Mutant of Nitrile Hydratase Derived from Caldalkalibacillus thermarum

Abstract

The disclosure discloses a mutant of nitrile hydratase derived from Caldalkalibacillus thermarum, and belongs to the technical field of enzyme engineering. The nitrile hydratase mutant Cal. t Nhase-A20V provided by the disclosure has a half-life of about 10 min at 70° C., which does not change much compared with the thermal stability of the wild enzyme. The specific enzyme activity of the mutant Cal. t Nhase-A20V is 128% of that of the wild enzyme. At the same time, the mutant also has better tolerance to a substrate and a product, and the final yield of nicotinamide produced by whole-cell catalysis reaches 598 g/L. Therefore, the nitrile hydratase mutant Cal. t Nhase-A20V provided by the disclosure has good enzymatic properties and is beneficial to future industrial production.

Claims

1. A nitrile hydratase mutant, comprising a β subunit, an a subunit and a regulatory protein, the amino acid sequences of which are set forth in SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO. 4, respectively.

2. Recombinant E. coli, expressing the nitrile hydratase mutant according to claim 1.

3. The recombinant E. coli according to claim 2, using E. coli BL21 as a host and a pET-series plasmid as a vector.

4. The recombinant E. coli according to claim 3, wherein the plasmid is pET-24(+).

5. A method for producing nicotinamide or acrylamide, comprising expressing the nitrile hydratase mutant of claim 1 as a catalyst, and carrying out a transformation reaction, wherein 3-cyanopyridine or acrylonitrile is used as a substrate to.

6. The method according to claim 5, comprising carrying out a fermentation culture of Recombinant E. coli of claim 2, and using fermentation broth for whole-cell transformation to produce nicotinamide or acrylamide.

7. The method according to claim 6, wherein OD.sub.600 of the fermentation broth is 5-10, and the concentration of the substrate is 0.2-1 mol/L.

8. The method according to claim 6, wherein conditions of the whole-cell transformation reaction are: the temperature is 25-28° C., and the mass ratio of the substrate 3-cyanopyridine to wet bacterial cells is 0.5-2.

9. The method according to claim 6, wherein the whole-cell transformation reaction conditions are: the temperature is 25-28° C., and the mass ratio of the substrate acrylonitrile to wet bacterial cells is 1-1.5.

10. The method according to claim 5, wherein the nitrile hydratase mutant is prepared as follows: an LB culture medium is inoculated with the recombinant E. coli, culturing is performed at 35-37° C. until the OD.sub.600 is 0.6-0.8, and an inducer IPTG is added for induction at 20-30° C. for 12-18 h.

11. The method according to claim 10, wherein the method further comprises the following steps: collecting the bacterial cells of the cells, disrupting the bacterial cells, collecting the supernatant, performing filtering through a membrane, and performing separation with a Strep Trap HP column to obtain the nitrile hydratase mutant.

Description

BRIEF DESCRIPTION OF FIGURES

[0026] FIG. 1 shows the thermal stability of the wild enzyme and the mutant enzyme Cal. t Nhase-A20V treated at 70° C. for 10 min.

[0027] FIG. 2 shows the r of the relative enzyme activity of wild enzyme and the mutant enzyme treated at 30° C. for 30 min.

[0028] FIG. 3 shows the tolerance of the wild enzyme and the mutant enzyme Ca11 Nhase-A20V to the substrate under different concentrations of substrate 3-cyanopyridine.

[0029] FIG. 4 shows the tolerance of the wild enzyme and the mutant enzyme Ca11 Nhase-A20V to the substrate under different concentrations of substrate nicotinamide.

[0030] FIG. 5 shows the concentration of 3-cyanopyridine and nicotinamide in the process of enzymatic reaction from 3-cyanopyridine to nicotinamide.

DETAILED DESCRIPTION

[0031] Definition of enzyme activity (U): The amount of enzyme required to transform 3-cyanopyridine to 1 μmol/L nicotinamide per minute is defined as 1 U.

