SCAEVOLA PLANTS WITH RADIALLY SYMMETRICAL FLOWERS

20210388368 · 2021-12-16

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention provides Scaevola plants that produce at least one flower with a floral phenotype characterised by at least one of: a fused, or partially fused, dorsal slit, a radially, or near radially symmetrical, arrangement of petals, and delayed senescence. The phenotype is a result of reduced or eliminated expression or activity of a CYCLOIDEA2 (CYC2) gene or protein, and or presence of a novel allele designated the FUSED allele. The invention further provides plant cells, plant parts, propagules, seeds and tissue cultures of such plants. The invention further provides methods for the productions and selection of such plants, plant cells, plant parts, propagules, seeds and tissue cultures.

Claims

1. A Scaevola aemula plant that comprises the FUSED allele.

2. The plant of claim 1 that produces at least one flower with a floral phenotype characterised by a radially symmetrical arrangement of petals as a result of the plant containing the FUSED allele.

3. The plant of claim 2 wherein the floral phenotype is further characterised by at least one of: a) a fused dorsal slit, and b) delayed senescence.

4. The plant of claim 2 wherein the allele is present in the heterozygous state, and the plant expresses the floral phenotype in the first few flowers that develop on the plant, and later flowers are of normal (wild-type) appearance.

5. The plant of claim 2 wherein the allele is present in the homozygous state, and the plant expresses the floral phenotype in all, or nearly all, flowers produced.

6. The plant of claim 1 wherein the FUSED allele is characterised by at least one of: a) the presence of an adenine (A) at position corresponding to nucleotide 39 in the sequence of SEQ ID NO: 7, b) the presence of an adenine (A) at position corresponding to nucleotide 39 in the sequence of SEQ ID NO: 8, c) the presence of an adenine (A) at position corresponding to nucleotide 99 in the sequence of SEQ ID NO: 24.

7. The plant of claim 6, wherein the adenine (A) is a substitution of a cytosine (C) at the same position in the corresponding wild-type sequence.

8. The plant of claim 7 wherein: a) SEQ ID NO: 4 is the wild-type sequence corresponding to SEQ ID NO: 7, b) SEQ ID NO: 5 is the wild-type sequence corresponding to SEQ ID NO: 8, and c) SEQ ID NO: 23 is the wild-type sequence corresponding to SEQ ID NO: 24.

9. The plant of claim 1, wherein the plant, or the FUSED allele, comprises the sequence of any one of: a) SEQ ID NO: 7, b) SEQ ID NO: 8, and c) SEQ ID NO: 24.

10. The plant of claim 1 produced, or derived, from a seed deposited under Accession Number: NCIMB 43619.

11. A plant cell, plant part, propagule, seed, cutting, cell culture, tissue culture, or callus of, or capable of producing, the plant of claim 1.

12. The plant cell, plant part, propagule, seed, cutting, cell culture, tissue culture, or callus of claim 11, wherein at least one of the flowing applies: a) the plant cell, plant part, propagule, seed, cutting, cell culture, tissue culture, or callus contains the FUSED allele, b) the plant cell, plant part, propagule, seed, cutting, cell culture, or callus is produced from a seed deposited under Accession Number: NCIMB 43619, and c) the seed is as deposited under Accession Number: NCIMB 43619.

13. A method of producing a Scaevola plant that produces at least one flower with a floral phenotype characterised by a radially symmetrical arrangement of petals, wherein the method includes at least one of: a) genetically manipulating a plant to produce the FUSED allele in the plant, b) gene-editing a plant to produce the FUSED allele in the plant c) inducing a mutation that produces the FUSED allele in the plant, d) crossing a plant of claim 1, or a plant containing the FUSED allele, with another plant, e) selfing a plant of claim 1 or a plant containing the FUSED allele, f) introducing the FUSED allele into the plant, and g) vegetatively propagating a plant of claim 1, or a plant containing the FUSED allele.

14. The method of claim 13 that includes the step of testing the plant produced for the presence of the FUSED allele.

15. A plant produced by the method of claim 14.

16. A method of producing seed, the method comprising growing a plant of claim 1 and harvesting the seed produced by the plant grown.

