CHIMERIC SIGNAL PEPTIDES FOR PROTEIN PRODUCTION
20210388046 · 2021-12-16
Assignee
Inventors
Cpc classification
C07K2317/14
CHEMISTRY; METALLURGY
C07K14/4723
CHEMISTRY; METALLURGY
C07K14/00
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
International classification
C07K14/705
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
Abstract
A chimeric signal peptide for protein expression includes an N-region, a hydrophobic region, and a C-region, wherein the N-region and the C-region are from a same signal peptide of a first protein and the hydrophobic region is from a signal peptide of a second protein, wherein the first protein is different from the second protein. The first and second protein are independently selected from the group consisting of BM40, IL2, HA, Insulin, CD33, IFNA2, IgGK leader, AZU, and SEAP.
Claims
1. A chimeric signal peptide for protein expression, comprising an N-region, a hydrophobic region (H-region), and a C-region, wherein the N-region and the C-region are from a signal peptide of a first protein and the hydrophobic region (H-region) is from a signal peptide of a second protein, wherein the first protein is different from the second protein.
2. The chimeric signal peptide according to claim 1, wherein the first protein is selected from the group consisting of basement membrane protein 40 (BM40), interleukin 2 (IL2), hemagglutinin (HA), Insulin, CD33, interferon alpha 2 (IFNA2), immunoglobulin kappa chain (IgK), Azurocidin (AZU), and secreted alkaline phosphatase (SEAP).
3. The chimeric signal peptide according to claim 1, wherein the second protein is selected from the group consisting of basement membrane protein 40 (BM40), interleukin 2 (IL2), hemagglutinin (HA), Insulin, CD33, interferon alpha 2 (IFNA2), immunoglobulin kappa chain (IgK), Azurocidin (AZU), and secreted alkaline phosphatase (SEAP).
4. The chimeric signal peptide according to claim 1, wherein the first protein is BM40 and the second protein is CD33.
5. The chimeric signal peptide according to claim 1, wherein the first protein is CD33 and the second protein is BM40.
6. The chimeric signal peptide according to claim 1, wherein the first protein is SEAP and the second protein is AZU.
7. The chimeric signal peptide according to claim 1, wherein the first protein is AZU and the second protein is SEAP.
8. The chimeric signal peptide according to claim 1, wherein the chimeric signal peptide comprises the sequence selected from SEQ ID No. 1 to 6.
9. The chimeric signal peptide according to claim 1, wherein the chimeric signal peptide comprises the sequence of SEQ ID NO: 5 or 6.
10. An isolated DNA sequence encoding the chimeric signal peptide according to claim 1, wherein the isolated DNA sequence is selected from SEQ ID NO: 21 to 26.
11. An expression vector for production of a target protein from a mammalian host cell, comprising a promoter, functionally linked to the isolated DNA sequence of claim 10, which is linked in frame to a DNA sequence encoding the target protein.
12. A method for producing a target protein, comprising: a) transfecting a mammalian host cell with the expression vector according to claim 11; b) culturing the mammalian host cell to express the target protein; and c) harvesting the target protein.
13. The method according to claim 12, wherein the mammalian host cell is a CHO cell.
14. The method according to claim 12, wherein the target protein is an antibody.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
DETAILED DESCRIPTION
[0025] Embodiments of the invention relate to chimeric signal peptides and their uses to enhance the productions of target proteins from eukaryotic systems. In accordance with embodiments of the invention, chimeric signal peptides are designed to enhance the expression and/or secretion of target proteins expressed in eukaryotic host cells. A signal peptide typically contains 5-30 amino acids in length and can be divided into an N-region, an H-region (hydrophobic region), and a C-region. A chimeric signal peptide of the invention may be constructed, for example, by swapping the hydrophobic region of a first signal peptide with the hydrophobic region from a second signal peptide.
