METHOD FOR REVERSIBLY PROTECTING AND SEPARATING DNA
20210388417 · 2021-12-16
Assignee
Inventors
Cpc classification
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Q2525/173
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q2525/173
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure provides a method for reversibly protecting and separation DNA, comprising phosphorylating the 5′-terminal of a target DNA molecule, modifying the 5′-terminal by adenylation; adding adenosine DNA-sensitive exonuclease to samples obtained after termination of the reaction to digest the template; finally, the obtained adenylated modified DNA, that is, the obtained target DNA is separated, and subjected to technical analysis such as sequencing and identification, and the 5′end of the obtained sequence is the site of adenylation modification. The method provided by the present disclosure fills the gap that the prior art cannot accurately locate the break site on genomic DNA, can realize the quantitative and positioning analysis of the break site on DNA samples of different lengths and different sources, and is simple to use and easy to operate. And there are no special requirements for samples, high accuracy, low detection background influence, and high resolution.
Claims
1. A method for reversibly protecting and separating DNA, comprising steps of: (1) subjecting a DNA molecule to enzymatic treatment to obtain a sample containing 5′-phosphorylated DNA; (2) unwinding the sample containing 5′-phosphorylated DNA to obtain single-stranded DNA; (3) labeling the single-stranded DNA by 5′-adenylation to obtain a sample containing 5′-adenylated DNA; (4) digesting the sample obtained in step (3) with adenylation-sensitive 5′-3′ exonuclease, removing the single-stranded DNA that is not modified by 5′-adenylation, and purifying the sample to obtain a target DNA molecule that is modified by 5′-adenylation; (5) subjecting the target DNA molecule with adenylation modification to deadenylation treatment to obtain a target DNA molecule.
2. The method according to claim 1, wherein in step (1), the DNA molecule is double-stranded or single-stranded, and when the DNA molecule is single-stranded, step (2) is omitted.
3. The method according to claim 1, wherein in step (1) the enzyme is an enzyme that is capable of converting 5′-hydroxyl DNA into 5′-phosphorylated DNA, and the enzyme is selected from T4 polynucleotide kinase and an excision repair enzyme targeting DNA damage sites; and wherein in step (4), the adenylation-sensitive 5′-3′ exonuclease is selected from T5 exonuclease, RecJ exonuclease, and combination thereof.
4. The method according to claim 1, wherein in step (2), unwinding the sample containing 5′-phosphorylated DNA comprises thermal denaturation.
5. The method according to claim 1, wherein in steps (1), (3), and (5), further comprising purifying the sample after reaction.
6. A method for detecting damage and modification sites in a DNA molecule by using the method according to claim 1, comprising: (i) extracting a DNA molecule, disrupting and dephosphorylating the DNA molecule to obtain a sample; (ii) obtaining a target DNA molecule by using the methods according to claim 1; and (iii) sequencing the target DNA molecule and performing analysis and alignment to obtain the damage or modification sites.
7. The method according to claim 6, wherein the step (i) disrupting is performed by sonication, with a fragment size of preferably 200-500 bp.
8. The method according to claim 6, wherein in step (iii), sequencing is performed by Sanger sequencing or Illumina sequencing.
9. The method according to claim 8, wherein in step (iii), sequencing is performed by Illumina sequencing, and the method further comprises a step of PCR amplification after the target DNA molecule is converted into double-stranded DNA, and the product of PCR amplification is used for Illumina sequencing.
Description
BRIEFT DESCRIPTION OF THE DRAWINGS
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0039] The present disclosure will be further described below in conjunction with the embodiments and drawings, but the present disclosure is not limited by the following embodiments.
Example 1
[0040] DNA modification by adenylation and analysis of its anti-nuclease activity
[0041] A DNA single-stranded fragment (20 nt, SEQ ID NO. 1: 5′Phos/-NNCAC TCG GGC ACC AAG GAC-3′) containing a modification of 5′-phosph and a Homeobox DNA without phosphate modification were synthesized by a DNA synthesis company (IDT, USA).
[0042] The short DNA fragments with phosphorylation modification and without modification were mixed in equal proportion and used as a DNA substrate. The 20 μL reaction system contains 100 pmol of Mth RNA Ligase (NEB, USA), 2 μL of 1 mM ATP (NEB. USA), 2 μL of DNA Adenylation Buffer (NEB, USA), 2 μg of DNA substrate, and the reaction system was made up to 20 μL with water. After reacting at 65° C. for 1.5 h, the reaction system was inactivated at 85° C. for 5 min.
