Combination of viral superinfection therapy with subthreshold doses of nivolumab plus ipilimumab in chronic HBV patients

Abstract

The present invention relates to the combination of attenuated non-pathogenic avian double-stranded (ds) RNA viral vector (IBDV) with an anti-PD-1 antibody and/or an anti-CTLA-4 antibody for treating Hepatitis B virus (HBV) infection.

Claims

1. A combination of attenuated non-pathogenic avian double-stranded (ds) RNA viral vector (IBDV) with an anti-PD-1 antibody and/or an anti-CTLA-4 antibody for use in the treatment of Hepatitis B virus (HBV) infection.

2. The combination according to claim 1, wherein the viral vector is R903/78.

3. A method for the treatment of HBV infection comprising the administration of a combination defined in claim 1, wherein the administration includes 0.5 mg/kg or lower dose of anti-PD-1 antibody with co-administration of 0.3 mg/kg or lower dose of anti-CTLA-4 antibody.

4. The combination for use or method according to claim 1, wherein the anti-PD-1 antibody and the anti-CTLA-4 antibody are administered simultaneously or sequentially.

5. The combination for use or method according to claim 1, wherein the anti-PD-1 antibody and the anti-CTLA-4 antibody are administered at different times.

6. The combination for use or method according to claim 1, wherein the anti-PD-1 antibody is nivolumab or pembrolizumab and the anti-CTLA-4 antibody is ipilimumab.

7. A method for the treatment of Hepatitis B virus (HBV) infection, said method comprising administering to a subject in need thereof a combination attenuated non-pathogenic avian double-stranded (ds) RNA viral vector (IBDV) with an anti-PD-1 antibody and/or an anti-CTLA-4 antibody.

8. The method of claim 7, wherein the viral vector is R903/78.

9. The method of claim 7, said method comprising administering a dose of 0.5 mg/kg or lower of the anti-PD-1 antibody and a dose of 0.3 mg/kg or lower of the anti-CTLA-4 antibody.

10. The method of claim 7, wherein the anti-PD-1 antibody and the anti-CTLA-4 antibody are administered simultaneously or sequentially.

11. The method of claim 7, wherein the anti-PD-1 antibody and the anti-CTLA-4 antibody are administered at different times.

12. The method of claim 7, wherein the anti-PD-1 antibody is nivolumab or pembrolizumab and the anti-CTLA-4 antibody is ipilimumab.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0038] FIGURE. Analysis of expression levels of virus-activated genes following intravenous injection of IBDV (R903/78) drug candidate. X=delta-delta Ct values presented as log 2 values; Y=time after IV injection of IBDV (R903/78) (hrs.)

[0039] At 0 minute the mice were inoculated with the 1 million IBDV particles in PBS intravenously using tail vein. At appropriate time (2 h, 4 h, 8 h, 16 h, 24 h, 72 h, 1 week) the mice were sacrificed by CO2 asphyxiation and the liver was isolated for RNA purification. Total RNAs were isolated as described previously.sup.38. Quantitative realtime PCR (QRT-PCR) analysis was performed as described previously.sup.39. Relative expression ratios were calculated as normalized ratios to mouse GUSB gene. Each sample was tested in triplicate. The final relative gene expression ratios were calculated as delta-delta Ct values and presented as log 2 values. For expression analysis virus-activated gene primers were designed using the online Roche Universal Probe Library (UPL) Assay Design Center.

[0040] The quality of the primers was verified by MS analysis provided by Bioneer (Daejeon, Korea). Table 1 presents the sequence information about the UPL probes and primers.

TABLE-US-00001 TABLE 1 Accession UPL Gene name no. Forward primer Reverse primer probe toll-like receptor 9 (Tlr9) NM_031178 gagaatcctccatctcccaac ccagagtctcagccagcac #79 (SEQ ID NO: 1) (SEQ ID NO: 12) Z-DNA binding protein 1 NM_021394 caggaaggccaagacatagc gacaaataatcgcaggggact #109 (Zbp1) (SEQ ID NO: 3) (SEQ ID NO: 4) interferon activated NM_008329 tgcgttttgtgaagaagtacca ggacctgcttcttgaccatt #2 gene 204 (Ifi204) (SEQ ID NO: 5) (SEQ ID NO: 6) interferon gamma (Ifng) BC119063 atctggaggaactggcaaaa ttcaagacttcaaagagtctgaggta #21 (SEQ ID NO: 7) (SEQ ID NO: 8) toll-like receptor 3 (Tlr3) AF355152 ccaccagcgagagcactt aaagatcgagctgggtgaga #26 (SEQ ID NO: 9) (SEQ ID NO: 10) interferon regulatory BC138799 cttcagcactttcttccgaga tgtagtgtggtgacccttgc #25 factor 7 (Irf7) (SEQ ID NO: 11) (SEQ ID NO: 12)

