Efficient Protein Expression System for Expressing Bt Insecticidal Protein
20210380645 · 2021-12-09
Assignee
Inventors
Cpc classification
C07K14/325
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C12N9/86
CHEMISTRY; METALLURGY
International classification
C12N15/70
CHEMISTRY; METALLURGY
Abstract
An efficient protein expression system for expressing a Bt insecticidal protein. Said protein expression system uses Bla (beta-lactamase) as a fusion tag, so that Bt genes unable to be expressed as soluble proteins are expressed as soluble proteins.
Claims
1-5. (canceled)
6. A fusion protein comprising a Bt protein and a beta-lactamase as a fusion tag.
7. The fusion protein according to claim 6, wherein the Bt protein is a Bt protein unable to be expressed.
8. A nucleic acid molecule encoding the fusion protein according to claim 6.
9. A vector comprising the nucleic acid molecule according to claim 8.
10. The vector according to claim 9, wherein the vector is a pSol-Bla vector into which a Bt gene to be expressed is inserted, or a modified pSol-Bla vector as shown in
11. A cell comprising the vector according to claim 9.
12. The cell according to claim 11, wherein the cell is an Escherichia coli cell.
13. The cell according to claim 12, wherein the Escherichia coli cell is an Escherichia coli 10G or BL21 (DE3) cell.
14. A method for expressing a Bt protein, comprising: (1) culturing the cell according to claim 11 under conditions suitable for expressing the desired protein; and (2) optionally, cleaving the Bla tag to obtain a Bt protein without the tag.
15. A modified pSol-Bla vector as shown in
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0017]
DETAILED DESCRIPTION OF EMBODIMENTS
[0018] The embodiments of the present invention will be described in detail below in combination with examples, but a person skilled in the art would understand that the following examples serve only to illustrate the present invention and are not intended to limit the scope of the present invention. If the specific conditions are not indicated in the examples, the conventional conditions or the conditions suggested by the manufacturer shall be followed. Any reagents or instruments used, unless the manufacture stated, are conventional products that can be obtained by market purchase.
Example 1. Screening of Fusion Tags for 16 Bt Genes Unable to be Expressed as Soluble Proteins to Achieve Soluble Expression
[0019] We selected 16 Bt genes unable to be expressed as soluble proteins through conventional methods (for example, the expression of pET series vectors at different temperatures and IPTG induced concentrations, the use of fusion tags such as SUMO and GST, the use of different types of competent cells, cell-free culture, expression with Bt cells, etc.). Their numbers, molecular weights, and expression issues are shown in Table 2 below:
TABLE-US-00002 TABLE 2 Protein Molecular Expression number Gene family SEQ ID NO weight issue BT-0025 Cry1If 1 80 KD Insoluble BT-0027 2 79 KD No expression BT-0275 Cry22Aa 3 96 KD No expression BT-0362 4 73 KD No expression BT-0425 Cry36Aa 5 56 KD No expression BT-0435 Cry42Aa 6 75 KD No expression BT-0445 Vip1Aa 7 138 KD Insoluble BT-0452 Cry19Ca 8 59 KD No expression BT-0560 Cry20Aa 9 26 KD No expression BT-0587 Cry49Ab 10 60 KD No expression BT-0669 Cry2Ae 11 30 KD Insoluble BT-0685 Cry49Ab 12 51 KD Insoluble BT-0827 Cry48Ab2 13 86 KD No expression BT-0830 Cry48Ab2 14 87 KD No expression BT-0831 Cry54Ba1 15 80 KD No expression HO4 Cry1Ab.1Ca 16 130 KD Insoluble
[0020] Using Expresso® Solubility and Expression Screening System from Lucigen, according to the instructions thereof, the primer sequences at both ends were designed to synthesize PCR primers of these 16 genes, respectively. The target fragments of 16 genes with homologous recombination ends were obtained by PCR amplification methods. Then, after mixing the PCR products with 8 linear vectors in the kit, the chemically competent cells were transformed with plasmids. After the positive clones were identified from the obtained monoclonal plasmids by PCR, the positive clones were sent to a company for sequencing and identification. After analyzing the sequencing results, we obtained the plasmids of these 16 genes on 8 vectors, a total of 128 plasmids.
