PATIENT SELECTION FOR TREATMENT OF MYC POSITIVE CANCERS WITH INDENOISOQUINOLINES
20210382058 · 2021-12-09
Inventors
- Mark S. Cushman (West Lafayette, IN)
- Danzhou Yang (WEST LAFAYETTE, IN, US)
- Guanhui Wu (WEST LAFAYETTE, IN, US)
- Kaibo Wang (WEST LAFAYETTE, IN, US)
Cpc classification
C07D491/056
CHEMISTRY; METALLURGY
G01N2800/52
PHYSICS
C07D401/06
CHEMISTRY; METALLURGY
International classification
C07D401/06
CHEMISTRY; METALLURGY
C07D491/056
CHEMISTRY; METALLURGY
Abstract
The present disclosure is directed to a method for selecting a patient with cancer for treatment with a compound of formula (I) by determining if the patient's cancer cells are MYC-positive and when the MYC promoter sequence in those cancer cells contains a nucleic acid sequence capable of forming a MYC G-quadruplex (MYC G4) (i.e. are MYC G4-positive) and treating the patient with a compound of formula (I).
Claims
1. A method for selecting a patient for treatment with a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, or solvate thereof, wherein the patient has a MYC-positive cancer comprising the steps of a) obtaining a sample of the patient's cancer; b) determining if the cancer cells in the sample are MYC-positive; and c) selecting the patient for treatment with the compound of formula (I), or a pharmaceutically acceptable salt, hydrate, or solvate thereof, if the patient's cancer cells in the sample are MYC-positive; ##STR00023## wherein A is N, CH, or CR; B is N, CH, or CR; C is N, CH, or CR; D is N, CH, or CR; E is N, CH, or CR, wherein R is a halo, azido, alkoxy, cyano, nitro, hydroxy, amino, thio, or a derivative thereof; or an alkyl, alkenyl, heteroalkyl, heteroalkenyl, heterocyclyl, cycloalkyl, cycloalkenyl, cycloheteroalkyl, cycloheteroalkenyl, aryl, arylalkyl, and arylalkenyl, each of which is optionally substituted; R.sub.1 is an alkyl, alkenyl, heteroalkyl, heteroalkenyl, heterocyclyl, hydroxyalkyl, hydroxyalkylaminoalkyl, and heterocyclylalkyl, cycloalkyl, cycloalkenyl, cycloheteroalkyl, cycloheteroalkenyl, aryl, arylalkyl, and arylalkenyl, each of which is optionally substituted; R.sub.2, R.sub.3, and R.sub.4 represent four substituents each independently selected from the group consisting of hydrogen, halo, azido, alkoxy, cyano, nitro, hydroxy, amino, thio, and derivatives thereof; or any two adjacent substituents that are taken together with the attached carbons to form an optionally substituted heterocycle, and each of other two substituents is defined as above.
2. The method of claim 1, wherein the patient is selected for treatment with the compound of formula (I), or a pharmaceutically acceptable salt, hydrate, or solvate thereof, if the cancer cells in the sample are also MYC G4-positive, further comprising the step of determining if the cancer cells in the sample are MYC G4-positive.
3. The method of claim 1, wherein R.sub.1 is a C.sub.1-C.sub.12 alkyl, alkenyl, heteroalkyl, heteroalkenyl, hydroxyalkyl, hydroxyalkylaminoalkyl, and heterocyclylalkyl, or heterocyclyl, each of which is optionally substituted.
4. The method of claim 3, wherein R.sub.1 is selected from the group consisting of ##STR00024##
5. The method of claim 1, wherein D is N.
6. The method of claim 1, wherein E is N.
7. The method of claim 1, wherein the compound is selected from the group consisting of ##STR00025## ##STR00026## ##STR00027## ##STR00028## ##STR00029## ##STR00030## ##STR00031## ##STR00032## ##STR00033## ##STR00034## or a pharmaceutically acceptable salt, hydrate, or solvate thereof.
8. The method of claim 7, wherein the compound is selected from the group consisting ##STR00035## or a pharmaceutically acceptable salt, hydrate, or solvate thereof.
9. The method of claim 1, wherein the compound is a human topoisomerase I inhibitor.
10. The method of claim 1, wherein the compound is selected from ##STR00036## ##STR00037## ##STR00038## or a pharmaceutically acceptable salt, hydrate, or solvate thereof.
11. The method of claim 1 wherein the compound is a compound of formula (II): ##STR00039## or a pharmaceutically acceptable salt, hydrate, or solvate thereof, wherein m is 3, R.sup.1 is 3-Cl or 3-F, and R.sup.2 is selected from the group consisting of ##STR00040##
12. The method of claim 11 wherein R.sup.1 is 3-F.
13. The method of claim 11 wherein R.sup.1 is 3-Cl.
14. The method of claim 11 wherein R.sup.1 is 3-NO.sub.2.
15. The method of claim 12 wherein R.sup.2 is MeHN—, EtHN—, or i-PrHN—.
16. The method of claim 13 wherein R.sup.2 is MeHN—, EtHN—, or i-PrHN—.
17. The method of claim 14 wherein R.sup.2 is MeHN—, EtHN—, or i-PrHN—.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] The above and other objects, features, and advantages of the present invention will become more apparent when taken in conjunction with the following description and drawings.
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
DETAILED DESCRIPTION
[0038] While the concepts of the present disclosure are illustrated and described in detail herein, the descriptions are to be considered as exemplary and not restrictive in character; it being understood that only the illustrative embodiments are shown and described and that all changes and modifications that come within the spirit of the disclosure are desired to be protected.
[0039] As used herein, the following terms and phrases shall have the meanings set forth below. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art.
[0040] In the present disclosure the term “about” can allow for a degree of variability in a value or range, for example, within 10%, within 5%, or within 1% of a stated value or of a stated limit of a range. In the present disclosure the term “substantially” can allow for a degree of variability in a value or range, for example, within 90%, within 95%, 99%, 99.5%, 99.9%, 99.99%, or at least about 99.999% or more of a stated value or of a stated limit of a range.
[0041] In this document, the terms “a,” “an,” or “the” are used to include one or more than one unless the context clearly dictates otherwise. The term “or” is used to refer to a nonexclusive “or” unless otherwise indicated. In addition, it is to be understood that the phraseology or terminology employed herein, and not otherwise defined, is for the purpose of description only and not of limitation. Any use of section headings is intended to aid reading of the document and is not to be interpreted as limiting. Further, information that is relevant to a section heading may occur within or outside of that particular section. Furthermore, all publications, patents, and patent documents referred to in this document are incorporated by reference herein in their entirety, as though individually incorporated by reference. In the event of inconsistent usages between this document and those documents so incorporated by reference, the usage in the incorporated reference should be considered supplementary to that of this document; for irreconcilable inconsistencies, the usage in this document controls.
[0042] As used herein the terms “indenoisoquinoline” and “(aza)indenoisoquinoline” refers to both indenoisoquinolines and azaindenoisoquinolines.
[0043] The term “substituted” as used herein refers to a functional group in which one or more hydrogen atoms contained therein are replaced by one or more non-hydrogen atoms. The term “functional group” or “substituent” as used herein refers to a group that can be or is substituted onto a molecule. Examples of substituents or functional groups include, but are not limited to, a halogen (e.g., F, Cl, Br, and I); an oxygen atom in groups such as hydroxyl groups, alkoxy groups, aryloxy groups, arylalkyloxy groups, oxo(carbonyl) groups, carboxyl groups including carboxylic acids, carboxylates, carboxamides, and carboxylate esters; acyl groups; a sulfur atom in groups such as thiol groups, alkyl and aryl sulfide groups, sulfoxide groups, sulfone groups, sulfonyl groups, and sulfonamide groups; a nitrogen atom in groups such as amines, azides, hydroxylamines, cyano, nitro groups, N-oxides, hydrazides, and enamines; and other heteroatoms in various other groups.
[0044] The term “alkyl” as used herein refers to substituted or unsubstituted straight chain and branched alkyl groups and cycloalkyl groups having from 1 to about 20 carbon atoms (C.sub.1-C.sub.20), 1 to 12 carbons (C.sub.1-C.sub.12), 1 to 8 carbon atoms (C.sub.1-C.sub.8), or, in some embodiments, from 1 to 6 carbon atoms (C.sub.1-C.sub.6). Examples of straight chain alkyl groups include those with from 1 to 8 carbon atoms such as methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, n-heptyl, and n-octyl groups. Examples of branched alkyl groups include, but are not limited to, isopropyl, iso-butyl, sec-butyl, t-butyl, neopentyl, isopentyl, and 2,2-dimethylpropyl groups. As used herein, the term “alkyl” encompasses n-alkyl, isoalkyl, and anteisoalkyl groups as well as other branched chain forms of alkyl. Representative substituted alkyl groups can be substituted one or more times with any of the groups listed herein, for example, amino, hydroxy, cyano, carboxy, nitro, thio, alkoxy, and halogen groups, as described herein.
[0045] The term “alkenyl” as used herein refers to substituted or unsubstituted straight chain and branched divalent alkenyl and cycloalkenyl groups having from 2 to 20 carbon atoms (C.sub.2-C.sub.20), 2 to 12 carbons (C.sub.2-C.sub.12), 2 to 8 carbon atoms (C.sub.2-C.sub.8) or, in some embodiments, from 2 to 4 carbon atoms (C.sub.2-C.sub.4) and at least one carbon-carbon double bond. Examples of straight chain alkenyl groups include those with from 2 to 8 carbon atoms such as —CH═CH—, —CH═CHCH.sub.2—, and the like. Examples of branched alkenyl groups include, but are not limited to, —CH═C(CH.sub.3)— and the like.
[0046] The term “alkynyl” as used herein refers to a substituted or unsubstituted, straight or branched chain carbon chain having from 2 to 20 carbon atoms (C.sub.2-C.sub.20), 2 to 12 carbons (C.sub.2-C.sub.12), 2 to 8 carbon atoms (C.sub.2-C.sub.8) or, in some embodiments, from 2 to 4 carbon atoms (C.sub.2-C.sub.4) containing at least one carbon-carbon triple bond.
[0047] The term “hydroxyalkyl” as used herein refers to alkyl groups as defined herein substituted with at least one hydroxyl (—OH) group.
[0048] The term “cycloalkyl” as used herein refers to substituted or unsubstituted cyclic alkyl groups such as, but not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl groups. In some embodiments, the cycloalkyl group can have 3 to about 8-12 ring members, whereas in other embodiments the number of ring carbon atoms range from 3 to 4, 5, 6, or 7. In some embodiments, cycloalkyl groups can have 3 to 6 carbon atoms (C.sub.3-C.sub.6). Cycloalkyl groups further include polycyclic cycloalkyl groups such as, but not limited to, norbornyl, adamantyl, bornyl, camphenyl, isocamphenyl, and car-3-enyl 1 groups, and fused rings such as, but not limited to, decalinyl, and the like.
[0049] The term “acyl” as used herein refers to a group containing a carbonyl moiety wherein the group is bonded via the carbonyl carbon atom. The carbonyl carbon atom is also bonded to another carbon atom, which can be part of a substituted or unsubstituted alkyl, aryl, aralkyl cycloalkyl, cycloalkylalkyl, heterocyclyl, heterocyclylalkyl, heteroaryl, heteroarylalkyl group or the like. In the special case wherein the carbonyl carbon atom is bonded to a hydrogen, the group is a “formyl” group, an acyl group as the term is defined herein. An acyl group can include 0 to about 12-40, 6-10, 1-5 or 2-5 additional carbon atoms bonded to the carbonyl group. An acryloyl group is an example of an acyl group. An acyl group can also include heteroatoms within the meaning here. A nicotinoyl group (pyridyl-3-carbonyl) is an example of an acyl group within the meaning herein. Other examples include acetyl, benzoyl, phenylacetyl, pyridylacetyl, cinnamoyl, and acryloyl groups and the like. When the group containing the carbon atom that is bonded to the carbonyl carbon atom contains a halogen, the group is termed a “haloacyl” group. An example is a trifluoroacetyl group.
[0050] The term “aryl” as used herein refers to substituted or unsubstituted cyclic aromatic hydrocarbons that do not contain heteroatoms in the ring. Thus aryl groups include, but are not limited to, phenyl, azulenyl, heptalenyl, biphenyl, indacenyl, fluorenyl, phenanthrenyl, triphenylenyl, pyrenyl, naphthacenyl, chrysenyl, biphenylenyl, anthracenyl, and naphthyl groups. In some embodiments, aryl groups contain about 6 to about 14 carbons (C.sub.6-C.sub.14) or from 6 to 10 carbon atoms (C.sub.6-C.sub.10) in the ring portions of the groups. Aryl groups can be unsubstituted or substituted, as defined herein. Representative substituted aryl groups can be mono-substituted or substituted more than once, such as, but not limited to, 2-, 3-, 4-, 5-, or 6-substituted phenyl or 2-8 substituted naphthyl groups, which can be substituted with carbon or non-carbon groups such as those listed herein.