17. A method for identifying a Scaevola plant with a genotype indicative of producing at least one flower with a floral phenotype characterised by a radially symmetrical arrangement of petals, the method comprising testing a plant for at least one of: a) presence of the FUSED allele, and b) presence of a marker linked to the FUSED allele, wherein any one of a) to b) indicates that the plant will produce at least one flower with the floral phenotype.

18. A marker linked to a Scaevola floral phenotype characterised by a radially symmetrical arrangement of petals.

19. The marker of claim 18 wherein at least one of the following applies: a) the marker can be used to detect the FUSED allele, and b) the marker can be used to distinguish between plants containing the FUSED allele and those that do not, and text missing or illegible when filed

20. The marker of claim 18 comprising at least one of: i) a fragment of the sequence of SEQ ID NO:7 or 8 that comprises the adenine (A) at a position equivalent to nucleotide position 39 in SEQ ID NO:7 or 8, ii) the complement of the fragment in i), iii) a fragment of the sequence of SEQ ID NO: 24 that comprises the adenine (A) at a position equivalent to nucleotide position 99 in SEQ ID NO:24, and iv) the complement of the fragment in iii).

Description

BRIEF DESCRIPTION OF THE FIGURES

[0487] The following figures, which are incorporated herein and form part of the specification, illustrate some, but not the only or exclusive example embodiments and/or features and are to be considered illustrative and not limiting in scope.

[0488] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the office upon request and payment of the necessary fee.

[0489] FIG. 1 shows the normal ‘wild-type’ fan flower morphology of Scaevola aemula (bottom) and the new ‘radially symmetrical’ flower morphology of the present invention (top), with dorsal, lateral and ventral petals labelled.

[0490] FIG. 2 shows the fused dorsal slit characteristic of the present invention (left) compared to a normal flower (right) showing the dorsal slit extending from the edge of the corolla to the ovary.

[0491] FIG. 3 shows a mature plant example of the present invention homozygous for the FUSED allele (left) and a normal wild-type Scaevola aemula plant (right) possessing no FUSED alleles.

[0492] FIG. 4 shows range of flower colours and sizes of the present invention exhibiting radial floral symmetry, flower colours include blue, white, yellow, pink, pink and yellow combined and violet and yellow combined.

[0493] FIG. 5 shows self-pollinated progeny from accession 11361, demonstrating the radially symmetrical flower trait is homozygous, with 100% of progeny exhibiting radial symmetry.

[0494] FIG. 6 shows flowering progeny developed from inter-crossing ten radially symmetrical flowering lines from Example 5, 100% possessing the radially symmetrical flower trait.

[0495] FIG. 7 shows the CYC2 cDNA sequences for accessions 7482, 7952 and 11361, showing single base TAA (Stop) codon mutation for radially symmetrical flowered 11361 and mutant allele of initially radially symmetrical then normal flowered 7952 (red box).

[0496] FIG. 8 shows a diagrammatic explanation of the mutation causing the radially symmetrical flower form in accession 11361.

[0497] FIG. 9 shows the CYC2 expression pattern in the petals of accessions 7482, 7952, and 11361.

[0498] FIG. 10 shows Southern blot to determine the copy number of CYC2 in Scaevola aemula accessions used in the genetic investigations.

[0499] FIG. 11 shows a diagrammatic representation of CAPS marker system for identification of the mutant allele.

[0500] FIG. 12 shows CAPS marker result for accessions 7482 (normal), 7952 (heterozygous for FUSED allele) and 11361 (homozygous for FUSED allele).

[0501] FIG. 13 shows electrophoresis gel images of CAPS marker analysis relating to Table 3.

[0502] FIG. 14 shows an CLUSTAL O (1.2.4) multiple sequence alignment of CYC2 proteins from Scaevola aemula (SamCYC2—SEQ ID NO:1), Scaevola taccada (StaCYC2—SEQ ID NO:2), and Scaevola sericea (SseCYC2—SEQ ID NO:3). The position of Scaevola CYC2 motifs corresponding to motifs 1, 2 and 4 as described in Chen et al. 2018, is highlighted with grey shading. Motifs 1, 2 and 4 are present in all of the CYC2-like form Asterales, described by the authors of Chen et al., 2018.

[0503] FIG. 15 shows the % identity between the CYC2 proteins form Scaevola aemula (SamCYC2—SEQ ID NO:1), Scaevola taccada (StaCYC2—SEQ ID NO:2), and Scaevola sericea (SseCYC2—SEQ ID NO:3) aligned in FIG. 14.

