REGULATING MUSCLE PHYSIOLOGY AND ENERGY METABOLISM USING CRYM
20210379148 · 2021-12-09
Inventors
- Christian Kinney (Marietta, GA, US)
- Robert J. Bloch (Baltimore, MD)
- John McLenithan (Baltimore, MD, US)
- Kaila Noland (Baltimore, MD, US)
- Andrea O'Neill (Towson, MD, US)
Cpc classification
A61K31/167
HUMAN NECESSITIES
A61K31/565
HUMAN NECESSITIES
A61K31/568
HUMAN NECESSITIES
International classification
A61K31/167
HUMAN NECESSITIES
A61K31/565
HUMAN NECESSITIES
Abstract
Transgenic mice (Crym tg) overexpressing Crym protein in skeletal muscle were studied. Muscular functions, Ca.sup.2+ transients, contractile force, fatigue, and running on treadmills or wheels were not significantly altered and serum T.sub.3 and thyroid stimulating hormone levels were unaffected although T.sub.3 levels in tibialis anterior (TA) muscle were elevated and serum T.sub.4 was decreased. Crym tg mice had a decreased respiratory exchange ratio, corresponding to a 13.7% increase in fat utilization. Female Crym tg mice gained weight more rapidly than controls on high fat or high simple carbohydrate diets. Machine learning algorithms revealed morphological differences between Crym tg and control soleus fibers. RNA-seq and gene ontology enrichment analysis showed a shift towards genes associated with slower muscle function and β-oxidation. Therefore, high levels of μ-crystallin are associated with greater fat metabolism. These data indicate that Crym and μ-crystallin can be used as a treatment modality for diabetes and obesity.
Claims
1. A method of increasing expression of CRYM protein expression in a subject in need thereof, comprising administering a compound to the subject, wherein the compound is selected from the group consisting of (a) one or more chemical compounds that increases CRYM expression as described herein; and (b) a vector that expresses a CRYM protein.
2. A method of claim 1, wherein the vector comprises SEQ ID NO:2.
3. A method of claim 1, wherein the one or more chemical compounds that increase CRYM expression are selected from the group consisting of pentanal, tretinoin, fenretinide, estradiol 3-benzoate, dihydrotestosterone and any combination thereof.
4. A method of claim 1, wherein the subject in need suffers from a condition selected from the group consisting of a lipolytic disorder, a lipogenic disorder, a glycolytic disorder, a gluconeogenic disorder, type 2 diabetes, obesity, and a combination thereof.
5. A method of claim 4, wherein the subject suffers from obesity, type 2 diabetes, or a combination thereof.
6. A method of claim 1, wherein the administering is by intravenous, subcutaneous, or intramuscular injection.
7. A method of claim 1, wherein the administering is oral.
8. A method of shifting energy usage from glycolytic to oxidative pathways in muscle in a subject in need thereof, comprising administering a compound to the subject, wherein the compound is selected from the group consisting of (a) one or more chemical compounds that increases CRYM expression as described herein; and (b) an AAV vector that expresses a CRYM protein.
9. A method of treatment of obesity and type 2 diabetes in a subject in need thereof, comprising administering a compound to the subject, wherein the compound is selected from the group consisting of (a) one or more chemical compounds that increases CRYM expression as described herein; and (b) an AAV vector that expresses a CRYM protein.
Description
BRIEF SUMMARY OF THE DRAWINGS
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
DETAILED DESCRIPTION
1. Definitions
[0027] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although various methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. However, the skilled artisan understands that the methods and materials used and described are examples and may not be the only ones suitable for use in the invention. Moreover, as measurements are subject to inherent variability, any temperature, weight, volume, time interval, pH, salinity, molarity or molality, range, concentration and any other measurements, quantities or numerical expressions given herein are intended to be approximate and not exact or critical figures unless expressly stated to the contrary.
[0028] As used herein, the term “about” means plus or minus 20 percent of the recited value, so that, for example, “about 0.125” means 0.125±0.025, and “about 1.0” means 1.0±0.2.
[0029] As used herein, the term “subject” refers to any mammal. The terms “subject,” “individual,” “host,” and “patient,” are used interchangeably to refer to any animal, and can include simians, humans, felines, canines, equines, rodents, bovines, porcines, ovines, caprines, mammalian sport animals, and mammalian pets. A suitable subject for the invention preferably is a human that is suspected of having, has been diagnosed as having, or is at risk of developing a disease that can be ameliorated, treated or prevented by increasing CRYM in muscle. Particular preferred diseases and conditions include type 2 diabetes and obesity.
[0030] As used herein, the term “administer” and its cognates refers to introducing an agent to a subject, and can be performed using any of the various methods or delivery systems for administering agents, pharmaceutical compositions or delivering gene vectors known to those skilled in the art. Modes of administering include, but are not limited to oral administration or intravenous, subcutaneous, intramuscular or intraperitoneal injections, rectal administration by way of suppositories or enema, or local administration directly into or onto a target tissue (such as muscle), or administration by any route or method known in the art that delivers a therapeutically effective amount of the drug or composition to the cells or tissue to which it is targeted or systemically. Administration can refer to introducing the protein or, for example, a nucleic acid construct to the subject as DNA or mRNA, introducing a vector containing the nucleic acid to the subject, or introducing cells that have been transduced ex vivo with a construct, such as by electroporation or using a vector as described herein, to the subject.
[0031] As used herein, the terms “treatment,” “treating,” and the like, as used herein refer to obtaining a desired pharmacologic and/or physiologic effect. “Treatment,” includes: (a) preventing the condition or disease or symptom thereof from occurring in a subject which may be predisposed to the condition or disease but has not yet been diagnosed as having it; (b) inhibiting the condition or disease or symptom thereof, such as, arresting or slowing its development; and (c) relieving, alleviating or ameliorating the condition or disease or symptom thereof, such as, for example, causing regression of the condition or disease or symptom thereof.
[0032] As used herein, the term “pharmaceutical composition” refers to a composition that comprises an active agent, preferably μ-crystallin or a pro-drug thereof, in combination with a pharmaceutically acceptable carrier or excipient.
[0033] As used herein, the term “CRYM” refers to the protein product of the CRYM gene, which is also known as “μ-crystallin” or NADP-regulated thyroid-hormone binding protein (THBP).
2. Overview
[0034] A transgenic mouse that overexpressed CRYM at very high levels in muscle was produced and characterized. This mouse did have very high levels of CRYM protein in muscle, but not in other tissues. Consistent with this, muscles accumulated very high levels of T3 (thyroid hormone, triiodothyronine), with no significant changes in T4. Remarkably, serum T3 and TSH (thyroid stimulating hormone) also were unchanged. Studies of the transgenic mice in metabolic chambers indicated that they consumed the same number of calories daily as control mice, but that their energy utilization comes more from fats than from carbohydrates. RNA-seq studies showed that the muscles shift gene expression away from glycolytic metabolism and towards beta-oxidation. Consistent with this, the expression of many genes encoding contractile proteins in muscle tissue shifted from fast twitch to slow twitch or non-muscle isoforms. Thus, high levels of expression of CRYM in muscle modified energy metabolism and muscle fiber physiology.
[0035] Here we addressed the effects of high levels of Crym expression in mammalian muscle. We initially observed high levels of μ-crystallin in several muscle biopsies of patients with facioscapulohumeral muscular dystrophy (FSHD), a muscle wasting disease where patients progressively lose muscle. At the time, the cause of FSHD was unknown. Later studies showed that mRNA and protein both varied widely in expression in both healthy and diseased muscle, however, and it is now widely accepted that the protein DUX4 is the primary pathogen in FSHD. DUX4 is a transcription factor that activates CRYM expression. Thus, increases in CRYM may perturb muscle metabolism and contribute to pathology. Unusually, high levels of CRYM in skeletal muscle create conditions of mild hyperthyroidism in the muscle, including a significant shift in energy usage linked to changes in gene expression, without causing any obvious side effects normally associated with hyperthyroidism.
[0036] To examine the differences in metabolism linked to high vs. low levels of Crym expression, a transgenic mouse (Crym tg) that overexpresses μ-crystallin was produced. The Crym tg mice express the protein under the control of the human skeletal actin promoter (ACTA1) and the human slow troponin I enhancer (TNNI1) to enable skeletal muscle-specific expression. The physiologic, metabolic, and transcriptomic effects of overexpression of μ-crystallin on the function of muscle was investigated.
[0037] Significantly enriched ontological terms were seen in studies of 85 differentially expressed protein with the PANTHER Classification System. Only 7 ontological terms were significant, but of those 7 terms four involve muscle and one term, oxidation-reduction process, is metabolically related. Taken together, these terms are similar to the types of terms found via transcriptomic GO analysis.
[0038] These genes were used as a putative list of T3/T4 involved genes. Of the significant differentially expressed genes (DEGs) discovered by RNA-seq comparing Crym tg mice to controls, 211 of the 566 genes had putative T3/T4 involvement. Of those, 107 were significantly increased in expression while 104 were significantly decreased in expression (see Table 1, below, a list of genes with altered expression in Crym tg muscle, that are also altered in hypothyroid or hyperthyroid conditions). Notably, however, only a small subset of these DEGs are known to contain tetracycline-responsive elements (TREs) (see Table 2, below). This list of genes containing TREs which can act to promote or suppress the transcription of downstream genes in response to thyroid receptor complexes was cross referenced with 566 significant DEGs found via RNA-seq comparing the TA of Crym tg to the TA of control mice. padj=FDR corrected p-value. The expression of Crym is comprised of the endogenous Crym gene as well as the Crym transgene which was inserted into the Crym tg mice.