[0021] 30 μl of Escherichia coli 10G or BL21 (DE3) glycerol bacteria with these 16 genes were cultured in 3 ml of LB medium at 37° C. to an OD600 of approximately 0.5, and then 20% rhamnose was added to induce culture overnight at 18° C. The bacteria were collected and subjected to disruption by sonication, and whole bacteria and supernatant were collected respectively and boiled for 10 minutes before the expression was analyzed by SDS-PAGE. The expression of these 128 plasmids in Escherichia coli 10G and BL21 (DE3) cells was shown in Table 3 below (the first 6 genes in Table 3 were purified after successful expression and the Bla tag was cleaved to obtain a pure soluble target protein).
TABLE-US-00003 TABLE 3 Issue when expressing through conventional Valid tag Protein methods 10 G BL21 (DE3) BT-0025 (80 KD) Insoluble 6 tags (Bla, GST, 6 tags (Bla, GST, His, MBP, SUMO, Tsf) His, MBP, SUMO, Tsf) BT-0827 (86 KD) No 4 tags (AFV Not tested expression Bla, GST, Tsf) BT-0830 (87 KD) No 5 tags (Bla, GST, Not tested expression MBP, Tsf, SlyD) BT-0831 (80 KD) No 6 tags (AFV, Bla, Not tested expression GST, MBP, SlyD, Tsf) HO4 (130 KD) Insoluble 4 tags (AFV, Not tested Bla, MBP, Tsf) BT-0027 (79 KD) No 3 tags (Bla, Not tested expression MBP, SlyD) BT-0685 (51 KD) Insoluble All 8 tags 5 tags (AFV, Bla, GST, MBP, His) BT-0669 (30 KD) Insoluble 7 tags (All, 7 tags (All except for GST) except for GST) BT-0587 (60 KD) No 6 tags (AFV, Bla, All 8 tags expression GST, His, MBP, SUMO) BT-0560 (26 KD) No 3 tags (Bla, MBT, Tsf) 4 tags (AFV, expression GST, MBP, SUMO) BT-0362 (73 KD) No 4 tags (Bla, MBP, Not tested expression SlyD, Tsf) BT-0425 (56 KD) No 5 tags (AFV, Bla, Not tested expression MBP, SUMO, Tsf) BT-0452 (59 KD) No 5 tags (AFV, Bla, Not tested expression GST, MBP, SlyD) BT-0435 (75 KD) No 2 tags (AFV, Bla) Not tested expression BT-0445 (138 KD) Insoluble 4 tags (AFV, 4 tags (AFV, Bla, Bla, MBP, Tsf) MBP, Tsf) BT-0275 (96 KD) No 2 tags (AFV, Bla) Not tested expression
[0022] The results showed that most of the 8 vectors with different tags in the kit could express individual genes in these 16 Bt genes, and only the pSol-Bla vector was effective for all 16 genes (that is, the genes could be expressed as soluble proteins), implying that the Bla tag specifically improved the effect of the Bt gene expression.
Example 2. Modification of pSol-Bla Vector from Lucigen and Use of the Modified pSol-Bla Vector on 237 Bt Genes Unable to be Expressed as Soluble Proteins
[0023] For the convenience of cloning, we made a few modifications to the pSol-Bla vector from Lucigen, wherein the stop codon TAA at positions 1326-1328 in the original vector was removed, and the sequence “ggatccggctcaggctcaggctcaggctcaggctcaggctcactcgag” was added at position 1326 of the original vector, the sequence comprising one BamHI enzyme digestion site and one XhoI enzyme digestion site. The modified pSol-Bla vector was as shown in
[0024] The results showed that 193 out of the 237 Bt genes unable to be expressed as soluble proteins obtained soluble fusion proteins in this way, and the success rate was up to 81.4%. This result showed that the vector fused with Bla could specifically increase the success rate of the successful expression of the Bt gene.