[0504] FIG. 16 shows an alignment of the sequences of the coding sequence of wild-type Scaevola aemula, CYCLOIDEA2—“7482” (SEQ ID NO:23), the coding sequence of Scaevola aemula CYCLOIDEA2—FUSED ALLELE—“11361” (SEQ ID NO:24), the coding sequence of wild-type Scaevola taccada CYCLOIDEA2 “Scaevola taccada” (SEQ ID NO:25) and the coding sequence of the wild-type Goodenia pilosa, Cycloidea-like gene “Goodenia_pilosa” (SEQ ID NO:26). The adenine (A) at nucleotide position 99 in “11361” (SEQ ID NO:24), which is characteristic of the FUSED allele, is highlighted with a white box. In the other three wild-type sequences, there is a cytosine (C) at the equivalent position.

EXAMPLES

[0505] In addition to the exemplary aspects and embodiments described above, further aspects and embodiments will become apparent by study of the following non-limiting examples.

[0506] The following examples are provided to further illustrate the present invention. These examples are not to be construed as limiting the scope of the invention in any manner beyond the limitations set forth in the appended claims. Many variations and modifications may be made while remaining within the spirit and the scope of the invention.

Example 1. Development of the Original Mutant Radially Symmetrical Flowered Plant

[0507] A commercially based Scaevola aemula breeding program was commenced in 1997 to produce novel varieties for the international ornamental horticulture market. From 1997 to 2013 approximately 27,486 seedlings were developed from various crosses and open pollinations originating from up to 67 wild-collected and commercially available cultivars. Seedlings were carefully screened for commercially viable traits. Radially symmetric flowers were never observed. As a result of crossing during 2013 that included gamma irradiated accessions, a first altered floral phenotype plant (accession 7952) was observed in a population of proprietary plants during 2014. However, this plant only possessed radially symmetric flowers for the first few flowers developed during the production period. Flowers that developed later exhibited the normal floral phenotype of Scaevola aemula. Further selection and crossing resulted in one completely stable radially symmetrical flowering plant selected in 2016. This plant was designated accession 11361. This accession uniformly and stably expressed the new radially symmetrical floral phenotype through repeated generations of asexual propagation and growth under a wide range of environmental conditions during all seasons of the year in Yellow Rock, NSW Australia and Higashiomi, Shiga, Japan.

Example 2. Self-Pollination of the Original Mutant Radially Symmetrical Flower Plant (Accession 11361)

[0508] Scaevola aemula plants are known in the art to be self-incompatible (Luo, 2005; Sweeney, 1999; Howell, 1995). However, it was suspected that the new Scaevola aemula accession 11361 could be self-compatible. Self-pollinations were performed by hand using a small paint brush in an insect screened greenhouse during summer at Yellow Rock, Australia, following published methods.

[0509] When the first original stable radially symmetrical flowered plant (accession 11361) was self-pollinated (100 manual hand self-pollinations using a small paint brush), unexpectedly, 69 seeds were produced. From these seeds 53 plants were developed and grown to flowering. All 53 plants possessed the radially symmetrical flower trait, on every flower of every plant indicating this line was homozygous for the radially symmetrical flower trait (FIG. 5). In addition, this experiment showed the white flower colour of this line is also a homozygous trait. Evidence of inbreeding depression (slow, weak growth and late flowering) was observed in the population. The maximum number of seeds that can be produced in a Scaevola aemula fruit is two, after self-pollinating the accession 11361, 34.5% seed set occurred (Table 1).

TABLE-US-00004 TABLE 1 Seed set following self-pollination and plants grown to flowering for accession 11361 Self- Plants pollinations Seeds grown to Accession Flower phenotype performed collected flowering 11361 Radially symmetrical 100 69 53

Example 3. Intercrossing Seven Radially Symmetrical Flowered Accessions to Assess the Transmission of the Radially Symmetrical Flower Trait

[0510] Using the accession 11361, cross and open pollinations were performed among numerous accessions exhibiting normal flowers. The progeny from these crosses were also intercrossed directly or via open pollination. From this breeding work, seven accessions were selected that stably exhibited the symmetrical flower trait. Cross pollinations were performed by hand randomly between the seven accessions stably exhibiting the radially symmetrical flower trait. These seven lines were genetically diverse, possessing flower colours including: dark blue, pink, deep yellow, yellow, pink with eye, dark pink with eye and dark blue with eye. All seven lines were intercrossed using bulk pollen collected from all seven lines. 1367 pollinations were performed, 262 fruits were collected, 225 seeds were sown, resulting in 71 plants. Of these 71 plants, 54 reached the flowering stage (17 were weak and did not flower). The 54 plants reaching the flowering stage all exhibited the radially symmetrical flower trait. Various flower colours and combinations were revealed in the progeny. This work demonstrated that the radially symmetrical flower trait could be transferred between different genotypes of Scaevola aemula.