TABLE-US-00001 TABLE 1 List of genes with altered expression in Crym tg muscle that are also altered in hypothyroid or hyperthyroid conditions. T3 Responsive Genes Significant in RNA-seq Literature Review for Fold Gene Symbol T3/T4 Involvement padj Change Fhl1 1.77E−99 2.64 Myoz2 7.47E−25 1.78 Lmcd1 2.73E−22 1.62 H2-Q7 5.54E−19 1.92 Hspb6 1.55E−16 1.43 Tspan12 7.90E−16 1.64 Ptpn3 1.78E−12 1.37 Egln3 reviewed, no evidence 5.71E−12 1.54 Car14 6.28E−12 1.46 Pik3r1 2.85E−11 1.41 Stbd1 reviewed, no evidence 2.44E−10 1.44 G0s2 reviewed, no evidence 4.76E−09 1.62 Stom 1.05E−08 1.41 Slc25a25 1.42E−08 1.43 H2-D1 1.09E−07 1.24 Slc38a10 2.76E−07 1.27 Adh1 3.98E−07 1.31 Emp1 1.51E−06 1.40 P2ry2 1.80E−06 1.22 Ugp2 reviewed, evidence 1.87E−06 1.22 Ak4 reviewed, no evidence 2.73E−06 1.44 Mdh1 2.82E−06 1.21 Irf5 1.15E−05 1.47 Vim 1.21E−05 1.24 P2ry1 1.33E−05 1.36 Fmo2 2.30E−05 1.33 Acss2 2.77E−05 1.22 Got2 3.37E−05 1.20 Csrp3 reviewed, no evidence 4.42E−05 1.38 Pla2g12a reviewed, no evidence 4.50E−05 1.25 Dlst 5.42E−05 1.18 Alpl 8.29E−05 1.29 Rhot2 0.00010378 1.19 B2m 0.00013984 1.26 Slc25a11 0.0002713 1.17 Vgll2 0.00028075 1.21 Abcg2 0.00028772 1.24 Alas1 reviewed, no evidence 0.00031762 1.23 Slc22a4 reviewed, no evidence 0.00040147 1.36 Lpl 0.00046686 1.16 Lamb2 0.00048446 1.17 Rnf114 0.00054973 1.20 Anks1 reviewed, no evidence 0.00072273 1.25 Aak1 0.00081795 1.20 Lrp6 0.00102993 1.16 Slc43a3 0.00115456 1.20 Ppara 0.00134092 1.27 Epas1 0.00138168 1.16 Cux2 0.00193831 1.30 Car3 0.00234398 1.16 Mgll 0.00245892 1.26 Ndufb5 0.00262348 1.17 Ttc19 0.00270532 1.16 Slc38a3 0.00437608 1.16 Smarca2 reviewed, no evidence 0.00450294 1.16 D930015E06Rik 0.00549508 1.29 Ly6c1 0.00550375 1.16 Gramd1b 0.00554408 1.27 Nfkbia 0.0062563 1.25 Hebp1 0.00632571 1.31 Sorbs1 reviewed, evidence 0.00733468 1.16 Mapre2 0.00757248 1.16 Prdx2 0.00833725 1.14 Gpt 0.00978817 1.19 Ptprk 0.00978817 1.24 Sema3b 0.01125628 1.23 Sdhaf4 0.01197978 1.19 Lrg1 0.01361139 1.24 Ogdh 0.01472432 1.10 Pnpla2 reviewed, no evidence 0.01573111 1.11 Fgf1 0.01649821 1.27 Noct 0.01649821 1.20 Adprhl1 0.01735839 1.16 Pdha1 0.01748964 1.12 Fam21 0.01813911 1.15 Cobll1 reviewed, no evidence 0.01866365 1.26 Sdhd 0.01905828 1.12 Sdhb 0.01937883 1.12 P2rx5 0.02027152 1.20 Sesn1 0.02083407 1.18 Nnt 0.0227335 1.17 Fam234a 0.02376108 1.15 Pdhb reviewed, evidence 0.0246951 1.11 Abcb9 reviewed, no evidence 0.02624684 1.21 Sirt3 0.02709929 1.17 Pecam1 0.02866643 1.14 B4galt1 0.02935758 1.15 Atp2a3 0.02978623 1.22 Acaa2 0.03252215 1.15 Lrp4 0.03427458 1.18 Mrpl47 reviewed, evidence 0.03457695 1.16 Cebpb reviewed, evidence 0.03543368 1.20 Sel1l3 reviewed, no evidence 0.03688229 1.14 Pam 0.03692466 1.15 Atad1 0.03813728 1.11 Cox7a1 0.0385731 1.15 Ccdc80 0.04002404 1.20 Adipor2 0.04087305 1.10 Rhou 0.04186919 1.25 Tmem25 0.04208464 1.18 Abca9 0.04220456 1.24 Fam210a 0.04250672 1.10 Lace1 0.04252622 1.17 Acta2 0.04299242 1.18 Timm44 0.04414788 1.11 Ndufa9 0.04643071 1.12 Nid1 0.04918196 1.16 Gapdh 0 −6.30 Vldlr reviewed, evidence 2.89E−17 −1.37 Ybx3 8.21E−16 −1.30 Nrep 8.34E−16 −1.36 Itpr1 5.11E−13 −1.57 Cdk19 4.70E−12 −1.37 Eepd1 1.09E−11 −1.29 Slc40a1 1.26E−11 −1.39 Slc41a3 9.40E−11 −1.29 Aldh1a1 1.53E−09 −1.32 Plcd4 7.82E−08 −1.27 Calm3 1.42E−07 −1.21 Ociad2 1.69E−07 −1.28 Nr1d1 4.60E−07 −1.25 Rbfox1 5.79E−07 −1.20 Sorbs2 6.53E−07 −1.32 Gpr19 7.45E−07 −1.53 Tmod4 1.56E−06 −1.19 Plekhb1 1.68E−06 −1.27 Ltbr 3.54E−06 −1.33 Actn3 8.40E−06 −1.22 Spryd7 1.20E−05 −1.28 Sar1b 5.47E−05 −1.17 Mospd1 6.08E−05 −1.20 Cyp27a1 reviewed, evidence 6.15E−05 −1.21 Thns12 0.00010945 −1.38 Ddx47 0.00012618 −1.24 Lynx1 0.00016848 −1.17 Mib1 0.00018148 −1.27 Xpr1 0.00021952 −1.21 Park7 0.00024821 −1.14 Sqstm1 reviewed, evidence 0.00033996 −1.16 Deptor 0.00036582 −1.22 Pgm2 reviewed, no evidence 0.00053033 −1.15 Dbp reviewed, evidence 0.00063007 −1.17 Leo1 0.00063577 −1.24 Msrb1 0.0006502 −1.21 Myoz3 0.00072273 −1.17 Setd7 0.00079966 −1.13 Mgea5 0.00094545 −1.18 Phkb 0.00101605 −1.14 Tmem106b 0.0012225 −1.17 Slc16a10 reviewed, evidence 0.00125807 −1.18 Hbp1 0.00142136 −1.18 Bace1 0.00151236 −1.24 Ogt 0.001529 −1.14 Fzd7 0.00194534 −1.23 Hnrnph1 0.00220436 −1.14 Anapc5 0.0022629 −1.13 Polr1a 0.00242984 −1.34 C1s1 0.00263336 −1.27 Rtn4 0.00280843 −1.14 Gadd45b 0.00302273 −1.24 Kctd20 0.00438576 −1.16 Suclg2 0.00458479 −1.16 Zxdc 0.00505009 −1.21 Me1 reviewed, evidence 0.00509196 −1.15 Psme4 0.00598738 −1.12 Amigo1 0.00639044 −1.17 At12 0.0069287 −1.12 D1Ertd622e 0.00748037 −1.21 Pcbp1 0.00748037 −1.13 Igfbp5 0.00791648 −1.17 Rcl1 0.00902166 −1.24 Lgalsl 0.00947885 −1.14 Zfp956 0.00981265 −1.20 B3galnt2 0.01136638 −1.15 Tnip1 0.01147469 −1.17 Fnip1 0.01197978 −1.18 Zfp275 0.01215467 −1.23 Akap81 0.0123187 −1.17 Nup210 0.01429501 −1.15 Srsf5 0.01467077 −1.14 Fermt2 0.01494555 −1.11 Strbp 0.01595775 −1.17 Lgals1 0.01649821 −1.13 Ccdc91 0.01653354 −1.11 Snx12 0.01653354 −1.16 Gpcpd1 reviewed, no evidence 0.01787158 −1.16 Slc45a4 0.01956123 −1.15 Gclc reviewed, evidence 0.02063247 −1.19 Capza2 0.02079322 −1.11 Ypel3 0.02277742 −1.14 Celf2 reviewed, no evidence 0.02480137 −1.14 Ksr1 0.02866643 −1.13 Wnk1 0.02957678 −1.10 Abcd2 0.03060918 −1.13 Ctsc 0.03082624 −1.14 Calm2 reviewed, evidence 0.03186304 −1.12 Sccpdh 0.03485028 −1.14 Klhl24 0.03711703 −1.11 Phc1 0.03711703 −1.17 Nhs 0.03735671 −1.26 Adcy9 reviewed, evidence 0.0392952 −1.15 Cog6 0.03964867 −1.12 Acadsb 0.04057233 −1.14 Pabpc1 0.04134837 −1.15 Eif3a 0.04137634 −1.10 Mb21d2 0.04208464 −1.20 Pigp 0.04267094 −1.13 Fgd4 0.04278156 −1.19 Esr1 reviewed, evidence 0.04368916 −1.15 Tmem63a 0.04585533 −1.15 Ttll4 0.04998611 −1.14
TABLE-US-00002 TABLE 2 Genes with altered expression in Crym tg that contain TREs in their promotor regions. Gene padj Fold Change Crym 0.00E+00 32.142 Slc41a3 9.40E−11 −1.287 Ank2 7.19E−05 1.216 Slc12a4 5.92E−04 1.277 P2rx5 2.03E−02 1.202 Mapk12 3.00E−02 1.109 Abcd2 3.06E−02 −1.133
3. Summary of Exemplary Results
[0039] A. μ-Crystallin (Crym) is expressed specifically in transgenic skeletal muscle at highly elevated levels. [0040] B. T3 is increased ˜190 fold in the Tibialis anterior muscle of Crym tg mice. [0041] C. Small but significant changes were seen in gene and protein expression in tg muscle towards a slow twitch, oxidative phenotype. [0042] D. Metabolic studies show that Crym tg mice increase their use of fat as an energy source. [0043] E. Female Crym tg mice gain weight faster on high fat or simple carbohydrate diets than controls.
4. Embodiments of the Invention
[0044] Because imbalances in T.sub.3, such as hypothyroidism or hyperthyroidism, can result in a variety of maladies, thyroid hormone levels are carefully controlled under normal conditions. Regulation of thyroid hormone levels are affected by the feedback loop of thyrotropin releasing hormone (TRH), TSH, T.sub.4, somatostatin, monocarboxylate thyroid hormone transporters (especially MCT8/10), and deiodinases (DIO1-3) that convert T.sub.4 transported into the cell into T.sub.3 and other metabolites. μ-Crystallin binds T.sub.3 and its absence has been shown to increase efflux of T.sub.3 from the cell significantly. In addition, CRYM levels can vary greatly in human muscle. Therefore we became interested in what effects μ-crystallin has in those individuals where it is highly expressed. To address this, a skeletal muscle specific transgenic mouse, Crym tg, was generated in which Crym mRNA and protein were expressed in skeletal muscle at high levels comparable to those seen in some humans. When Crym is overexpressed, metabolism shifts away from carbohydrate use toward fat use, with concomitant shifts in the expression of genes from glycolysis toward β-oxidation and from fast contractile toward slow contractile gene products.
[0045] Expression of CRYM in human skeletal muscle from 430 individuals in the GTEx database show that about 20% of individuals express CRYM at relatively high levels while the majority of people express little to no CRYM. RT-qPCR and Western blot data show a similar percentage of individuals expressing high levels of CRYM, 30-40 times higher than low expressers. Though a marked variability in CRYM expression has been observed, to the best of our knowledge no data so far correlates human CRYM expression to energy expenditure, locomotive ability, or body composition. This now has been confirmed. Crym tg mice produce approximately 94-fold more Crym mRNA as assayed by RT-qPCR and about 28 times more μ-crystallin protein in their TA muscles compared to control C57BL/6J mice. Thus, the Crym tg mouse model reproduces key features of human high expressers, producing Crym at levels that vastly outstrip control mice or human low expressers.
[0046] The enhancer from the TNNI1 gene that was used to increase expression of the Crym transgene is a slow skeletal muscle specific gene, while the promoter, taken from the human skeletal actin gene (ACTA1), shows expression in both fast and slow type fibers. It is believed that muscle-specific differences in gene expression driven by the skeletal actin promoter have not been documented, though it is regulated by a number of factors, including adrenergic signaling. Thyroid hormone itself can reduce skeletal actin expression, but only when it is introduced exogenously at levels several orders of magnitude greater than those reached in either control or Crym tg TA muscles. Studies of skeletal actin protein do not show differences in expression that depend on the muscle or fiber type composition, however, suggesting that differences in the activity of the actin promoter may not account for the results seen here. Less is known about the activity of the TNNI1 enhancer element, but, paradoxically, soleus and diaphragm, which are more slowly contracting in mice than other skeletal muscles have lower levels of Crym expression at the mRNA and protein level compared to other skeletal muscles in Crym tg mice, although they are elevated compared to controls. Thus, although unexpected, the results clearly show that the same promoter/enhancer pair can drive different levels of transgene expression in different muscle groups.
[0047] As expected from the high levels of Crym expressed in the muscles of the transgenic mice, a large accumulation of intracellular T.sub.3 (˜190-fold) was observed in the TA muscle compared to controls. μ-Crystallin promotes accumulation of T.sub.3 in the cytoplasm in part by sequestering the hormone. Levels of total T.sub.3 in control mouse serum are unchanged in the transgenic mouse. At these levels, μ-crystallin in the muscle should be close to saturated with bound T.sub.3. The same should be true for the C57BL/6J control muscle. Although the 5-fold higher enrichment in the T.sub.3 level compared to μ-crystallin protein is not explained (the stoichiometry of binding is 1:1), μ-crystallin may promote the influx and slow the efflux of thyroid hormones by interacting directly with the T.sub.3 transporters at the cell surface. This would be consistent with finding μ-crystallin at the sarcolemma of Crym tg muscle (see Example 3, below).
[0048] It is also not clear why serum T.sub.4 is decreased in Crym tg mice compared to controls. TSH levels are unchanged between Crym tg and control mice, so T.sub.4 production should be unimpaired. Lower serum T.sub.4 may result from its increased intramuscular conversion into T.sub.3 and its intracellular storage once it is bound to μ-crystallin in the myoplasm. Thus, the higher levels of μ-crystallin are likely to create a “sink” for T.sub.3 within the cell that is filled by mass action of T.sub.4 transported from the serum into the myoplasm, followed by its intracellular deiodination.
[0049] No significant differences were noted in the numbers of any fiber type or in the total number of fibers when soleus muscles of Crym tg mice were compared to controls. Similarly, no differences in fiber type were seen between control and Crym tg TA and gastrocnemius muscles. Staining for myosin heavy chains is only one metric used to quantify fiber type as slow twitch or fast twitch, however. Differences in the minimal Feret's diameter and the circularity of particular fiber types were found, among other significantly different morphological characteristics, although no physiological significance can be ascribed to these differences. Because there is a shift towards β-oxidation as determined by RER, and slow twitch fibers preferentially utilize β-oxidation compared to fast twitch fibers while also having a smaller size, soleus myofibers may be shifting towards a slower twitch phenotype. Remarkably, notwithstanding the large changes in the levels of thyroid hormones that were measured, very few other changes were seen in the structure or function of the hindlimb muscles in mice. Like the fiber types, central nucleation and fat deposition were essentially unchanged. Physiologically, overall muscle function and the function of individual muscles and muscle fibers are indistinguishable between transgenic and control samples. Thus, μ-crystallin's effects on muscle structure and function are not readily apparent, despite its massive effect on the distribution of T.sub.3. This is consistent with the observation that most changes in gene expression that were measured in transgenic muscle are quite modest—usually less than 50% higher or lower than controls.
