METHOD FOR INHIBITING CORONAVIRUS INFECTION AND REPLICATION

20210386726 · 2021-12-16

    Inventors

    Cpc classification

    International classification

    Abstract

    Disclosed herein is a method for inhibiting coronavirus infection, including administering to a subject in need thereof an effective amount of rosiglitazone or a pharmaceutically acceptable salt thereof. Also disclosed is a method for inhibiting coronavirus replication, including contacting a coronavirus with rosiglitazone or a pharmaceutically acceptable salt thereof.

    Claims

    1. A method for inhibiting coronavirus infection, comprising administering to a subject in need thereof an effective amount of rosiglitazone or a pharmaceutically acceptable salt thereof.

    2. The method as claimed in claim 1, wherein the coronavirus infection is caused by a coronavirus selected from the group consisting of a member of Alphacoronavirus genus, a member of Betacorovirus genus, a member of Gammacoronavirus genus, a member of Deltacoronavirus genus, and combinations thereof.

    3. The method as claimed in claim 2, wherein the coronavirus is selected from the group consisting of bat coronavirus CDPHE 15, bat coronavirus HKU10, Rhinolopus ferrumequinum alphacoronavirus HuB-2013, human coronavirus 229E (HCoV-229E), Lucheng Rn rat coronavirus, mink coronavirus 1, Miniopterus bat coronavirus 1, Miniopterus bat coronavirus HKU8, Myotis ricketti alphacoronavirus Sax-2011, Nyctalus velutinus alphacoronavirus SC-2013, Pipistrellus kuhlii coronavirus 3398, porcine epidemic diarrhea virus, Scotophilus bat coronavirus 512, Rhinolophus bat coronavirus HKU2, human coronavirus NL63, NL63-related bat coronavirus strain BtKYNL63-9b, Sorex araneus coronavirus T14, Suncus murinus coronavirus X74, alphacoronavirus 1, bovine coronavirus, human coronavirus OC43 (HCoV-OC43), China Rattus corona virus HKU24, human coronavirus HKU1, murine coronavirus, Myodes coronavirus 2JL14, bat Hp-betacoronavirus Zhejiang 2013, Hedgehog coronavirus 1, Middle East respiratory syndrome-related coronavirus, Pipistrellus bat coronavirus HKU5, Tylonycteris bat coronavirus HKU4, Eidolon bat coronavirus 0704, Rousettus bat coronavirus GCCDC1, Rousettus bat coronavirus HKU9, severe acute respiratory syndrome coronavirus (SARS-CoV), severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), bat SARS-like coronavirus WIV1, and combinations thereof.

    4. The method as claimed in claim 3, wherein the coronavirus is HCoV-229E.

    5. The method as claimed in claim 3, wherein the coronavirus is HCoV-OC43.

    6. The method as claimed in claim 3, wherein the coronavirus is SARS-CoV-2.

    7. The method as claimed in claim 1, wherein the rosiglitazone or the pharmaceutically acceptable salt thereof is in a dosage form for oral administration.

    8. A method for inhibiting coronavirus replication, comprising contacting a coronavirus with rosiglitazone or a pharmaceutically acceptable salt thereof.

    9. The method as claimed in claim 8, wherein the coronavirus is selected from the group consisting of a member of Alphacoronavirus genus, a member of Betacorovirus genus, a member of Gammacoronavirus genus, a member of Deltacoronavirus genus, and combinations thereof.