Example 4. Inter-Crossing Ten Radially Symmetrical Flowered Accessions to Assess the Transmission of the Radially Symmetrical Flower Trait

[0511] Using ten different accessions to Example 3, cross pollinations were performed by hand randomly between the ten accessions stably exhibiting the radially symmetrical flower trait. These ten lines were genetically diverse, possessing flower colours including: yellow and blue bicolour, yellow and pink bicolour, blue and white centre, white, dark yellow and pink bicolour, blue and light blue. All ten lines were intercrossed using bulk pollen collected from all ten lines. Pollinations were performed, 621 fruits were collected, 692 seeds were sown, resulting in 421 plants reaching the flowering stage. All 421 plants reaching the flowering stage stably exhibited the radially symmetrical flower trait. Various flower colours and combinations were revealed in the progeny (FIG. 6). Examples 2, 3 and 4 demonstrated that the radially symmetrical flower trait was homozygous in plants stably exhibiting the trait.

Example 6. Determining the Genetic Mechanism of the Radially Symmetrical Flower Trait

[0512] Recent floral morphological studies in the Goodeniaceae family (Berger et al. 2017, Gardner et al. 2016 and Han, 2018) suggest that members of the CYCLOIDEA-like genes are responsible for the variation in floral petal arrangement within this family. These genes are transcription factors, regulating the copying of DNA to RNA so that the correct gene expression occurs in the correct location of the plant at the correct time. Han explains that floral symmetry can be influenced by asymmetrical expression and duplication of these transcription factors. In Scaevola aemula, Han 2018 (p59-p62) found three copies of CYC; CYC1, CYC2 and CYC3, and within CYC3 there were two copies CYC3A and CYC3B. These different copies were expressed differentially in leaves, floral buds and lateral and/or ventral petals. Han found that the degree of bilateral symmetry exhibited by flowers in Scaevola aemula was influenced by subtle changes in the expression levels of multiple CYC-like genes (p67). Han remarked (referencing Howarth et al 2011 and Zhang et al 2013) that in radially symmetrical groups (of plants) CYC2 clade members are either not expressed in corolla tissue or are ubiquitously expressed (underscore added). This statement clearly shows the ambiguity surrounding CYC2 genes and the difficulty in predicting in advance the possible impact of extra copies and/or deletions.

[0513] Prior to this invention, it was not known what genetic mechanism (if any) could be responsible for radial floral symmetry in Scaevola aemula. In fact, radially symmetrical Scaevola aemula flowering plant(s) had not been reported in the available literature. As such, it can be appreciated by one of ordinary skill in the art, that at this time there may have been a multitude of possible causes for the radially symmetrical flower trait in Scaevola aemula. A range of ideas were considered, and experiments were conducted.

[0514] Experiments were undertaken to determine if CYCLOIDEA gene(s) were responsible for the novel morphology of the present invention, as it could not be predicted in advance the mechanism controlling the floral symmetry in accession 11361. Three proprietary accessions were selected for analysis (Table 2).

TABLE-US-00005 TABLE 2 Plant materials utilized for CYCLOIDEA genetic investigations Accession Flower type  7482 Normal  7952 Initially radially symmetrical, changing to normal 11361 Radially symmetrical

[0515] Experimental work involved cloning CYCLOIDEA 2 genes. Primers for amplifying Scaevola aemula CYCLOIDEA 2 (CYC2) genes were designed using the Scaevola taccada CYC2 sequence deposited in GenBank (accession number: MG593372.1). These primers (St-cycF1: TCCATGTCTGCCCTCCTTCT [SEQ ID NO: 27], and St-cycR1: TTACACGCATCACCCTGCTG [SEQ ID NO: 28]) produced about a 1 kb amplicon from accessions 7482, 7952 and 11361 cDNA. cDNA was produced with total RNA prepared from flower buds using ReverTra Ace reverse transcriptase (Toyobo). PCRs were carried out using Tks gflex DNA polymerase (Takara Bio) for 35 cycles of 15 seconds at 98° C., 20 seconds at 60° C., and 30 seconds at 68° C. These amplicons were cloned using TArget clone-plus-(Toyobo) and sequenced using a 3500 Genetic Analyzer (Applied Biosystems).