[0051] The terms “aralkyl” and “arylalkyl” as used herein refer to alkyl groups as defined herein in which a hydrogen or carbon bond of an alkyl group is replaced with a bond to an aryl group as defined herein. Representative aralkyl groups include benzyl and phenylethyl groups and fused (cycloalkylaryl)alkyl groups such as 4-ethyl-indanyl. Arylalkenyl groups are alkenyl groups as defined herein in which a hydrogen or carbon bond of an alkyl group is replaced with a bond to an aryl group as defined herein.
[0052] The term “heterocyclyl” as used herein refers to substituted or unsubstituted aromatic and non-aromatic ring compounds containing 3 or more ring members, of which, one or more is a heteroatom such as, but not limited to, B, N, O, and S. Thus, a heterocyclyl can be a cycloheteroalkyl, or a heteroaryl, or if polycyclic, any combination thereof. In some embodiments, heterocyclyl groups include 3 to about 20 ring members, whereas other such groups have 3 to about 15 ring members. In some embodiments, heterocyclyl groups include heterocyclyl groups that include 3 to 8 carbon atoms (C.sub.3-C.sub.8), 3 to 6 carbon atoms (C.sub.3-C.sub.6) or 6 to 8 carbon atoms (C.sub.6-C.sub.8).
[0053] A heteroaryl ring is an embodiment of a heterocyclyl group. The phrase “heterocyclyl group” includes fused ring species including those that include fused aromatic and non-aromatic groups. Representative heterocyclyl groups include, but are not limited to pyrrolidinyl, azetidinyl, piperidynyl, piperazinyl, morpholinyl, chromanyl, indolinonyl, isoindolinonyl, furanyl, pyrrolidinyl, pyridinyl, pyrazinyl, pyrimidinyl, triazinyl, thiophenyl, tetrahydrofuranyl, pyrrolyl, oxazolyl, oxadiazolyl, imidazolyl, triazyolyl, tetrazolyl, benzoxazolinyl, benzthiazolinyl, and benzimidazolinyl groups.
[0054] The term “heterocyclylalkyl” as used herein refers to alkyl groups as defined herein in which a hydrogen or carbon bond of an alkyl group as defined herein is replaced with a bond to a heterocyclyl group as defined herein. Representative heterocyclylalkyl groups include, but are not limited to, furan-2-yl methyl, furan-3-yl methyl, pyridine-3-yl methyl, tetrahydrofuran-2-yl methyl, and indol-2-yl propyl.
[0055] The term “heteroarylalkyl” as used herein refers to alkyl groups as defined herein in which a hydrogen or carbon bond of an alkyl group is replaced with a bond to a heteroaryl group as defined herein.
[0056] The term “alkoxy” as used herein refers to an oxygen atom connected to an alkyl group, including a cycloalkyl group, as are defined herein. Examples of linear alkoxy groups include but are not limited to methoxy, ethoxy, propoxy, butoxy, pentyloxy, hexyloxy, and the like. Examples of branched alkoxy include but are not limited to isopropoxy, sec-butoxy, tert-butoxy, isopentyloxy, isohexyloxy, and the like. Examples of cyclic alkoxy include but are not limited to cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, cyclohexyloxy, and the like. An alkoxy group can further include double or triple bonds, and can also include heteroatoms. For example, an allyloxy group is an alkoxy group within the meaning herein. A methoxyethoxy group is also an alkoxy group within the meaning herein, as is a methylenedioxy group in a context where two adjacent atoms of a structure are substituted therewith.
[0057] The term “amine” as used herein refers to primary, secondary, and tertiary amines having, e.g., the formula N(group).sub.3 wherein each group can independently be H or non-H, such as alkyl, aryl, and the like. Amines include but are not limited to R—NH.sub.2, for example, alkylamines, arylamines, alkylarylamines; R.sub.2NH wherein each R is independently selected, such as dialkylamines, diarylamines, aralkylamines, heterocyclylamines and the like; and RN wherein each R is independently selected, such as trialkylamines, dialkylarylamines, alkyldiarylamines, triarylamines, and the like. The term “amine” also includes ammonium ions as used herein.
[0058] The term “amino group” as used herein refers to a substituent of the form —NH.sub.2, —NHR, —NR.sub.2, —NR.sub.3.sup.+, wherein each R is independently selected, and protonated forms of each, except for —NR.sub.3.sup.+, which cannot be protonated. Accordingly, any compound substituted with an amino group can be viewed as an amine. An “amino group” within the meaning herein can be a primary, secondary, tertiary, or quaternary amino group. An “alkylamino” group includes a monoalkylamino, dialkylamino, and trialkylamino group.
[0059] The terms “halo,” “halogen,” or “halide” group, as used herein, by themselves or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom.
[0060] The term “haloalkyl” group, as used herein, includes mono-halo alkyl groups, poly-halo alkyl groups wherein all halo atoms can be the same or different, and per-halo alkyl groups, wherein all hydrogen atoms are replaced by halogen atoms, such as fluoro. Examples of haloalkyl include trifluoromethyl, 1,1-dichloroethyl, 1,2-dichloroethyl, 1,3-dibromo-3,3-difluoropropyl, perfluorobutyl, —CF(CH.sub.3).sub.2 and the like.
[0061] The term “optionally substituted,” or “optional substituents,” as used herein, means that the groups in question are either unsubstituted or substituted with one or more of the substituents specified. When the groups in question are substituted with more than one substituent, the substituents may be the same or different. When using the terms “independently,” “independently are,” and “independently selected from” mean that the groups in question may be the same or different. Certain of the herein defined terms may occur more than once in the structure, and upon such occurrence each term shall be defined independently of the other.
[0062] The compounds described herein may contain one or more chiral centers, or may otherwise be capable of existing as multiple stereoisomers. It is to be understood that in one embodiment, the invention described herein is not limited to any particular stereochemical requirement, and that the compounds, and compositions, methods, uses, and medicaments that include them may be optically pure, or may be any of a variety of stereoisomeric mixtures, including racemic and other mixtures of enantiomers, other mixtures of diastereomers, and the like. It is also to be understood that such mixtures of stereoisomers may include a single stereochemical configuration at one or more chiral centers, while including mixtures of stereochemical configuration at one or more other chiral centers.
[0063] Similarly, the compounds described herein may include geometric centers, such as cis, trans, E, and Z double bonds. It is to be understood that in another embodiment, the invention described herein is not limited to any particular geometric isomer requirement, and that the compounds, and compositions, methods, uses, and medicaments that include them may be pure, or may be any of a variety of geometric isomer mixtures. It is also to be understood that such mixtures of geometric isomers may include a single configuration at one or more double bonds, while including mixtures of geometry at one or more other double bonds.
[0064] As used herein, the terms “salts” and “pharmaceutically acceptable salts” refer to derivatives of the disclosed compounds wherein the parent compound is modified by making acid or base salts thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic groups such as amines; and alkali or organic salts of acidic groups such as carboxylic acids. Pharmaceutically acceptable salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, and nitric; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, and isethionic, and the like.
[0065] Pharmaceutically acceptable salts can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods. In some instances, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, the disclosure of which is hereby incorporated by reference.
[0066] The term “solvate” means a compound, or a salt thereof, that further includes a stoichiometric or non-stoichiometric amount of solvent bound by non-covalent intermolecular forces. Where the solvent is water, the solvate is a hydrate.
[0067] Further, in each of the foregoing and following embodiments, it is to be understood that the formulae include and represent not only all pharmaceutically acceptable salts of the compounds, but also include any and all hydrates and/or solvates of the compound formulae or salts thereof. It is to be appreciated that certain functional groups, such as the hydroxy, amino, and like groups form complexes and/or coordination compounds with water and/or various solvents, in the various physical forms of the compounds. Accordingly, the above formulae are to be understood to include and represent those various hydrates and/or solvates. In each of the foregoing and following embodiments, it is also to be understood that the formulae include and represent each possible isomer, such as stereoisomers and geometric isomers, both individually and in any and all possible mixtures. In each of the foregoing and following embodiments, it is also to be understood that the formulae include and represent any and all crystalline forms, partially crystalline forms, and non-crystalline and/or amorphous forms of the compounds.
[0068] The term “pharmaceutically acceptable carrier” is art-recognized and refers to a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting any subject composition or component thereof. Each carrier must be “acceptable” in the sense of being compatible with the subject composition and its components and not injurious to the patient. Some examples of materials which may serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances employed in pharmaceutical formulations.
[0069] As used herein, the term “administering” includes all means of introducing the compounds and compositions described herein to the patient, including, but are not limited to, oral (po), intravenous (iv), intramuscular (im), subcutaneous (sc), transdermal, inhalation, buccal, ocular, sublingual, vaginal, rectal, and the like. The compounds and compositions described herein may be administered in unit dosage forms and/or formulations containing conventional nontoxic pharmaceutically acceptable carriers, adjuvants, and vehicles.
[0070] Illustrative formats for oral administration include tablets, capsules, elixirs, syrups, and the like. Illustrative routes for parenteral administration include intravenous, intraarterial, intraperitoneal, epidural, intraurethral, intrasternal, intramuscular and subcutaneous, as well as any other art recognized route of parenteral administration.
[0071] Illustrative means of parenteral administration include needle (including microneedle) injectors, needle-free injectors and infusion techniques, as well as any other means of parenteral administration recognized in the art. Parenteral formulations are typically aqueous solutions which may contain excipients such as salts, carbohydrates and buffering agents (preferably at a pH in the range from about 3 to about 9), but, for some applications, they may be more suitably formulated as a sterile non-aqueous solution or as a dried form to be used in conjunction with a suitable vehicle such as sterile, pyrogen-free water. The preparation of parenteral formulations under sterile conditions, for example, by lyophilization, may readily be accomplished using standard pharmaceutical techniques well known to those skilled in the art. Parenteral administration of a compound is illustratively performed in the form of saline solutions or with the compound incorporated into liposomes. In cases where the compound in itself is not sufficiently soluble to be dissolved, a solubilizer such as ethanol can be applied.
[0072] The dosage of each compound of the claimed combinations depends on several factors, including: the administration method, the condition to be treated, the severity of the condition, whether the condition is to be treated or prevented, and the age, weight, and health of the person to be treated. Additionally, pharmacogenomic (the effect of genotype on the pharmacokinetic, pharmacodynamic or efficacy profile of a therapeutic) information about a particular patient may affect the dosage used.
[0073] It is to be understood that in the methods described herein, the individual components of a co-administration, or combination can be administered by any suitable means, contemporaneously, simultaneously, sequentially, separately or in a single pharmaceutical formulation. Where the co-administered compounds or compositions are administered in separate dosage forms, the number of dosages administered per day for each compound may be the same or different. The compounds or compositions may be administered via the same or different routes of administration. The compounds or compositions may be administered according to simultaneous or alternating regimens, at the same or different times during the course of the therapy, concurrently in divided or single forms.
[0074] The term “therapeutically effective amount” as used herein, refers to that amount of active compound or pharmaceutical agent that elicits the biological or medicinal response in a tissue system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician, which includes alleviation of the symptoms of the disease or disorder being treated. In one aspect, the therapeutically effective amount is that which may treat or alleviate the disease or symptoms of the disease at a reasonable benefit/risk ratio applicable to any medical treatment. However, it is to be understood that the total daily usage of the compounds and compositions described herein may be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically-effective dose level for any particular patient will depend upon a variety of factors, including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed; the age, body weight, general health, gender and diet of the patient: the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidentally with the specific compound employed; and like factors well known to the researcher, veterinarian, medical doctor or other clinician of ordinary skill.
[0075] Depending upon the route of administration, a wide range of permissible dosages are contemplated herein, including doses falling in the range from about 1 μg/kg to about 1 g/kg, 10 μg/kg to about 1 g/kg, 100 μg/kg to about 1 g/kg, 500 μg/kg to about 1 g/kg, 1 mg/kg to about 1 g/kg, 10 mg/kg to about 1 g/kg, 100 mg/kg to about 1 g/kg, 500 mg/kg to about 1 g/kg, 1 μg/kg to about 1 g/kg, 1 μg/kg to about 1 g/kg, 1 μg/kg to about 1 g/kg, 1 μg/kg to about 1 g/kg. The dosages may be single or divided, and may administered according to a wide variety of protocols, including q.d. (once a day), b.i.d. (twice a day), t.i.d. (three times a day), or even every other day, once a week, once a month, once a quarter, and the like. In each of these cases it is understood that the therapeutically effective amounts described herein correspond to the instance of administration, or alternatively to the total daily, weekly, month, or quarterly dose, as determined by the dosing protocol.
[0076] In addition to the illustrative dosages and dosing protocols described herein, it is to be understood that an effective amount of any one or a mixture of the compounds described herein can be determined by the attending diagnostician or physician by the use of known techniques and/or by observing results obtained under analogous circumstances. In determining the effective amount or dose, a number of factors are considered by the attending diagnostician or physician, including, but not limited to the species of mammal, including human, its size, age, and general health, the specific disease or disorder involved, the degree of or involvement or the severity of the disease or disorder, the response of the individual patient, the particular compound administered, the mode of administration, the bioavailability characteristics of the preparation administered, the dose regimen selected, the use of concomitant medication, and other relevant circumstances.