[0050] Because T.sub.3 has profound effects on metabolism, the Crym tg mice were studied using metabolic cages. Uunder normal resting conditions, RER, a measure of preference for sources of metabolic energy, was significantly different between the Crym tg mice and controls. The difference in RER corresponds to a 13.7% increase in utilization of fat as an energy source over carbohydrates in Crym tg mice compared to controls.
[0051] Consistent with the changes observed in RER, GO analysis of RNA-seq data on Crym tg and controls showed an increase in expression of genes associated with β-oxidation and a decrease in genes associated with glycolysis. As the murine TA muscle is almost entirely fast twitch fibers, which are primarily glycolytic, the 566 significantly differentially expressed genes were compared to a list of 1343 fast and slow fiber type genes generated by Drexler et al. Onew hundred six (about 19%) of the genes altered in expression in the Crym tg mice encode contractile or other proteins related to fiber type, and that the expression of genes associated with fast fiber types significantly decreased while that of genes associated with slow fiber types significantly increased (see Example 9, below).
[0052] In contrast, proteomic studies results revealed 26 significantly differentially expressed, fiber type-specific proteins, of which 7 shifted towards a slower phenotype while 19 shifted towards a faster phenotype (see Table 3, below). As reported in the art, high levels of TH have little effect on fast twitch muscles but cause slow twitch muscles to exhibit faster twitch characteristics. Because mice have very few slow twitch fibers and the Crym tg mouse is subject to far less than the thyrotoxic levels of TH used in previous rodent studies, it is not surprising that minimal effects of Crym overexpression were seen. However, the data show for the first time that high levels of T.sub.3 in myocytes may cause curious transcriptional/translational shifts in which slow fiber type genes increase in expression while fast fiber type proteins increase in expression.
TABLE-US-00003 TABLE 3 Significant biological GO terms derived from a list of 85 differently expressed proteins via LC MS/MS proteomics comparing Crym tg mice to controls. Term Count P value Fold Enrichment Oxidation-reduction 11 0.0004 3.9761 process Cardiac muscle 4 0.0010 20.3626 contraction Cardiac myofibril 3 0.0010 61.0878 assembly Detection of muscle 2 0.0161 122.1757 stretch Protein refolding 2 0.0358 54.3003 Cardiac muscle 2 0.0358 54.3003 hypertrophy Regulation of mitotic 2 0.0474 40.7252 spindle assembly
[0053] Coupled with the shift towards a preference for fat utilization and increased expression of genes involved in β-oxidative metabolism, 11 proteins related to the metabolic oxidation-reduction process, and decreased expression of genes involved in carbohydrate metabolism, indicates that the accumulation of T.sub.3 in muscle is associated with a shift towards a slower twitch, more β-oxidative phenotype.
[0054] Earlier studies used thyrotoxic doses of T.sub.3 and T.sub.4 in rats to alter skeletal muscles. These doses induced a shift in slow twitch soleus muscle from slow to faster characteristics, but without accompanying changes in contractile velocity. They had no effect on fast twitch extensor digitorum longus (EDL) muscles (23). Consistent with the observations here, these results suggest that the contractile properties of muscle may not always correspond to its histochemical and biochemical properties, at least when thyroid hormones are elevated. The levels reached in Crym tg muscle are considerably below thyrotoxic levels, however. A later study examined the properties of muscle in mice lacking thyroid hormone receptors and, again found changes in soleus but not EDL. In this case, however, soleus muscles in the knockouts showed even slower twitch characteristics than in controls, consistent with changes seen in hypothyroid mice. These results suggest that any elevation in T.sub.3 related to transgenic expression of Crym is more likely to appear in slow twitch than in fast twitch muscles. Given the fact that only about 60% of murine soleus muscles are slow and the effects of Crym overexpression are subtler than either thyrotoxicosis or the complete ablation of the thyroid hormone receptor, significant differences in the physiological properties of Crym tg muscles might not be expected. This is congruent with the observation that the changes in gene expression of the myosin heavy and light chains in TA muscle are relatively small and inconsistent (see Table 4, below). Myosin heavy and light chain, mRNA and protein expression was measured with RNA-seq and LC.MS/MS respectively. In Table 4, * indicates when the transcript or protein was detected, followed by the p value and fold change in expression in Crym tg TA muscles vs controls. While no changes were seen in fiber type as measured by myosin heavy chain presence in soleus muscle, smaller Type I/IIb and Ha fibers were consistent with a shift towards a slower muscle twitch phenotype.
TABLE-US-00004 TABLE 4 Myosin Heavy and Light Chain, mRNA and Protein Expression RNA-seq LC.MS/MS Heavy/Light Transcript p Fold Protein p Abundance Gene Function Chain Measured Value Change Measured Value Ratio Myh2 Type IIa heavy * 1E−56 1.99 * Myl2 slow light * * 5E−16 2.67 skeletal/cardiac Myh1 Type IIx heavy * 7E−14 1.44 * Myh4 Type IIb heavy * 3E−05 −1.25 * Myl12a smooth/non-muscle light * 4E−05 1.19 Myl3 slow light * 0.0012 1.36 * skeletal/cardiac Myh10 non-muscle heavy * 0.0014 1.23 Myh11 smooth muscle heavy * 0.0049 1.22 * Myh7b/14 slow muscle/non- heavy * * 0.0057 1.38 muscle Myh7 Type I heavy * * Myh8 neonatal/perinatal heavy * * Myh6 cardiac heavy * * Myh13 superfast heavy * * Myh9 non-muscle heavy * * Myh3 embryonic heavy * * Myh15 slow skeletal/non- heavy * muscle Myl9 smooth/non- light * * muscle Myl4 embryonic/cardiac light * * Myl1 fast skeletal light * * Myl10 non-muscle light Myl6 smooth/non- light * * muscle Myl12b non-muscle light * * Mylpf fast skeletal light * * Myl6b slow skeletal/non- light * * muscle
[0055] Significantly greater rates of increase in body weight of female Crym tg compared to control mice on high fat or high simple carbohydrate diets. There may be a sexually dimorphic effect that higher levels of μ-crystallin has on metabolism because a similar significant increase in body weight of Crym tg was not observed in males on these diets. Indeed Chen et al. found that mice with two X chromosomes had “accelerated weight gain on a high fat diet” and up to a 2-fold increase in adiposity compared to XY mice, showing a clear sexual dimorphism for fat storage. Thus, μ-crystallin may affect metabolism in a sexually dimorphic way. See Example 8, below.
[0056] The changes discussed here are novel. The only comprehensive studies of thyroid hormone-dependent gene expression in mice to date were performed in liver tissue, though an older study has been reported on skeletal muscle in men. There are 5,129 significantly differentially expressed genes shared across three whole genome microarrays comparing hyperthyroid mouse liver to euthyroid or hypothyroid mouse liver (GEO DataSets ID: 200068803, 200065947, 200021307). Of the 566 significant DEGs identified by RNA-seq, 211 showed changes in these studies of liver. 107 were significantly increased in expression while 104 were significantly decreased in expression (see Table 1, above). Notably, however, only a small subset of these DEGs are known to contain TREs (see Table 2, above). Despite the fact that T.sub.3 is highly elevated in the TA muscles of Crym tg mice, the changes in mRNA and protein levels are modest. This is in keeping with earlier studies of the relatively modest effects of more extreme changes in thyroid hormone signaling in rodent muscle.
[0057] The shift in gene expression and metabolism in Crym tg mice also can be relevant to human physiology and perhaps to the pathophysiology of facioscapulohumeral muscular dystrophy (FSHD). CRYM levels in human muscles vary widely, but no distinctive physiological differences have been linked to this variability. Such differences can appear in muscle stressed by disease, however. In particular, CRYM is likely to be linked directly or indirectly to FSHD. DUX4 expressed in FSHD muscle increases CRYM expression, and μcrystallin in mice promotes a shift in RER and gene expression consistent with a shift toward a slower fiber type, which if pronounced enough would generate less force upon contraction. Notably, force generated by fast twitch muscle fibers is significantly reduced in FSHD. Although Crym tg mice do not show a decrease in force, the changes documented in TA muscle could be associated with such a decrease if it manifests over decades, the time course of the disease in man.
[0058] In summary, the high levels of μ-crystallin in skeletal muscle greatly increases T.sub.3 levels in muscle, shifts metabolism to favor the use of fat over carbohydrates as an energy source, and enhances the expression of genes typical of slow skeletal muscle. Remarkably, the morphological and physiological characteristics of the muscle are not significantly altered. Therefore the information presented here suggests that the higher levels of μ-crystallin seen in some humans regulate gene expression and metabolism in similar, subtle ways. Individuals showing high levels of μ-crystallin expression in muscle likely will be more resistant to diabetes and obesity, and that mechanisms that up-regulate μ-crystallin will be beneficial in treating these conditions.
[0059] The invention is useful for mammalian subjects, including rats, mice, dogs, cats, primates, or any mammal in need of treatment for diabetes or obesity, preferably humans. Such a subject in need of treatment includes any mammal that has or is susceptible to a disease or condition that can be ameliorated by shifting metabolism to favor the use of fats over carbohydrates as an energy source or increased beta oxidation. Preferably, the disease or condition is a lipolytic disorder, a lipogenic disorder, a glycolytic disorder, a gluconeogenic disorder, type 2 diabetes, or obesity and more preferably is type 2 diabetes, obesity or both.
[0060] The compounds of the invention include CRYM protein or viral vectors, such as AAV or baculovirus, containing a CRYM transgene, chemical compounds (see Table 5 for a list of chemicals currently known to increase CRYM expression), protein agonists such as transcription factors or targeted overexpression systems. Some method embodiments of the invention involve direct injection with CRYM protein or RNA, transgenesis, addition of CRYM genes through genome editing, addition of an alternate CRYM promoter through genome editing, transfection of stable or transient CRYM overexpression plasmids or artificial chromosomes, genome editing of SNPs that may control CRYM expression, addition of CRYM stabilizing protein complexes or chemicals, addition of stabilizing DNA or RNA sequences provided transiently or produced intracellularly.
TABLE-US-00005 TABLE 5 Chemical Compounds that Increase CRYM Expression Chemical Name Interaction pirinixic acid [pirinixic acid binds to and results in increased activity of PPARA protein] which results in increased expression of CRYM mRNA 4-(5-benzo(1,3)dioxol-5-yl- [NOG protein co-treated with entinostat co-treated with 4-pyridin-2-yl-1H-imidazol- dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4- 2-yl)benzamide pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of CRYM mRNA Choline [Methionine deficiency co-treated with Choline deficiency co- treated with Folic Acid deficiency] results in increased expression of CRYM mRNA dorsomorphin [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4- pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of CRYM mRNA entinostat [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4- pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of CRYM mRNA Estradiol [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of CRYM mRNA estradiol 3-benzoate [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of CRYM mRNA Folic Acid [Methionine deficiency co-treated with Choline deficiency co- treated with Folic Acid deficiency] results in increased expression of CRYM mRNA Methionine [Methionine deficiency co-treated with Choline deficiency co- treated with Folic Acid deficiency] results in increased expression of CRYM mRNA Oxaliplatin [Oxaliplatin co-treated with Topotecan] results in increased expression of CRYM mRNA Testosterone [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of CRYM mRNA Topotecan [Oxaliplatin co-treated with Topotecan] results in increased expression of CRYM mRNA Phenobarbital NR1I3 protein affects the reaction [Phenobarbital results in increased expression of CRYM mRNA] 1,2,5,6-dibenzanthracene 1,2,5,6-dibenzanthracene results in increased expression of CRYM mRNA 1,3-butadiene 1,3-butadiene results in increased expression of CRYM mRNA 1,4-bis(2-(3,5- 1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in dichloropyridyloxy))benzene increased expression of CRYM mRNA abrine abrine results in increased expression of CRYM mRNA Aldehydes Aldehydes results in increased expression of CRYM mRNA Amphetamine Amphetamine results in increased expression of CRYM mRNA archazolid B archazolid B results in increased expression of CRYM mRNA Asbestos, Crocidolite Asbestos, Crocidolite results in increased expression of CRYM mRNA Benzo(a)pyrene Benzo(a)pyrene results in increased expression of CRYM mRNA BEP protocol BEP protocol results in increased expression of CRYM mRNA bis(4-hydroxyphenyl)sulfone bis(4-hydroxyphenyl)sulfone results in increased expression of CRYM mRNA bisphenol F bisphenol F results in increased expression of CRYM mRNA butyraldehyde butyraldehyde results in increased expression of CRYM mRNA Carbon Tetrachloride Carbon Tetrachloride results in increased expression of CRYM mRNA Cyclosporine Cyclosporine results in increased expression of CRYM mRNA Dibutyl Phthalate Dibutyl Phthalate results in increased expression of CRYM mRNA Dietary Fats Dietary Fats results in increased expression of CRYM mRNA Dihydrotestosterone Dihydrotestosterone results in increased expression of CRYM mRNA entinostat entinostat results in increased expression of CRYM mRNA Ethanol Ethanol results in increased expression of CRYM mRNA Fenretinide Fenretinide results in increased expression of CRYM mRNA Methamphetamine Methamphetamine results in increased expression of CRYM protein Methyl Methanesulfonate Methyl Methanesulfonate results in increased expression of CRYM mRNA ochratoxin A ochratoxin A results in increased expression of CRYM protein Oxaliplatin Oxaliplatin results in increased expression of CRYM mRNA Palm Oil Palm Oil results in increased expression of CRYM mRNA pentanal pentanal results in increased expression of CRYM mRNA Phenobarbital Phenobarbital results in increased expression of CRYM mRNA Potassium Dichromate Potassium Dichromate results in increased expression of CRYM mRNA propionaldehyde propionaldehyde results in increased expression of CRYM mRNA Propylthiouracil Propylthiouracil results in increased expression of CRYM mRNA Quercetin Quercetin results in increased expression of CRYM mRNA Sesame Oil Sesame Oil results in increased expression of CRYM mRNA Silicon Dioxide Silicon Dioxide results in increased expression of CRYM mRNA Sunitinib Sunitinib results in increased expression of CRYM mRNA Tetrachlorodibenzodioxin Tetrachlorodibenzodioxin results in increased expression of CRYM mRNA Topotecan Topotecan results in increased expression of CRYM mRNA Tretinoin Tretinoin results in increased expression of CRYM mRNA Valproic Acid Valproic Acid results in increased expression of CRYM mRNA
[0061] Preferred compounds in Table 5, for use with the inventive methods for treatment of obesity and type 2 diabetes include: pentanal, tretinoin, fenretinide, estradiol 3-benzoate, and dihydrotestosterone.