[0026] The chimeric signal peptides of the invention may be based on known signal peptides. Commonly used signal peptides include those from BM40 (basement membrane protein 40), IL-2 (interleukin 2), HA (hemagglutinin), Insulin, CD33, IFNA2 (interferon alpha 2), IgK (immunoglobulin kappa chain), SEAP (secreted alkaline phosphatase), and AZU (Azurocidin) proteins. In the following description, these protein names may be also used to refer to their signal peptides (SPs). From these natural signal peptides, better ones are selected for further optimization. To assess the efficiencies of these signal peptides in enhancing protein productions, one can construct an expression vector containing the signal peptide and assay for levels of protein expression, e.g., using ELISA or other assays. The following examples will use antibodies as examples of target proteins. However, one skilled in the art would appreciate that embodiments of the invention may be used to express any proteins, not just antibodies.
[0027] Using an antibody as a target protein, two vectors containing a heavy chain and a light chain, respectively, of an antibody are cloned. Alternatively, an expression vector containing both the heavy chain and light chain may be used. To facilitate the assays, these vectors may also contain tags (e.g., a red and a green fluorescence tags, respectively). The test signal peptide is integrated in front of the translation start codon ATG of the antibody heavy chain or light chain. The efficiencies of antibody productions were then evaluated by co-transfection of these vectors into proper host cells. Several signal peptides, such as Albumin (ALB), Azurocidin (AZU), H5L1, and H7N1 that are known to support efficient protein productions, may be used as positive controls.
[0028] For protein productions, constructs that contain the signal peptides of the invention may be constructed into any suitable expression vectors appropriate for the protein expression systems (e.g., E. coli, yeast cells, CHO, etc.). For example, in our prior study, suitable expression vectors J1.0delta and J1.0.2 (based on pTCAE8.3) were constructed for the productions of Herceptin and Avastin. The signal peptide of each vector is AZU (Azurocidin) or Ori (original). To find better signal peptides, the AZU and Ori in the independent vectors containing the nucleic acid sequences of heavy chain or light chain, respectively, may be replaced with other signal peptides. In one example, a total of 32 vectors were constructed, and each contains a light chain or a heavy chain of an antibody (e.g., Herceptin or Avastin) with a different signal peptide.
[0029] These expression vectors were transiently transfected into CHO cells (e.g., DXB11 cells, or CHOK1 (CCL61-S1) cells) with different heavy-chain (HC) to light-chain (LC) ratio (1:1 or 1:4) to assess transfection/expression efficiencies. The expression levels of the antibodies were then assessed using ELISA.
[0030] As shown in
[0031] Next, we applied different signal peptides to produce Avastin. As shown in
[0032] Based on these and similar tests, several signal peptides are found to have similar or better abilities, as compared to the positive control AZU, to enhance protein expressions. These signal peptides are selected for further optimization. These selected signal peptides include CD33, IgK, BM40, AZU, and SEAP signal peptides.
[0033] As noted above, a signal peptide may be divided into three regions: the N-region, the H-region (hydrophobic region), and the C-region. The hydrophobic region (H-region) of a signal peptide forms a helix that is important for interactions with a signal recognition particle (SRP). Such interactions allow an SRP to bind the nascent protein and facilitate the translocation of the protein across the ER membrane. Because the H-regions play such important functions, we decided to investigate whether changing the H-regions can improve the efficiencies of signal peptides.
[0034] One approach of the invention is to create chimeric signal peptides, in which the H-region of the first signal peptide is replaced with a corresponding H-region from a second signal peptide. To perform such H-region swapping, we first analyzed the signal peptides to determine the boundaries of each regions and the signal protease cleavage sites. Many methods/programs are available in the art for such analysis, e.g., SignalP 4.0, SignalP-HMM, PrediSi, and Signal Blast.
[0035] For example, SignalP server, hosted by the Center for Biological Sequence Analysis at the Technical University of Denmark, predicts the presence and location of signal peptide cleavage sites in amino acid sequences. The method incorporates a prediction of cleavage sites and a signal peptide/non-signal peptide prediction based on a combination of several artificial neural networks. In addition, the server provides methods for predicting N-region, H-region, and C-region.