[0077] The term “patient” includes human and non-human animals such as companion animals (dogs and cats and the like) and livestock animals. Livestock animals are animals raised for food production. The patient to be treated is preferably a mammal, in particular a human being.
[0078] It has been discovered that potent anticancer activity of (aza)indenoisoquinolines can be correlated with strong MYC suppression and dual-targeting of topoisomerase I. It has also been discovered that the suppression of MYC expression and inhibition of topoisomerase I may be synergistic. It is believed that patients whose cancers are MYC-positive and which contain MYC G4 forming region(s) in the DNA of the cancer cell are good candidates for successful treatment of their cancers with (aza)indenoisoquinolines. As used herein, the term “MYC-positive,” indicates a cell that over-expresses the MYC protein compared to normal cells. It is understood that normal cells contain MYC. MYC-positive is used to indicate that the MYC protein levels are higher than in normal cells. These higher levels can be detected by commonly available procedures, such as IHC or western blot. Generally MYC protein levels in normal cells are very low and show as very faint band in a western blot, whereas in cancer cells that are “MYC-positive” a very clear band shows for the MYC protein in the western blot. As used herein, the phrase “a MYC-positive-cancer” indicates a cancer where the proliferation of the cancer cells is dependent or partially dependent on MYC.
[0079] As used herein, cancer cells are “MYC G4-positive” when the MYC promoter sequence in those cancer cells contains a nucleic acid sequence capable of forming a MYC G-quadruplex (MYC G4).
[0080] In some illustrative embodiments, the present disclosure relates to a method for selecting a patient for treatment and treating the patient with a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, or solvate thereof; wherein the patient has a MYC-positive cancer comprising the steps of obtaining a sample of the patient's cancer; determining if the cancer cells in the sample are MYC-positive; and selecting the patient for treatment with the compound if the patient's cancer cells are MYC-positive; where the compound of formula (I) is
##STR00001##
[0081] or a pharmaceutically acceptable salt, hydrate, or solvate thereof, wherein
[0082] A is N, CH, or CR; B is N, CH, or CR; C is N, CH, or CR; D is N, CH, or CR; E is N, CH, or CR, wherein R is a halo, azido, alkoxy, cyano, nitro, hydroxy, amino, thio, or a derivative thereof; or an alkyl, alkenyl, heteroalkyl, heteroalkenyl, heterocyclyl, cycloalkyl, cycloalkenyl, cycloheteroalkyl, cycloheteroalkenyl, aryl, arylalkyl, and arylalkenyl, each of which is optionally substituted;
[0083] R.sub.1 is an alkyl, alkenyl, heteroalkyl, heteroalkenyl, heterocyclyl, hydroxyalkyl, hydroxyalkylaminoalkyl, and heterocyclylalkyl, cycloalkyl, cycloalkenyl, cycloheteroalkyl, cycloheteroalkenyl, aryl, arylalkyl, and arylalkenyl, each of which is optionally substituted;
[0084] R.sub.2, R.sub.3, and R.sub.4 represent four substituents each independently selected from the group consisting of hydrogen, halo, azido, alkoxy, cyano, nitro, hydroxy, amino, thio, and derivatives thereof; or any two adjacent substituents that are taken together with the attached carbons to form an optionally substituted heterocycle, and each of other two substituents is defined as above.
[0085] In some illustrative embodiments, the present disclosure relates to a method for selecting and treating a patient if the patient's cancer cells are MYC-positive with a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, or solvate thereof wherein R.sub.1 is a C.sub.1-C.sub.12 alkyl, alkenyl, heteroalkyl, heteroalkenyl, hydroxyalkyl, hydroxyalkylaminoalkyl, and heterocyclylalkyl, (add a space here) or heterocyclyl, each of which is optionally substituted.
[0086] In some illustrative embodiments, the present disclosure relates to a method for selecting and treating a patient if the patient's cancer cells are MYC-positive with a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, or solvate thereof, wherein R.sub.1 is
##STR00002##
[0087] In some illustrative embodiments, the present disclosure relates to a method for selecting and treating a patient if the patient's cancer cells are MYC-positive with a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, or solvate thereof wherein D is N.
[0088] In some illustrative embodiments, the present disclosure relates to a method for selecting and treating a patient if the patient's cancer cells are MYC-positive with a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, or solvate thereof wherein E is N.
[0089] In some illustrative embodiments, the present disclosure relates to a method for selecting and treating a patient if the patient's cancer cells are MYC-positive with a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, or solvate thereof, wherein said compounds are selected from the following compound list (List 1).
##STR00003## ##STR00004## ##STR00005## ##STR00006## ##STR00007## ##STR00008## ##STR00009## ##STR00010## ##STR00011## ##STR00012##
or a pharmaceutically acceptable salt, hydrate, or solvate thereof.
[0090] In some illustrative embodiments, the present disclosure relates to a method for selecting and treating a patient if the patient's cancer cells are MYC-positive with a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, or solvate thereof, wherein the compound of formula (I) is selected from the group consisting of
##STR00013## ##STR00014## ##STR00015##
or a pharmaceutically acceptable salt, hydrate, or solvate thereof
[0091] In some illustrative embodiments, the present disclosure relates to a method for selecting and treating a patient if the patient's cancer cells are MYC-positive with a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, or solvate thereof, wherein said compounds are selected from the group consisting of
##STR00016## ##STR00017##
or a pharmaceutically acceptable salt, hydrate, or solvate thereof.
[0092] In some illustrative embodiments, the present disclosure relates to a method for selecting and treating a patient if the patient's cancer cells are MYC-positive with a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, or solvate thereof, wherein said compound is a human topoisomerase I inhibitor.
[0093] In some illustrative embodiments, the present disclosure relates to a method for selecting and treating a patient if the patient's cancer cells are MYC-positive with a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, or solvate thereof, wherein the compound of formula (I) are selected from the group consisting of
##STR00018## ##STR00019## ##STR00020##
or a pharmaceutically acceptable salt, hydrate, or solvate thereof.
[0094] In some illustrative embodiments, the present disclosure relates to a method for selecting and treating a patient if the patient's cancer cells are MYC-positive with a compound of formula (II):
##STR00021##
or a pharmaceutically acceptable salt, hydrate, or solvate thereof, wherein m is 3, R.sup.1 is 3-Cl or 3-F, and R.sup.2 is selected from the group consisting of
##STR00022##
[0095] In some illustrative embodiments, the present disclosure relates to a method for selecting and treating a patient if the patient's cancer cells are MYC-positive with a composition comprising a compound of formula (I) or a pharmaceutically acceptable salt, hydrate, or solvate thereof, wherein said compounds are a human topoisomerase I inhibitor and wherein said compounds block the activities of MYC oncogene through binding the MYC G-quadruplex.
[0096] In any of the preceding embodiments disclosed herein, the present disclosure further relates to a method for selecting and treating the patient if the patient's cancer cells are MYC-positive and contain a MYC promoter G-quadruplex (MYC G4), i.e. are MYC G4-positive, the method further comprising the step of determining if the cancer cells in the sample are MYC G4-positive.
[0097] Herein, using fluorescence resonance energy transfer (FRET) assays, nuclear magnetic resonance (NMR), fluorescence-based binding assay and competition fluorescence displacement assay, circular dichroism (CD) spectroscopy, and gel electromobility shift assay (EMSA), it has been shown that a large number of anticancer indenoisoquinolines strongly bind and stabilize MYC G4 in vitro. Using cell-based western blotting and quantitative reverse transcription-polymerase chain reaction (qRT-PCR) assays, it is shown that MYC G4-interactive indenoisoquinolines lower MYC mRNA and protein levels in vivo, indicating that targeting the MYC promoter G4 to downregulate MYC may be a mechanism of action for the anticancer activities of these particular indenoisoquinolines. Furthermore, some active indenoisoquinolines show both MYC downregulation and topoisomerase I inhibition, suggesting that dual-targeting of MycG4 and topoisomerase I could be a potential strategy for anticancer drug development.
Results and Discussion
Indenoisoquinolines can Induce and Stabilize MYC G4
[0098] To examine whether the indenoisoquinolines could induce and stabilize the MYC G4 (MycG4), a FRET-quenching assay was conducted on indenoisoquinoline compounds. The full-length MYC promoter NHE III.sub.1 G4 DNA (MycPu28,
[0099] 56 indenoisoquinoline compounds (List 1, shown above) were examined using this FRET-quenching assay (
[0100] To confirm the stabilizing effect of indenoisoquinolines on MycG4, the T.sub.m values of MycG4 were measured in the presence of indenoisoquinoline compounds in 10 mM K.sup.+ using dual-3′-FAM- and 5′-TAMRA-labeled MycPu22 DNA by FRET-melting experiments. MycPu22 DNA forms a single MycG4 structure and was used for NMR structure determination (
Indenoisoquinolines can Lower MYC Levels in Cancer Cells
[0101] G-Quadruplex formed in the MYC promoter was found to function as a transcriptional silencer..sup.32-34 To determine the effects of indenoisoquinolines on the MYC protein level, a western blotting experiment was carried out using MCF-7 breast cancer cells treated with 44 indenoisoquinolines that increased the T.sub.m value of MycG4 by more than 5° C. MCF-7 cells were incubated with each compound at four concentrations (0.5, 1, 2, and 4 μM) for 24 hours, and the MYC protein levels were measured (
[0102] The human topoisomerase I inhibitory activities of the 44 indenoisoquinolines have been previously determined..sup.3, 6-9, 15, 50-52 Of the 44 compounds tested for their cytotoxicities in the NCI-60 cancer cell lines, the 31 most potent compounds had their mean graph midpoint (MGM) values determined based on the GI.sub.50 values obtained from the NCI-60 cancer cell line drug screen (Table 3)..sup.53-55 The topoisomerase I inhibitory activities were plotted against the anticancer activities of these 31 compounds (
[0103] To confirm the effect on the transcription of the MYC gene in cancer cells by the six selected indenoisoquinoline compounds, the MYC mRNA levels in MCF-7 cancer cells were measured by qRT-PCR. Consistent with the western blotting data, all five MYC-inhibiting compounds significantly lowered MYC mRNA levels at 6 hours post the treatments with 1 μM indenoisoquinolines. The negative control compound 17 showed no reduction of MYC mRNA level (
TABLE-US-00001 TABLE 1 The DNA sequences and primers used in this study. Sequence Sequence Name DNA Sequence (5′ to 3′) ID No MycPu28 TGGGGAGGGTGGGGAGGGTGGGG SEQ ID NO. 1 AAGGT MycPu22 TGAGGGTGGG TAGGGTGGGTAA SEQ ID NO. 2 K-RasG4 AGGGCGGTGTGGGAAGAGGGAAG SEQ ID NO. 3 AGGGGGAGG Telomeric G4 TTAGGGTTAGGGTTAGGGTTAGG SEQ ID NO. 4 GTT qRT-PCR Primers MYC Forward GCTGCTTAGACGCTGGATT SEQ ID NO. 5 MYC Reverse TCCTCCTCGTCGCAGTAGA SEQ ID NO. 6 GAPDH Forward CATGAGAAGTATGACAACAGCCT SEQ ID NO. 7 GAPDH Reverse AGTCCTTCCACGATACCAAAGT SEQ ID NO. 8
TABLE-US-00002 TABLE 2 Competitor binding affinities (K.sub.i) of the five indenoisoquinolines determined by competition fluorescence displacement experiments. K.sub.i (nM) Telomeric calf thymus Compound MycPu22 MycPu28 K-RasG4 G4 dsDNA.sup.a 5 16 18 21 164 ~11000 6 40 33 32 286 ~12000 9 12 11 11 28 5171 12 7 7 7 14 3624 13 26 19 23 146 2138 .sup.aThe K.sub.i value of the calf thymus ds-DNA refers to the base-pair concentration.
