinating at 24° C. for about 3 h. And, 100 μl of Agrobacterium tumefaciens liquid was coated on CM plate with the pre-germinated Trichoderma reesei mycelium for co-culturing at 25° C. in dark to obtain Agrobacterium tumefaciens mediated Trichoderma reesei mutant library.

[0090] The normal growth colonies on the MM plate without uracil and cephalosporin were obtained after primary screening and secondary screening, and considered as the suspected transformants which were verified by PCR with the extracted genomic DNA.

[0091] 3. Flow Cytometry Sorting Agrobacterium pTi-Pyr4 Random Insertion Mutant Library

[0092] The plasmid pTi-pyr4 was transformed into the protoplast of SUS4 strain by Agrobacterium tumefaciens mediated transformation, so as to successfully construct the Agrobacterium tumefaciens transformation mutant library of which the transformants were imaged on the PDA plate containing cephalosporin through membrane transfer. As shown in FIG. 8, the Trichoderma reesei strains showing the red fluorescence on the surface were screened by flow cytometry after sporulation.

[0093] Primers were used to verify whether the transformant screened by flow cytometry comprised plasmid pTi-pry4, wherein as shown in FIG. 9, the results showed that four transformants after transforming the stain SUS4 were screened and confirmed to contain said plasmid, named as SUS4-T7, SUS4-T33, SUS4-T37 and SUS4-T47.

[0094] 4. Enzyme Activity Analysis of Agrobacterium tumefaciens pTi-Pyr4 Randomly Inserted Transformants Screened by Flow Cytometry

[0095] The transformants screened by flow cytometry were analyzed by shake flask fermentation taking SUS4 as the control strain. After MM and Avicel inducing, samples were taken to determine the CMC-Na activity in the supernatant. As shown in FIG. 10, the endoglucanase activities of the four transformants found by shake flask fermentation were 26.3-33.3 U/mL higher than that of their parents which is 11.1 U/ml.