[0516] FIG. 7 shows the base sequence for the three Scaevola aemula accessions 7482, 7952 and 11361. All obtained sequences from 11361 possess a C to A point mutation, producing a stop codon (TAA) and truncated, presumably non-functional protein (FIGS. 7 and 8). Two of six obtained sequences from 7952 have the same C to A mutation, showing 7952 is a heterozygous mutant.

[0517] A further alignment of the sequences of: the coding sequence of wild-type Scaevola aemula, CYCLOIDEA2—“7482” (SEQ ID NO:23), the coding sequence of Scaevola aemula CYCLOIDEA2—FUSED ALLELE—“11361” (SEQ ID NO:24), the coding sequence of wild-type Scaevola taccada CYCLOIDEA2 “Scaevola taccada” (SEQ ID NO:25) and the coding sequence of the wild-type Goodenia pilosa, Cycloidea-like gene “Goodenia_pilosa” (SEQ ID NO:26), is shown in in FIG. 16. The adenine (A) at nucleotide position 99 in “11361” (SEQ ID NO:24), which is characteristic of the FUSED allele, is highlighted with a white box. In the other three wild-type sequences, there is a cytosine (C) at the equivalent position.

[0518] Quantitative RT-PCR was undertaken to determine the expression levels of CYC2 in the petals of Scaevola aemula flowers. Total RNA of dorsal, lateral, and ventral petals of 1 cm, 1.5 cm, and 2 cm flower buds was separately extracted using the RNeasy plant mini kit (Qiagen). cDNA was produced from total RNA using ReverTra Ace reverse transcriptase (Toyobo). Quantitative PCR was carried out using PowerUp SYBR Green Master Mix (Applied Biosystems) and StepOnePlus real-time PCR system (Applied Biosystems). Primers for CYC2 qPCR are CYC2rt-F (GGCAAGAGCAAGAGCTAGGG)—SEQ ID NO: 29 and CYC2rt-R (AGGTTGGGCTTACGTGACAG)—SEQ ID NO: 30. CYC2 expression levels were normalized to actin expression levels. Primers for actin qPCR are actrt-F (GCCTGATGGGCAGGTAATCA)—SEQ ID NO: 31 and actrt-R (TACCAGCAGCTTCCATTCCG)—SEQ ID NO: 32. Results are displayed in FIG. 10. Accessions 7482, 7952, and 11361 showed essentially the same CYC2 expression pattern.

[0519] Southern blot analysis was undertaken to determine the copy number of CYC2 in the Scaevola aemula accessions 7482, 7952 and 11361. Genomic DNA was extracted from leaf tissue using NucleoSpin PlantII Kit (Macherey-Nagel). About 15 μg of genomic DNA was digested with AflII or HincII (New England Biolabs), electrophoresed in a 0.8% agarose gel and transferred to a positively charged nylon membrane (GE Healthcare). A part of CYC2 cDNA sequence excluding regions conserved among all Cycloidea genes was labelled with digoxigenin using DIG-High Prime (Roche). Hybridization and detection were carried out according to the manufacturer's manual.

[0520] Southern blot analysis with AflII showed 1 band on all three varieties. Southern blot analysis with HincII showed 1 band on 11361, but 2 bands on 7482 and 7952. We hypothesized that 7482 had two normal alleles of the same CYC2 gene, one of which had an additional HincII site close to CYC2 gene, 7952 had one mutant allele and one normal alelle which had an additional HincII site, and that 11361 had two mutant alleles. These results suggested Scaevola aemula might have only one copy of CYC2 gene, agreeing with the results of Han 2018.