[0036] Using a CD33_IgK chimeric signal peptide as an example, MPLLLWVLLLWAGALA-EVQLVESGGG (SEQ ID NO:11), SignalP 4.0 predicts the C, S, Y scores. The C score predicts that the signal peptidase would cleave after the alanine (A) and before the glutamic acid (E) in the sequence, MPLLLWVLLLWAGALA-EVQLVESGGG (SEQ ID NO:11). The S score indicates the likelihood of the sequence being a signal peptide: the higher the score means it is more likely to be a signal peptide. The Y score is based on a combination of the C and S scores. The Y score further confirms that the peptidase would cleave before the glutamic acid residue. (see
[0037] A similar program, SignalP-HMM (based on hidden Markov Model, Henrik Nielsen and Anders Krogh, In Proceedings of the Sixth International Conference on Intelligent Systems for Molecular Biology (ISMB 6), AAAI Press, Menlo Park, Calif., pp. 122-130 (1998)), also predicts the N-region, H-region, and C-region, as well as the signal peptidase cleavage site (
[0038] Another program, PrediSi (Prediction of Signal Peptides, Karsten Hiller et al. “Prediction of Signal Peptides and Their Cleavage Positions,” Nucleic Acids Res., 2004, July 1, 32:: W375-W379, doi: 10.1093/nar/gkh378), also predicts that the peptidase will cleave between alanine (A) and glutamic acid (E). (
[0039] Any of these methods may be used to predict the signal peptides and their corresponding N-regions, H-regions, and C-regions. They generally produce consistent results. Even if, arguendo, there is minor discrepancy, the precise demarcation of boundaries between the N-regions, H-regions, and C-regions are not critical for embodiments of the invention. As noted above, the H-region is a hydrophobic stretch that tends to form an α-helix. It is known that the M domain of a signal recognition particle (SRP) binds signal peptides with considerable sequence variations in the H-region, including a synthetic peptide with poly-Leu for its H-region. (Kendall et al., “Idealization of the hydrophobic segment of the alkaline phosphatase signal peptide,” Nature, 1986; 321:706-708). Therefore, swapping one α-helix for another would not be impacted by the exact boundaries for the α-helix.
[0040] In accordance with embodiments of the invention, based on the above-mentioned prediction methods or other similar methods, one can design H-region swapping to create chimeric signal peptides. For example, one may swap the H-region of a first signal peptide with the H-region from a second signal peptide. Based on the promising signal peptides described above, e.g., CD33, IgK, BM40, AZU, and SEAP signal peptides, one can create various chimeric signal peptides.
[0041] In this description, the following notations are adopted for the chimeric signal peptides: the first signal peptide providing the N-region and C-region is listed first, followed by the name of the second signal peptide that provides the H-region. For example, BM40_CD33 (or BM-CD or BMCD) chimeric signal peptide contains the N-region and C-region from BM40 and the H-region from CD33. Similarly, CD33_BM40 (or CD-BM or CDBM) chimeric signal peptide contains the N-region and C-region from CD33 and the H-region from BM40. Other examples include: CD33_IgK (CD33 with the hydrophobic region of IgK leader), IgK_CD33 (IgK leader with the hydrophobic region of CD33), SEAP_AZU (SEAP with the hydrophobic region of AZU), AZU_SEAP (AZU with the hydrophobic region of SEAP). The nucleotide and peptide sequences for some of these chimeric signal peptides are shown in the following Table 1:
TABLE-US-00001 TABLE 1 SEQ SP name Sequences of Signal Peptides ID NO CD33_IgK MPLLLWVLLLWAGALA 1 IgK_CD33 METDTLLLLLPLLWVPGSTG 2 SEAP_AZU MILGPLTVLALLAGLLRLQLSLG 3 AZU_SEAP MTRCMLLLLLLLGLASSRA 4 BM40_CD33 MRALLLLLPLLWAGRALA 5 CD33_BM40 MPWIFFLLCLAGALA 6 SEAP MILGPCMLLLLLLLGLRLQLSLG 7 AZU MTRLTVLALLAGLLASSRAGSSPLLD 8 AZUd MTRLTVLALLAGLLASSRA 9 3D5R SP MRVPAQLLGLLLLWLPGARC 10 CD33-IgK-P MPLLLWVLLLWAGALA-EVQLVESGGG 11 BM40_CD33- MRALLLLLPLLWAGRA 12 truncated Underlines indicate the hydrophobic regions in the chimeric signal peptides.