[0062] The compounds listed above can be administered as a base compound, and any pharmaceutically acceptable hydrate, solvate, acid or salt, and can be amorphous or in any crystalline form, or as an oil or wax. Any pharmaceutically acceptable salt can be used, as may be convenient. Generally, these salts are derived from pharmaceutically and biologically acceptable inorganic or organic acids and bases or metals. Examples of such salts include, but are not limited to: acetate, adipate, alginate, ammonium, aspartate, benzoate, benzenesulfonate (besylate), bicarbonate, bisulfate, butyrate, citrate, camphorate, camphorsulfonate, carbonate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptanoate, glycerophosphate, glycolate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate, lactate, magnesium, maleate, malonate, methanesulfonate (mesylate), 2-naphthalenesulfonate, nicotinate, nitrate, oxalate, palmoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, potassium, propionate, salicylate, sodium, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate (tosylate) and undecanoate salts.
[0063] In certain preferred embodiments, the compounds described herein are formulated and are administered as a pharmaceutical composition that includes a pharmaceutically acceptable carrier and one or more pharmaceutical agent, including one or more of the compounds described herein, and including one or more of the inventive compounds described herein with an additional agent, such as drug of another class.
[0064] A pharmaceutically acceptable carrier refers to any convenient compound or group of compounds that is not toxic and that does not destroy or significantly diminish the pharmacological activity of the therapeutic agent with which it is formulated. Such pharmaceutically acceptable carriers or vehicles encompass any of the standard pharmaceutically accepted solid, liquid, or gaseous carriers known in the art. A suitable carrier depends on the route of administration contemplated for the pharmaceutical composition.
[0065] Routes of administration are determined by the person of skill according to convenience, the health and condition of the subject to be treated, and the location and stage of the condition to be treated. Such routes can be any route which the practitioner deems to be most effective or convenient using considerations such as the patient, the patient's general condition, and the specific condition to be treated, including local or systemic administration. For example, routes of administration can include, but are not limited to local or parenteral routes, including: oral, intravenous, intraarterial, intrathecal, intramuscular, subcutaneous, intradermal, intraperitoneal, rectal, vaginal, topical, nasal, local injection, buccal, transdermal, sublingual, inhalation, transmucosal, wound covering, direct injection into an area to be treated, and the like. The administration can be given by transfusion or infusion, and can be administered by an implant, an implanted pump, or an external pump, or any device known in the art.
[0066] Therefore, the forms which the pharmaceutical composition can take will include, but are not limited to: tablets, capsules, caplets, lozenges, dragees, pills, granules, oral solutions, powders or granules for dilution, powders for inhalation, vapors, gases, sterile solutions or other liquids for injection or infusion, transdermal patches, buccal patches, inserts and implants, rectal suppositories, vaginal suppositories, creams, lotions, oils, ointments, topical coverings (e.g., wound coverings and bandages), suspensions, emulsions, lipid vesicles, and the like.
[0067] Treatment regimens of the chemical compounds contemplated for use with the invention include a single administration or a course of administrations lasting two or more days, including a week, two weeks, several weeks, a month, two months, several months, a year, or more, including administration for the remainder of the subject's life. The regimen can include multiple doses per day, one dose per day or per week, for example, or a long infusion administration lasting for an hour, multiple hours, a full day, or longer.
[0068] Dosage amounts per administration of these compounds include any amount determined by the practitioner and will depend on the size of the subject to be treated, the state of the health of the subject, the route of administration, the condition to be treated, the severity of the condition, and the like. In general, it is contemplated that for the majority of subjects, a dose in the range of about 0.01 mg/kg to about 100 mg/kg is suitable, preferably about 0.1 mg/kg to about 50 mg/kg, more preferably about 0.1 mg/kg to about 10 mg/kg, and most preferably about 0.2 mg/kg to about 5 mg/kg are useful. This dose can be administered weekly, daily, or multiple times per day. A dose of about 0.1 mg, 0.2 mg, 0.25 mg, 0.5 mg, 1 mg, 5 mg, 10 mg, 20 mg, 40 mg, 80 mg, 100 mg, 250 mg, 500 mg, or 1000 mg can be administered.
[0069] In other embodiments of the invention, subjects in need can be treated with a transgene, preferably inserted in to an AAV vector for administration to a subject. Such techniques are well known to those of skill in the art. The methods of preparing a suitable vector and determining doses for a particular patient is within the skill in the art, but dosages of vector (for example, AAV) will range from about 3×10.sup.9 vg/kg (vector genomes/kilogram) to about 3×10.sup.14 vg/kg and may be delivered intravenously, intramuscularly, subcutaneously, or retroperitoneally. Preferably the vector contains a transgene that encodes CRYM protein, for example SEQ ID NO:2. See
[0070] Thus, the invention comprises methods of treatment for patients and methods of modulating CRYM expression or content in the body. AAV or small molecules would be delivered to patients at appropriate doses and at a given dosing regimen. Subject inclusion criteria would include individuals with lipolytic disorders, lipogenic disorders, glycolytic disorders, gluconeogenic disorders, type 2 diabetes, obesity, or any combination of the aforementioned disorders. Individuals would not have other major underlying health disorders and may range in age from 18 to 65 years of age. The dose of AAV or of a small molecule may be given one to three times and may be separated by one week up to two month in between doses.
[0071] The studies presented here demonstrate that high levels of Crym, expressed specifically in skeletal muscles, result in an increase in T.sub.3 levels in muscle of ˜200-fold. This is accompanied by a change in metabolism from glycolytic towards oxidative pathways, and by small but significant changes in gene and protein expression that correspond with shifts from glycolytic to oxidative and fast to slow twitch phenotypes. Notably, there were no significant changes in muscle structure or function in the whole animal, isolated muscles, or individual myofibers. This study therefore provides further understanding of the roles of Crym and thyroid hormone in regulating metabolism and gene expression in skeletal muscle and provides methods for treatment of diseases and conditions which would benefit from increased CRYM protein function, such as obesity and type 2 diabetes. 4. Examples
[0072] This invention is not limited to the particular processes, compositions, or methodologies described, as these may vary. The terminology used in the description is for the purpose of describing the particular versions or embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention, the preferred methods, devices, and materials are now described. All publications mentioned herein, are incorporated by reference in their entirety; nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
Example 1: Materials and Methods
A. Materials
[0073] Unless otherwise stated, all biologics were from Sigma-Aldrich™ and all salts were from Thermo Fisher™
B. Creation of the Crym tg Mouse
[0074] Mouse Crym was cloned downstream of the human skeletal actin promoter (ACTA1) and human slow troponin I enhancer element (TNNI1), (kindly provided by Dr. J. Molkentin, Cincinnati Children's Hospital Medical Center), to limit expression to differentiated skeletal muscle. The expression construct was linearized and injected into C57BL/6J mouse embryos at the Genome Modification Facility, Harvard University (Cambridge, Mass.). See
TABLE-US-00006 forward: (SEQ ID NO: 3) TGGCCACGCGTCGACTAGTACG reverse: (SEQ ID NO: 4) AATTCGTACTAGTCGACGCGTGGCC.
[0075] As it was initially difficult to differentiate between heterozygotes and homozygotes with PCR methods, qPCR was done on several of the Crym-positive genomic DNA samples. Mice with higher levels of Crym were then bred to controls and the F1 and F2 offspring were crossed and screened to generate probable homozygotes. Mice were identified as tg/tg homozygotes if after crossing with controls they gave at least 12 Crym-positive offspring and no Crym-negative offspring by PCR. Homozygotes were then bred together to establish the line of Crym tg/tg mice.
[0076] All histologic and physiologic experiments used approximately three-month-old, male control and Crym tg mice that were anesthetized under isoflurane (2.5%). Euthanasia was by cervical dislocation under anesthesia. All procedures were approved by the Institutional Animal Care and Use Committee, University of Maryland School of Medicine.
C. Back-Crossing and Genotyping
[0077] Crym tg mice were backcrossed with control C57BL/6J mice. Non-littermate F1 heterozygotes were then bred together to generate F2 mice. Tail snips of Crym tg, C57BL/6J, F1 heterozygotes, and F2 mice were then taken at 6 weeks of age or older. Genomic DNA was extracted from the tail snips by following the manufacturers protocol from the PureLink™ Genomic DNA Mini Kit (K182001; Invitrogen™) modified only by substituting DirectPCR Lysis Reagent™ (Tail) (102-T; Viagen Biotech™, Los Angeles, Calif.) in place of PureLink™ Genomic Digestion Buffer. Crym tg, F1 heterozygotes, and C57BL/6J mice were genotyped using a multiplexed probe-based assay from IDT for Crym and Tert. The Crym assay was designed such that it would produce the same amplicon from the native Crym gene as well as the inserted transgene. A synthetic Crym amplicon was used as an interplate control and Tert was used as the control for copy number. RT-qPCR was used to determine copy number and average normalized C.sub.q for each mouse. The amplification protocol followed the manufacturer's instructions (IDT). Mice were genotyped to one of the three genotypes when the calculated copy number and average normalized C.sub.q was closest to a known genotype (i.e. Crym tg, C57BL/6J, or F1 heterozygotes).
D. Sequencing the Transgene Insertion Site
[0078] Genomic DNA obtained from Crym tg mice was digested with EcoRI. We designed and had synthesized a double stranded short oligonucleotide with overhanging sequences corresponding to an EcoRI digestion that we called Crym-Adaptor. Crym-Adaptor was ligated to the digested genomic DNA. The resulting ligation fragments were amplified using a forward primer in the multiple cloning site of the transgene and a reverse primer in the Crym-Adaptor sequence. Nested primers were used to specifically amplify the sequence. The products of this last reaction were purified by gel purification and sequenced from both ends. The sequence was then evaluated with NCBI BLASTn.