Example 7. Development of CAPS Marker System to Identify Heterozygous and Homozygous CYC2 Mutants

[0521] DNA extraction was performed using NucleoSpin Plant II (MACHEREY-NAGEL). The following PCR primers and conditions were used to generate a 151 bp fragment, followed by Msel digestion and electrophoresis to distinguish normal, radially symmetrical (homozygous) and initially radially symmetrical, later normal flowering (heterozygous) plants. PCR primers for CAPS marker system are CYC2-2F (CCATGTCTGCCCTCCTTCT)—SEQ ID NO: 33 and CYC2-152R (AACATTCTCCATAACCTGAGGA)—SEQ ID NO: 34. PCRs were carried out using Tks gflex DNA polymerase (Takara Bio) for 30 cycles of 15 seconds at 98° C., 20 seconds at 60° C., and 30 seconds at 68° C.

[0522] FIG. 11 shows the diagrammatic representation of the CAPS marker system and FIG. 12 shows the CAPS marker results for the three accessions 7482, 7952 and 11361.

Example 8. Applying the CAPS Marker System to Commercially Available and Proprietary Accessions

[0523] The CAPS marker system developed was utilized to assess 20 Scaevola aemula varieties and 19 Scaevola aemula accessions. Results are displayed in Table 3 and FIG. 14.

TABLE-US-00006 TABLE 3 List of thirty-nine Scaevola aemula commercially available varieties and proprietary accessions, including United States Plant Patent number, supplier, flower phenotype and results of CAPS marker testing United States Accession Variety Name Plant Patent Supplier Flower phenotype CAP genotype  7056 Surdiva Light Blue PP28,786 Suntory Flowers Normal Normal/Normal  7482 Surdiva White Improved PP26,471 Suntory Flowers Normal Normal/Normal  7768 Surdiva Blue Violet PP28,820 Suntory Flowers Normal Normal/Normal  7769 Surdiva Fashion Pink PP28,821 Suntory Flowers Normal Normal/Normal K0012 New Wonder PP10,584 InnovaPlant Normal Normal/Normal K0014 Whirlwind White PP20,790 Proven Winners Normal Normal/Normal K0015 Bombay Pink PP17,943 Syngenta Normal Normal/Normal K0054 Top Pot White PP19,728 Westhoff Normal Normal/Normal K0241 Top Pot Blue PP19,658 Westhoff Normal Normal/Normal K0242 Scalora Topaz Pink PP19,729 Westhoff Normal Normal/Normal K0325 Scalora Suntastic Yellow PP22,344 Westhoff Normal Normal/Normal K0326 Pink charm Not Patented Danziger Normal Normal/Normal K0327 Blue angel Not Patented Danziger Normal Normal/Normal K0451 Scalora Brilliant PP12,099 Westhoff Normal Normal/Normal K0452 Scalora Diamond PP15,431 Westhoff Normal Normal/Normal K0518 Scalora Glitzy Not Patented Westhoff Normal Normal/Normal K0568 Touch White Not Patented Danziger Normal Normal/Normal K0569 Touch Blue Not Patented Danziger Normal Normal/Normal K0570 Touch Blessing Pink Not Patented Danziger Normal Normal/Normal K0571 Purple Haze Not Patented Danziger Normal Normal/Normal  7952 Proprietary accession Not Patented Bonza Botanicals Initially radially symmetrical, Normal/Mutant then normal 11361 Proprietary accession Not Patented Bonza Botanicals Radially symmetrical Mutant/Mutant 11366 Proprietary accession Not Patented Bonza Botanicals Initially radially symmetrical, Normal/Mutant then normal 11380 Proprietary accession Not Patented Bonza Botanicals Normal Normal/Normal 11383 Proprietary accession Not Patented Bonza Botanicals Normal Normal/Normal 11893 Proprietary accession Not Patented Bonza Botanicals Normal Normal/Normal 12341 Proprietary accession Not Patented Bonza Botanicals Normal Normal/Normal 12619 Proprietary accession Not Patented Bonza Botanicals Radially symmetrical Mutant/Mutant 12620 Proprietary accession Not Patented Bonza Botanicals Radially symmetrical Mutant/Mutant 12806 Proprietary accession Not Patented Bonza Botanicals Radially symmetrical Mutant/Mutant 12807 Proprietary accession Not Patented Bonza Botanicals Radially symmetrical Mutant/Mutant 12808 Proprietary accession Not Patented Bonza Botanicals Radially symmetrical Mutant/Mutant 12811 Proprietary accession Not Patented Bonza Botanicals Radially symmetrical Mutant/Mutant 12815 Proprietary accession Not Patented Bonza Botanicals Radially symmetrical Mutant/Mutant 12816 Proprietary accession Not Patented Bonza Botanicals Radially symmetrical Mutant/Mutant 12817 Proprietary accession Not Patented Bonza Botanicals Radially symmetrical Mutant/Mutant 12821 Proprietary accession Not Patented Bonza Botanicals Radially symmetrical Mutant/Mutant 12822 Proprietary accession Not Patented Bonza Botanicals Initially radially symmetrical, Normal/Mutant then normal 12823 Proprietary accession Not Patented Bonza Botanicals Radially symmetrical Mutant/Mutant