[0042] The following section will use a limited number of specific chimeric signal peptides as examples to illustrate embodiments of the invention. However, one skilled in the art would appreciate that these limited examples are for illustration only and are not meant to limit the scope of the invention.
[0043] These chimeric signal peptides can be first analyzed in silico using SignalP server (or other similar services) to make sure that they can still function as signal peptides, and they still have the signal peptidase cleavage sites. The following examples use BMCD and CDBM chimera as the signal peptides to illustrate embodiments of the invention. However, the description is equally applicable to other chimeric signal peptides of the invention.
[0044] As shown in
[0045] These chimeric signal peptides are then tested for their abilities to serve as signal peptides and to assess their abilities to support and enhance protein expression/secretion. The tests are performed using an exemplary construct shown in
[0046] As shown in
[0047] Using Herceptin as a target protein,
[0048] The above results are from co-transfection of two separate vectors for the production of HC and LC chains of Herceptin. An alternative method is to construct an expression vector that produces both HC and LC from the same vector. To test whether the one-vector expression system would be more effective, the HC vector containing BMCD and the LC vector containing BMCD are subcloned into a proper expression vector (e.g., J2.0-PDSZ vector, which is based on pTCAE8.3). The expression of Herceptin using this vector is tested in CHO cells. As shown in
[0049]
[0050] While the above results use Herceptin as the target protein/antibody, other proteins (e.g., Avastin, Denosumab, etc.) have also been tested and are found to have similar results. For example,
[0051] In addition to the chimeric signal peptides themselves, the context/environment of these chimeric signal peptides may also have influence on the efficiencies of protein productions. That is, different vectors may further enhance the efficiencies of these chimeric signal peptides. For example, we found that the expression vector J2.0.2 produces about 2 times the level of Denosumab compared to J2.0 vector. Similarly, Avastin also produces better using a J2.0.2 vector. On the other hand, for Herceptin and Tim3 antibodies, the vector J2.0 produces higher yield. J2.0.2 vector has different promotors for the HC and LC chains, as illustrated in
[0052]
[0053] While the above examples show the productions of various antibodies, embodiments of the invention may also be used for the productions of other proteins (such as fusion proteins of interest).
[0054]
[0055] The above examples show that chimeric signal peptides of the invention can efficiently enhanced the production and secretion of recombinant proteins, include antibodies. The enhancements are seen in transient transfection, as well as in stable transfected cells in batch cultures.
[0056] Embodiments of the invention may be practiced with any suitable methods known in the art. The following description provides some examples. One skilled in the art would appreciate that these examples are for illustration only and that other modifications and variations are possible without departing from the scope of the invention.
Cell Culture and Media
[0057] Chinese Hamster Ovary (CHO) cell lines DXB11 were obtained from Dr. Lawrence Chasin, University of Columbia. The DHFR negative CHO DXB11 cell line (also known as DUX_TX-B11 and DUKX) was historically the first CHO cell line to be used for large scale production of heterologous proteins and is still used for production of a number of complex proteins (C. S. Kaas et al., “Sequencing the CHO DXB11 genome reveals regional variations in genomic stability and haploidy,” BMC Genomics, 16, Article No. 160 (2015)). Cell cultures were carried out in an incubator under 5% CO.sub.2, at a temperature of 37° C. and 95% humidity. The media for the cell cultures include Hyclone and Mixed medium (50% CDFortiCHO and 50% ActiCHO). Cell counts and viability analysis were performed after staining with trypan blue using an automatic cell counter TC10 (Bio-Rad, USA).