TABLE-US-00003 TABLE 3 MYC inhibition, Top1 inhibition, and GI50 values (pM) of the 29 indenoisoquinolines. Compound No. 1 2 3 4 5 6 7 8 MYC Inhibition.sup.a + +++ +++ ++ +++ +++ +++ + Top1 Inhibiton.sup.b + ++ ++ + ++ + ++ + MGM (uM).sup.c 0.580 0.630 0.600 2.900 0.165 0.240 0.220 0.218 Cancer Cell Lines Antiproliferative Activities [GI50 (μM)].sup.d Leukemia CCRF-CEM 0.08 0.03 0.06 0.53 0.11 0.26 0.16 0.04 HL-60(TB) 0.11 6.23 0.60 18.00 0.16 0.22 0.20 0.09 K-562 0.56 0.79 1.14 1.19 0.13 0.17 0.21 0.15 MOLT-4 0.04 0.02 0.04 0.35 0.04 0.04 0.05 0.03 RPMI-8226 0.87 5.26 1.47 13.90 0.15 0.20 0.14 0.05 SR 0.12 0.05 0.14 0.58 0.08 0.12 0.13 0.05 Non-Small Cell Lung Cancer A549/ATCC 0.06 0.61 0.45 4.17 0.07 0.11 0.06 0.02 EKVX 1.37 2.18 1.20 7.73 0.30 0.30 0.33 0.44 HOP-62 0.21 0.05 0.22 0.95 0.11 0.14 0.15 0.07 HOP-92 1.12 2.20 1.19 4.68 0.28 0.37 0.36 0.14 NCI-H226 1.04 3.27 1.35 12.30 0.15 0.16 0.14 0.15 NCI-H23 1.01 0.86 0.92 6.27 0.18 0.31 0.30 0.23 NCI-H322M 1.26 1.68 1.28 4.34 0.32 0.45 0.44 0.96 NCI-H460 0.04 0.02 0.05 0.38 0.04 0.05 0.05 0.03 NCI-H522 0.61 0.27 0.37 6.32 0.04 0.06 0.06 0.12 Colon Cancer COLO 205 0.78 0.16 0.50 1.30 0.09 0.07 0.07 0.15 HCC-2998 1.29 5.07 1.41 11.30 0.40 1.15 1.06 1.05 HCT-116 0.30 0.10 0.55 0.98 0.09 0.14 0.14 0.09 HCT-15 0.26 1.73 1.11 4.08 0.16 0.25 0.23 0.13 HT29 0.66 0.16 1.08 1.37 0.07 0.15 0.15 0.15 KM12 0.55 2.11 1.10 3.37 0.17 0.24 0.26 0.17 SW-620 0.09 0.03 0.08 0.30 0.12 0.18 0.17 0.11 CNS Cancer SF-268 1.07 0.17 0.40 4.75 0.21 0.38 0.39 0.28 SF-295 0.08 0.03 0.13 0.67 0.09 0.19 0.19 0.13 SF-539 1.33 1.98 0.73 2.15 0.25 0.37 0.32 0.53 SNB-19 1.06 1.03 0.61 13.80 0.18 0.22 0.16 0.13 SNB-75 0.29 0.35 0.26 0.93 0.22 0.25 0.36 0.37 U251 0.31 0.04 0.30 7.24 0.08 0.11 0.10 0.08 Melanoma LOX IMVI 0.17 0.04 0.16 0.78 0.11 0.14 0.14 0.18 MALME-3M 1.54 5.90 1.48 5.77 0.20 0.32 0.33 1.13 M14 1.23 0.87 0.57 1.71 0.23 0.31 0.34 0.37 MDA-MB -435 1.25 5.06 1.07 1.53 0.31 0.47 0.48 0.58 SK-MEL-2 2.11 7.17 13.20 5.29 0.51 1.60 1.13 1.71 SK-MEL-28 1.81 8.34 1.62 2.30 0.94 1.44 1.23 1.52 SK-MEL-5 1.07 2.54 1.12 11.00 0.16 0.31 0.25 0.22 UACC-257 2.19 7.85 2.24 4.04 0.47 0.49 0.40 1.29 UACC-62 1.43 2.09 0.57 1.81 0.27 0.61 0.34 1.26 Ovarian Cancer IGROV1 1.13 2.47 1.14 10.40 0.21 0.32 0.33 0.48 OVCAR-3 1.43 5.97 1.41 15.10 0.19 0.26 0.28 0.34 OVCAR-4 1.17 1.43 1.27 2.19 0.30 0.42 0.46 0.89 OVCAR-5 1.74 5.02 1.69 3.56 0.28 0.35 0.33 0.33 OVCAR-8 1.10 0.81 1.18 3.09 0.14 0.19 0.18 0.13 NCl/ADR-RES 1.09 0.22 0.54 0.98 0.23 0.43 0.37 0.86 SK-OV-3 1.16 1.47 0.66 10.10 0.22 0.23 0.22 0.21 Renal Cancer 786-0 0.47 1.47 0.32 2.47 0.12 0.20 0.20 0.13 A498 0.55 0.38 0.53 0.96 0.20 0.37 0.25 0.35 ACHN 0.18 0.08 0.22 0.78 0.06 0.12 0.13 0.06 CAKI-1 0.41 0.03 0.06 2.97 ND ND ND ND RXF 393 1.04 0.70 1.30 1.90 0.23 0.32 0.26 0.27 SN12C 0.49 2.05 1.18 10.20 0.16 0.21 0.15 0.08 TK-10 ND.sup.e ND ND ND 0.18 0.33 0.30 0.27 U0-31 1.03 0.60 1.08 3.74 0.08 0.13 0.12 0.13 Prostate Cancer PC-3 0.98 0.86 1.02 3.60 0.28 0.37 0.30 0.60 DU-145 0.24 0.19 0.33 3.18 0.21 0.20 0.22 0.06 Breast Cancer MCF7 0.09 0.02 0.05 0.49 0.03 0.03 0.04 0.03 MDA-MB- 231/ATCC 1.35 6.15 1.62 10.70 0.40 0.70 0.40 0.48 HS 578T 1.49 6.87 1.84 12.90 0.75 2.24 1.62 2.08 BT-549 1.53 3.80 0.65 15.20 0.66 0.58 0.94 1.25 T-47D 8.98 1.21 1.12 22.80 0.08 0.16 0.15 0.27 MDA-MIB-468 0.55 0.06 1.28 1.19 0.23 0.22 0.14 0.21 Compound No. 9 10 11 12 13 19 20 MYC Inhibition.sup.a ++++ ++++ ++++ ++++ +++ ++ + Topl Inhibiton.sup.b ++ +++ +++ ++++ ++++ +++ +++ MGM (uM).sup.c 0.045 0.074 0.177 0.055 0.140 2.570 1.260 Cancer Cell Lines Antiproliferative Activities [GI50 (μM)].sup.d Leukemia CCRF-CEM <0.01 0.04 0.05 <0.01 0.01 1.57 1.37 HL-60(TB) 0.03 0.04 0.10 <0.01 0.21 4.28 1.80 K-562 0.02 0.04 0.23 0.11 0.18 5.13 1.42 MOLT-4 <0.01 0.03 0.03 <0.01 <0.01 0.87 0.29 RPMI-8226 0.04 0.08 0.17 0.03 0.10 1.85 1.84 SR <0.01 0.01 0.02 <0.01 <0.01 0.29 0.31 Non-Small Cell Lung Cancer A549/ATCC 0.05 0.07 0.12 0.04 0.06 1.96 0.59 EKVX 0.30 0.27 0.45 1.01 0.43 4.91 ND HOP-62 <0.01 0.03 0.15 0.01 0.03 1.41 1.25 HOP-92 0.55 0.24 0.87 1.38 0.15 4.47 1.42 NCI-H226 0.10 0.09 0.17 0.04 1.42 2.79 1.32 NCI-H23 0.03 0.04 0.15 0.02 0.21 3.10 1.86 NCI-H322M 0.05 0.16 0.28 0.04 0.34 5.44 2.47 NCI-H460 <0.01 0.02 0.04 <0.01 <0.01 0.44 0.41 NCI-H522 0.06 0.08 0.08 <0.01 0.02 1.06 1.84 Colon Cancer COLO 205 0.04 0.06 0.30 0.24 0.07 1.74 0.47 HCC-2998 0.16 0.20 0.30 1.03 0.19 3.44 2.17 HCT-116 <0.01 0.03 ND ND 0.04 1.27 0.44 HCT-15 0.06 0.12 0.30 1.17 0.15 2.90 1.03 HT29 0.02 0.06 0.15 0.03 0.12 2.48 1.01 KM12 0.14 0.16 0.40 1.11 0.19 3.80 1.61 SW-620 <0.01 0.03 0.13 0.01 0.04 1.68 0.46 CNS Cancer SF-268 0.02 0.07 0.08 <0.01 0.07 1.75 2.15 SF-295 <0.01 0.03 0.07 0.01 0.08 1.27 0.75 SF-539 0.03 0.05 0.31 0.04 0.11 1.96 0.85 SNB-19 0.04 0.04 0.11 0.01 0.11 2.13 1.75 SNB-75 0.05 0.13 0.27 0.03 0.23 3.63 0.66 U251 0.01 0.04 0.08 <0.01 0.10 1.72 1.05 Melanoma LOX IMVI <0.01 0.03 0.04 <0.01 0.05 1.34 0.81 MALME-3M 0.06 0.18 0.34 0.62 0.21 4.49 ND M14 <0.01 0.04 0.07 <0.01 0.32 2.85 1.57 MDA-MB-435 0.06 0.15 0.42 0.48 0.39 4.67 1.93 SK-MEL-2 1.01 0.35 1.59 1.56 0.55 19.50 3.92 SK-MEL-28 10.60 0.39 1.13 1.18 1.11 8.03 1.56 SK-MEL-5 0.07 0.11 0.26 0.03 0.07 1.50 1.00 UACC-257 0.18 0.18 0.59 0.58 1.18 6.60 2.02 UACC-62 0.02 0.02 0.04 <0.01 0.55 1.58 1.30 Ovarian Cancer IGROV1 0.02 0.21 0.42 0.08 ND ND 1.91 OVCAR-3 0.06 0.17 0.32 0.14 0.41 2.70 2.41 OVCAR-4 0.08 0.17 0.33 0.48 0.23 3.13 1.93 OVCAR-5 0.16 0.14 0.45 1.04 0.38 6.31 2.44 OVCAR-8 0.09 0.09 0.17 0.02 0.07 3.11 0.95 NCl/ADR-RES 0.03 0.06 0.13 0.02 1.04 3.14 2.72 SK-OV-3 0.03 0.06 0.14 0.01 0.22 2.67 2.22 Renal Cancer 786-0 0.03 0.04 0.22 0.02 0.06 1.78 1.16 A498 ND 0.03 ND ND 0.13 1.64 ND ACHN <0.01 0.04 0.04 <0.01 0.04 1.67 0.29 CAKI-1 <0.01 0.03 0.04 <0.01 0.24 3.17 0.57 RXF 393 0.06 0.07 0.39 0.03 0.96 7.16 2.31 SN12C 0.04 0.05 0.08 <0.01 0.16 4.10 1.12 TK-10 0.37 0.32 0.73 1.34 0.41 4.63 3.02 U0-31 <0.01 0.03 0.05 <0.01 0.10 0.42 0.57 Prostate Cancer PC-3 0.07 0.13 0.57 1.28 0.28 19.50 2.05 DU-145 0.02 0.05 0.06 <0.01 0.06 2.31 1.89 Breast Cancer MCF7 <0.01 0.01 0.03 <0.01 <0.01 0.20 0.37 MDA-MB- 231/ATCC 0.68 0.27 0.63 1.61 0.68 11.20 2.58 HS 578T 1.91 1.17 3.85 1.82 0.66 8.95 3.08 BT-549 0.35 0.37 0.29 0.05 0.28 4.11 1.67 T-47D 0.02 0.03 0.11 <0.01 0.05 1.07 2.04 MDA-MIB-468 0.03 0.03 0.12 0.03 ND ND 1.57 Compound No. 25 30 36 37 38 42 MYC Inhibition 0 + ++++ +++ + +++ Topl Inhibiton ++ 0 ++ ++ ++ +++++ MGM (uM) 0.720 0.600 0.280 1.860 0.660 0.570 Cancer Cell Lines Antiproliferative Activities [GI50 (μM)].sup.d Leukemia CCRF-CEM 0.34 0.03 0.05 0.66 0.11 <0.01 HL-60(TB) 1.17 0.03 0.08 0.59 1.48 0.02 K-562 0.83 0.34 0.09 2.25 0.77 1.49 MOLT-4 0.10 0.02 0.03 0.24 0.15 <0.01 RPMI-8226 0.27 0.12 0.12 0.70 1.02 <0.01 SR 0.31 0.02 0.03 0.03 0.04 <0.01 Non-Small Cell Lung Cancer A549/ATCC 0.22 0.06 0.52 ND 1.31 10.50 EKVX 1.18 2.91 ND ND ND 70.70 HOP-62 1.06 0.18 0.12 0.59 0.46 <0.01 HOP-92 1.72 0.13 0.28 13.60 1.34 0.19 NCI-H226 0.56 0.27 0.45 ND 1.18 0.37 NCI-H23 1.05 0.24 0.17 0.68 0.38 0.09 NCI-H322M 0.45 7.05 0.66 72.60 1.39 >100 NCI-H460 0.31 0.04 0.03 0.24 0.37 <0.01 NCI-H522 0.96 0.84 0.05 0.10 0.78 <0.01 Colon Cancer COLO 205 0.62 4.92 7.76 7.90 0.69 >100 HCC-2998 0.35 10.00 1.42 37.10 0.62 29.30 HCT-116 ND 0.39 0.22 0.74 0.15 0.17 HCT-15 0.73 0.09 1.53 >100 1.49 >100 HT29 0.35 0.34 1.18 4.08 0.48 >100 KM12 1.13 0.53 1.04 9.39 1.34 >100 SW-620 0.16 0.20 0.08 0.81 0.34 0.06 CNS Cancer SF-268 0.95 1.85 0.04 0.27 0.55 ND SF-295 1.16 0.36 0.18 0.33 0.28 <0.01 SF-539 1.61 1.04 0.27 0.37 0.67 <0.01 SNB-19 0.54 0.33 0.39 12.80 1.08 <0.01 SNB-75 0.95 1.39 0.21 2.97 0.16 0.23 U251 0.64 0.18 0.12 0.27 0.33 <0.01 Melanoma LOX IMVI 0.15 0.10 0.09 0.30 0.30 0.06 MALME-3M 1.42 0.93 1.16 1.79 2.16 1.60 M14 1.05 1.65 0.08 ND 0.46 <0.01 MDA-MB-435 1.20 10.30 0.89 2.84 1.30 >100 SK-MEL-2 1.71 18.20 9.44 30.80 2.18 >100 SK-MEL-28 1.53 2.01 1.37 16.40 1.88 >100 SK-MEL-5 0.70 0.48 0.22 1.67 1.26 0.22 UACC-257 1.69 12.30 0.48 25.30 1.57 >100 UACC-62 1.03 0.72 0.05 0.21 0.95 <0.01 Ovarian Cancer IGROV1 0.84 0.58 1.52 11.30 1.24 6.72 OVCAR-3 1.05 6.09 0.57 1.35 1.69 16.40 OVCAR-4 0.34 1.45 1.29 