REFERENCES

[0041] 1. Revill P A, Chisari F V, Block J M, et al. A global scientific strategy to cure hepatitis B. Lancet Gastroenterol Hepatol. 2019; 4(7):545-558. [0042] 2. Gane E. Ongoing clinical trials with novel drugs to cure HBV and HDV infections. 6th ANRS HBV Cure Workshop; 2019; Paris. [0043] 3. Bersoff-Matcha Si, Cao K, Jason M, et al. Hepatitis B Virus Reactivation Associated With Direct-Acting Antiviral Therapy for Chronic Hepatitis C Virus: A Review of Cases Reported to the U.S. Food and Drug Administration Adverse Event Reporting System. Ann Intern Med. 2017; 166(11):792-798. [0044] 4. Papatheodoridis G V, Manolakopoulos S, Dusheiko G, Archimandritis Therapeutic strategies in the management of patients with chronic hepatitis B virus infection. The Lancet Infectious Diseases. 2008; 8(3):167-178. [0045] 5. Janssen HLA, van Zonneveld M, Senturk H, et al. Pegylated interferon alfa-2b alone or in combination with lamivudine for HBeAg-positive chronic hepatitis B: a randomised trial. The Lancet. 2005; 365(9454):123-129. [0046] 6. Lau G K, Piratvisuth T, Luo K X, et al. Peginterferon Alfa-2a, lamivudine, and the combination for HBeAg-positive chronic hepatitis B. N Engl J Med. 2005; 352(26):2682-2695. [0047] 7. Marcellin P, Lau G K, Bonino F, et al. Peginterferon alfa-2a alone, lamivudine alone, and the two in combination in patients with HBeAg-negative chronic hepatitis B. N Engl J Med. 2004; 351(12):1206-1217. [0048] 8. Kaufmann SHE, Dorhoi A, Hotchkiss R S, Bartenschlager R. Host-directed therapies for bacterial and viral infections. Nat Rev Drug Discov. 2018; 17(1):35-56. [0049] 9. Kovesdi I, Bakacs T. Therapeutic exploitation of viral interference. Infectious Disorders—Drug Targets. 2019; 19:1-1. [0050] 10. Bakacs T, Moss R W, Kleef R, Szasz M A, Anderson C C. Exploiting autoimmunity unleashed by low-dose immune checkpoint blockade to treat advanced cancer. Scand J Immunol. 2019:e12821. [0051] 11. Gane E, Verdon D J, Brooks A E, et al. Anti-PD-1 blockade with nivolumab with and without therapeutic vaccination for virally suppressed chronic hepatitis B: A pilot study. J Hepatol. 2019; 71(5):900-907. [0052] 12. Block T M, Alter H, Brown N, et al. Research priorities for the discovery of a cure for chronic hepatitis B: Report of a workshop. Antiviral Res. 2018; 150:93-100. [0053] 13. Bakacs T, Safadi R, Kovesdi I. Post-infection viral superinfection technology could treat HBV and HCV patients with unmet needs. Hepatol Med Policy. 2018; 3:2. [0054] 14. Hornyak A, Lipinski K S, Bakonyi T, et al. Effective multiple oral administration of reverse genetics engineered infectious bursal disease virus in mice in the presence of neutralizing antibodies. J Gene Med. 2015; 17(6-7):116-131. [0055] 15. Csatary L K, Telegdy L, Gergely P, Bodey B, Bakacs T. Preliminary report of a controlled trial of MTH-68/B virus vaccine treatment in acute B and C hepatitis: a phase II study. Anticancer Res. 1998; 18(2B):1279-1282. [0056] 16. Csatary L K, Schnabel R, Bakacs T. Successful treatment of decompensated chronic viral hepatitis by bursal disease virus vaccine. Anticancer Res. 1999; 19(1B):629-633. [0057] 17. de Weerd N A, Nguyen T. The interferons and their receptors-distribution and regulation. Immunol Cell Biol. 2012; 90(5):483-491. [0058] 18. Nomaguchi M, Fujita M, Miyazaki Y, Adachi A. Viral tropism. Front Microbiol. 2012; 3:281. [0059] 19. Gane E J. Future anti-HBV strategies. Liver Int. 2017; 37 Suppl 1:40-44. [0060] 20. Pham E A, Perumpail R B, Fram al, Glenn J S, Ahmed A, Gish R G. Future Therapy for Hepatitis B Virus: Role of Immunomodulators. Curr Hepatol Rep. 2016; 15(4):237-244. [0061] 21. Couzin-Frankel J. Autoimmune diseases surface after cancer treatment. Science. 