E. Staining of Longitudinal and Cross Sections for μ-Crystallin
[0079] Mice were perfusion-fixed with 2% paraformaldehyde in phosphate-buffered saline (PBS). TA and soleus muscles were collected, snap frozen in a liquid nitrogen slush, mounted in Optimal Cutting Temperature (OCT) (Fisher Healthcare™, Hampton, N.H.) and sectioned at 10-20 μm with a Reichert Jung™ cryostat (Leica™, Buffalo Grove, Ill.). Sections were stained using the Mouse-On-Mouse (M.O.M.) Basic Kit (BMK-2202; Vector™ Labs, Burlingame, Calif.). Sections were incubated for at least 1 hour at room temperature in Mouse-on-Mouse (MOM) blocking reagent followed by a 10 minutes of incubation in MOM diluent. Sections were incubated overnight at 4° C. in mouse monoclonal anti-μ-crystallin antibody (GTX84654; GeneTex™ Inc., Irvine, Calif.) diluted 1:100. Some sections were also incubated with rabbit anti-desmin (PA5-16705; Thermo Fisher™, Waltham, Mass.), also diluted 1:100. Sections were washed in PBS and then stained for 1 hour at room temperature with Alexa Fluor™ 568 goat anti-mouse secondary antibody (A11031) and Alexa Fluor™ 488 goat anti-rabbit (A32731), both from Alexa™ Molecular Probes (Invitrogen™, Carlsbad, Calif.), diluted 1:200. Ali antibodies were made up in MOM diluent. Samples were washed with PBS, mounted in Vectashield+DAPI (H-1500; Vector™ Laboratory), and imaged with a Nikon™ W-1 spinning disc confocal microscope (Nikon™ USA, Melville. N.Y.). We used identical laser power and exposure settings to compare cross sections of TA muscle, of soleus muscle, and of longitudinal sections of TA muscle, but we adjusted them for each set of comparisons to optimize image clarity.
F. Fiber Type Staining
[0080] We used a slightly modified version of Kammoun et al.'s fiber typing protocol as known in the art. Primary murine monoclonal antibodies specific for the myosin isoforms Myh7 (type I; BA-D5, isotype IgG2b), Myh2 (type IIa; SC-71, isotype IgG1), and Myh4 (type IIb; BF-F3, isotype IgM) were from the Developmental Studies Hybridoma Bank, (Iowa City, Iowa). Alexa Fluor™ 647 conjugated wheat germ agglutinin (WGA) was used to stain the myofiber surface (W32466, Thermo Fisher™). The 4 reagents were used on 10 μm thick cross sections of snap frozen soleus and TA muscles (n=5). The following secondary antibodies were used: goat anti-mouse IgG2b Cross-Adsorbed Secondary Antibody Alexa Fluor™ 568 (A-21144, Thermo Fisher™), goat anti-mouse IgG1 Cross-Adsorbed Secondary Antibody Alexa Fluor™ 488 (A-21121, Thermo Fisher), and goat anti-mouse IgM mu chain Alexa Fluor™ 405 (ab175662, Abcam). Slides were imaged on a Nikon™ W-1 spinning disc microscope. Laser power and exposure were identical for comparisons of sections of control and tg TA muscles, and for soleus muscles, but were different between these tissues. We used 5 Crym tg and 4 control mice to study soleus fiber type. Four stacked images were taken at approximately 2 μm intervals and stacked to generate a single image, which were flattened using Aguet et al.'s Model-Based 2.5-D Deconvolution for Extended Depth of Field algorithm. We determined that an η.sub.0=0.2 and a η.sub.1=1.3 were optimal in our images to generate an in-focus image of the flattened z stacks. For soleus muscle sections we used Myosoft™, a Fiji™ macro, to categorize fibers by their myosin heavy chain composition and measure several traits (count, area, perimeter, circularity, minimal Feret's diameter, roundness, and solidity). Statistical analysis used Real Statistics Resource Pack software (Release 6.8) as a plugin in Microsoft Excel™ with a=0.05. Normality of the 7 measured metrics for each fiber type (I, IIa, IIb, IIx, I/IIa, I/IIb, IIa/IIb, and I/IIa/IIb) were determined with the Shapiro-Wilks and d'Agostino-Pearson tests, while scedasticity was determined with the mean, median, and trimmed method in Levene's test. If a dataset failed any individual test for normality or homoscedasticity, it was considered not normal and heteroscedastic. Measurements that were both normal and homoscedastic were tested for significance using Student's t test, while measurements that were normal but heteroscedastic were tested for significance using either Welch's t test or the Brown-Forsythe test. The Kruskal-Wallis test for significance was used on measurements that failed the tests for normality but were homoscedastic. Either the Yuen-Welch or the Mann-Whitney U test were used on measurements that failed tests for both normality and homoscedasticity.
G. Fat Staining
[0081] Cryosections of 5 snap frozen soleus and TA muscles from control and Crym tg mice were stained with BODIPY (493/503) according to Spangenburg et al. and imaged with a Nikon™ spinning disk microscope (see above). Laser power and exposure settings were maintained for each section regardless of mouse strain, but these were altered between TA and soleus tissues. Accordingly, look up table values were also different from TA to soleus samples but the same within a tissue regardless of mouse strain.
H. μ-Crystallin Staining of Isolated FDB Fibers
[0082] FDB muscles were harvested bilaterally and digested in Dulbecco's modified Eagle's medium with 4 mg/mL type II collagenase (Gibco™, Thermo Fisher™ Scientific, Waltham, Mass.) for 3 h at 37° C. Tissue was transferred to FDB medium (Dulbecco's modified Eagle's medium with 2% BSA, 1 μl/mL gentamicin, and μl/ml fungizone). Single myofibers were mechanically separated by trituration and allowed to incubate overnight. Isolated fibers were plated down on coverslips coated with Geltrex™ (A1413201; Thermo Fisher™ Scientific) for 2 hours. Coverslips were fixed in 2% paraformaldehyde at room temperature for 15 minutes. They were then permeabilized with 0.25% Triton™ X-100 in PBS for 10 minutes and stained with antibody to μ-crystallin (H00001428-M03; Abnova, Taiwan), diluted 1:100, followed by Alexa™ Fluor 488, goat anti-mouse secondary antibody (A11029; Alexa™ Molecular Probes, Invitrogen™), diluted 1:200, with the MOM kit, as described above. Each incubation was for 1 hour at room temperature. Samples were imaged on a Zeiss™ 510 Duo microscope (Carl Zeiss™, Thornwood, N.Y.).
I. CNFs and Minimal Feret's Diameter of TA Cross Sections
[0083] Cross sections of TA muscles were used to measure centrally nucleated fibers (CNFs) and minimal Feret's diameter. Sections were stained as above but with rabbit anti-dystrophin (PAS-16734; Merino Fisher™ Scientific), mounted in Vectashield™+DAPI as above and imaged by confocal microscopy with a Zeiss™ 510 Duo microscope (Carl Zeiss™). DAPI labeling was evaluated with ImageJ™ (NIH, Bethesda, Md.), for determination of centrally nucleated fibers. Measurements of minimal Feret's diameter were obtained with Zeiss™ LSM Image Browser (Carl Zeiss™). A total of 312 myofibers from 5 Crym tg mice and 722 fibers from 5 control mice were analyzed.
J. Measurements of Contractile Force
[0084] Nerve-evoked contractile function of gastrocnemius, extensor digitorum longus, or soleus muscles in vivo was evaluated as described. In brief, isofluorane-anesthetized mice were placed supine on a warming pad (37° C.) of an Aurora™ 1300 A system with knee position fixed and paw secured to the foot-plate of the 300C-FP. Percutaneous nerve stimulation was with brief (100 μecond) pulses with current adjusted to achieve maximal isometric force. The force vs frequency relationship was determined with 250 msecond trains of pulses between 1 and 150 Hz and normalized to muscle mass or cross-sectional area (CSA). Fatigability was determined by delivering tetanic trains (250 msecond at 80 Hz) every 2 seconds for 10 minutes for soleus or for 5 minutes for gastrocnemius. Data were analyzed with DMA-HT analysis software (Aurora Scientific™, Ontario, Canada) and evaluated for statistical difference via the Holm-S̆ídák test with GraphPad™ Prism version 8.2.0 for Mac (GraphPad™ Software, La Jolla, Calif.).
K. Treadmill and Ad Libidum Running
[0085] Mice were conditioned to the treadmill over 3 days, as follows. Mice were placed in the treadmill with no belt movement for 10 minutes. The next day they were made to walk at 5 m/min for 10 minutes; this was increased to 10 m/minute the following day. For testing, mice were placed in the treadmill at a 7° incline. The speed was set at 10 m/minute and was increased by 1.5 m/minute every 2 minutes. Mice were considered exhausted when they were unable to run for 30 seconds consecutively. Each mouse was run 3 times with a minimum of 2 days rest between each run.
[0086] Additional Crym tg and control mice were housed in cages equipped with running wheels for 7 days. The number of times the wheel spun per minute was recorded every 6 minutes and analyzed to determine total distance run in different time periods, day and night.
L. Protein Extraction
[0087] Tissues of interest (gastrocnemius, TA, soleus, diaphragm, heart, kidney, cerebral cortex and liver) were collected from 3-month old Crym tg and control mice, snap frozen in liquid nitrogen and stored at −80° C. Protein was extracted in RIPA Buffer (R0278-50ML, Sigma-Aldrich™), prepared with cOmplete Mini, EDTA-free protease inhibitor tablets (11836170001, Sigma-Aldrich™; 10 mL of RIPA buffer to every protease inhibitor tablet). Tissue was weighed and 100 μL per 10 mg of tissue of RIPA/protease inhibitor solution was added along with two 5 mm steel beads (69989; Qiagen™, Hilden, Germany). Samples were placed in a TissueLyser LT (Qiagen™) at 50 oscillations/second for 3 minutes, briefly vortexed, put on ice for 2 minutes, followed by a second round of 50 oscillations/second for 3 minutes in the TissueLyser. Samples were sonicated for 10 seconds and subjected to centrifugation at 12,470×g for 30 minutes at 4° C. The supernatant was transferred to a new microfuge tube and protein concentration was determined with BioRad™′s Protein Assay Dye Reagent Concentrate (Bradford Assay) (5000006, Bio-Rad™)
M. Immunoblotting Protocols
[0088] Traditional Western blot: Muscle tissue was combined with an equal volume of sample homogenate and Laemmli sample buffer, containing 5% 2-mercaptoethanol, then further diluted in sample buffer to a final concentration of 1 mg/mL. Samples of 10 μg of Crym tg TA homogenate and 40 μg of control TA homogenate were loaded onto 4-12% Bis-Tris gels (NuPAGE NP0321PK2, Thermo Fisher™), electrophoresed for 1 h at 170 V, and transferred to nitrocellulose for 2 hours at 22 V. Blots were blocked for 3 hours in blocking solution (3% milk in TBS containing 0.1% Tween-20 and 10 mM azide). Monoclonal mouse anti-μ-crystallin (SC-376687, Santa Cruz Biotechnology™, Inc., Dallas, Tex.) and monoclonal rabbit anti-lysyl-tRNA synthetase antibodies (#129080, Abcam™, Cambridge, United Kingdom), used as a loading control, were diluted 1:1000 in blocking buffer and incubated overnight at room temperature. Lysyl-tRNA synthetase, encoded by the Kars gene, was used as the protein loading control because the expression of its mRNA showed minimal variance among mice and across genotypes, unlike many other common control proteins (see Example 9, below). At the time these studies were conducted, proteomic data was not available. After extensive washing, the membranes were incubated for 2 hours with HRP conjugated goat anti-rabbit (3-035-144, Jackson ImmunoResearch, West Grove, Pa.) or goat anti-mouse (47-035-146, Jackson ImmunoResearch) secondary antibody diluted 1:10,000 in blocking solution. After extensive washing, chemiluminescence was visualized with the Super Signal West Femto Maximum Sensitivity Kit (#34095, Thermo Fisher™) and imaged with a BioRad™ ChemiDoc XRS and image lab software (#1708265, BioRad™)
[0089] Capillary-based Western blot (Wes): Wes analysis was performed according to the manufacturer's instructions for the 12-230 kDa protein separation module (#SM-W004; Protein Simple, San Jose, Calif.) to provide an automated alternative to the traditional Western Blot. Instrument settings were as follows; stacking and separation time, 30 minutes; separation voltage, 375 V; time for antibody blocking, 30 minutes; incubation with primary antibody time, 60 minutes; incubation with secondary antibody time, 30 minutes; luminol/peroxide chemiluminescence detection time, 15 minutes (HDR exposure). Protein extracted from whole tissue lysates (gastrocnemius, TA, soleus, diaphragm, heart, kidney, cerebral cortex, quadriceps, liver) from 3 male Crym tg and 3 control were prepared with 2× Laemmli Sample Buffer (#1610737; Bio-Rad™, Hercules, Calif.) to generate an overall sample protein concentration of 1.0 mg/mL for each sample generated. The primary antibody to μ-crystallin (see above) was diluted 1:25 in Protein Simple's Antibody Diluent 2. A primary antibody to a control protein, aconitase-2 (ab129069; Abcam™, United Kingdom), was used at 1:200. We chose aconitase-2 as the protein loading control because this protein is abundantly expressed in many tissues, showed very little variability in expression in mice of the same genotype and between Crym tg and controls, as assayed by whole proteome LC.MS/MS (data not shown), and because the molecular mass of this protein is distinct from that of μ-crystallin. The primary and control antibodies were multiplexed. Samples were run as technical duplicates. Compass software (Compass for SW 4.0 Mac Beta; Protein Simple) was used to visualize the electropherograms and to analyze peaks of interest for area under the curve (AUC). The peak signal-to-noise ratio was set at >10 automatically by the software. Due to slight capillary-to-capillary variations in molecular weight readout, identified peaks at a molecular weight of interest were allowed a 10% range in molecular weight (as automatically set by the Wes system). AUC was analyzed with individual t-tests per tissue following the Benjamini, Krieger and Yekutieli FDR approach at Q=1%.