1.41 1.11 >100 OVCAR-5 2.12 1.51 3.60 >100 1.67 >100 OVCAR-8 0.40 0.16 0.45 0.89 1.01 1.03 NCl/ADR-RES 1.16 1.48 0.28 >100 2.55 0.35 SK-OV-3 1.05 1.21 0.24 0.56 1.15 <0.01 Renal Cancer 786-0 1.34 0.22 0.21 0.33 0.34 <0.01 A498 ND 10.60 0.07 ND 0.96 7.17 ACHN 0.39 0.09 0.05 0.31 0.28 <0.01 CAKI-1 1.05 ND 0.12 0.22 0.29 0.32 RXF 393 1.29 1.66 0.46 1.35 1.13 8.00 SN12C 0.33 0.25 0.20 0.42 0.45 <0.01 TK-10 1.33 2.75 2.12 2.54 1.85 73.70 U0-31 0.77 0.30 0.07 ND 0.69 0.03 Prostate Cancer PC-3 0.86 1.21 0.67 7.22 0.64 34.90 DU-145 0.33 0.20 0.14 0.33 0.43 <0.01 Breast Cancer MCF7 0.30 0.04 0.05 0.08 0.16 <0.01 MDA-MB- 231/ATCC 0.51 1.27 2.06 18.10 1.57 77.80 HS 578T 1.44 4.90 1.97 >100 ND 54.20 BT-549 1.27 3.10 0.12 0.35 0.36 ND T-47D 1.55 0.63 0.56 12.00 0.70 <0.01 MDA-MB-468 0.95 7.84 0.14 ND 0.24 ND No. in JACS 44 45 46 47 48 49 50 55 MYC Inhibition +++ ++ + ++ + + ++ + Topl Inhibiton ++++ +++ +++ ++++ + + ++++ ++ MGM (uM) 0.060 0.180 0.350 0.390 1.020 12.000 0.040 0.340 Cancer Cell Lines Antiproliferative Activities [GI.sub.50 (μM].sup.d Leukemia CCRF-CEM <0.01 <0.01 <0.01 <0.01 0.30 2.44 <0.01 <0.01 HL-60(TB) <0.01 0.22 0.25 1.60 >50 19.50 0.29 0.30 K-562 0.02 0.09 0.28 ND 1.59 6.49 <0.01 0.19 MOLT-4 <0.01 <0.01 <0.01 <0.01 0.42 <0.01 <0.01 <0.01 RPMI-8226 0.01 <0.01 0.48 0.30 0.20 2.39 0.02 0.25 SR <0.01 <0.01 ND <0.01 ND ND <0.01 <0.01 Non-Small Cell Lung Cancer A549/ATCC 0.03 0.11 0.74 0.89 0.65 18.70 <0.01 0.11 EKVX 0.26 ND 2.06 1.46 1.31 17.70 2.57 ND HOP-62 0.01 0.06 0.05 ND 0.42 18.00 <0.01 0.19 HOP-92 0.83 1.65 3.27 1.30 ND 19.80 <0.01 1.66 NCI-H226 0.21 1.39 0.65 1.40 0.66 13.90 0.05 2.12 NCI-H23 <0.01 0.13 0.05 0.19 0.71 11.90 0.02 0.71 NCI-H322M 0.05 ND 0.53 1.56 1.05 15.60 3.18 1.00 NCI-H460 <0.01 0.02 0.43 0.28 0.24 5.81 <0.01 0.03 NCI-H522 <0.01 0.07 0.40 0.31 13.10 15.40 0.02 0.04 Colon Cancer COLO 205 0.38 0.30 0.08 0.94 1.14 10.30 <0.01 0.31 HCC-2998 ND 0.10 ND 0.13 0.14 <0.01 <0.01 3.32 HCT-116 0.07 0.12 0.13 0.22 0.12 1.49 <0.01 0.16 HCT-15 0.55 0.14 0.91 0.20 1.11 16.00 0.07 1.02 HT29 <0.01 0.09 ND 0.07 1.04 16.90 <0.01 0.32 KM12 0.26 0.15 1.00 1.29 0.68 12.80 1.62 1.01 SW-620 0.11 0.13 0.25 <0.01 0.57 11.20 <0.01 0.11 CNS Cancer SF-268 0.11 1.20 0.38 1.11 2.41 11.90 <0.01 0.07 SF-295 <0.01 <0.01 0.87 0.02 0.57 10.70 <0.01 0.03 SF-539 ND 0.01 0.25 0.16 0.64 17.70 <0.01 0.24 SNB-19 ND ND 0.02 0.55 1.39 >100 <0.01 0.31 SNB-75 0.01 0.13 ND 0.79 1.30 16.00 <0.01 0.40 U251 <0.01 0.03 0.01 0.06 0.52 11.40 <0.01 0.05 Melanoma LOX IMVI <0.01 0.11 0.03 0.07 0.46 3.81 <0.01 0.05 MALME-3M 0.15 1.01 0.69 1.07 ND 24.80 ND 1.25 M14 0.01 0.32 0.37 1.10 1.34 ND <0.01 0.15 MDA-MB-435 0.53 1.23 0.36 0.65 1.81 >100 <0.01 0.95 SK-MEL-2 1.62 1.93 3.39 4.99 3.01 >100 19.60 5.32 SK-MEL-28 0.17 1.27 0.25 1.48 1.42 16.50 0.68 11.80 SK-MEL-5 0.14 1.33 0.48 0.33 2.26 14.20 0.21 1.15 UACC-257 0.29 1.54 0.95 1.34 7.72 >100 0.12 0.70 UACC-62 0.03 0.36 0.27 0.54 1.38 15.10 0.01 0.33 Ovarian Cancer IGROV1 0.27 0.32 2.57 1.04 18.90 7.05 0.02 0.11 OVCAR-3 0.58 0.43 0.10 1.19 0.71 15.30 0.04 1.23 OVCAR-4 0.12 0.14 0.10 0.33 0.25 4.17 1.48 2.21 OVCAR-5 0.15 0.25 0.79 ND 1.53 17.60 0.13 12.80 OVCAR-8 0.11 0.14 0.28 0.48 0.59 18.10 <0.01 0.34 NCl/ADR-RES ND ND 8.70 0.03 2.44 1.55 <0.01 1.50 SK-OV-3 0.60 1.40 ND 1.29 2.18 12.30 <0.01 0.21 Renal Cancer 786-0 <0.01 0.11 0.09 0.17 0.76 12.90 <0.01 0.29 A498 0.38 1.13 ND 20.20 5.94 ND 1.52 ND ACHN <0.01 0.09 0.11 0.15 0.64 10.10 <0.01 0.07 CAKI-1 <0.01 0.11 0.29 0.20 0.38 10.30 <0.01 0.10 RXF 393 0.14 0.62 2.97 2.48 1.30 20.50 0.05 0.80 SN12C <0.01 0.59 0.26 0.94 0.44 11.40 <0.01 0.24 TK-10 ND ND 2.95 1.66 0.52 17.10 12.50 ND U0-31 0.02 0.29 16.90 1.05 3.75 20.60 0.15 0.32 Prostate Cancer PC-3 ND ND 1.15 ND 1.13 15.80 0.50 0.62 DU-145 <0.01 0.05 0.25 0.16 0.11 10.60 <0.01 0.04 Breast Cancer MCF7 <0.01 <0.01 0.36 0.09 0.38 8.82 <0.01 0.07 MDA-MB- 231/ATCC 0.46 0.25 0.64 0.97 0.68 15.30 0.15 1.59 HS 578T 2.03 2.29 0.55 1.93 2.85 13.90 1.52 ND BT-549 0.75 1.30 0.88 ND 2.41 80.80 2.40 4.70 T-47D 0.02 0.12 0.07 0.50 0.73 ND <0.01 5.51 MDA-MB-468 ND ND ND ND ND ND ND 0.55 .sup.aThe MYC inhibition levels were determined based on the western blotting results as shown in FIGS 3A and 12A to 12F. MYC inhibition levels were classified into four levels: strong inhibition, +++, MYC expression inhibited at 0.5 to 1.0 μM; medium inhibition, ++, MYC expression inhibited at 2.0 μM, or no clear dose-dependent MYC inhibition; weak inhibition, +, MYC expression inhibited at 4.0 μM; no inhibition, 0, no MYC expression inhibition up to 4.0 μM. .sup.bThe relative topoisomerase I (Top 1) inhibition levels of the compounds were previously determined and classified into six levels (0 - 5, +++++ = 5)..sup.3, 6-9, 15, 50-52 .sup.cThe MGM values for each compound are the average of GI.sub.50 values across the entire panel of NCI-60 cancer cell lines, where compounds with GI.sub.50 values that fall outside the test range of 10.sup.-4 to 10.sup.-8 M are assigned values of 10.sup.-4 or 10.sup.-8M. .sup.dThe antiproliferative activities [GI.sub.50 values, μM)] listed are the concentrations corresponding to 50% growth inhibition which were determined in the NCI-60 cancer cell lines drug screen. .sup.eGI.sub.50 value not determined.
TABLE-US-00004 TABLE 4 Raw log.sub.10MGM data of the 29 indenoisoquinolines. MYC Inhibition Levels* log.sub.10MGM (μM) 3 2 1 0 Topoisomerase I 0 −0.22 Inhibition Mean: −0.22 Levels** 1 −0.62*** 0.46 −0.66, −0.24, −0.12, 1.08 Mean: −0.62**** Mean: 0.46 Mean: 0.02 2 −1.35, −0.78, −0.70, −0.66, −1.18, −0.22 −0.10 −0.22, −0.20, −0.13 Mean: −0.70 Mean: −0.10 Mean: −0.58 3 −1.13, −0.75 −0.80, −0.06, 0.10, 0.43 Mean: −0.94 Mean: −0.08 4 −1.26, −0.40 −0.95, −0.68, −0.46 Mean: −0.83 Mean: −0.69 5 −1.10 Mean: −1.10 The 29 indenoisoquinolines were grouped by their MYC inhibition levels and topoisomerase I inhibition levels. The overall anticancer activity of each group was determined by the mean(log.sub.10MGM) value. *The MYC inhibition levels were determined based on the western blotting results as shown in FIGs 3A and 12A to 12F (3 = strong, 2 = medium, 1 = weak, and 0 = no inhibition). **The topoisomerase I inhibition levels were previously determined..sup.3, 6-9, 15, 50-52 ***log.sub.10MGM value of each individual compound. The MGM values for each compound are the average of GI.sub.50 values across the entire panel of NCI-60 cancer cell lines, where compounds with GI.sub.50 values that fall outside the test range of 10.sup.-4 to 10.sup.-8 M are assigned values of 10.sup.-4 or 10.sup.-8 M. 50% growth inhibition (GI.sub.50) values were determined in the NCI-60 cancer cell lines drug screen. **** the mean(log.sub.10MGM) value of all compounds in each group.
MYC-Inhibiting Indenoisoquinolines are Strong MYC G4 Binding Ligands
[0104] The binding interactions of six selected indenoisoquinolines with MycG4 were examined using .sup.1H NMR titration experiments in K.sup.+-containing solution. The free MycG4 DNA shows 12 imino proton peaks of guanines from the three G-tetrads (
[0105] CD titration experiments with MycG4 were also carried out for the six selected indenoisoquinolines. The free MycPu22 DNA in K.sup.+ buffer showed the CD signature of a parallel G-quadruplex, with a positive peak at 264 nm and a negative peak at 242 nm..sup.57 Upon addition of indenoisoquinolines, the CD signature of a parallel G-quadruplex was maintained (
[0106] Binding affinities of these six indenoisoquinolines to MycG4 were measured using a 3′-TAMRA-labeled MycPu22 DNA..sup.59 The five MYC-inhibiting compounds showed strong binding with apparent binding affinity K.sub.d values of 5.6-23.9 nM, whereas the negative control compound showed negligible binding (
Molecular Docking Study of the Binding of Indenoisoquinoline 5 to MYC G4
[0107] NMR titration data showed that 7-azaindenoisoquinoline 5 (page 24) binds MycG4 to form a well-defined complex at both the 5′- and 3′-ends, as is evident by the significant shifting of the imino proton peaks of the 5′- and 3′-external tetrad guanines (
Binding Selectivity of MYC G4-Interactive Indenoisoquinolines and 7-Azaindenoisoquinolines.