    10. The method as claimed in claim 9, wherein the coronavirus is selected from the group consisting of bat coronavirus CDPHE 15, bat coronavirus HKU10, Rhinolorus ferrumequinum alphacoronavirus HuB-2013, human coronavirus 229E (HCoV-229E), Lucheng Rn rat coronavirus, mink coronavirus 1, Miniopterus bat coronavirus 1, Miniopterus bat coronavirus HKU8, Myotis ricketti alphacoronavirus Sax-2011, Nyctalus velutinus alphacoronavirus SC-2013, Pipistrellus kuhlii coronavirus 3398, porcine epidemic diarrhea virus, Scotophilus bat coronavirus 512, Rhinolophus bat coronavirus HKU2, human coronavirus NL63, NL63-related bat coronavirus strain BtKYNL63-9b, Sorex araneus coronavirus T14, Suncus murinus coronavirus X74, alphacoronavirus 1, bovine coronavirus, human coronavirus OC43 (HCoV-OC43), China Rattus coronavirus HKU24, human coronavirus HKU1, murine coronavirus, Myodes coronavirus 2JL14, bat Hp-betacoronavirus Zhejiang 2013, Hedgehog coronavirus 1, Middle East respiratory syndrome-related coronavirus, Pipistrellus bat coronavirus HKU5, Tylonycteris bat coronavirus HKU4, Eidolon bat coronavirus 3704, Rousettus bat coronavirus GCCDC1, Rousettus bat coronavirus HKU9, severe acute respiratory syndrome coronavirus (SARS-CoV), severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), bat SARS-like coronavirus WIV1, and combinations thereof.

    11. The method as claimed in claim 10, wherein the coronavirus is HCoV-229E.

    12. The method as claimed in claim 10, wherein the coronavirus is HCoV-OC43.

    13. The method as claimed in claim 10, wherein the coronavirus is SARS-CoV-2.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0012] Other features and advantages of the present disclosure will become apparent in the following detailed description of the embodiments with reference to the accompanying drawings, of which:

    [0013] FIG. 1 shows cell viability of mock-infected and HCoV-229E-infected LLC-MK2 cells pretreated with different concentrations of rosiglitazone at 7 days post-infection (d.p.i.), in which she symbols “*”, “***” and “****” respectively represent p<0.05, p<0.005 and p<0.001;

    [0014] FIG. 2 shows virus titers of HCoV-229E in a control group and infected LLC-MK2 cells pretreated with 20 μM rosiglitazone (upper panel) and virus titers of HCoV-OC43 in a control group and infected Vero E6 cells pretreated with 20 μM rosiglitazone (lower panel) at 1, 2, and 3 d.p.i., in which the symbols “*” and “**” respectively represent p<0.05 and p<0.01;

    [0015] FIG. 3 shows RNA copy numbers of E gene (upper panel) and RdRp gene (lower panel) of SARS-CoV-2 in a control group and infected LLC-MK2 cells pretreated with 20 μM rosiglitazone at 1, 2, 3, and 4 in which the symbol “****” represents p<001;

    [0016] FIG. 4 shows fluorescence microscopy images of expression of spike (S) and nucleocapside (NP) proteins of SARS-CoV-2 in a control group, mock-infected LLC-MK2 cells and virus-infected LLC-MK2 cells pretreated with rosiglitazone at 4 d.p.i., in which the nucleus of LLC-MK2 cells was stained with DAPI and the scale bar of each images is 50 μm; and

    [0017] FIG. 5 shows distribution and size of viral plaques of SARS-CoV-2 in a control group and infected Vero E6 cells treated with rosiglitazone at 3 d.p.i.

    DETAILED DESCRIPTION

    [0018] It is to be understood that, if any prior art publication is referred to herein, such reference does not constitute an admission that the publication forms a part of the common general knowledge in the art, in Taiwan or any other country.

    [0019] For the purpose of this specification, it will be clearly understood that the word “comprising” means “including but not limited to”, and that the word “comprises” has a corresponding meaning.

    [0020] Unless otherwise defined, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this disclosure belongs. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of this disclosure. Indeed, this disclosure is in no way limited to the methods and materials described.

    [0021] In the development of drugs that can be used to treat coronavirus infection, the applicants unexpectedly found that rosiglitazone can significantly reduce the viral titer and inhibit viral replication of coronavirus in infected host cells, and hence is expected to be effective against coronavirus infection.