[0025] The information regarding the 237 Bt genes unable to be expressed as soluble proteins is as follows:
TABLE-US-00004 TABLE 4 Molecular Protein weight Whether expressed number Gene family SEQ ID NO (KD) in this experiment BT-0269 Cry41Ab 17 93 Yes BT-0290 Cry19Ca 18 136 No BT-0397 Cry59Aa 19 77 Yes BT-0398 Cry4Ca 20 75 Yes BT-0411 Vip2Ad 21 22.5 Yes BT-0426 Cry59Aa 22 73 Yes BT-0434 Cry21Ba 23 120 Yes BT-0439 Cry36Aa 24 57 Yes BT-0441 Cry68Aa 25 82 Yes BT-0455 Cry41Ba 26 94 Yes BT-0456 Cry22Ab 27 79 Yes BT-0464 Cry44Aa 28 59 Yes BT-0474 Cry41Ba 29 92 Yes BT-0481 Cry24Ca 30 45 Yes BT-0482 Cry4Cc 31 49 Yes BT-0483 Cry4Ca 32 131 Yes BT-0526 Cry2Aa 33 39 Yes BT-0532 Vip2Af 34 50 Yes BT-0552 Cry15Aa 35 34 Yes BT-0555 Cry52Aa 36 77 Yes BT-0557 Cry53Ab 37 74 No BT-0567 Cry70Bb 38 106 Yes BT-0579 Cry40Da 39 74 Yes BT-0581 Cry40Da 40 72 Yes BT-0585 Cry36Aa 41 52 Yes BT-0586 Cry49Aa 42 56 Yes BT-0591 Cry4Cc 43 78 No BT-0596 Cry4Ca 44 61 Yes BT-0597 Cry69Aa 45 135 No BT-0599 Cry54Aa 46 72 Yes BT-0600 Cry56Aa 47 70 Yes BT-0603 Cry53Ab 48 76 Yes BT-0609 Cry4-like 49 26 Yes BT-0610 Cry68Aa 50 89 Yes BT-0612 Cry15Aa 51 40 No BT-0613 Cry51Aa 52 37 Yes BT-0624 Cry22Ab 53 64 Yes BT-0626 Cry49Aa 54 23 Yes BT-0663 Cry68Aa 55 82 Yes BT-0666 Cry68Aa 56 90 Yes BT-0667 Cry68Aa 57 91 Yes BT-0671 Cry14Ab 58 90 Yes BT-0681 Cry42Aa 59 88 Yes BT-0683 Cry19Ca 60 76 Yes BT-0713 Cry41Aa1 61 56 Yes BT-0735 Cry4Cb1 62 79 Yes BT-0744 Cry60Aa 63 35 Yes BT-0760 Cry64Aa1 64 37 No BT-0762 Cry64Aa1 65 36 No BT-0764 Cry15Aa1 66 34 Yes BT-0766 Cry54Aa2 67 78 Yes BT-0767 Cry20Ba1 68 83 Yes BT-0768 Cry51Aa1 69 35 No BT-0770 Cry51Aa1 70 40 Yes BT-0772 Cry70Bb1 71 110 No BT-0776 Cry32Mb1 72 138 No BT-0777 Cry32Ra1 73 126 Yes BT-0778 Cry32Cb1 74 96 Yes BT-0781 cry69Aa1 75 81 Yes BT-0783 Cry40Da1 76 74 Yes BT-0784 Cry4Ca1 77 65 No BT-0785 Cry55Aa1 78 35 Yes BT-0787 Cry55Aa1 79 35 No BT-0788 Cry60Aa1 80 36 Yes BT-0795 Cry41Aa1 81 66 Yes BT-0878 Cry4Ca1 66 Yes BT-0879 Cry40Da1 74 Yes BT-0895 Cry49Ab1 43 Yes BT-0903 Vip2Ba2 44 Yes BT-0905 Vip2Ac1 58 Yes BT-0911 Cry14Aa1 82 91 Yes BT-0912 Cry32Ta1 83 147 Yes BT-0914 Cry73Aa1 84 89 Yes BT-0915 Cry32Sa1 85 139 Yes BT-0916 Cry41Ba2 86 86 Yes BT-0920 Cry21Ca1 87 146 Yes BT-0922 Cry4Aa4 88 137 Yes BT-0927 Cry8Ga3 89 37 Yes BT-0934 