2017; 358(6365):852. [0062] 22. June C H, Warshauer J T, Bluestone J A. Is autoimmunity the Achilles' heel of cancer immunotherapy? Nat Med. 2017; 23(5):540-547. [0063] 23. Callahan M K, Kluger H, Postow M A, et al. Nivolumab Plus Ipilimumab in Patients With Advanced Melanoma: Updated Survival, Response, and Safety Data in a Phase I Dose-Escalation Study. J Clin Oncol. 2018; 36(4):391-398. [0064] 24. Xu H, Tan P, Ai J, et al. Antitumor Activity and Treatment-Related Toxicity Associated With Nivolumab Plus Ipilimumab in Advanced Malignancies: A Systematic Review and Meta-Analysis. Front Pharmacol. 2019; 10:1300. [0065] 25. Bakacs T, Mehrishi J N, Moss R W. Ipilimumab (Yervoy) and the TGN1412 catastrophe. Immunobiology. 2012; 217(6):583-589. [0066] 26. Bakacs T, Mehrishi J N, Szabados T, Varga L, Szabo M, Tusnady G. T cells survey the stability of the self: a testable hypothesis on the homeostatic role of TCR-MHC interactions. Int Arch Allergy Immunol. 2007; 144(2):171-182. [0067] 27. Szabados T, Bakacs T. Sufficient to recognize self to attack non-self: Blueprint for a one-signal T cell model. Journal of Biological Systems. 2011; 19(2):299-317. [0068] 28. Bakacs T, Mehrishi J N. Anti-CTLA-4 therapy may have mechanisms similar to those occurring in inherited human CTLA4 haploinsufficiency. Immunobiology. 2014; 220:624-625. [0069] 29. Slavin S, Moss R W, Bakacs T. Control of minimal residual cancer by low dose ipilimumab activating autologous anti-tumor immunity. Pharmacol Res. 2014; 79:9-12. [0070] 30. Bakacs T, Moss, R. W., Kleef, R., Szasz, M. A., Andersone, C. C. Exploiting autoimmunity unleashed by low-dose immune checkpoint blockade to treat advanced cancer. ScandJImmunol in press. 2019; X(Y). [0071] 31. Gett A V, Hodgkin P D. A cellular calculus for signal integration by T cells. Nat Immunol. 2000; 1(3):239-244. [0072] 32. Marchingo J M, Kan A, Sutherland R M, et al. T cell signaling. Antigen affinity, costimulation, and cytokine inputs sum linearly to amplify T cell expansion. Science. 2014; 346(6213):1123-1127. [0073] 33. Kleef R, Moss R W, Szasz A M, Bohdjalian A, Bojar H, Bakacs T. From Partial to Nearly Complete Remissions in Stage I V Cancer Administering Off-label Low-Dose Immune Checkpoint Blockade in Combination with High Dose Interleukin-2 and Fever Range Whole Body Hyperthermia. ASCO; 2016; Chicago, USA. [0074] 34. Kleef R, Moss R, Szasz A M, Bohdjalian A, Bojar H, Bakacs T. Complete Clinical Remission of Stage I V Triple-Negative Breast Cancer Lung Metastasis Administering Low-Dose Immune Checkpoint Blockade in Combination With Hyperthermia and Interleukin-2. Integr Cancer Ther. 2018; 17(4):1297-1303. [0075] 35. Sen S, Hess K R, Hong D S, et al. Impact of immune checkpoint inhibitor dose on toxicity, response rate, and survival: A pooled analysis of dose escalation phase 1 trials. J Clin Oncol. 2018; 36(15_suppl):3077-3077. [0076] 36. Renner A, Burotto M, Rojas C. Immune Checkpoint Inhibitor Dosing: Can We Go Lower Without Compromising Clinical Efficacy? J Glob Oncol. 2019; 5:1-5. [0077] 37. Boni C, Barili V, Acerbi G, et al. HBV Immune-Therapy: From Molecular Mechanisms to Clinical Applications. Int J Mol Sci. 2019; 20(11). [0078] 38. Kalman J, Palotas A, Juhasz A, et al. Impact of venlafaxine on gene expression profile in lymphocytes of the elderly with major depression-evolution of antidepressants and the role of the “neuro-immune” system. Neurochem Res. 2005; 30(11):1429-1438. [0079] 39. Nagy L I, Molnar E, Kanizsai I, et al. Lipid droplet binding thalidomide analogs activate endoplasmic reticulum stress and suppress hepatocellular carcinoma in a chemically induced transgenic mouse model. Lipids Health Dis. 2013; 12:175.