[0043] The reaction product was purified with a DyeEx DNA Purification Kit 2.0 spin kit (QIAGEN) and analyzed by Bioanalyzer (Agilent) Small RNA Chip. The results are shown in
[0044] DNA with 5′-adenylation modification and DNA without modification were subjected to analysis of hydrolysis by RecJ and T5 exonuclease, respectively. In a 20 μL reaction system, containing 1 μg of DNA substrate, 10 units of exonuclease T5 (NEB) or 30 units of exonuclease RecJf (NEB), reaction was carried out at 37° C. for 1.5 hours, and inactivated at 65° C. for 20 minutes. The reaction product was purified with DyeEx DNA purification kit 2.0 spin kit (QIAGEN), and then analyzed using Bioanalyzer (Agilent) Small RNA Chip. The results are shown in
[0045] Reversible removal of adenylation modification: adenylated DNA (5′ App DNA) was reverted to its initial state (5′-phosphorylation-modified DNA) with Deadenylation Kit (NEB). 20 μL of reaction system containing 50 units of deadenylation enzyme 5′-Deadenylase (NEB, USA), 2 μL of buffer (NEB Buffer1), 50 ng of adenylation-modified short-chain DNA substrate, 50 ng of short chain DNA substrate without modification was made up with water to 20 μL. Reaction was carried out at 30° C. for 1 hour, and inactivated at 70° C. for 20 minutes. The reaction product was purified with DyeEx DNA Purification Kit 2.0 spin kit (QIAGEN) and analyzed by Bioanalyzer (Agilent) Small RNA Chip. The result is shown in
Example 2
[0046] Application of technology of reversible protection and separation by adenylation in identification of DNA damage sites
[0047] 1. AP Site
[0048] (1) by DNA synthesis companies (the IDT Corporation, USA) containing synthetic 100 bp of DNA double-stranded fragments, sense strand sequence:
TABLE-US-00001 SEQ ID NO. 2: ACTGGGGCCAGATGUGTAAGCCCTCCCGTATCGTAGTTATCTACACGACG GGGAGTCAGGATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTA G,
underlined is the DNA damage (Uracil) site;
[0049] (2) Enzyme digestion of DNA damage sites: A 50 μL reaction system containing 10 units of Uracil repair enzyme UDG and endonuclease IV (NEB, USA), 5 μL of buffer (NEB Cutsmart Buffer), 1 μg of DNA substrate was made up to 50 μL with water. After reacting at 37° C. for 1 h, the reaction system was inactivated at 75° C. for 20 min;
[0050] (3) DNA denaturation: DNA sample was placed in a PCR machine, and the sample was quickly placed on ice after thermal denaturation at 95° C. for 3 minutes;
[0051] (4) Reversible labeling of break points: 20 μL×2 systems containing 100 pmol of Mth RNA Ligase (NEB, USA), 2 μL of 1 mM ATP (NEB, USA), 2 μL of DNA Adenylation Buffer (NEB, USA), 2 μg of 5′-phosphorylated DNA substrate were made up to 20 μL with water. After reacting at 65° C. for 1.5 h, the reaction system was inactivated at 85° C. for 5 min.
[0052] (5) Purification of the labeled DNA fragments: Using a Zymo DNA purification kit, 100 μL of binding solution and 400 μL of absolute ethanol were added to the reaction product, mixed thoroughly and passed through a column, rinsed once with 750 μL of wash buffer, and eluted with 20 μL of eluent.
[0053] (6) Elimination of the template: 10 units of exonuclease enzyme T5 (NEB) or 30 units of exonuclease enzyme RecJf (NEB) was added to the purified solution, reacted at 37° C. 1.5 h, and inactivated at 65° C. for 20 min. The reaction product was just the isolated adenylation-modified DNA, which was purified using DyeEx the DNA purification kit 2.0 Spin kit (QIAGEN) and would be used for the reaction in step (7).
[0054] (7) Removal of breakpoint label: adenylated DNA (5′App DNA) was reverted to initial state (5′p-DNA) using Deadenylation Kit (NEB). A 20 μL reaction system containing 50 units of deadenylation enzyme 5′-Deadenylase (NEB, USA), 2 μL of buffer (NEB Buffer1), and short-chain DNA substrate obtained in step (6) was made up to 20 μL with water. Reaction was carried out at 30° C. for 1 h and inactivated at 70° C. for 20 min.