    [0022] Therefore, the present disclosure is directed to use of rosiglitazone or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for inhibiting coronavirus infection and/or coronavirus replication.

    [0023] The present disclosure also provides a method for inhibiting coronavirus infection, including administering to a subject in need thereof an effective amount of rosiglitazone or the pharmaceutically acceptable salt thereof.

    [0024] The present disclosure also provides a method for inhibiting coronavirus replication, including contacting a coronavirus with rosiglitazone or the pharmaceutically acceptable salt thereof.

    [0025] As used herein, the term “administration” or “administering” means introducing, providing or delivering a pre-determined active ingredient to a subject by any suitable routes to perform its intended function.

    [0026] As used herein, the term “subject” refers to any animal of interest, such as humans, monkeys, cows, sheep, horses, pigs, goats, dogs, cats, mice, and rats. In certain embodiments, the subject is a human.

    [0027] As used herein, the term “pharmaceutically acceptable salt” refers to any salt, which, upon administration to the subject is capable of providing (directly or indirectly) a compound as described herein (i.e., rosiglitazone) without undue toxicity, irritation, allergic response and the like. In particular, “pharmaceutically acceptable salt” may encompass those approved by a regulatory agency of the federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The preparation of salts can be carried out by methods known in the art.

    [0028] For instance, the pharmaceutically acceptable salts of rosiglitazone may be acid addition salts, base addition salts or metallic salts, and they can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts are, for example, prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent or in a mixture thereof. Examples of the acid addition salts may include mineral acid addition salts such as, for example, hydrochloride, hydrobromide, hydroiodide, sulfate, nitrate, and phosphate; and organic acid addition salts such as, for example, acetate, maleate, fumarate, citrate, oxalate, succinate, tartrate, malate, mandelate, methanesulphonate, p-toluenesulphonate, 2-naphtalenesulphonate, and 1,2-ethanedisulphonate. Examples of the alkali addition salts may include inorganic salts such as, for example, ammonium; and organic alkali salts such as, for example, ethylenediamine, ethanolamine, N,N-dialkylenethanolamine, triethanolamine, choline, glucamine, and basic aminoacids salts. Examples of the metallic salts may include, for example, sodium, potassium, calcium, magnesium, aluminium, and lithium salts.

    [0029] According to this disclosure, the coronavirus infection is caused by a coronavirus selected from the group consisting of a member of Alphacoronavirus genus, a member of Betacorovirus genus, a member of Gammacoronavirus genus, a member of Deltacoronavirus genus, and combinations thereof.

    [0030] Examples of the member of Alphacoronavirus genus may include, but are not limited to, Colavirus, Decacovirus, Duvinacovirus, Luchacovirus, Minacovirus, Minunacovirus, Myotacovirus, Nyctacovirus, Pedacovirus, Rhinacovirus, Setracovirus, Soracovirus, Sunacovirus, Tegacovirus, and combinations thereof.

    [0031] For example, the member of Alphacoronavirus genus may be bat coronavirus CDPHE 15, bat coronavirus HKU10, Rhinolopus ferrumequinum alphacoronavirus HuB-2013, human coronavirus 229E (HCoV-229E), Lucheng Rn rat coronavirus, mink coronavirus 1, Miniopterus bat coronavirus Miniopterus bat coronavirus HKU8, Myotis ricketti alphacoronavirus Sax-2011, Nyctalus velutinus alphacoronavirus SC-2013, Pipistrellus kuhlii coronavirus 3398, porcine epidemic diarrhea virus, Scotophilus bat coronavirus 512, Rhinolophus bat coronavirus HKU2, human coronavirus NL63, NL63-related bat coronavirus strain BtKYNL63-9b, Sorex araneus coronavirus T14, Suncus murinus coronavirus X74, or alphacoronavirus 1.