[0032] Specific enzyme activity (U/mg): The enzyme activity per milligram of NHase.

[0033] Definition of relative enzyme activity: The enzyme activity of a mutant enzyme measured at a pH of 7.4 and a temperature of 30° C. for 10 min is defined as 100%.

[0034] LB culture medium: Peptone 10 g/L, yeast extract 5 g/L, and NaCl 10 g/L.

[0035] Reaction system of nitrile hydratase: The substrate is 490 μL of 200 mM 3-cyanopyridine. 10 μL of a pure enzyme solution with a concentration of 0.5 mg/mL or 10 μL of a broth with an OD.sub.600 of 8 is added, and the reaction is carried out at 30° C. for 10 min. Then the reaction is stopped with 500 μL of acetonitrile, and the reaction solution is centrifuged to remove precipitate. The supernatant is taken, filtered through a 0.22 μm membrane, and used as a sample for liquid phase determination.

[0036] Detection of nitrile hydratase: HPLC is used for detection; a mobile phase contains water and acetonitrile in a ratio of 1:2; the detection wavelength is 210 nm; the flow rate is 0.6 mL/min; and the chromatographic column is C18 column.

[0037] Determination of temperature stability: The wild enzyme and mutant are treated in a KPB buffer with a pH of 7.4 at 70° C. for 10 min and 30 min respectively, and the residual enzyme activity is determined. The enzyme activity of the untreated enzyme is defined as 100%, and the thermostability result is obtained.

[0038] Determination of tolerance to substrate: The wild enzyme and the mutant are diluted in a KPB buffer with a pH of 7.4 to form broths with an OD.sub.600 of 8. After incubation at 30° C. for 30 minutes in 3-cyanopyridine with the concentrations of 0 M and 1 M respectively, the residual enzyme activity is determined and the results of tolerance to the substrate are obtained.

[0039] Determination of tolerance to product: The wild enzyme and the mutant are diluted in a KPB buffer with a pH of 7.4 to form broths with an OD.sub.600 of 8. After incubation at 30° C. for 30 minutes in nicotinamide with the concentrations of 0 M, 1 M and 2 M respectively, the residual enzyme activity is determined and the results of tolerance to the product are obtained.

Example 1

[0040] Kinetic simulations of the nitrile hydratase (Pt NHase) derived from Pseudonocardia thermophila and the Cal. t NHase derived from Caldalkalibacillus thermarum found that some amino acids had higher RMSF values, and it was speculated that these amino acids might affect the thermal stability. Therefore, the following mutants were constructed: Cal. t NHase-A20V, Cal. t NHase-H150S (the histidine at position 150 of the β subunit with an amino acid sequence as shown in SEQ ID NO. 2 was mutated to serine), Cal. t NHase-T104A (the threonine at position 104 of the β subunit with an amino acid sequence as shown in SEQ ID NO. 2 was mutated to alanine), Cal. t NHase-S152K (the serine at position 152 of the β subunit with an amino acid sequence as shown in SEQ ID NO. 2 was mutated to lysine), and Cal. t NHase-K185A (the lysine at position 185 of the β subunit with an amino acid sequence as shown in SEQ ID NO. 2 was mutated to alanine).

(1) Construction of Mutants:

[0041] A Cal. t-NHase gene (as shown in SEQ ID NO. 1) was synthesized, and the gene was cloned at the Nde I and EcoR I restriction sites of a pET24a plasmid by Suzhou Genewiz, to obtain a pET24a-Cal. t NHase recombinant plasmid. Using pET24a-Cal. t NHase as a template, PCR was carried out with the primers shown in Table 1 under the conditions shown in Table 2. The PCR products were transformed into E. coli JM109 and sequenced by Suzhou Genewiz. The recombinant plasmids pET24a-NHase-A20V, pET24a-Cal. t Nhase-H150S, pET24a-Cal. t Nhase-T104A, pET24a-Cal. t Nhase-S152K, and pET24a-Cal. t Nhase-K185A carrying the gene encoding the mutant were obtained from the plasmids with correct sequencing results. The recombinant plasmids were transformed into E. coli BL21 strains for expression to obtain recombinant strains.