[0058] The transfection constructs include puromycin resistance gene. Stable pools were selected based on puromycin resistance. Once it becomes a single clone, selection is not necessary.
Vector Constructions
[0059] In the examples, each HC or LC peptide fragment containing the signal peptide sequence may be amplified using PCR and then integrated into expression vectors using any technique known in the art, such as the highly efficacy In-Fusion® HD enzyme (Clontech, Takara Bio USA, Inc., Mountain View, Calif.). To construct the expression vectors of the invention, a selected signal peptide sequence is cloned into a suitable vector (e.g., pcDNA3.1 or pTCAE based vectors) that contains a protein to be expressed (e.g., HC or LC chain of a target antibody). The vector also contains an IRES sequence for the control of reporter genes (e.g., EGFP and DsRed). Using the CD33 signal peptide as an example, CMV-HC.sup.CD33-IRES-EGFP and CMV-LC.sup.CD33-IRES-DsRed were obtained. Other signal peptides may be similarly constructed. For example, the following signal peptide sequences (TABLE 2) have been constructed into expression vectors in a similar manner.
TABLE-US-00002 TABLE 2 SP Name Sequence SEQ ID NO BM40 gccaccatgagagcctggatcttttttctgctctgcctcgctggcagagccctggct 13 IL_2 gccaccatgcagctgctgtcatgcatcgcattgatcttggcgctggtg 14 HA gccaccatgaagaccatcatcgccctgtcctacatcttctgcttggtcctcgga 15 Insulin gccaccatggcgctgtggatgcgcctgctgccgctgctggcgctgctggcgctgtgg 16 ggcccagatccggcggcggcg CD33 gccaccatgccgctgctgctgctgctgccgctgctgtgggcgggcgcgctggcg 17 IFNA2 gccaccatggcgctgacctttgcgctgctggtggcgctgctggtgctgagctgcaaa 18 agc IgG kappa gccaccatggagacagacacactcctgctatgggtactgctgctctgggttccaggt 19 chain tccactggt SEAP atgattctggggccctgcatgctgctgctgctgctgctgctgggcctgaggctacag 20 ctctccctgggc CD33-IgK gccaccatgccgctcctgctatgggtactgctgctctgggcgggcgcgctggcg 21 IgK-CD33 gccaccatggagacagacacactgctgctgctgctgccgctgctgtgggttccaggt 22 tccactggt SEAP-AZU gccaccatgattctggggcccctgacagtcctggccctgctggctggtctgctgagg 23 ctacagctctccctgggc AZU-SEAP gccaccatgacccggtgcatgctgctgctgctgctgctgggcctggcgtcctcgagg 24 gcc BM40-CD33 gccaccatgagagccctgctgctgctgccgctgctgtgggctggcagagccctggct 25 CD33-BM40 gccaccatgccgtggatcttttttctgctcgcctcgcgggcgcgctggcg 26
[0060] The constructions of these vectors may use any conventional cloning techniques. In some specific examples, overlapping PCR techniques are used, e.g., PCR amplifications and joining of amplified overlap fragments. These techniques are routine and conventional.
Transfection of CHO Cells
[0061] Transfection of the constructs into host cells can use any suitable methods and setups known in the art. For example, CHOK1 cells were cultured in a 6-well plate. Each well was seeded with 1×10.sup.6 cells in 3 mL of Hyclone™ HyCell™ CHO culture medium (GE Healthcare) containing 8 mM GlutaMAX™ (Thermo Fischer). Transfections of the vectors (e.g., pcDNA3.1) containing the LC and HC of Herceptin constructs may be performed using any suitable reagents known in the art, such as a lipophilic agent FreeStyle MAX™ (Thermo Fischer). For example, Herceptin HC.sup.BM40CD33, Herceptin LC.sup.BM40CD33, and the transfection reagent Freestyle MAX™ (Thermo Fischer) were separately added into OptiPRO™ SFM (Thermo Fischer) to prepare the vector solutions as shown in TABLE 3. These solutions were let stand for 5 minutes before they were added into the transfection reagents and mixed well. The resultant solutions were allowed to stand for 20 minutes before transfection into the cells. The cells were then evaluated 3 days after the transfection.