[0108] Using a competition fluorescence displacement assay, the binding selectivity of five indenoisoquinolines for MycG4 was determined as compared to a parallel K-Ras promoter G4, a hybrid telomeric G4, and double-stranded (ds) DNA at 1 and 5 equivalents of each compound (
Structure-Activity Relationship of MYC G4 Binding by Indenoisoquinolines.
[0109] To understand the factors that govern indenoisoquinoline recognition for MycG4, indenoisoquinoline analogues were analyzed for their MycG4 interactions and MYC inhibitory activity. Trends could be established to generate structure-activity relationships for MycG4 binding (
[0110] 9-Methoxy-7-azaindenoisoquinolines, which were developed to improve water solubility and increased charge-transfer properties,.sup.62-63 appear to bind MycG4 well and show potent MYC-inhibitory activity (
CONCLUSION
[0111] It has been discovered that anticancer indenoisoquinolines and 7-azaindenoisoquinolines strongly bind and stabilize MycG4 and lower MYC levels in cancer cells as revealed by various biophysical, biochemical, computer modeling, and cell-based experiments. A large number of active indenoisoquinolines and 7-azaindenoisoquinolines caused strong MYC downregulation. Indenoisoquinoline analogs are clinically useful anticancer drugs and present a promising scaffold for MycG4-targeting anticancer drug development (
Indenoisoquinolines are More Effective in MYC-Positive Cancers that Contain MYC Promoter G4 (MYC G4) (
[0112] In human Burkitt's lymphoma (BL), a translocation occurs between the IgH heavy chain (an immunoglobin chain) that resides on chromosome 14 and the MYC promoter on chromosome 8, which results in aberrant control and up-regulation of MYC expression.sup.32, 34, 67. The BL cell line Raji retains the MYC G4 after the translocation, whereas the BL cell line CA46 losses this element. For characterization of the intracellular activity of indenoisoquinolines, this pair of BL cell lines was used.sup.32, 34, 67. It was found that Raji cells are more sensitive than the CA46 cells to indenoisoquinolines that mediate their intracellular effects through stabilization of MYC G4 and modulation of MYC expression. Using MTS assay, active G4-interactive indenoisoquinolines showed dose-dependent cytotoxicity in Raji and CA46 cells, while the Raji cells were much more sensitive than the CA46 cells at 100 nM and 300 nM treatments for 72 h. This data indicates that active G4-interactive indenoisoquinolines target MYC G4 and are more effective against MYC-positive cancers that contain MYC G4. Using these same techniques, differential activity of (aza)indenoisoquinolines against other cancers that are MYC-positive and contain MYC G4 can be measured.
The More Potent Anticancer Indenoisoquinolines Show Strong MYC Suppression (FIG. 10)
[0113] MCF7 is a MYC-positive breast cancer cell line that contains MYC G4. This cell line was used to examine the activities of indenoisoquinolines and dual targeting of MYC and topoisomerase I. Using protein quantification of western blot combined with the high throughput ELISA, in-cell western blot performed in 96-well microplates allow for the assessment of protein expression levels of interest upon drug treatments. We used 96-well in-cell western blot to examine the levels of MYC and phosphorylated form of H2AX (γ-H2AX), a biomarker of DNA double-strand break, upon the treatment with indenoisoquinolines. It was found that potent anticancer G4-interactive indenoisoquinolines significantly decreased the MYC protein expression levels (top panel). In the meantime, active indenoisoquinolines induced the phosphorylated form of H2AX (γ-H2AX) (bottom panel). Therefore, the results show potent anticancer indenoisoquinolines correlate with strong MYC suppression and dual-targeting of topoisomerase I. These results demonstrate strong MYC-suppression of G4-interactive indenoisoquinolines may lead to more potent anticancer activity in MYC-positive cancers that contain MYC G4.
Materials and Methods
Sample Preparation.
[0114] Unlabeled DNA sequences used for NMR and competition fluorescence displacement assays were synthesized and purified using commercially available reagents as previously described..sup.48, 64 The sequences are listed in Table 1. 3′-6-Carboxytetramethylrhodamine (3′-TAMRA)-labeled MycPu22 and 3′-TAMRA, 5′-6-carboxyfluorescein (5′-FAM) dual-labeled MycPu22 DNA sequences were obtained from Sigma-Aldrich. 3′-FAM, 5′-Black Hole Quencher-1 (5′-BHQ1) dual-labeled MycPu28 DNA sequence was synthesized using an Expedite 8909 DNA Synthesizer, with 3′-(6-FAM) CPG (20-2961-xx) and BHQ-1 phosphoramidite (10-5931-xx) obtained from Glen Research Corporation. The synthesized 5′-BHQ1-MycPu28-FAM-3′ DNA sequence was purified using MicroPure II columns and dialyzed against water before lyophilization. DNA concentrations were quantified by UV/Vis absorption at 260 nm using their extinction coefficients. Calf thymus DNA was purchased from Sigma-Aldrich. Indenoisoquinoline stock solutions were dissolved in DMSO at 40 mM by quantifying the mass. For all experiments, indenoisoquinoline stock solutions were further diluted with DMSO or desired buffers.
Fluorescence Resonance Energy Transfer (FRET) Experiments.
[0115] FRET-quenching experiments. The stock solution containing 100 μM 3′-FAM (Ex. 490 nm/Em. 520 nm), 5′-BHQ1 (Abs. 480-580 nm) dual-labeled MycPu28 DNA sequence was first diluted to 2 μM using 50 mM Tris.acetate buffer, pH 7.0. The 2 μM probe solution was equilibrated for 1 h at room temperature. Subsequently, the FRET probe (1 μM) was incubated with the indenoisoquinolines (10 μM) or KCl (100 mM) in 50 mM Tris.acetate buffer at pH 7.0 for another 1 h, using a black 96-well plate (ThermoFisher Scientific) with a total volume of 100 in each well. Fluorescence measurements were then recorded by a Synergy Neo2 plater reader (Bio Tek) at 25° C. with 10 nm bandwidth. The excitation and emission wavelengths were set to 490 and 520 nm, respectively. The final fluorescence intensity was plotted as the average relative fluorescence intensity of two individual experiments after correction for background. Relative fluorescence intensity (%)=F.sub.Compound/F.sub.DMSO×100%. Relative fluorescence reduction (%)=(1−F.sub.Compound/F.sub.DMSO)×100%.
[0116] FRET-melting experiments. The stock solution containing 100 μM 3′-TAMRA (Ex. 555 nm/Em. 580 nm), 5′-FAM (Ex. 490 nm/Em. 520 nm) dual-labeled MycPu22 DNA sequence was first diluted to 2 μM using 7.5 mM KCl, 2.5 mM phosphate buffer, pH 7.0. The 2 μM probe solution was heated to 95° C. for 1 min then cooled down slowly to room temperature for G4 formation. Subsequently, the FRET probe (150 nM) was incubated with the indenoisoquinolines (1.5 μM) in 7.5 mM KCl, 2.5 mM phosphate buffer at pH 7.0 for 1 h, using a blank 96-well plate (ThermoFisher Scientific) with a total volume of 100 μL for each well. In the presence of 10 mM K.sup.+, the labeled MycPu22 is mainly present in a G4 form where the FAM is in close proximity to the TAMRA, which shows a low FAM fluorescence due to the FRET effect. With gradually increasing temperature, the MycPu22 DNA is unfolded from the G4 form to a single-stranded conformation where the FAM is far apart to the TAMRA, which results in a high FAM fluorescence. Melting curves for the determination of T.sub.m were then obtained by recording FAM fluorescence with increasing temperatures from 25 to 95° C. at a rate of 0.9° C./min using a QuantStudio 6 Flex Real-Time PCR System. The T.sub.m values were determined by the maximum of the first derivative plot of the melting curves. The final T.sub.m values were plotted as the average T.sub.m values of two individual experiments.
Cell Culture.
[0117] MCF-7 (Michigan Cancer Foundation-7) cancer cell lines were originally obtained from the Arizona Cancer Center and grown in RMPI 1640 (10-040-CV, Corning) supplemented with 10% fetal bovine serum (35-010-CV, Corning). Cells were incubated at 37° C. with 5% CO.sub.2.
Western Blotting.
[0118] After collecting cells from 6-well plates, the cell pellets were re-suspended in 150 μL of 1×RIPA buffer supplemented with 1× Protease Inhibitor Cocktail (11836153001, Roche) and 1× NuPAGE LDS Sample Buffer (NP0007, Invitrogen) and then proteins were immediately denatured at 80° C. for 10 min. After sonication, 7 μL of each sample was analyzed using 4-15% Mini-PROTEAN TGX Gels (456-1086, Bio-Rad). The gels were cut into strips that contained the proteins of interest and transferred to nitrocellulose membrane (I323002, Invitrogen) using an iBlot 2 Dry Transfer Device (Invitrogen). Immunoblotting was carried out according to standard procedures using the ECL detection method. The membrane was hybridized with the following antibodies: monoclonal anti-MYC (1:1000 dilution; rabbit, Cell Signaling Technology), monoclonal anti-GAPDH (1:2000 dilution; rabbit, Cell Signaling Technology).
NCI-60 Cancer Cell Line Drug Screen.
[0119] The antiproliferative activities of the indenoisoquinoline compounds were determined in the NCI-60 cancer cell lines of the National Cancer Institute Developmental Therapeutics Program (NCI-DTP) (Table 3)..sup.53-55 Compounds showed sufficient cytotoxicity during the pre-screen were subjected to the five-dose assay to determine the 50% growth inhibition (GI.sub.50) values. Cancer cells were incubated with the test compounds at five concentrations ranging from 100 μM to 10 nM for 48 h. After the treated cancer cells had been stained with sulforhodamine B dye, the percentage growth was plotted as a function of the common logarithm of the tested compound concentration. The GI.sub.50 values were determined by interpolation between the points located above and below the 50% cell growth. GI.sub.50 values above and below the tested range (10.sup.−4 to 10.sup.−8 M) were taken as the maximum (10.sup.−4 M) and minimum (10.sup.−8 M) drug concentrations, respectively, used in the screening test. The approximate average of GI.sub.50 values across the entire panel of NCI-60 cancer cell lines for each compound was recorded as the MGM value.
Quantitative Reverse Transcription PCR (QRT-PCR).
[0120] Total RNA was isolated using TRIzol reagent (Invitrogen). To remove phenol contamination, purified RNA was dissolved in DEPC-treated water and re-precipitated with 75% ethanol. RNA (1 μg) was subjected to cDNA synthesis using the qScript cDNA Synthesis kit (Quanta Biosciences) according to manufacturer's instructions. Real-time PCR was performed in triplicate reactions. For each reaction, a mix of the following reaction components was prepared to the indicated end-concentration: 3 μl water, 1 μl cDNA synthesis products, 0.25 μM of each primer for MYC or GAPDH and 5 μl of SYBR Green PCR Master Mix. Cycling conditions were 95° C. for 5 min, followed by 40 cycles of 95° C. for 15 s, 60° C. for 15 s and 72° C. for 15 s. Relative gene expression was calculated by using the 2.sup.−ΔΔCT, in which the amount of MYC mRNA was normalized to an endogenous reference (GAPDH). Melting curve analysis or agarose gel electrophoresis was carried out to confirm correct PCR products.
Nuclear Magnetic Resonance (NMR) Spectroscopy Experiments.
[0121] All NMR experiments were conducted using a Bruker AV-500 spectrometer equipped with a Prodigy cryoprobe at 25° C. Watergate water suppression technique was used to suppress water signals. Briefly, each DNA sample was prepared to a final concentration of 150 oligonucleotide in 75 mM KCl, 25 mM phosphate buffer at pH 7.0, and containing 90/10% H.sub.2O/D.sub.2O. DNA samples were heated to 95° C. for 5 min then cooled slowly to room temperature for G4 formation. .sup.1H-NMR titrations were performed by adding increasing amounts of the compound (0.5 to 4 equivalents) to the oligonucleotide solution.
Native Gel Electrophoretic Mobility Shift Assay (EMSA).
[0122] Native PAGE experiments were performed with a 1.5 mm thick 10×7 cm native gel containing 15% acrylamide (acrylamide:bisacrylamide 29:1) in 1×TBE buffer, pH 8.0, supplemented with 12.5 mM KCl. MycG4 DNA samples were the samples from NMR titration experiments in the absence and presence of indenoisoquinolines. Each sample contains 4 μL of 150 μM DNA. DNA bands were visualized using ultraviolet (UV) light absorption at 260 nm.
Circular Dichroism (CD) Spectroscopy Experiments.