TABLE-US-00001 TABLE 1 Primers Primer Sequence Sequence No. H150S-U AAGAACATCAGCCCGAGTGGTCATACCC SEQ ID NO. 6 H150S-D GACCACTCGGGCTGATGTTCTTGGTTTT SEQ ID NO. 7 CAC T104A-U CCAGCCGGATGCCCCGACCCCGCGCCGC SEQ ID NO. 8 GAAAAC T104A-D GGCGCGGGGTCGGGGCATCCGGCTGGGC SEQ ID NO. 9 CAG S152K-U TCCACCCGAAGGGTCATACCCGTCTG SEQ ID NO. 10 S152K-D GGGTATGACCCTTCGGGTGGATGTTCTT SEQ ID NO. 11 G K185A-U GCCCATGGCGCCGGCGAAAGCCCGCAG SEQ ID NO. 12 K185A-D GCTTTCGCCGGCGCCATGGGCATTGGCA SEQ ID NO. 13 T A20V-U TTTTGGAGCGTGCGTGCAAAGGCTTTAG SEQ ID NO. 14 A20V-D CCTTTGCACGCACGCTCCAAAAAGACTC SEQ ID NO .15 C

TABLE-US-00002 TABLE 2 Whole-plasmid PCR amplification reaction system Regent Amount ddH.sub.2O 32 μL 5 × PS Buffer (Mg.sup.2+ plus) 10 μL dNTP Mixture (2 mmol/L)  4 μL P1 (10 mmol/L)  1 μL P2 (10 mmol/L)  1 μL pET24a-Cal.t NHase  1 μL Primer STAR HS DNA  1 μL polymerase Total 50 μL

[0042] PCR Amplification Reaction Conditions:

TABLE-US-00003 95° C. Initial denaturation  5 min 95° C. Denaturation  1 min {close oversize brace} 30 cycles 58° C. Annealing 30 s  72° C. Extension  2 min 72° C. Extension 10 min

[0043] The PCR products were identified by agarose gel electrophoresis. Then the PCR products were purified, digested and transformed into E. coli BL21 competent cells.

[0044] (2) 5 mL of LB culture medium (peptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L) containing kanamycin with a concentration of 50 μg/mL was inoculated with the recombinant E. coli strains BL21/pET24a-Cal. t NHase-A20V, BL21/pET24a-Cal. t Nhase-H150S, BL21/pET24a-Cal. t Nhase-T104A, BL21/pET24a-Cal. t Nhase-S152K, and BL21/pET24a-Cal. t Nhase-K185A obtained in step (1), and culturing was performed with shaking overnight at 37° C. and 200 r/min.

[0045] 100 mL of LB expression culture medium (peptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L) containing kanamycin with a concentration of 50 μg/mL was inoculated with the overnight culture at an inoculum concentration of 1% (v/v), and culturing was performed at 37° C. and 200 r/min with shaking until the OD.sub.600 was 0.6-0.8. Then an inducer IPTG was added to 0.1 mM, and Co.sup.2+ was added to 0.1 mg/L to carry out induction at 25° C. for 12-18 h to obtain bacterial cells. The bacterial cells were centrifuged at 12,000 rpm and then collected.

[0046] (3) The recombinant bacterial cells were concentrated with a binding buffer solution (20 mmol/L Na.sub.2HPO.sub.4, 280 mmol/L NaCl, 6 mmol/L KCl) 5 times, ultrasonically disrupted, and centrifuged at 12,000 rpm for 40 min. The supernatant was filtered with a 0.22 μm filter membrane. A 1 mL strep Trap HP column was equilibrated with the binding buffer solution 10 times the column volume. Non-specifically adsorbed proteins were washed out with the binding buffer solution 15 times the column volume. The protein was eluted with 20 mM Na.sub.2HPO.sub.4, 280 mM NaCl, 6 mM KCl, and 2.5 mM dethiobiotin buffer 8 times the column volume. The samples were collected and analyzed and identified by SDS-PAGE.