Example 9. Transferring the FUSED Mutant Allele to a Wide Range of Scaevola aemula Genetic Backgrounds Via Cross Pollination

[0524] The homozygous FUSED mutant accession 11361 exhibiting floral radial symmetry was crossed as both a male and female parent, with a plurality of different Scaevola aemula accessions (genotype Normal/Normal=NN, Mutant/Normal=MN or Mutant/Mutant=MM). The resulting F.sub.1 progeny were assessed phenotypically for the presence of the mutant FUSED allele and numerous plants were tested using the CAPS molecular marker system to identify heterozygotes.

TABLE-US-00007 TABLE 4 Transmission of the mutant FUSED allele from accession 11361 homozygous for the radially symmetrical flower trait, to other Scaevola aemula accessions Genotype of Number of Phenotype Plants all plants Cross Female Male plants of all mature tested by tested by Number Female parent genotype Male parent genotype developed plants CAPS CAPS M5-42 11361 M/M Whirlwind White N/N 39 Normal 4 N/M M5-29 Whirlwind White N/N 11361 M/M 3 Normal M5-43 11361 M/M Kangaroo Island N/N 6 Normal 6 N/M M5-30 Kangaroo Island N/N 11361 M/M 14 Normal 2 N/M M5-44 11361 M/M Scarletti N/N 3 Normal M5-31 Scarletti N/N 11361 M/M 3 Normal 1 N/M M5-45 11361 M/M 16-141 N/N 21 Normal 6 N/M M5-32 16-141 N/N 11361 M/M 1 Normal M5-47 11361 M/M 16-200 N/N 1 Normal M5-34 16-200 N/N 11361 M/M 4 Normal M5-48 11361 M/M 16-204 N/N 10 Normal 6 N/M M5-35 16-204 N/N 11361 M/M 25 Normal 4 N/M M5-49 11361 M/M 16-214 N/N 16 Normal 5 N/M M5-36 16-214 N/N 11361 M/M 83 Normal 5 N/M M5-50 11361 M/M 16-221 N/N 11 Normal 6 N/M M5-37 16-221 N/N 11361 M/M 11 Normal 4 N/M M5-51 11361 M/M 16-226 N/N 1 Normal M5-52 11361 M/M 18-151 M/M 10 Mutant M5-39 18-151 M/M 11361 M/M 22 Mutant M5-54 11361 M/M 18-157 N/N 2 Normal M5-33 16-185 M/N 11361 M/M 10 10 Normal 4 Mutant M5-40 18-152 M/M 11361 M/M 1 Mutant

Example 10. Inter-Crossing FUSED Heterozygotes to Determine the Segregation Ratio of the FUSED Trait

[0525] Six accessions were selected based on the ability to produce at least one radially symmetrical flower during the early stages of flowering. This phenotypic characteristic has been shown to correlate with a heterozygous genotype for the mutant FUSED allele. The 6 accessions were randomly intercrossed by hand pollination using bulk pollen collected from all 6 accessions. Seeds were collected and germinated, resulting in 133 plants grown to flowering maturity. The resulting segregation was as expected with 25% radially symmetrical flowering mature plants and 75% normal phenotype plants recorded.