    [0032] Examples of the member of Betacoronavirus genus may include, but are not limited to, Embecovirus, Hihecovirus, Merbecovirus, Nobecovirus, Sarbecovirus, and combinations thereof. For example, the member of Betacoronavirus genus may be bovine coronavirus, human coronavirus OC43 (HCoV-OC43), China Rattus coronavirus HKU24, human coronavirus HKU1, murine coronavirus, Myodes coronavirus 2JL14, bat Hp-betacoronavirus Zhejiang 2013, Hedgehog coronavirus 1, Middle East respiratory syndrome-related coronavirus, Pipistrellus bat coronavirus HKU5, Tylonycteris bat coronavirus HKU4, Eidolon bat coronavirus C704, Rousettus bat coronavirus GCCDC1, Rousettus bat coronavirus HKU9, severe acute respiratory syndrome coronavirus (SARS-CoV), severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), or bat SARS-like coronavirus WIV1.

    [0033] Examples of the member of Gammacoronavirus genus may include, but are not limited to, Brangacovirus, Cegacovirus, Igacovirus, and combinations thereof. For example, the member of Gammacoronavirus genus may be goose coronavirus CB17, Beluga whale coronavirus SW1, avian coronavirus, avian coronavirus 9203, or duck coronavirus 2714.

    [0034] Examples of the member of Deltacoronavirus genus may include, but are not limited to, Andecovirus, Buldecovirus, Herdecovirus, and combinations thereof. For example, the member of Deltacoronavirus genus may be Wigeon coronavirus HKU20, Bulbul coronavirus HKU11, Common moorhen coronavirus HKU21, Coronavirus HKU15, Munia coronavirus 1=13, White-eye coronavirus HKU16, or Night heron coronavirus HKU19.

    [0035] In an exemplary embodiment, the coronavirus is HCoV-229E. In another exemplary embodiment, the coronavirus is HCoV-OC43. In yet another exemplary embodiment, the coronavirus is SARS-CoV-2.

    [0036] According to this disclosure, rosiglitazone or the pharmaceutically acceptable salt thereof may be prepared into a pharmaceutical composition in a dosage form suitable for, e.g., oral administration, using technology well known to those skilled in the art. Examples of the dosage form for oral administration may include, but are not limited to, sterile powder, tablets, troches, lozenges, capsules, dispersible powder, granule, solutions, suspensions, emulsions, syrup, elixirs, slurry, and the like.

    [0037] According to this disclosure, the pharmaceutical composition may further include a pharmaceutically acceptable carrier that is widely employed in the art of drug-manufacturing. Examples of the pharmaceutically acceptable carrier may include, but are not limited to, solvents, buffers, emulsifiers, suspending agents, decomposers, disintegrating agents, dispersing agents, binding agents, excipients, stabilizing agents, chelating agents, diluents, gelling agents, preservatives, wetting agents, lubricants, absorption delaying agents, liposomes, and the like. The choice and amount of the pharmaceutically acceptable carrier are within the expertise of those skilled in the art.

    [0038] The dosage and the frequency of administration of rosiglitazone or the pharmaceutically acceptable salt thereof may vary depending on the following factors: the severity of the illness/viral infection to be treated and the weight, age, physical condition and response of the subject to be treated.

    [0039] The present disclosure will be further described by way of the following examples. However, it should be understood that the following examples are intended solely for the purpose of illustration and should not be construed as limiting the present disclosure in practice.

    EXAMPLES

    General Experimental Materials:

    [0040] 1. Rosiglitazone was purchased from Sigma Aldrich.
    2. Primers used in the following examples were synthesized by Taqkey Science Co., Ltd., Taiwan.