[0123] Circular dichroism spectra were recorded using a Jasco-1100 spectropolarimeter (Jasco Inc.) equipped with a temperature controller. Samples were prepared in 3.8 mM KCl, 1.2 mM phosphate buffer at a DNA concentration of 15 μM in the absence and presence of the indenoisoquinolines. CD measurements were taken through a quartz cell with a 1 mm path length, 1 nm bandwidth, and 1 s response time for spectra at 25° C. Spectra were obtained using three averaged scans between 230 and 330 nm. The baseline was corrected by subtracting the buffer spectrum.
Fluorescence-Based Binding Assay.
[0124] The fluorescence-based binding assay was performed on a Jasco FP-8300 spectrofluorometer equipped with a temperature controller at 20° C. The stock solution containing 2 μM 3′-TAMRA labelled MycPu22 oligonucleotide was diluted to 0.5 nM using 75 mM KCl, 25 mM phosphate buffer, pH 7.0. To check the binding affinity of each indenoisoquinoline to MycG4 DNA, the compound was gradually added to the DNA solution in a volume of 1.6 mL using a quartz cell with a 10 mm path length. After each addition of the compound, the solution was allowed to equilibrate for at least 2 min. The fluorescence spectrum was recorded at a range from 570 to 600 nm with an excitation wavelength of 555 nm, 10 nm bandwidths, 100 nm/min scan speed, and 1 s response time. The fluorescence intensity at the emission maximum (λ.sub.max=580 nm) was used in all calculations. The apparent binding affinity K.sub.d values were determined by fitting the data to a one site-specific binding model using GraphPad Prism software, with a simplified equation of
where ΔF represents the fluorescence intensity change of the indenoisoquinolines bound to MycPu22 DNA and [L].sub.T represents the total ligand concentration that is the independent variable, varying with each measurement.
Competition Fluorescence Displacement Experiments.
[0125] The competition fluorescence displacement experiments were performed on a Jasco FP-8300 Spectrofluorometer equipped with a temperature controller at 20° C. The stock solution containing 2 μM 3′-TAMRA-labelled MycPu22 oligonucleotide was diluted to 20 nM using 75 mM KCl, 25 mM phosphate buffer at pH 7.0. To check the binding selectivity of each compound to MycG4 DNA, 20 nM or 100 nM of the indenoisoquinoline was added to the DNA solution in a total volume of 1.6 mL in a quartz cell with a 10 mm path length. Subsequently, various unlabeled MycG4s (MycPu22 and MycPu28), K-Ras G4, telomeric G4 DNAs, or calf thymus dsDNA were gradually added to the complex solution. For each addition of the DNA, the sample was equilibrated at least 2 min. The fluorescence spectrum was recorded between 570 and 600 nm with an excitation wavelength of 555 nm, 10 nm bandwidths, 100 nm/min of scan speed, and 1 s of response time. The fluorescence intensities at the emission maximum (Δ.sub.max=580 nm) were plotted for figures. The competitor binding affinities (K, values) were calculated by
using data from 20 nM compound. The C.sub.50 value was the concentration of the unlabeled competing DNA that recovers the fluorescence of the labelled DNA by 50%. [L] represents the ligand concentration that is a constant value of 20 nM. K.sub.d,app values were obtained by fluorescence-based binding assay.
Molecular Modeling
[0126] The binding sites at the two ends of the MycG4 were defined by using the NMR structure of the 2:1 quindoline:MycG4 complex (PDB ID 2L7V)..sup.48 The docking program Glide (Schrödinger Inc.) was used in the standard precision (SP)..sup.60-61 During docking, the DNA was fixed while the ligand was flexible. Before running docking, the 3D energy-minimized structure of the ligand was generated using the LigPrep from Maestro (Schrödinger Inc.). The protonation state of the ligand was assigned at pH 7.0 using the program Epik (Schrödinger Inc.)..sup.65 The following default settings in the Glide protocol were used for docking: the OPLS3 force field was used to describe the DNA-ligand complex and a distance-dependent dielectric constant ε=2.0 was used to mimic the solvent effect..sup.66 A maximum of 5000 poses passed through the initial phase of docking, and a maximum of 400 best poses were kept for energy minimization. The maximum number of the minimization steps was set to be 100.
[0127] Those skilled in the art will recognize that numerous modifications can be made to the specific implementations described above. The implementations should not be limited to the particular limitations described. Other implementations may be possible.
[0128] While the inventions have been illustrated and described in detail in the drawings and foregoing description, the same is to be considered as illustrative and not restrictive in character, it being understood that only certain embodiments have been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected.
[0129] It is intended that that the scope of the present methods and compositions be defined by the following claims. However, it must be understood that this disclosure may be practiced otherwise than is specifically explained and illustrated without departing from its spirit or scope. It should be understood by those skilled in the art that various alternatives to the embodiments described herein may be employed in practicing the claims without departing from the spirit and scope as defined in the following claims.
REFERENCES
[0130] 1. Kohlhagen, G.; Paull, K. D.; Cushman, M.; Nagafuji, P.; Pommier, Y., Protein-linked DNA strand breaks induced by NSC 314622, a novel noncamptothecin topoisomerase I poison. Mol. Pharmacol. 1998, 54 (1), 50-58. [0131] 2. Strumberg, D.; Pommier, Y.; Paull, K.; Jayaraman, M.; Nagafuji, P.; Cushman, M., Synthesis of cytotoxic indenoisoquinoline topoisomerase I poisons. Synthesis of cytotoxic indenoisoquinoline topoisomerase I poisons. J. Med. Chem. 1999, 42 (3), 446-457. [0132] 3. Cushman, M.; Jayaraman, M.; Vroman, J. A.; Fukunaga, A. K.; Fox, B. M.; Kohlhagen, G.; Strumberg, D.; Pommier, Y., Synthesis of new indeno [1, 2-c] isoquinolines: cytotoxic non-camptothecin topoisomerase I inhibitors. J. Med. Chem. 2000, 43 (20), 3688-3698. [0133] 4. Pommier, Y.; Sun, Y.; Shar-yin, N. H.; Nitiss, J. L., Roles of eukaryotic topoisomerases in transcription, replication and genomic stability. Nat. Rev. Mol. Cell. Biol. 2016, 17 (11), 703-721. [0134] 5. Pommier, Y., DNA topoisomerase I inhibitors: chemistry, biology, and interfacial inhibition. Chem. Rev. 2009, 109 (7), 2894-2902. [0135] 6. Wang, P.; Elsayed, M. S. A.; Plescia, C. B.; Ravji, A.; Redon, C. E.; Kiselev, E.; Marchand, C.; Zeleznik, O.; Agama, K.; Pommier, Y.; Cushman, M., Synthesis and biological evaluation of the first triple inhibitors of human topoisomerase I, tyrosyl-DNA phosphodiesterase 1 (Tdp1), and tyrosyl-DNA phosphodiesterase 2 (Tdp2). J. Med. Chem. 2017, 60 (8), 3275-3288. [0136] 7. Elsayed, M. S. A.; Su, Y.; Wang, P.; Sethi, T.; Agama, K.; Ravji, A.; Redon, C. E.; Kiselev, E.; Horzmann, K. A.; Freeman, J. L.; Pommier, Y.; Cushman, M., Design and synthesis of chlorinated and fluorinated 7-azaindenoisoquinolines as potent cytotoxic anticancer agents that inhibit topoisomerase I. J. Med. Chem. 2017, 60 (13), 5364-5376. [0137] 8. Cinelli, M. A.; Reddy, P. V.; Lv, P. C.; Liang, J. H.; Chen, L.; Agama, K.; Pommier, Y.; van Breemen, R. B.; Cushman, M., Identification, synthesis, and biological evaluation of metabolites of the experimental cancer treatment drugs indotecan (LMP400) and indimitecan (LMP776) and investigation of isomerically hydroxylated indenoisoquinoline analogues as topoisomerase I poisons. J. Med Chem. 2012, 55 (24), 10844-10862. [0138] 9. Nagarajan, M.; Morrell, A.; Ioanoviciu, A.; Antony, S.; Kohlhagen, G.; Agama, K.; Hollingshead, M.; Pommier, Y.; Cushman, M., Synthesis and evaluation of indenoisoquinoline topoisomerase I inhibitors substituted with nitrogen heterocycles. J. Med Chem. 2006, 49 (21), 6283-6289. [0139] 10. Doroshow, J. H.; Ji, J. J.; Chen, A.; Allen, D.; Zhang, Y.; Lawrence, S. M.; Pfister, T. D.; Wang, L.; Redon, C. E.; Bonner, W.; Speranza, G.; Weil, M. K.; Eiseman, J.; Holleran, J. L.; Kinders, R. J.; Beumer, J. H.; Parchment, R. E.; Pommier, Y.; Tomaszewski, J. E.; Kummar, S., Proof of mechanism (POM) in the first-in-human trial of two novel indenoisoquinoline, non-camptothecin topoisomerase I (TOP1) inhibitors. J. Clin. Oncol. 2012, 30 (15 suppl), 3031-3031. [0140] 11. Kummar, S.; Chen, A.; Gutierrez, M.; Pfister, T. D.; Wang, L.; Redon, C.; Bonner, W. M.; Yutzy, W.; Zhang, Y.; Kinders, R. J., Clinical and pharmacologic evaluation of two dosing schedules of indotecan (LMP400), a novel indenoisoquinoline, in patients with advanced solid tumors. Cancer Chemother. Pharmacol. 2016, 78 (1), 73-81. [0141] 12. Coyne, G. H. O. S.; Kummar, S.; Meehan, R. S.; Streicher, H.; Takebe, N.; Sharon, E.; Conley, B. A.; Harris, L.; Collins, J. M.; Moore, N.; Juwara, L.; Rubinstein, L.; Quinn, M. F.; Pommier, Y.; Cushman, M.; Doroshow, J. H.; Chen, A. P., Phase I study of indenoisoquinolines LMP776 in adults with relapsed solid tumors and lymphomas. J. Clin. Oncol. 2017, 35 (15 suppl), 2558-2558. [0142] 13. A phase I study of indenoisoquinolines LMP400 and LMP776 in adults with relapsed solid tumors and lymphomas. https://clinicaltrials.govict2/show/NCT01051635 (Accessed Apr. 20, 2019). [0143] 14. Indenoisoquinoline LMP744 in adults with relapsed solid tumors and lymphomas. https://clinicaltrials.govict2/show/NCT03030417 (accessed Apr. 20, 2019). [0144] 15. Nagarajan, M.; Morrell, A.; Fort, B. C.; Meckley, M. R.; Antony, S.; Kohlhagen, G.; Pommier, Y.; Cushman, M., Synthesis and anticancer activity of simplified indenoisoquinoline topoisomerase I inhibitors lacking substituents on the aromatic rings. J. Med. Chem. 2004, 47 (23), 5651-5661. [0145] 16. Pommier, Y.; Cushman, M., The indenoisoquinoline noncamptothecin topoisomerase I inhibitors: update and perspectives. Mol. Cancer. Ther. 2009, 8 (5), 1008-1014. [0146] 17. Bejugam, M.; Gunaratnam, M.; Müller, S.; Sanders, D. A.; Sewitz, S.; Fletcher, J. A.; Neidle, S.; Balasubramanian, S., Targeting the c-Kit promoter G-quadruplexes with 6-substituted indenoisoquinolines. ACS Med. Chem. Lett. 2010, 1 (7), 306-310. [0147] 18. Slack, G. W.; Gascoyne, R. D., MYC and aggressive B-cell lymphomas. Adv. Anat. Pathol. 