N. RNA and cDNA Preparation
[0090] Tissue from 3-month old Crym tg and control mice were removed, snap frozen in liquid nitrogen and stored at −80° C.
[0091] RNA was extracted using the following protocol. Tissue was placed in a 2 mL tube with 1 mL of TRIzol Reagent (Ser. No. 15/596,026; Thermo Fisher™ Scientific) and two 5 mm steel beads (69989; Qiagen™, Hilden, Germany), loaded into a TissueLyser LT (Qiagen™) and run at 50 oscillations/second for 2 minutes. Samples were checked for complete homogenization after 2 minutes and, if incompletely homogenized, run again in 30 second cycles with checks for complete homogenization after each cycle. Samples were vortexed briefly, inverted to mix at room temperature for 5 minutes, and subjected to centrifugation at 12,000 g for 10 minutes at 4° C. Supernatant was removed into a new 1.5 mL RNase-free tube and 200 μL of chloroform was added. After vortexing for 15 seconds, the sample remained at room temperature for 3 minutes. After a second centrifugation, at 12,000×g for 15 minutes at 4° C., the top (clear) layer was removed into a new 1.5 mL RNase free tube and 500 μL of ice-cold isopropanol was added. Tubes were vortexed and inverted several times to mix, and then left at room temperature for 10 minutes. Centrifugation at 12,000×g for 10 minutes at 4° C. generated a white pellet of RNA, which was washed with 1 mL of ice-cold 75% ethanol and collected again by centrifugation (7,500×g for 5 minutes at 4° C.). After drying at room temperature, the pellet was dissolved in 25-35 μL of RNase-, DNase-free water at 60° C. for 10 minutes. RNA samples were stored at −80° C. until use.
[0092] cDNA was generated with the QuantiTect™ Reverse Transcription Kit (205313; Qiagen). RT-qPCR was performed on a CFX Connect thermal cycler (Bio-Rad™) using the cDNA and PrimeTime Gene Expression Master Mix (1055772; IDT, Coralville, Iowa) in 20 μL reaction volumes in a BioRad™ CFX Connect thermal cycler following the manufacturer's protocol for the PrimeTime qPCR Probe Assays (IDT) except for the extension of the number of amplification cycles to 60. Primers are listed below (IDT PrimeTime RT-qPCR Probe-Based Assay) in Table 6, below. “ZEN” stands for the ZEN quencher and “3IABkFQ” stands for 3′ Iowa Black FQ. These are non-base modifiers that absorbs the light from fluorophores placed proximally to them. “HEX”, “SHEX”, and “FAM” are fluorophores that generate light when excited by particular wavelengths of light.
TABLE-US-00007 TABLE 6 Primers and Probes. SEQ ID Name Sequence NO Crym Forward 5′-GAGATGTTCGGGTCTGTTC 5 AT-3′ Probe 5′-/FAM/TCATCACAG/ZEN/ 6 TCACCATGGCAACAGA/ 3IABkFQ/-3′ Reverse 5′-GGCTTTACCCATTCACCAA 7 ATAA-3′ NomI Forward 5′-TAAACCCAGAGTTCACTTC 8 CTAC-3′ Probe 5′-/5HEX/TCGTCTTCA/ZEN/ 9 GTTTCCATCAACAGTGCA/ 3IABkFQ/-3′ Reverse 5′-CCTTCTCGCAACATTCCC 10 A-3′ Tert Forward 5′-CTCCTTTCCTCTAGGGCT 11 ATCT-3′ Probe 5′-/HEX/TCTCTGTCT/ZEN/ 12 CCCTTACCCACAGCT/ 3IABkFQ/-3′ Reverse 5′-AGTGCTGACATCTCATTCC 13 TTC-3′
[0093] Relative tissue specific expression of Crym, standard deviations, and p values were calculated according to Taylor et al. Nom1 was used as the control gene to measure Crym expression by qPCR.
P. Proteomic Comparison of Skeletal Muscle of Crym tg and Control Mice
[0094] Skeletal muscle samples were harvested from six 3-month-old, male, Crym tg and control littermate mice. All of the mice were perfused with cold PBS prior to muscle collection except for one of the 6 control samples. Samples, each comprising half of the left TA muscle, divided longitudinally, were homogenized by bead beating (see above). Sample preparation for proteomics and nano ultra-performance liquid chromatography-tandem mass spectrometry were performed as described in the art. Spectra were searched against a UniProt mouse reference proteome using Sequest HT algorithm described by Eng et al. and MS Amanda algorithm developed by Dorfer et al. Search configuration, false discovery control, and quantitation were as described.
Q. RNA-seq
[0095] RNA extraction and RNA-seq was performed by Genewiz (South Plainfield, N.J.) on 20 mg samples of TA muscles from 3-month-old mice from 3 Crym tg littermate and 3 control littermate mice. Genewiz generated FASTQ files of the raw RNA-seq data, after removing transcripts that mapped to introns and transcripts that mapped to multiple genes. p-Values for comparisons of genes expressed in Crym tg and control mice were also from Genewiz.
R. Ca.SUP.2+ Transients
[0096] The amplitude of Ca.sup.2+ transients was recorded as described. In brief, isolated FDB fibers were loaded with Rhod-2AM (Thermo Fisher Scientific, Waltham, Mass.). Trains of voltage-induced Ca.sup.2+ transients were induced by field stimulation (A-M Systems, Carlsborg, Wash.). Rhod-2 was visualized with the Zeiss 510 Duo confocal microscope (Carl Zeiss). Image J 1.31v (NIH) was used for image analysis. The values reported were measured as the difference between maximal fluorescence intensity (F.sub.max) and background fluorescence (F.sub.0), normalized to F.sub.o. Quantitative data are shown as mean±SE. A Student's t-test was used to compare the data with p<0.05 considered statistically significant.
S. Metabolic Chambers
[0097] Data were from two different cohorts of 4 Crym tg and 4 C57BL/6J control mice housed in an Oxymax/CLAMS (Columbus Instruments, Columbus, Ohio) open circuit indirect calorimeter, in two separate experiments. Measurements for RER, Accumulated CO.sub.2, Delta CO.sub.2, CO.sub.2 Out, Heat, Delta 02, Feed Weight, Volume CO.sub.2, Accumulated 02, Feed Accumulation, Z Total, Volume 02, 02 Out, X Total, X Ambulatory, Flow, 02 In, and CO.sub.2 In were taken directly or calculated every 18 minutes for approximately 92 hours.
[0098] Z Total and X Total refer to the total number of times an animal disrupted the infrared (IR) beam in the Z and X axis, respectively, while X Ambulatory refers to the number of times an animal disrupted at least two consecutive IR beams. Complete measurements were compiled and 24 hours' worth of measurements were analyzed, starting at the first dark cycle after a 24 hour period of acclimation. Values were normalized to total body weight and analyzed separately for light and dark periods. Outliers were identified with the ROUT method at Q=1%, with GraphPad™ Prism version 6.0e for Mac (GraphPad™ Software, La Jolla, Calif.). Averages were then calculated for all measurements except for Feed Weight, Feed Accumulation, Z Total, X Total, and X Ambulatory, for which the sums were determined. Each average or sum for each mouse was tested for significance, grouped as a genotype with an unpaired, parametric t-test with Welch's Correction.
T. Diet Studies
[0099] Crym tg and control male and female mice at approximately 14 weeks old were placed on one of five diets. The number of mice on a particular diet varied from 5 to 16, due to the occasional death of a mouse, unrelated to the experiment, or to inability to weigh them on a particular date. The diets were “normal” diet (2018SX, Envigo Madison, Wis.), high fat diet (D12492), low fat diet (D12450J), high simple carbohydrate diet (D15040205), or high complex carbohydrate diet (D12450K), all from Research Diets Inc. (New Brunswick, N.J.) unless otherwise specified. Mouse weight (anaesthetized with 2.5% isoflurane) and food weight were recorded every Monday, Wednesday, and Friday for approximately 60 days. Water was provided ad libitum.
[0100] The results of this experiment show that female Crym tg mice placed on high fat or high simple carbohydrate diet gain weight faster than controls placed on the same diet. Male Crym tg mice placed on low fat or high simple carbohydrate diet trend towards gain weight more slowly compared to controls placed on the same diet. See
U. T.sub.3, T.sub.4, TSH Levels
[0101] Homogenates of TA muscles and serum from four Crym tg and four control mice were sent to the clinical diagnostic service at Vanderbilt University (Nashville, Tenn.) for analysis of T.sub.3, T.sub.4 and TSH.
V. Statistics
[0102] T.sub.3, T.sub.4 and TSH levels were analyzed by a two-tailed t-test with Welch's correction. The thyroid hormone mass (in ng/mL) was divided by total protein (in ng/mL) and used to determine the percent of total thyroid hormone per total protein in a milliliter of serum or homogenized muscle. The negative log base 10 of the percent of total protein for each value was determined and used to calculate the average and standard deviation.
Example 2: Crym Transgenic Mice
[0103] A transgenic mouse in which murine Crym is expressed at high levels in skeletal muscle, comparable to those seen in some human muscle biopsies, was used to assess the effects an abundance of μ-crystallin would have on muscle structure and function, and on metabolism. The Crym transgene was encoded in a plasmid under the control of the human slow troponin I enhancer and the human skeletal actin promoter with the polyadenylation sequence of bovine growth hormone mRNA. (see
TABLE-US-00008 TABLE 7 Mendelian Ratios of Offspring of Crym tg Heterozygotic Parents. Observed Expected Control 15 18 Heterozygote 40 36 Crym tg 16 18
Example 3: RT-qPCR, Western Blot, and Immunofluorescence
[0104] RT-qPCR of several skeletal muscles showed moderate to large increases in Crym mRNA in male Crym tg mice compared to male controls (see
[0105] Nom1 was found to be optimal, showing the most stability. Using Nom1 mRNA as a standard, large increases in the Crym mRNA levels were observed in skeletal muscles of the Crym tg mice, compared both to controls and to heart muscle and non-muscle tissues. Notably, different skeletal muscles in the tg mice differed significantly in their relative expression of Crym. There were no significant differences in Crym mRNA levels in non-skeletal muscle tissues in tg and controls (see
[0106] Western blots were performed of μ-crystallin in Crym tg and control TA muscle extracts. Control mice had 40 μg of TA homogenate per lane, and Crym tg lanes had 10 μg of TA homogenates per lane. μ-crystallin was not detected reliably in controls in these blots. Immunoblotting confirmed that μ-crystallin (Crym) was present in elevated to highly elevated amounts in transgenic skeletal muscles compared to controls (see results in
[0107] Capillary-based immunoblotting in a Wes apparatus (
[0108] We also examined the distribution of μ-crystallin in transgenic muscle. Cross sections (
[0109] The results show that μ-crystallin was detected at higher levels in tg muscles than in controls. In TA muscle and FDB myofibers it was enriched at the levels of the sarcolemma (arrows,
[0110] In cross-sections of TA and flexor digitorum brevis (FDB) muscle, immunolabeling for μ-crystallin was concentrated near the sarcolemma (
Example 4: Hormone Levels
[0111] The levels of different hormones involved in thyroid hormone signaling in Crym tg and control mice were compared. Significantly, more T.sub.3 in the TA muscle (about 190 fold more) of Crym tg mice and significantly less T.sub.4 in the serum (˜1.2 fold less) compared to controls (p<0.001 and p<0.05, respectively). Thyroid stimulating hormone (TSH) was not significantly different in serum (see Table 1) of Crym tg and control mice and, as expected, was not detected in muscle. Intramuscular T.sub.4 and serum T.sub.3 also did not differ significantly between Crym tg and controls. Thus, the large increase in μ-crystallin in murine skeletal muscle is associated with an even larger increase in muscle T.sub.3.
Example 5: Morphology and Physiology
[0112] Different morphological and physiological assays of the structure and function of the transgenic mice showed no significant differences between Crym tgs and controls. The fiber sizes, distribution of fiber sizes, fiber types by immunohistochemistry of myosin heavy chains, weights, and the frequency of centrally nucleated fibers (CNFs) were not significantly altered in the TA muscles of Crym tgs (see
[0113]
[0114] The results show no statistically significant differences in any of these measurements.