    3. Cell Cultures

    [0041] Rhesus monkey kidney epithelial (LLC-MK2) cells (ATCC CCL-7) and African green monkey kidney (Vero-E6) cells (ATCC CRL-15.86) used in the following experiments were purchased from ATCC (American Type Culture Collection, Manassas, Va., USA). Human hepatocellular carcinoma (Huh-7) cells (Ser. No. 01/042,712) was purchased from Sigma Aldrich. The cells of the respective type were incubated in a cell culture dish, where LLC-MK2 cells and Vero-E6 cells were incubated in minimum essential medium (MEM; Gibco, Grand Island, N.Y.) and Huh-7 cells were incubated in Dulbecco's Modified Eagle's Medium (DMEM; Gibco), each supplemented with 10% fetal bovine serum (PBS; Gibco), followed by cultivation in an incubator with culture conditions set at 37° C. or 33° C. and 5% CO.sub.2. Medium change was performed every 3 days. Cell passage was performed when the cultured cells reached 90% of confluence.

    4. Virus Strains

    [0042] Human coronavirus 229E (HCoV-229E) (ATCC VR-740) and human coronavirus OC43 (HCoV-OC43) (ATCC VR-1558) used in the following experiments were purchased from ATCC. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was isolated from nasopharyngeal swab of a patient diagnosed with coronavirus disease 2019 (COVID-19) who was followed and treated at Chang-Gung Memorial Hospital, Linkou, Taiwan (CGMH-CGU-01).

    General Experimental Procedures:

    1. Virus Infection

    [0043] When the cultured cells reached 80% to 90% of confluence, infection by viruses, such as HCoV-229E, HCoV-OC43 or SARS-CoV-2, at a given multiplicity of infection (m.o.i.), was performed in serum-free MEM. The viruses were allowed to adsorb at 37° C. (HCoV-229E and SARS-CoV-2) or 33° C. (HCoV-OC43) for 1 hour, after which the infected cells were washed with phosphate-buffered saline (PBS) and incubated at 37° C. or 33° C. in MEM containing 2% PBS.

    2. Statistical Analysis

    [0044] The experimental data are expressed as mean±standard error of the mean (SEM), and were analyzed by Student's two-tailed unpaired t-test using GraphPad Prism 6 software (GraphPad Software, Inc., California, USA), where p-values <0.05 were considered to be statistically significant.

    Example 1. Evaluation of the Effect of Rosiglitazone on Cell Viability of HCoV-229E-Infected Cells

    Experimental Procedures:

    [0045] LLC-MK2 cells were seeded in a 96-well plate at 2000 cells per well. After 24 hours, the cells were pretreated with rosiglitazone, at concentrations of 0, 5, 10, 20, and 40 μM, respectively, for 1 hour. Subsequently, the pretreated cells were infected with HCoV-229E at m.o.i. of 0.01 for 7 days according to the procedures as described in the preceding section, entitled “1. Virus infection,” of the General Experimental Procedures. Mock-infected cells served as a control group. HCoV-229E-infected cells and mock-infected cells were subjected to cell viability determination using CeliTiter96 Aqueous One Solution Cell Proliferation Assay (Promega).

    Results:

    [0046] FIG. 1 illustrates cell viability of HCoV-229E-infected and mock-infected LLC-MK2 cells that were pretreated with increasing concentrations of rosiglitazone. As shown in FIG. 1, rosiglitazone is capable of increasing cell viability of HCoV-229E-infected LLC-MK2 cells as compared to the control group, indicating that infection of coronavirus, such as HCoV-229E, can be inhibited by rosiglitazone.

    Example 2. Evaluation of the Effect of Rosiglitazone on Viral Yield in HCoV-229E-Infected and HCoV-OC43-Infected Cells

    Experimental Procedures:

    [0047] LLC-MK2 cells and Vero E6 cells were pretreated with 20 μM of rosiglitazone for 1 hour, and then were infected with HCoV-229E and HCoV-OC43 at m.o.i. of 0.01 according to the procedures as described in the preceding section, entitled “1. Virus infection,” of the General Experimental Procedures.

    [0048] The HCoV-229E in the infected LLC-MK2 cells and the HCoV-OC43 in the infected Vero E6 cells were harvested at 1, 2, and 3 days post-infection (d.p.i.) for determination of virus titers.