Cyt2Ca1 90 25 Yes BT-0936 Cry49Ab1 91 31 Yes BT-0938 Cry49Ab1 92 42 Yes BT-0939 Cry13Aa1 93 68 Yes BT-0941 Cry32Ra1 94 155 No BT-0942 Cry60Aa3 95 36 Yes BT-0943 Cry8La1 96 115 Yes BT-0944 Cry30Db1 97 78 Yes BT-0946 Cry51Aa2 98 32 Yes BT-0948 Cry32Da1 99 138 Yes BT-0949 Cry8Ca1 100 132 Yes BT-0950 Cry60Ba3 101 36 Yes BT-0951 Cry32Ra1 102 147 Yes BT-0952 Cry73Aa1 103 59 Yes BT-0953 Cry73Aa1 104 57 Yes BT-0954 Cry45Aa 105 31 Yes BT-0955 Cry32Qa1 106 150 Yes BT-0956 Cry20Aa1 107 81 Yes BT-0957 Cry54Aa2 108 77 Yes BT-0958 Cry60Aa3 109 36 Yes BT-0961 Cry41Ba2 110 63 No BT-0962 Cry19Ca1 111 86 Yes BT-0964 Cry28Aa2 112 125 Yes BT-0965 Cry60Ba3 113 35 Yes BT-0968 Cry43Ca1 114 145 Yes BT-0970 Cry4Ca1 115 139 Yes BT-0976 Cry8Ib1 116 137 No BT-0977 Cry22Ba1 117 53 Yes BT-0979 Cry42Aa1 118 57 Yes BT-0980 Cry30Aa1 119 78 Yes BT-0981 Cry4Ca1 120 136 Yes BT-0983 Cry54Aa2 121 80 Yes BT-0984 Cry4Cb2 122 129 Yes BT-0985 Cyt2Ca1 123 29 Yes BT-0987 Cry36Aa1 124 54 Yes BT-0989 Cry4Ca1 125 64 Yes BT-0991 Cry40Da1 126 76 Yes BT-0993 Cry70Bb1 127 113 Yes BT-0997 Cry8Ia1 128 139 No BT-0998 Cry45Aa 129 29 Yes BT-0999 Cry45Aa 130 30 Yes BT-1000 Cry32Ra1 131 151 Yes BT-1002 Cry11Bb1 132 33 Yes BT-1003 Cry56Aa2 133 78 Yes BT-1004 Cry53Ab1 134 76 Yes BT-1006 Cry60Ba3 135 35 Yes BT-1008 Cry60Ba3 136 35 Yes BT-1009 Cry10Aa4 137 82 No BT-1010 Cry9Ga1 138 84 Yes BT-1013 Cry32Ca1 139 145 Yes BT-1015 Cry32Qa1 140 143 No BT-1018 Vip1Ba2 141 88 Yes BT-1019 Cry60Ba3 142 32 Yes BT-1020 Cry2Ah1 143 57 Yes BT-1021 Cry70Bb1 144 109 Yes BT-1022 Cry30Ga2 145 81 No BT-1023 Cry39Aa1 146 78 Yes BT-1026 Cry56Aa2 147 73 Yes BT-1027 Cry72Aa1 148 79 Yes BT-1028 Cry30Fa1 149 79 Yes BT-1029 Cyt2Aa4 29 No BT-1031 Cry40Da1 150 86 Yes BT-1032 Cry4Ca1 151 64 Yes BT-1033 Cry73Aa1 152 64 Yes BT-1034 Vip2Ae2 153 84 Yes BT-1036 Cry32Qa1 154 143 Yes BT-1037 Cry54Ba1 155 34 Yes BT-1042 Cry4Ba5 156 134 Yes BT-1045 Cry67Aa2 157 125 Yes BT-1048 Cry32Cb1 158 144 Yes BT-1050 Vip3Ad1 159 104 Yes BT-1051 Cry73Aa1 160 54 Yes BT-1054 Cry2Aa3 161 36 Yes BT-1055 Cry73Aa1 162 58 Yes BT-1057 Cry15Aa1 163 38 Yes BT-1060 Cry4Ba5 164 140 No BT-1062 Cry8Aa1 165 77 Yes BT-1064 Cry8Ga3 166 129 Yes BT-1065 Cry29Aa1 167 78 Yes BT-1068 Cry51Aa2 168 32 Yes BT-1069 Cry70Bb1 169 93 Yes BT-1070 Cry4Aa4 170 134 No