[0055] The product obtained in step (7) was sent to a sequencing company (Genewiz) for Sanger sequencing. The results are shown in
[0056] 2. Detection of Oxidative Damage Sites in Escherichia coli
[0057] (1) An Escherichia coli strain of DH10B was cultured in 10 mL LB culture at 37° C. till OD600=0.5, and the culture was placed on ice for 20 min, then 0.2 mM hydrogen peroxide was added for treatment for 30 min. 1 mL of bacterial cells was collected and extracted for genomic DNA with OMEGA Bacterial DNA Kit (OMEGA, USA). The extraction method was conducted in accordance with the product instructions.
[0058] (2) 5 μg of extracted genomic DNA was taken and added, and made up to 100 μL with ultrapure water, and an ultrasonic breaker was used to fragment the DNA into fragments of about 500 bp.
[0059] (3) 26 μL of the DNA obtained in step (2) was treated by dephosphorylation: 3 μL of Cutsmart Buffer (NEB) and 1 μL Shrimp Alkaline Phosphatase (rSAP, NEB) were added, reacted at 37° C. for 30 min, and inactivated at 70° C. 10 min.
[0060] (4) Restriction enzyme digestion of the DNA damage sites: 50 μL of reaction system containing 10 units of Uracil repair enzyme UDG and endonuclease IV (NEB, USA), 5 μL of buffer (NEB Cutsmart Buffer), and 1 μg of DNA substrate was made up to 50 μL with water. After reacting at 37° C. for 1 hour, the reaction system was inactivated at 75° C. for 20 minutes. The reaction product was purified with DyeEx DNA Purification Kit 2.0 spin kit (QIAGEN).
[0061] (5) DNA denaturation: the DNA sample obtained in step (4) was placed in a PCR machine, and quickly placed the sample on ice after thermal denaturation at 95° C. for 3 minutes.
[0062] (6) Reversible labeling of breakpoints: 5′-phosphorylated terminal was converted to adenylation modification by using 5′-DNA adenylation kit (NEB, USA). A reaction system contained 2 μL of Mth RNA Ligase, 2 μL of 1 mM ATP, 2 μL of DNA Adenylation Buffer, and the DNA substrate obtained in step (5) was made up to 20 μL with water. The reaction was carried out at 65° C. for 1.5 h and then inactivated at 85° C. to 5 min;
[0063] (7) Elimination of the templates: 10 units of exonuclease endonuclease T5 (NEB, USA) or 30 units of exonuclease RecJf (NEB, USA) was added to the purified solution, reacted at 37° C. for 1.5 h and inactivated at 65° C. for 20 min. Control: Non-adenylated DNA was digested with the same system.
[0064] (8) Purification of labeled DNA fragments: using Zymo DNA purification kit, 100 μL of binding solution and 400 μL of absolute ethanol was added to the reaction product, mixed thoroughly and passed through a column. The column was rinsed once with 750 μL of wash buffer, and then eluted with 10 μL of eluting agent.
[0065] (9) Removal of breakpoint label: deadenylation was conducted using Deadenylation Kit (NEB, USA). A reaction system containing 50 units of deadenylation enzyme (NEB, USA), 2 μL of buffer (NEB Buffer1), and DNA substrate obtained in step (6) was made up to 20 L with water. The reaction was carried out at 30° C. for 1 h and inactivated at 70° C. for 20 min. The reaction product is purified according to the method in step (8).
[0066] (10) Construction of Illumina library: DNA library was constructed with the eluted DNA obtained in step (9), using the Clontech SMART ChIP-seq kit for. Kit instructions were followed: 1 mM of adaptor DNA and MML viral reverse transcriptase were added and reacted at 50° C. for 2 hours. The reaction was terminated at 70° C. for 10 min. Then PCR amplification was performed under the conditions of denaturation at 95° C. for 30 s, annealing at 50° C. for 30 s, and extension at 68° C. for 30 s, 15 cycles. The product was sent to the sequencing company for Illumina sequencing.
[0067] (11) Analysis of Illumina sequencing data: the obtained sequencing data were matched to E. coli genome, and 5′-terminal in the region where the reads were concentrated is shown in