Example 2

[0047] 10 μL of the 0.5 mg/mL mutant enzyme purified in Example 1 was added to a 500 pi buffer reaction system, and the reaction system was treated in a metal bath at 70° C. for 0 min, 10 min, 20 min, and 30 min respectively. The residual enzyme activity was determined, wherein the enzyme activity after treatment for 0 min is defined as 100%.

[0048] As shown in FIG. 1, it was found that when the mutant was treated at 70° C. for 10 min, the enzyme activity of the mutant enzyme Cal. t NHase-H150S decreased sharply, while the other mutant enzymes did not change much compared with the wild type. Therefore, the properties of the Cal. t NHase-H150S mutant enzyme were not studied in the follow-up study.

Example 3

[0049] Solutions of the product nicotinamide with different concentrations of 0 M and 2 M were prepared. Broths of the wild enzyme and the mutant with an OD.sub.600 of 8 were treated in the substrate solutions with different concentrations at 30° C. for 30 min, and then the cells were resuspended in KPB and washed twice. 10 μL of samples were taken to determine the residual enzyme activity. The enzyme activity treated with the nicotinamide solution of 0 M was defined as 100%.

[0050] As shown in FIG. 2, the enzyme activity without treatment with a product was defined as 100%. It was found that after the mutant was treated with the product nicotinamide of 2 M for 20 min, the residual enzyme activity of the mutant enzyme Cal. t Nhase-A20V increased from 40% of the wild enzyme to 69%, while the residual enzyme activity of the rest mutant enzymes Cal. t NHase-H150S, Cal. t NHase-T104A, Cal. t NHase-S152K, and Cal. t NHase-K185A, compared with the wild enzyme, showed varying degrees of decline. The tolerance of the mutant enzyme Cal. t Nhase-A20V to a product was significantly improved, so the Cal. t Nhase-A20V mutant enzyme was selected for follow-up study.

Example 4

[0051] Solutions of substrate with different concentrations of 0 M and 1 M were prepared: The broths of the wild enzyme and mutants with an OD.sub.600 of 8 were treated in solutions of substrate with different concentrations at 30° C. for 30 min. Then the cells were resuspended in KPB and washed twice. 10 μL of samples were taken to determine the residual enzyme activity. The enzyme activity treated with the solution of 0 M is defined as 100%.

[0052] As shown in FIG. 3 and FIG. 4, the enzyme activity after treatment with the substrate of 0 M was defined as 100%, and it was found that after the mutant was treated with the substrate 3-cyanopyridine of 1 M at 30° C. for 30 min, the residual enzyme activity of the mutant was increased from 52% of the wild enzyme to 72%, and the tolerance of the mutant to a substrate was significantly improved.

Example 5

[0053] The BL21/pET24a-Cal. t NHase-A20V broth obtained in step (2) of Example 1 was centrifuged and collected, washed with water, and centrifuged and collected again. The temperature was adjusted to 25-28° C. 3-cyanopyridine was added to the broth with an OD.sub.600 of 8 at a final concentration of 0.4 mol/L, and stirred continuously. When the present batch of substrate reacted completely, the next batch of substrate was added. The content of each component in the reaction solution was detected by HPLC, and the concentration of nicotinamide was calculated as 598 g/L, as shown in FIG. 5.

[0054] While various aspects and embodiments have been disclosed herein, other aspects and embodiments will be apparent to those skilled in the art. The various aspects and embodiments disclosed herein are for purposes of illustration and are not intended to be limiting, with the true scope and spirit being indicated by the following claims.