BT-1073 Cry32La1 171 137 No BT-1076 Cry60Aa3 172 40 No BT-1078 Cry22Aa3 173 33 Yes BT-1084 Cry33Aa1 174 30 Yes BT-1085 Cry32La1 175 128 Yes BT-1087 Cry32La1 176 75 Yes BT-1088 Cry73Aa1 177 91 Yes BT-1090 Cyt2Aa4 178 31 Yes BT-1091 Cry32Ra1 179 151 No BT-1092 Cry51Aa1 180 35 Yes BT-1093 Vip1Aa2 181 88 Yes BT-1094 Cry73Aa1 182 94 Yes BT-1095 Cry32Ra1 183 147 Yes BT-1102 Vip3Ca2 184 105 Yes BT-1106 Cry42Aa1 185 55 Yes BT-1110 Cry6Aa3 186 42 No BT-1113 Cry32Ra1 187 150 Yes BT-1114 Cry41Aa1 188 96 Yes BT-1116 Cry15Aa1 189 37 Yes BT-1120 Cry41Ba2 190 109 Yes BT-1121 Cry43Ca1 191 137 Yes BT-1122 Cry64Aa1 192 33 Yes BT-1124 CryL (BT-0174) 193 119 Yes BT-1125 Cry73Aa1 194 55 Yes BT-1126 Cry16Aa1 195 50 Yes BT-1127 Cry29Aa1 196 61 Yes BT-1272 Cry66Aa2 197 159 Yes BT-1274 Vip1Ba1 198 97 Yes BT-1275 Cry55Aa1 199 44 Yes BT-1276 Cry55Aa1 200 40 Yes BT-1277 Cry1Fb4 201 53 Yes BT-1280 Cry1Ia11 202 83 Yes BT-1283 Cry12Aa1 203 96 Yes BT-1284 Cry15Aa1 204 40 Yes BT-1285 Cry60Ba3 205 35 No BT-1287 Cry60Aa1 206 35 No BT-1292 Cry71Aa1 207 71 Yes BT-1296 Cry22Ab2 208 93 Yes BT-1297 Cry22Ba1 209 99 No BT-1300 Cry32Ra1 210 149 No BT-1305 Cry37Aa1 211 16 Yes BT-1306 Cry4Ca1 212 60 Yes BT-1308 Cry59Aa1 213 75 No BT-1312 Cry45Aa 214 31 Yes BT-1314 Cry36Aa1 215 57 Yes BT-1316 Cry49Ab1 216 43 No BT-1317 Cry36Aa1 217 55 Yes BT-1318 Cry49Ab1 218 44 No BT-1319 Cry49Ab1 219 43 Yes BT-1322 Cry49Aa4 220 29 Yes BT-1323 Cry4Aa1 221 80 No BT-1324 Cry4Ba5 222 79 Yes BT-1331 Cyt2Aa3 223 27 Yes BT-1333 Cry73Aa1 224 57 Yes BT-1334 Cry73Aa1 225 57 Yes BT-1336 Cry64Aa1 226 40 Yes BT-1337 Cry45Aa 227 41 Yes BT-1338 Cry45Aa 228 48 Yes BT-1339 Cry60Aa1 229 38 Yes BT-1340 Vip1Bb1 230 108 Yes BT-1342 Vip2Ba1 231 29 No BT-1343 Vip2Ba2 232 29 No BT-1344 Vip2Ac1 233 28 No BT-1345 Vip2Ba2 234 30 Yes BT-1346 Vip2Aa1 235 33 No BT-1347 Vip2Ba1 236 30 Yes BT-1353 Vip2Ba2 237 29 No BT-1354 Vip2Ac1 238 26 No BT-1356 Vip2Aa2 239 25 No BT-1357 Vip2Ba2 240 29 No BT-1358 Vip2Aa2 241 26 No BT-1359 Vip2Aa1 242 28 Yes BT-1360 Vip2Ad1 243 57 No BT-1362 Vip1Bb1 244 118 Yes BT-1366 Cry22Aa3 245 75 Yes BT-1369 Cry3Ca1 246 67 Yes BT-1371 Cry22Aa3 247 122 Yes
REFERENCES
[0026] 1. Tokunaga Hi, et al., (2010) Appl Microbiol Biotechnol. 88, 1223 [0027] 2. Bruce E. Tabashnik, et al., Sci Rep. 2015; 5: 15107