TABLE-US-00003 TABLE 3 pcDNA3.1-HerHC.sup.BM40CD33 (A) + CHOK1 Sample ID pcDNA3.1-HerLC.sup.BM40CD33 (B) TCAE-Her.sup.BMCD Herceptin Conc. A: 0.83/ A: 0.83/ A: 0.83/ 2 (μg/μl) B: 0.61 B: 0.61 B: 0.61 Prepare DNA- 1:4 1:2 1:1 Liquid Complex Dilute 5 ug DNA in Plasmid HC: 1.2/ HC: 2/ HC: 3/ 2.5 OptiPRO SFM (μl) LC: 6.6 LC: 5.5 LC: 4.1 (total 0.15 ml) Medium 142.2 142.5 142.9 147.5 (μl) Dilute 5 ul FreeStyle Liposome 5 5 5 5 MAX in OptiPRO SFM (μl) (total 0.15 ml) Medium 145 145 145 145 (μl) Add the diluted DNA to Incubate for the diluted reagent 20 mins Add 3 ml of complex to 1.00E+6 each suspension flask (3 ml); cell density/ml
Protein Expression
[0062] For protein/antibody production in the test CHO cells, the antibody/protein expression constructs may be from commercial sources or be prepared based on procedures known in the art and transfected into the test CHO cells for transient expression of the antibodies or proteins. The transfected CHO cells were cultured for an appropriate duration (e.g., 3 days) to produce the target proteins. Alternatively, the transfection may produce stable cell lines that can be used to produce proteins in conventional cultures or batch cultures. Any methods known in the art to facilitate the selection of stable transfectant cell lines may be used. For example, one may use vectors that contain DHFR genes and CHO cells that lack the DHFR genes. Only the CHO cells containing the transfected vectors would survive in restricted media.
[0063] The protein expression levels may be assessed using any suitable methods, such as ELISA, HPLC, or other methods. If the expressed protein has an enzymatic activity (e.g., SEAP), one can also use the activity to assess the protein expression levels. For example, for SEAP, a GreatEscAPe™ chemiluminescence kit may be obtained from Clontech. Prepare 1× Dilution Buffer by diluting the 5× Dilution Buffer 1:5 with ddH.sub.2O. To evaluate the protein expression levels, transfer 25 μl of cell culture medium from transfected cells or mock transfected cells to a 96-well microtiter plate. If necessary, the plate can be sealed and frozen at 20° C. for future analysis. Add 75 μl of 1× Dilution Buffer to each sample in the 96-well microtiter plate. Seal the plate with adhesive aluminum foil or a regular 96-well lid and incubate the diluted samples for 30 min at 65° C. using a heat block or water bath.
[0064] Cool the samples on ice for 2-3 min, then equilibrate to room temperature. Add 100 μl of SEAP Substrate Solution to each sample. Incubate for 30 min at room temperature before reading. Use a 96-well plate reader luminometer (e.g., CLARIOstar®) to detect and record the chemiluminescence signals. Antibody titers in the culture supernatants were determined by ELISA. Cell specific productivity (Qp) was calculated by dividing the titer by the integral area under the curve of daily viable cell density.
[0065] While embodiments of the invention has been described with respect to a limited number of embodiments, those skilled in the art, having benefit of this disclosure, will appreciate that other embodiments can be devised which do not depart from the scope of the invention as disclosed herein. Accordingly, the scope of the invention should be limited only by the attached claims.