    [0049] Each of HCoV-229E and HCoV-OC43 was subjected to a ten-fold dilution using serum-free DMEM or MEM, so as to obtain a diluted viral solution having a dilution factor of 10 for use in the following viral plaque assay.

    [0050] Huh-7 cells and Vero E6 cells were seeded at 8×10.sup.5 and 5×10.sup.5 cells per well into respective wells of 6-well plates containing 10% PBS DMEM or MEM, and were cultured in an incubator (37° C. and 5% CO.sub.2) for 24 hours. Thereafter, the Huh-7 cells and Vero E6 cells were infected with the diluted solutions (500 μL) of HCoV-229E and HCoV-OC43, respectively, according to the procedures as described in the preceding section, entitled “1. Virus infection,” of the General Experimental Procedures. After that, the HCoV-229E-infected Huh-7 cells and the HCoV-OC43-infected Vero E6 cells were washed with PBS, and then 3 mL of an agarose overlay medium (0.3% agarose in DMEM or MEM containing 2% PBS) was added to each well. After the agarose overlay medium had solidified, the plates were placed in an incubator set at 37° C. for the HCoV-229E-infected Huh-7 cells or at 33° C. for the HCoV-OC43-infected Vero E6 cells.

    [0051] The cells in each well were fixed with 2 mL of a 10% formaldehyde solution at room temperature for 2 hours. Next, the agarose overlay in each well was removed, and then the fixed cells in each well were stained with 0.5% crystal violet (Manufacturer: Sigma Aldrich) for 2 min. After rinsing the stained cells with water, the viral plaques in each well were counted. The viral titer (plaque forming units (P.F.U.)/mL) was determined by the following formula (1).


    A=B/(0.5)  (1)

    wherein: A=viral titer [0052] B=the viral plaques counted [0053] C=the dilution factor of the virus

    [0054] In comparison, Huh-7 cells and Vero E6 cells pretreated with 0.08% dimethyl sulfoxide (DMSO) (serving as control groups) were subjected to the same analysis.

    Results:

    [0055] FIG. 2 shows virus titers (expressed as log P.F.U./mL) of the HCoV-229E and HCoV-OC43 respectively in the infected Huh-7 cells pretreated with rosiglitazone (upper panel) and the infected Vero E6 cells pretreated with rosiglitazone (lower panel) at 1, 2, and 3 d.p.i. As shown in FIG. 2, as compared to the control groups, viral yields of the HCoV-229E and HCoV-OC43 in the infected cells pretreated with rosiglitazone are significantly lower, indicating that rosiglitazone is effective in reducing viral replication in host cells infected with coronavirus.

    Example 3. Evaluation of the Effects of Rosiglitazone on Viral Gene Expression and Viral Yields in SARS-CoV-2-Infected Cells

    A. Quantitative Determination of Viral Gene Expression

    [0056] LLC-MK2 cells were pretreated with 20 μM of rosiglitazone for 1 hour, and then were infected with SARS-CoV-2 at m.o.i. of 0.01 according to the procedures as described in the preceding section, entitled “1. Virus infection,” of the General Experimental Procedures.

    [0057] At 1, 2, 3 and 4 d.p.i., viral RNA was extracted using LabTurbo Viral Mini Kit with LabTurbo 48 Compact System (Taigen Bioscience Corporation), and was used as a template for synthesizing cDNA by reverse transcription polymerase chain reaction (RT-PCR) using MMLV Reverse Transcription kit (Protech Technology). Thereafter, the thus obtained cDNA, serving as a DNA template, was subjected to quantitative PCR (qPCR), which was performed on a LightCycler®480 System (Roche Life Science) using the PCR reaction mixture and the reaction conditions shown in Table 1, so as to determine the RNA copy number of viral target genes, including Envelope (E) and RNA-dependent RNA polymerase (RdRp) genes of SARS-CoV-2. The SARS-CoV-2-E gene-specific primers and probe and the SARS-CoV-2-RdRp gene-specific primers and probe listed in Table 2 were designed following recommendations by the Taiwan Center for Disease Control (CDC).