[0115] Specific isometric force of contraction, maximal rate of twitch force contraction/relaxation, grip strength, maximum treadmill running speed, and distance run also were indistinguishable between Crym tg and controls (
[0116] Fatiguability in the Crym tg mice showed a trend towards being slower than in controls, but this did not rise to the level of significance (
[0117] Fat staining with BODIPY (493/503) was also the same (
[0118] The average weight of tibialis anterior, gastrocnemius, soleus, and quadriceps muscle, subcutaneous, epididymal, mesenteric, retroperitoneal, and brown adipose fat and the total body weight of control and Crym tg mice is shown in
Example 6: Fiber Types
[0119] A machine learning approach was applied to obtain more quantitative information about the soleus muscles in the Crym tg mouse. No significant differences in the fiber type populations or total number of fibers of Crym tg soleus muscles (782±219 fibers) compared to controls (933±442). Furthermore, the results obtained by determining fiber type visually closely matched the results as determined computationally (
[0120] Using visual evaluation only, no significant differences in myosin-specific fiber type labeling in TA or gastrocnemius muscle cross sections were observed between Crym tg mice and controls (
[0121] For
[0122] For
[0123] STRING analysis of genes with altered expression in the Crym tg was performed. STRING was used to generate clusters of related genes. Disconnected nodes were removed and the interaction score was set to 0.90. MCL clustering with an inflation parameter of 3.0 was used to discern more similar gene clusters. The STRING network analysis showed large clusters of muscle-related genes and metabolically involved genes as well as smaller clusters of genes involved in ubiquitination, filament associated genes, the innate immune system.
Example 7: Metabolism
[0124] Because T.sub.3 can have a profound effect on metabolism, Crym tg and control mice were subjected to metabolic studies in Comprehensive Lab Monitoring System (CLAMS) cages. Eighteen metabolic traits were determined. Six and 4 traits were significantly different between Crym tg and control mice during the light and dark cycles, respectively. See Table 8, below. For this table, traits were measured in OSYMAX-CLAMS cages every 18 minutes for approximately 92 hours in 4 Crym tg and 4 control mice. Twenty-four hours of measurements were retained and segregated by light and dark cycle. The ROUT outlier method was used to remove obviously inaccurate measurement. A t test with Welch's Correction was used to compare Crym tg and control mice (*=p<0.05; **=p<0.005).
[0125] The respiratory exchange ratio (RER), a measure of the oxidative preference for carbohydrates vs fats, was significantly different during both the light and dark cycles, with essentially no change in the overall energy expenditure (Table 8). Table 8 shows the mean RER of the Crym tg and control mice, compared to standardized values. The results show that the oxidative metabolism in the transgenic mice has partially shifted away from the use of carbohydrates as an energy source and towards fats. The difference from controls was 13.7%. Other traits that also differed significantly between Crym tg and control mice in both light and dark periods were Delta CO.sub.2, and Accumulated CO.sub.2 (Table 8). Thus, overexpression of Crym in skeletal muscle has a significant effect on murine preference for fat as a fuel source for energy metabolism.
TABLE-US-00009 TABLE 8 Measured Metabolic Traits. Dark Cycle Light Cycle P value P value Measurement P value summary P value summary RER 0.0107 * 0.0019 ** Delta CO.sub.2 0.0483 * 0.0100 * Accumulated CO.sub.2 0.0489 * 0.0305 * CO.sub.2 out 0.0633 ns 0.0125 * Heat 0.1244 ns 0.0480 * Delta O.sub.2 0.1302 ns 0.0449 * Feed weight 0.0305 * 0.0931 ns Accumulated O.sub.2 0.1522 ns 0.1300 ns Volume CO.sub.2 0.2580 ns 0.1002 ns O.sub.2 out 0.3313 ns 0.4596 ns Feed accumulation 0.4068 ns 0.2860 ns Volume O.sub.2 0.7370 ns 0.3824 ns X total 0.8813 ns 0.4485 ns Flow 0.8909 ns 0.9456 ns CO.sub.2 in 0.9796 ns 0.9963 ns X ambulatory 0.9850 ns 0.1120 ns O.sub.2 in 0.9878 ns 0.9961 ns Z total 0.9919 ns 0.9789 ns
Example 8: Diet Study
[0126] Because the Crym tg mice prefer fats to carbohydrates as an energy source, Crym tg and control mice were fed high fat, low fat, high simple carbohydrate, high complex carbohydrate, and normal control diets. Their weight gain was measured over a period of 2 months. Specifically, Crym tg and control mice were placed on the different diets and weighed over the course of 60 days. See results in
[0127] Significant increases in normalized body weight were seen for female Crym tg mice on the high simple carbohydrate and high fat diets, compared to controls. Female Crym tg mice on the other diets and male Crym tg mice on all 5 of the diets did not gain significantly more or less weight than controls (
Example 9: Global Gene Expression (RNA-Seq)
[0128] The expression of a large number of genes can be affected by T.sub.3 (see Table 1, above, for a list of genes with altered expression in Crym tg muscle that are also altered in hypothyroid or hyperthyroid conditions), which is thought to act largely through thyroid responsive elements (TREs). Since T.sub.3 is present in much higher levels in Crym tg mice, RNA-seq was performed on TA muscle samples from 3 Crym tg and 3 control mice. More than 13,000 transcripts from approximately 8.4×10.sup.8 reads were measured. The samples had an average Q score>37 with approximately 87% of bases having a Q score greater than 30. After removing transcripts that aligned to introns or that mapped to multiple genes, and after Benjamini-Hochberg False Discovery Rate (FDR) correction, 566 genes were significantly different between Crym tg and controls at α=0.05 (see Table 9, below, a list of genes with altered expression in Crym tg muscle, determined by RNA-seq).
[0129] Gene ontology (GO) analysis revealed a relative decrease in the expression of genes encoding proteins involved in glycolysis and glycogen metabolism and in fast contractile speeds, and an increase in the expression of genes associated with oxidative metabolism and slower contraction (Table 3, Table 10). Ontological terms in Table 10 were derived from a list of 566 DEGs discovered via RNA-seq comparing Crym tg mice to controls. STRING network analysis also showed clusters of genes involved in ubiquitination, filament associated genes, and the innate immune system. After Benjamini-Hochberg FDR correction, DAVID chromosome annotation showed significantly more (p=5.7E-7) differentially expressed transcripts arising from chromosome 6 than would be expected. Notably, only 7 of the 566 DEGs contained putative TREs. See Table 2, above. For this table, a list of genes containing thyroid responsive elements (TREs) was generated from two computed TRE searches and one literatures review. This list of genes containing TREs which can act to promote or suppress the transcription of downstream genes in response to thyroid receptor complexes was cross referenced with 566 significant DEGs found via RNA-seq comparing the TA of Crym tg to the TA of control mice.
TABLE-US-00010 TABLE 9 Genes with Altered Expression in Crym tg Muscle, Determined by RNA-seq. Gene Gene Symbol Gene Name Symbol Gene Name Crym crystallin, mu(Crym) Lmcd1 LIM and cysteine-rich domains 1(Lmcd1) Gapdh glyceraldehyde-3-phosphate Dnaja4 DnaJ heat shock protein family (Hsp40) member dehydrogenase(Gapdh) A4(Dnaja4) Fhl1 four and a half LIM domains 1(Fhl1) Atp1b1 ATPase, Na+/K+ transporting, beta 1 polypeptide(Atp1b1) Lrrnl leucine rich repeat protein 1, Hspb7 heat shock protein family, member 7 neuronal(Lrrn1) (cardiovascular)(Hspb7) Actn2 actinin alpha 2(Actn2) H2-Q7 histocompatibility 2, Q region locus 7(H2-Q7) Myh2 myosin, heavy polypeptide 2, skeletal Mettl21c methyltransferase like 21C(Mettl21c) muscle, adult(Myh2) Gbe1 glucan (1,4-alpha-), branching enzyme Vldlr very low density lipoprotein receptor(Vldlr) 1(Gbe1) Cryab crystallin, alpha B(Cryab) Hspb6 heat shock protein, alpha-crystallin-related, B6(Hspb6) Myoz2 myozenin 2(Myoz2) Slc16a1 solute carrier family 16 (monocarboxylic acid transporters), member 1(Slc16a1) Amd1 S-adenosylmethionine decarboxylase Kbtbd12 kelch repeat and BTB (POZ) domain containing 1(Amd1) 12(Kbtbd12) Car14 carbonic anhydrase 14(Car14) Tspan12 tetraspanin 12(Tspan12) H2-Q6 histocompatibility 2, Q region locus 6(H2- Ybx3 Y box protein 3(Ybx3) Q6) Eepd1 endonuclease/exonuclease/phosphatase Nrep neuronal regeneration related protein(Nrep) family domain containing 1(Eepd1) Slc40a1 solute carrier family 40 (iron-regulated Cops7a COP9 signalosome subunit 7A(Cops7a) transporter), member 1(Slc40a1) Pik3r1 phosphatidylinositol 3-kinase, regulatory Padi2 peptidyl arginine deiminase, type II(Padi2) subunit, polypeptide 1 (p85 alpha)(Pik3r1) Ehd4 EH-domain containing 4(Ehd4) Tbc1d1 TBC1 domain family, member 1(Tbc1d1) Slc41a3 solute carrier family 41, member Myh1 myosin, heavy polypeptide 1, skeletal muscle, 3(Slc41a3) adult(Myh1) Smox spermine oxidase(Smox) Itpr1 inositol 1,4,5-trisphosphate receptor 1(Itpr1) Slc15a5 solute carrier family 15, member Dynit1b dynein light chain Tctex-type 1B(Dynit1b) 5(Slc15a5) Actr3b ARP3 actin-related protein 3B(Actr3b) Abra actin-binding Rho activating protein(Abra) Myoz1 myozenin 1(Myoz1) Ptpn3 protein tyrosine phosphatase, non-receptor type 3(Ptpn3) Stbd1 starch binding domain 1(Stbd1) Htra4 HtrA serine peptidase 4(Htra4) Wbscr17 Williams-Beuren syndrome chromosome Amot angiomotin(Amot) region 17 homolog (human)(Wbscr17) Ckmt2 creatine kinase, mitochondrial 2(Ckmt2) Cdk19 cyclin-dependent kinase 19(Cdk19) Ube2d1 ubiquitin-conjugating enzyme E2D1 Flnc filamin C, gamma(Flnc) (Ube2d1) 9330159F19Rik RIKEN cDNA 9330159F19 Egln3 egl-9 family hypoxia-inducible factor 3(Egln3) gene(9330159F19Rik) Aldh1a1 aldehyde dehydrogenase family 1, Tmem233 transmembrane protein 233(Tmem233) subfamily A1(Aldh1a1) Pde8a phosphodiesterase 8A(Pde8a) Slc30a2 solute carrier family 30 (zinc transporter), member 2(Slc30a2) Spns2 spinster homolog 2(Spns2) G0s2 G0/G1 switch gene 2(G0s2) Ip6k3 inositol hexaphosphate kinase 3(Ip6k3) Cpeb1 cytoplasmic polyadenylation element binding protein 1(Cpeb1) Pvalb parvalbumin(Pvalb) Cacna2d4 calcium channel, voltage-dependent, alpha 2/delta subunit 4(Cacna2d4) Ankrd2 ankyrin