2011, 18 (3), 219-228. [0148] 19. Nesbit, C. E.; Tersak, J. M.; Prochownik, E. V., MYC oncogenes and human neoplastic disease. Oncogene 1999, 18 (19), 3004-3016. [0149] 20. Dang, C. V., MYC on the path to cancer. Cell 2012, 149 (1), 22-35. [0150] 21. Bouvard, C.; Lim, S. M.; Ludka, J.; Yazdani, N.; Woods, A. K.; Chatterjee, A. K.; Schultz, [0151] P. G.; Zhu, S., Small molecule selectively suppresses MYC transcription in cancer cells. Proc. Natl. Acad. Sci. U.S.A 2017, 114 (13), 3497-3502. [0152] 22. Adhikary, S.; Eilers, M., Transcriptional regulation and transformation by MYC proteins. Nat. Rev. Mol. Cell. Biol. 2005, 6 (8), 635-645. [0153] 23. Meyer, N.; Penn, L. Z., Reflecting on 25 years with MYC. Nat. Rev. Cancer 2008, 8 (12), 976-990. [0154] 24. Dang, C. V., c-MYC target genes involved in cell growth, apoptosis, and metabolism. Mol. Cell. Biol. 1999, 19 (1), 1-11. [0155] 25. Lin, C. Y.; Lovén, J.; Rahl, P. B.; Paranal, R. M.; Burge, C. B.; Bradner, J. E.; Lee, T. I.; Young, R. A., Transcriptional amplification in tumor cells with elevated c-MYC. Cell 2012, 151 (1), 56-67. [0156] 26. Nie, Z.; Hu, G.; Wei, G.; Cui, K.; Yamane, A.; Resch, W.; Wang, R.; Green, D. R.; Tessarollo, L.; Casellas, R.; Zhao, K.; Levens, D., c-MYC is a universal amplifier of expressed genes in lymphocytes and embryonic stem cells. Cell 2012, 151 (1), 68-79. [0157] 27. Jain, M.; Arvanitis, C.; Chu, K.; Dewey, W.; Leonhardt, E.; Trinh, M.; Sundberg, C. D.; Bishop, J. M.; Felsher, D. W., Sustained loss of a neoplastic phenotype by brief inactivation of MYC. Science 2002, 297 (5578), 102-104. [0158] 28. Weinstein, I. B.; Joe, A. K., Mechanisms of disease: Oncogene addiction—a rationale for molecular targeting in cancer therapy. Nat. Clin. Pract. Oncol. 2006, 3 (8), 448-457. [0159] 29. Dang, C. V.; Reddy, E. P.; Shokat, K. M.; Soucek, L., Drugging the ‘undruggable’ cancer targets. Nat. Rev. Cancer 2017, 17 (8), 502-508. [0160] 30. Felsenstein, K. M.; Saunders, L. B.; Simmons, J. K.; Leon, E.; Calabrese, D. R.; Zhang, [0161] S.; Michalowski, A.; Gareiss, P.; Mock, B. A.; Schneekloth, J. S., Jr., Small molecule microarrays enable the identification of a selective, quadruplex-binding inhibitor of MYC expression. ACS Chem. Biol. 2016, 11 (1), 139-148. [0162] 31. Whitfield, J. R.; Beaulieu, M. E.; Soucek, L., Strategies to inhibit MYC and their clinical applicability. Front. Cell Dev. Biol. 2017, 5, 1-13. [0163] 32. Siddiqui-Jain, A.; Grand, C. L.; Bearss, D. J.; Hurley, L. H., Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription. Proc. Natl. Acad. Sci. U.S.A 2002, 99 (18), 11593-11598. [0164] 33. Brooks, T. A.; Hurley, L. H., The role of supercoiling in transcriptional control of MYC and its importance in molecular therapeutics. Nat. Rev. Cancer 2009, 9 (12), 849-861. [0165] 34. Brown, R. V.; Danford, F. L.; Gokhale, V.; Hurley, L. H.; Brooks, T. A., Demonstration that drug-targeted downregulation of MYC in non-hodgkins lymphoma is directly mediated through the promoter G-quadruplex. J. Biol. Chem. 2011, 286 (47), 41018-41027. [0166] 35. Kouzine, F.; Sanford, S.; Elisha-Feil, Z.; Levens, D., The functional response of upstream DNA to dynamic supercoiling in vivo. Nat. Struct. Mol. Biol. 2008, 15 (2), 146-154. [0167] 36. Kang, H. J.; Park, H. J., Novel molecular mechanism for Actinomycin D activity as an oncogenic promoter G-quadruplex binder. Biochemistry 2009, 48 (31), 7392-7398. [0168] 37. Yang, D.; Okamoto, K., Structural insights into G-quadruplexes: towards new anticancer drugs. Future Med Chem. 2010, 2 (4), 619-646. [0169] 38. Qin, Y.; Hurley, L. H., Structures, folding patterns, and functions of intramolecular DNA G-quadruplexes found in eukaryotic promoter regions. Biochimie 2008, 90 (8), 1149-1171. [0170] 39. Chen, Y.; Yang, D., Sequence, stability, and structure of G-quadruplexes and their interactions with drugs. Curr. Protoc. Nucleic Acid Chem. 2012, Chapter 17, Unit17 5. [0171] 40. Balasubramanian, S.; Hurley, L. H.; Neidle, S., Targeting G-quadruplexes in gene promoters: a novel anticancer strategy? Nat. Rev. Drug Discov. 2011, 10 (4), 261-275. [0172] 41. Biffi, G.; Tannahill, D.; McCafferty, J.; Balasubramanian, S., Quantitative visualization of DNA G-quadruplex structures in human cells. Nat. Chem. 2013, 5 (3), 182-186. [0173] 42. Hansel-Hertsch, R.; Beraldi, D.; Lensing, S. V.; Marsico, G.; Zyner, K.; Parry, A.; Di Antonio, M.; Pike, J.; Kimura, H.; Narita, M.; Tannahill, D.; Balasubramanian, S., G-quadruplex structures mark human regulatory chromatin. Nat. Genet. 2016, 48 (10), 1267-1275. [0174] 43. Ambrus, A.; Chen, D.; Dai, J.; Jones, R. A.; Yang, D., Solution structure of the biologically relevant G-quadruplex element in the human c-MYC promoter. Biochemistry 2005, 44 (6), 2048-2058. [0175] 44. Mathad, R. I.; Hatzakis, E.; Dai, J.; Yang, D., c-MYC promoter G-quadruplex formed at the 5′-end of NHE III1 element: insights into biological relevance and parallel-stranded G-quadruplex stability. Nucleic Acids Res. 2011, 39 (20), 9023-9033. [0176] 45. Seenisamy, J.; Rezler, E. M.; Powell, T. J.; Tye, D.; Gokhale, V.; Joshi, C. S.; Siddiqui-Jain, A.; Hurley, L. H., The dynamic character of the G-quadruplex element in the c-MYC promoter and modification by TMPyP4. J. Am. Chem. Soc. 2004, 126 (28), 8702-8709. [0177] 46. Ou, T. M.; Lu, Y. J.; Zhang, C.; Huang, Z. S.; Wang, X. D.; Tan, J. H.; Chen, Y.; Ma, D. L.; Wong, K. Y.; Tang, J. C.; Chan, A. S.; Gu, L. Q., Stabilization of G-quadruplex DNA and down-regulation of oncogene c-MYC by quindoline derivatives. J. Med. Chem. 2007, 50 (7), 1465-1474. [0178] 47. Ou, T. M.; Lin, J.; Lu, Y. J.; Hou, J. Q.; Tan, J. H.; Chen, S. H.; Li, Z.; Li, Y. P.; Li, D.; Gu, L. Q., Inhibition of cell proliferation by quindoline derivative (SYUIQ-05) through its preferential interaction with c-MYC promoter G-quadruplex. J. Med. Chem. 2011, 54 (16), 5671-5679. [0179] 48. Dai, J.; Carver, M.; Hurley, L. H.; Yang, D., Solution structure of a 2:1 quindoline-c-MYC G-quadruplex: insights into G-quadruplex-interactive small molecule drug design. J. Am. Chem. Soc. 2011, 133 (44), 17673-17680. [0180] 49. Hatzakis, E.; Okamoto, K.; Yang, D., Thermodynamic stability and folding kinetics of the major G-quadruplex and its loop isomers formed in the nuclease hypersensitive element in the human c-MYC promoter: effect of loops and flanking segments on the stability of parallel-stranded intramolecular G-quadruplexes. Biochemistry 2010, 49 (43), 9152-9160. [0181] 50. Morrell, A.; Placzek, M.; Parmley, S.; Antony, S.; Dexheimer, T. S.; Pommier, Y.; Cushman, M., Nitrated indenoisoquinolines as topoisomerase I inhibitors: a systematic study and optimization. J. Med. Chem. 2007, 50 (18), 4419-4430. [0182] 51. Conda-Sheridan, M.; Reddy, P. N.; Morrell, A.; Cobb, B. T.; Marchand, C.; Agama, K.; Chergui, A.; Renaud, A.; Stephen, A. G.; Bindu, L. K., Synthesis and biological evaluation of indenoisoquinolines that inhibit both tyrosyl-DNA phosphodiesterase I (Tdp1) and topoisomerase I (Top1). 1 Med. Chem. 2012, 56 (1), 182-200. [0183] 52. Beck, D. E.; Agama, K.; Marchand, C.; Chergui, A.; Pommier, Y.; Cushman, M., Synthesis and biological evaluation of new carbohydrate-substituted indenoisoquinoline topoisomerase I inhibitors and improved syntheses of the experimental anticancer agents indotecan (LMP400) and indimitecan (LMP776). J. Med. Chem. 2014, 57 (4), 1495-1512. [0184] 53. NCI-60 human tumor cell lines screen. https://dtp.cancer.gov/discovery_development/nci-60/(accessed Apr. 20, 2019). [0185] 54. Kiselev, E.; Sooryakumar, D.; Agama, K.; Cushman, M.; Pommier, Y., Optimization of the lactam side chain of 7-azaindenoisoquinoline topoisomerase I inhibitors and mechanism of action studies in cancer cells. J. Med Chem. 2014, 57 (4), 1289-1298. [0186] 55. Shoemaker, R. H., The NCI60 human tumour cell line anticancer drug screen. Nat. Rev. Cancer 2006, 6 (10), 813. [0187] 56. Kotar, A.; Wang, B.; Shivalingam, A.; Gonzalez-Garcia, J.; Vilar, R.; Plavec, J., NMR structure of a triangulenium-based long-lived fluorescence probe bound to a G-quadruplex. Angew. Chem., Int. Ed. 2016, 55 (40), 12508-12511. [0188] 57. Del Villar-Guerra, R.; Trent, J. O.; Chaires, J. B., G-quadruplex secondary structure obtained from circular dichroism spectroscopy. Angew. Chem., Int. Ed. 2018, 130 (24), 7289-7293. [0189] 58. Brown, R. V.; Wang, T.; Chappeta, V. R.; Wu, G.; Onel, B.; Chawla, R.; Quijada, H.; Camp, S. M.; Chiang, E. T.; Lassiter, Q. R., The consequences of overlapping G-Quadruplexes and i-Motifs in the platelet-derived growth factor receptor β core promoter nuclease hypersensitive element can explain the unexpected effects of mutations and provide opportunities for selective targeting of both structures by small molecules to downregulate gene expression. J. Am. Chem. Soc. 2017, 139 (22), 7456-7475. [0190] 59. Le, D. D.; Di Antonio, M.; Chan, L.; Balasubramanian, S., G-quadruplex ligands exhibit differential G-tetrad selectivity. Chem. Commun. 2015, 51 (38), 8048-8050. [0191] 60. Friesner, R. A.; Banks, J. L.; Murphy, R. B.; Halgren, T. A.; Klicic, J. J.; Mainz, D. T.; Repasky, M. P.; Knoll, E. H.; Shelley, M.; Perry, J. K., Glide: a new approach for rapid, accurate docking and scoring. 1. Method and assessment of docking accuracy. J. Med. Chem. 2004, 47 (7), 1739-1749. [0192] 61. Halgren, T. A.; Murphy, R. B.; Friesner, R. A.; Beard, H. S.; Frye, L. L.; Pollard, W. T.; Banks, J. L., Glide: a new approach for rapid, accurate docking and scoring. 2. Enrichment factors in database screening. J. Med. Chem. 2004, 47 (7), 1750-1759. [0193] 62. Kiselev, E.; DeGuire, S.; Morrell, A.; Agama, K.; Dexheimer, T. S.; Pommier, Y.; Cushman, M., 7-azaindenoisoquinolines as topoisomerase I inhibitors and potential anticancer agents. J. Med. Chem. 2011, 54 (17), 6106-6116. [0194] 63. Kiselev, E.; Agama, K.; Pommier, Y.; Cushman, M., Azaindenoisoquinolines as Topoisomerase I Inhibitors and Potential Anticancer Agents: A Systematic Study of Structure—Activity Relationships. J. Med. Chem. 2012, 55 (4), 1682-1697. [0195] 64. Onel, B.; Carver, M.; Wu, G.; Timonina, D.; Kalarn, S.; Larriva, M.; Yang, D., A new G-quadruplex with hairpin loop immediately upstream of the human BCL2 P1 promoter modulates transcription. J. Am. Chem. Soc. 2016, 138 (8), 2563-2570. [0196] 65. Shelley, J. C.; Cholleti, A.; Frye, L. L.; Greenwood, J. R.; Timlin, M. R.; Uchimaya, M., Epik: a software program for pK a prediction and protonation state generation for drug-like molecules. J. Computer Aid. Mol. Des. 2007, 21 (12), 681-691. [0197] 66. Harder, E.; Damm, W.; Maple, J.; Wu, C.; Reboul, M.; Xiang, J. Y.; Wang, L.; Lupyan, D.; Dahlgren, M. K.; Knight, J. L., OPLS3: a force field providing broad coverage of drug-like small molecules and proteins. J. Chem. Theory Comput. 2015, 12 (1), 281-296. [0198] 67. Calabrese, D. R.; Chen, X.; Leon, E. C.; Gaikwad, S. M.; Phyo, Z.; Hewitt, W. M.; Alden, S.; Hilimire, T. A.; He, F.; Michalowski, A. M.; Simmons, J. K.; Saunders, L. B.; Zhang, S.; Connors, D.; Walters, K. J.; Mock, B. A.; Schneekloth, J. S., Jr., Chemical and structural studies provide a mechanistic basis for recognition. Nat Commun 2018, 9 (1), 4229.