    [0058] In comparison, LLC-MK2 cells pretreated with DMSO (serving as control group) were subjected to the same analysis.

    TABLE-US-00001 TABLE 1 Volume Contents (μL) cDNA 1 E gene-specific Forward primer (10 μM) 0.5 primers and probe Reverse primer (10 μM) 0.5 5′FAM probe (10 μM) 0.5 RdRp gene-spedfic Forward primer (10 μM) 0.5 primers and probe Reverse primer (10 μM) 0.5 5′FAM probe (5 μM) 0.5 2 × qPCRBIO Probe Blue Mix Lo-ROX 5 (PCR Biosystems) DEPC-treated d.sub.2H.sub.2O 2.5 Operation conditions: Denaturation at 95° C. for 5 min, followed by 50 cycles of the following reactions: denaturation at 95° C. for 5 sec, and primer annealing and extension at 72° C. for 10 sec.

    TABLE-US-00002 TABLE 2 Nucleotide sequence SEQ ID Viral gene Primer/Probe (5′ .fwdarw. 3′) NO. E gene Forward primer acaggtacgttaatagttaatagcgt 1 Reverse primer atattgcagcagtacgcacaca 2 5′ FAN probe FAM-acactagccatccttactgcgctt 3 cg-BBQ RdRp gene Forward primer gtgaratggtcatgtgtggcgg 4 Reverse primer caratgttaaasacactattagcata 5 5′ FAN probe FAM-caggtggaacctcatcaggagatg 6 c-BBQ Note: FAM and BBQ respectively represent fluorescein and BlackBerry ® Quencher.

    Results:

    [0059] FIG. 3 illustrates RNA quantification (expressed as log RNA copy number/mL) of E gene (upper panel) and RdRp gene (lower panel) of SARS-CoV-2 in the infected LLC-MK2 cells pretreated with rosiglitazone. As shown in FIG. 3, as compared to the control group, rosiglitazone leads to significant reduction in RNA expression of each of E and RdRp genes of SARS-CoV-2 in the infected LLC-MK2 cells, indicating that rosiglitazone can reduce the viral gene expression and thereby inhibit the viral replication in the host cells.

    B. Immunofluorescence Microscopy:

    [0060] LLC-MK2 cells were pretreated with 20 μM of rosiglitazone for 1 hour, and then were infected with SARS-CoV-2 at m.o.i. of 0.01 according to the procedures as described in the preceding section, entitled “1. Virus infection,” of the General Experimental Procedures. In comparison, SARS-CoV-2-infected LLC-MK2 cells pretreated with 0.08% DMSO served as an infection control group, and mock-infected LLC-MK2 cells pretreated with rosiglitazone served as a normal control group.

    [0061] At 4 d.p.i., the cells were washed with PBS and fixed with 4% formaldehyde for 1.0 minutes at room temperature. Then, the cells were permeabilized and subjected to immunostaining for detection of SARS-CoV-2 spike (S2 subunit) and nucleocapsid proteins using the primary and secondary antibodies shown in Table 3 below, and the nucleus of the cells was stained with DAPI (Manufacturer: Invitrogen; Catalog no.: D1306). Thereafter, the stained cells were examined using a fluorescence microscope (Manufacturer: Olympus Corporation; Model No.: IX71).