TABLE-US-00008 TABLE 5 Segregation results of radially symmetrical to normal phenotype plants from intercrossing six accessions heterozygous for the FUSED mutant allele Expected phenotype Observed phenotype Female Parent Genotype Male Parent Genotype Normal Fused Normal Fused 16-144 NM x All NM 24.75 8.25 27 6 16-182 NM x All NM 21.75 7.25 21 8 16-184 NM x All NM 24.75 8.25 20 13 16-185 NM x All NM 12 4 13 3 16-203 NM x All NM 3.75 1.25 4 1 17-27 NM x All NM 30 10 30 10 Total 117 39 115 41 Ratio 3 1 2.8 1

[0526] The observed ratio of Normal to FUSED mutant plants was 2.8:1, the expected ratio was predicted to be 3:1. According to this data it can be considered that the FUSED allele is a single recessive gene, in agreement with the molecular data presented previously.

TABLE-US-00009 SUMMARY OF SEQUENCES SEQ ID NO: Sequence type Order/genus/species Name Abbreviation  1 Protein Scaevola aemula CYCLOIDEA2 SamCYC2 wild-type  2 Protein Scaevola taccada CYCLOIDEA2 StaCYC2 wild-type  3 Protein Scaevola sericea CYCLOIDEA2 SseCYC2 wild-type  4 DNA-gene Scaevola aemula CYCLOIDEA2 SamCYC2 wild-type  5 DNA-cDNA Scaevola aemula CYCLOIDEA2 SamCYC2 wild-type  6 DNA-cDNA Scaevola taccada CYCLOIDEA2 SamCYC2 wild-type  7 DNA-gene Scaevola aemula CYCLOIDEA2 SamCYC2 Fused allele  8 DNA-cDNA Scaevola aemula Fused allele SamCYC2  9 Protein Asterales CYCLOIDEA2 Motif 1 from Chen et al 2018 with variable amino acids shown as Xs 10 Protein Scaevola CYCLOIDEA2 CYC2 Motif 1 (corresponding to Motif 1 from Chen et al 2018) with variable amino acids shown as Xs 11 Protein Scaevola CYCLOIDEA2 CYC2 Motif 1 (corresponding to Motif 1 from Chen et al 2018) with options for the variable amino acids shown as Xs 12 Protein Scaevola aemula CYCLOIDEA2 CYC2 Motif 1 (corresponding to Motif 1 from Chen et al 2018) 13 Protein Scaevola taccada CYCLOIDEA2 CYC2 Motif 1 (corresponding to Motif 1 from Chen et al 2018) 14 Protein Scaevola sericea CYCLOIDEA2 CYC2 Motif 1 (corresponding to Motif 1 from Chen et al 2018) 15 Protein Scaevola CYCLOIDEA2 CYC2 Motif 2 (corresponding to Motif 1 from Chen et al 2018) with variable amino acids shown as Xs 16 Protein Scaevola CYCLOIDEA2 CYC2 Motif 2 (corresponding to Motif 1 from Chen et al 2018) with options for the variable amino acids shown as Xs 17 Protein Scaevola aemula CYCLOIDEA2 CYC2 Motif 2 (corresponding to Motif 1 from Chen et al 2018) 18 Protein Scaevola taccada CYCLOIDEA2 CYC2 Motif 2 (corresponding to Motif 1 from Chen et al 2018) 19 Protein Scaevola sericea CYCLOIDEA2 CYC2 Motif 2 (corresponding to Motif 1 from Chen et al 2018) 20 Protein Scaevola CYCLOIDEA2 CYC2 Motif 4 (corresponding to Motif 1 from Chen et al 2018) 21 Protein Scaevola taccada CYCLOIDEA2 CYC2 Motif 4 (corresponding to Motif 1 from Chen et al 2018) 22 Protein Scaevola sericea CYCLOIDEA2 CYC2 Motif 4 (corresponding to Motif 1 from Chen et al 2018) 23 DNA Scaevola aemula CYCLOIDEA2 Coding sequence- wild-type-7482 24 DNA Scaevola aemula CYCLOIDEA2 Coding sequence- FUSED ALLELE- 11361 25 DNA Scaevola taccada CYCLOIDEA2 Coding sequence 26 DNA Goodenia pilosa Cycloidea-like Coding sequence from GenBank: MG593373.1 27 DNA Artificial Primer St-cycF1 28 DNA Artificial Primer St-cycR1 29 DNA Artificial Primer CYC2rt-F 30 DNA Artificial Primer CYC2rt-R 31 DNA Artificial Primer actrt-F 32 DNA Artificial Primer actrt-R 33 DNA Artificial Primer CYC2-2F 34 DNA Artificial Primer CYC2-152R