    TABLE-US-00003 TABLE 3 Proteins Primary antibody Secondary antibody SARS-CoV-2 Mouse anti-SARS-CoV-2 Alexa Fluor 488 spike spike monoclonal goat anti-mouse IgG antibody (Cat. No. A-11901, (Cat. No. GTX632604, Invitrogen, GeneTex, Irvine, CA) Waltham, MA) SARS-CoV-2 Rabbit anti-SARS-CoV-2 Alexa Fluor 594 nucleocapsid nucleocapsid goat anti-rabbit IgG polyclonal antibody (Cat. No. A-11012, (Cat. No. GTX135361, Invitrogen, GeneTex, Irvine, CA) Waltham, MA)

    Results:

    [0062] FIG. 4 shows fluorescence microscopy images of expression of the spike and nucleocapside proteins of SARS-CoV-2 in the LLC-MK2 cells pretreated with rosiglitazone. It can be seen from FIG. 4 that, as compared to the mock-infected LLC-MK2 cells, the spike and nucleocapside proteins are clearly expressed in the infection control group, indicating that SARS-CoV-2 viruses have been replicated in the infected cells. However, such viral replication is significantly reduced in the cells pretreated with rosiglitazone, suggesting that rosiglitazone exerts an inhibitory affect against SARS-CoV-2 infection.

    C. Viral Plaque Reduction Assay:

    [0063] Vero E6 cells were seeded at 5×10.sup.5 cells per well into 6-well plates containing 10% FBS MEM, and were cultured in an incubator (37° C. and 5% CO.sub.2) for 24 hours. Next, the Vero E6 cells were pretreated with 20 μM of rosiglitazone for 1 hour, and then were infected with SARS-CoV-2 at 100 P.F.U., according to the procedures as described in the preceding section, entitled “1. Virus infection,” of the General Experimental Procedures. After that, the SARS-CoV-2-infected Vero E6 cells were washed with PBS, and then 3 mL of an agarose overlay medium (0.3% agarose in MEM containing 2% FBS) containing 20 μM of rosiglitazone was added to each well. After the rosiglitazone-containing agarose overlay medium had solidified, the plates were placed in a 37° C. incubator. Subsequently, the SARS-CoV-2 viruses in the infected Vero E6 cells were harvested at 3 d.p.i. for determination of virus titers. The cells in each well were fixed with 2 mL of a 10% formaldehyde solution at room temperature for 2 hours. Next, the agarose overlay in each well was removed, and then the fixed cells in each well were stained with 0.5% crystal violet (Manufacturer: Sigma Aldrich) for 2 min. After rinsing the stained cells with water, distribution of the viral plaques in each well was analyzed by visual observation. In comparison, SARS-CoV-2-infected Vero E6 cells cultured in a rosiglitazone-free agarose overlay medium (0.3% agarose in MEM containing 2% FBS), which served as a control group, were subjected to the same analysis.

    Results:

    [0064] FIG. 5 shows the viral plaques of the SARS-CoV-2 in the Vero E6 cells treated with rosiglitazone. As shown in FIG. 5, the size and number of the viral plaques of the SARS-CoV-2 were reduced in the rosiglitazone-treated Vero E6 cells as compared to the control group.

    [0065] Taken together, the above results demonstrate that rosiglitazone can effectively inhibit replication of coronavirus, such as SARS-CoV-2.

    [0066] In the description above, for the purposes of explanation, numerous specific details have been set forth in order to provide a thorough understanding of the embodiments. It will be apparent, however, to one skilled in the art, that one or more other embodiments may be practiced without some of these specific details. It should also be appreciated that reference throughout this specification to “one embodiment,” “an embodiment,” an embodiment with an indication of an ordinal number and so forth means that a particular feature, structure, or characteristic may be included in the practice of the disclosure. It should be further appreciated that in the description, various features are sometimes grouped together in a single embodiment, figure, or description thereof for the purpose of streamlining the disclosure and aiding in the understanding of various inventive aspects, and that one or more features or specific details from one embodiment may be practiced together with one or more features or specific details from another embodiment, where appropriate, in the practice of the disclosure.

    [0067] While the disclosure has been described in connection with what are considered the exemplary embodiments, it is understood that this disclosure is not limited to the disclosed embodiments but is intended to cover various arrangements included within the spirit and scope of the broadest interpretation so as to encompass all such modifications and equivalent arrangements.