repeat domain 2 (stretch Stom stomatin(Stom) responsive muscle)(Ankrd2) Eci1 enoyl-Coenzyme A delta isomerase Casp12 caspase 12(Casp12) 1(Eci1) Plcd4 phospholipase C, delta 4(Plcd4) H2-Q4 histocompatibility 2, Q region locus 4(H2-Q4) A930018M24Rik Slc25a25 solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25(Slc25a25) H2-D1 histocompatibility 2, D region locus 1(H2- Col7a1 collagen, type VII, alpha 1(Col7a1) D1) Calm3 calmodulin 3(Calm3) Stat5b signal transducer and activator of transcription 5B(Stat5b) Mgst1 microsomal glutathione S-transferase Adck3 coenzyme Q8A(Coq8a) 1(Mgst1) Ociad2 OCIA domain containing 2(Ociad2) Klhl33 kelch-like 33(Klhl33) Mlf1 myeloid leukemia factor 1(M1f1) Sbk2 SH3-binding domain kinase family, member 2(Sbk2) Tmem65 transmembrane protein 65(Tmem65) Ankrd23 ankyrin repeat domain 23(Ankrd23) Slc38a10 solute carrier family 38, member Plekhb1 pleckstrin homology domain containing, family 10(Slc38a10) B (evectins) member 1(Plekhb1) Myod1 myogenic differentiation 1(Myod1) Abhd18 abhydrolase domain containing 18(Abhd18) Trim63 tripartite motif-containing 63(Trim63) Adamtsl4 ADAMTS-like 4(Adamtsl4) Zfand5 zinc finger, AN1-type domain 5(Zfand5) Dgat2 diacylglycerol O-acyltransferase 2(Dgat2) Kcnn3 potassium intermediate/small conductance calcium-activated channel, subfamily N, Npc1 Niemann-Pick type C1(Npc1) member 3(Kcnn3) Adh1 alcohol dehydrogenase 1 (class I)(Adh1) Kcnc1 potassium voltage gated channel, Shaw-related subfamily, member 1(Kcnc1) Nr1d1 nuclear receptor subfamily 1, group D, P2ry2 purinergic receptor P2Y, G-protein coupled member 1(Nr1d1) 2(P2ry2) Smim10l1 small integral membrane protein 10 like Ugp2 UDP-glucose pyrophosphorylase 2(Ugp2) 1(Smim10l1) Rbfox1 RNA binding protein, fox-1 homolog (C. Homer2 homer scaffolding protein 2(Homer2) elegans) 1(Rbfox1) Slc47a1 solute carrier family 47, member Ak4 adenylate kinase 4(Ak4) 1(Slc47a1) Sorbs2 sorbin and SH3 domain containing Mdh1 malate dehydrogenase 1, NAD (soluble)(Mdh1) 2(Sorbs2) Apol6 apolipoprotein L 6(Apol6) Ltbr lymphotoxin B receptor(Ltbr) Gpr19 G protein-coupled receptor 19(Gpr19) Plpp1 phospholipid phosphatase 1(Plpp1) Emp1 epithelial membrane protein 1(Emp1) Klhl31 kelch-like 31(Klhl31) Tmod4 tropomodulin 4(Tmod4) Pcx pyruvate carboxylase(Pcx) Mustn1 musculoskeletal, embryonic nuclear Slc43a1 solute carrier family 43, member 1(Slc43a1) protein 1(Mustn1) Slc2a3 solute carrier family 2 (facilitated glucose Bpgm 2,3-bisphosphoglycerate mutase(Bpgm) transporter), member 3(Slc2a3) Irf5 interferon regulatory factor 5(Irf5) Neto2 neuropilin (NRP) and tolloid (TLL)-like 2(Neto2) Spryd7 SPRY domain containing 7(Spryd7) Actn3 actinin alpha 3(Actn3) Myot myotilin(Myot) Srpr signal recognition particle receptor (‘docking protein’)(Srpr) Vim vimentin(Vim) Ssx2ip synovial sarcoma, X breakpoint 2 interacting protein(Ssx2ip) P2ry1 purinergic receptor P2Y, G-protein Dusp18 dual specificity phosphatase 18(Dusp18) coupled 1(P2ry1) Cbfb core binding factor beta(Cbfb) Ralgapa2 Ral GTPase activating protein, alpha subunit 2 (catalytic)(Ralgapa2) Nos1 nitric oxide synthase 1, neuronal(Nos1) Asb15 ankyrin repeat and SOCS box-containing 15(Asb15) Gm44386 Nmrk2 nicotinamide riboside kinase 2(Nmrk2) Rad52 RAD52 homolog, DNA repair Myh4 myosin, heavy polypeptide 4, skeletal protein(Rad52) muscle(Myh4) Hfe2 hemochromatosis type 2 (juvenile)(Hfe2) Acss2 acyl-CoA synthetase short-chain family member 2(Acss2) Ddit41 DNA-damage-inducible transcript 4- Trafd1 TRAF type zinc finger domain containing like(Ddit41) 1(Trafd1) Klhl34 kelch-like 34(Klhl34) Got2 glutamatic-oxaloacetic transaminase 2, mitochondrial(Got2) Fmo2 flavin containing monooxygenase 2(Fmo2) Myl12a myosin, light chain 12A, regulatory, non- sarcomeric(Myl12a) Tmod1 tropomodulin 1(Tmod1) Csrp3 cysteine and glycine-rich protein 3(Csrp3) Esr1 estrogen receptor 1 (alpha)(Esr1) Pla2g12a phospholipase A2, group XIIA(Pla2g12a) Timm44 translocase of inner mitochondrial Prkag3 protein kinase, AMP-activated, gamma 3 non- membrane 44(Timm44) catatlytic subunit(Prkag3) Tiparp TCDD-inducible poly(ADP-ribose) Dlst dihydrolipoamide S-succinyltransferase (E2 polymerase(Tiparp) component of 2-oxo-glutarate complex)(Dlst) Dapp1 dual adaptor for phosphotyrosine and 3- Tead4 TEA domain family member 4(Tead4) phosphoinositides 1(Dapp1) Btg2 B cell translocation gene 2, anti- Sar1b secretion associated Ras related GTPase proliferative(Btg2) 1B(Sar1b) Rps6ka5 ribosomal protein S6 kinase, polypeptide Ntng2 netrin G2(Ntng2) 5(Rps6ka5) Tmem63a transmembrane protein 63a(Tmem63a) Iqsec2 IQ motif and Sec7 domain 2(Iqsec2) Rgcc regulator of cell cycle(Rgcc) Mospd1 motile sperm domain containing 1(Mospd1) Ndufa9 NADH dehydrogenase (ubiquinone) 1 Cyp27a1 cytochrome P450, family 27, subfamily a, alpha subcomplex, 9(Ndufa9) polypeptide 1(Cyp27a1) Sec24a Sec24 related gene family, member A (S. Rab12 RAB12, member RAS oncogene family(Rab12) cerevisiae)(Sec24a) Fhod1 formin homology 2 domain containing Ank2 ankyrin 2, brain(Ank2) 1(Fhod1) Nid1 nidogen 1(Nid1) 2310040G24Rik RIKEN cDNA 2310040G24 gene(2310040G24Rik) Scn4b sodium channel, type IV, beta(Scn4b) Maf avian musculoaponeurotic fibrosarcoma oncogene homolog(Maf) Ttll4 tubulin tyrosine ligase-like family, member Wfs1 Wolfram syndrome 1 homolog (human)(Wfs1) 4(Ttll4) Thnsl2 threonine synthase-like 2 Alpl alkaline phosphatase, liver/bone/kidney(Alpl) (bacterial)(Thnsl2) 9830004L10Rik Zfp703 zinc finger protein 703(Zfp703) Ddx47 DEAD (Asp-Glu-Ala-Asp) box Ppargc1a peroxisome proliferative activated receptor, polypeptide 47(Ddx47) gamma, coactivator 1 alpha(Ppargc1a) B2m beta-2 microglobulin(B2m) Rhot2 ras homolog family member T2(Rhot2) Zfp9 zinc finger protein 9(Zfp9) Rsrp1 arginine/serine rich protein 1(Rsrp1) Mcm2 minichromosome maintenance complex Alas1 aminolevulinic acid synthase 1(Alas1) component 2(Mcm2) Npnt nephronectin(Npnt) Sqstm1 sequestosome 1(Sqstm1) Lsmem1 leucine-rich single-pass membrane protein Tmem246 transmembrane protein 246(Tmem246) 1(Lsmem1) Borcs5 BLOC-1 related complex subunit Myom3 myomesin family, member 3(Myom3) 5(Borcs5) Lynx1 Ly6/neurotoxin 1(Lynx1) Deptor DEP domain containing MTOR-interacting protein(Deptor) Fam131a family with sequence similarity 131, Amd2 S-adenosylmethionine decarboxylase 2(Amd2) member A(Fam131a) Chmp4c charged multivesicular body protein Slc22a4 solute carrier family 22 (organic cation 4C(Chmp4c) transporter), member 4(Slc22a4) Pim1 proviral integration site 1(Pim1) Mlec malectin(Mlec) Wnt5b wingless-type MMTV integration site Tulp3 tubby-like protein 3(Tulp3) family, member 5B(Wnt5b) Mrpl35 mitochondrial ribosomal protein Mrln myoregulin(Mrln) L35(Mrpl35) Mib1 mindbomb E3 ubiquitin protein ligase Tmem140 transmembrane protein 140(Tmem140) 1(Mib1) Bhlhe41 basic helix-loop-helix family, member Lpl lipoprotein lipase(Lpl) e41(Bhlhe41) Raver2 ribonucleoprotein, PTB-binding 2(Raver2) Tln1 talin 1(Tln1) Xpr1 xenotropic and polytropic retrovirus Hk2 hexokinase 2(Hk2) receptor 1(Xpr1) Acadvl acyl-Coenzyme A dehydrogenase, very Lamb2 laminin, beta 2(Lamb2) long chain(Acadvl) Park7 Parkinson disease (autosomal recessive, Trim24 tripartite motif-containing 24(Trim24) early onset) 7(Park7) Slc25a11 solute carrier family 25 (mitochondrial Osbpl3 oxysterol binding protein-like 3(Osbpl3) carrier oxoglutarate carrier), member 11(Slc25a11) Vgll2 vestigial like family member 2(Vgll2) Eif4ebp1 eukaryotic translation initiation factor 4E binding protein 1(Eif4ebp1) Gpt2 glutamic pyruvate transaminase (alanine Pgm2 phosphoglucomutase 2(Pgm2) aminotransferase) 2(Gpt2) Ldhb lactate dehydrogenase B(Ldhb) Kcnq5 potassium voltage-gated channel, subfamily Q, member 5(Kcnq5) Abcg2 ATP-binding cassette, sub-family G Rnf114 ring finger protein 114(Rnf114) (WHITE), member 2(Abcg2) Dbp D site albumin promoter binding Sub1 SUB1 homolog (S. cerevisiae)(Sub1) protein(Dbp) Tmtc1 transmembrane and tetratricopeptide repeat Slc12a4 solute carrier family 12, member 4(Slc12a4) containing 1(Tmtc1) Leo1 Leo1, Paf1/RNA polymerase II complex Etl4 enhancer trap locus 4(Etl4) component(Leo1) Msrb1 methionine sulfoxide reductase B1(Msrb1) Slc37a4 solute carrier family 37 (glucose-6-phosphate transporter), member 4(Slc37a4) Igfn1 immunoglobulin-like and fibronectin type Stac3 SH3 and cysteine rich domain 3(Stac3) III domain containing 1(Igfnl) Ctsf cathepsin F(Ctsf) Adamtsl5 ADAMTS-like 5(Adamtsl5) Atp1a1 ATPase, Na+/K+ transporting, alpha 1 Mgea5 meningioma expressed antigen 5 polypeptide(Atp1a1) (hyaluronidase)(Mgea5) Gbp10 guanylate-binding protein 10(Gbp10) Phkb phosphorylase kinase beta(Phkb) H19 H19, imprinted maternally expressed Lrp6 low density lipoprotein receptor-related protein transcript(H19) 6(Lrp6) A330023F24Rik RIKEN cDNA A330023F24 Hist1h4i histone cluster 1, H4i(Hist1h4i) gene(A330023F24Rik) Anks1 ankyrin repeat and SAM domain Pnck pregnancy upregulated non-ubiquitously containing 1(Anks1) expressed CaM kinase(Pnck) Gm5113 predicted gene 5113(Gm5113) Slc43a3 solute carrier family 43, member 3(Slc43a3) Myoz3 myozenin 3(Myoz3) Nmt2 N-myristoyltransferase 2(Nmt2) Ldb3 LIM domain binding 3(Ldb3) Tmem106b transmembrane protein 106B(Tmem106b) Pygm muscle glycogen phosphorylase(Pygm) Myl3 myosin, light polypeptide 3(Myl3) Setd7 SET domain containing (lysine Asb14 ankyrin repeat and SOCS box-containing methyltransferase) 7(Setd7) 14(Asb14) Aak1 AP2 associated kinase 1(Aak1) Tagln transgelin(Tagln) Fzd5 frizzled class receptor 5(Fzd5) Slc16a10 solute carrier family 16 (monocarboxylic acid transporters), member 10(Slc16a10) Fry FRY microtubule binding protein(Fry) Tead1 TEA domain family member 1(Tead1) Cbr2 carbonyl reductase 2(Cbr2) Ppara peroxisome proliferator activated receptor alpha(Ppara) Irs2 insulin receptor substrate 2(Irs2) Myh10 myosin, heavy polypeptide 10, non- muscle(Myh10) Hnrnph1 heterogeneous nuclear ribonucleoprotein Epas1 endothelial PAS domain protein 1(Epas1) H1 (Hnrnph1) Anapc5 anaphase-promoting complex subunit Tfcp2l1 transcription factor CP2-like 1(Tfcp2l1) 5(Anapc5) Col9a1 collagen, type IX, alpha 1(Col9a1) Hbp1 high mobility group box transcription factor 1(Hbp1) Rnf150 ring finger protein 150(Rnf150) Fmo1 flavin containing monooxygenase 1(Fmo1) Tiam1 T cell lymphoma invasion and metastasis Bace1 beta-site APP cleaving enzyme 1(Bace1) 1(Tiam1) Got1 glutamic-oxaloacetic transaminase 1, Ogt O-linked N-acetylglucosamine (GlcNAc) soluble(Got1) transferase (UDP-N- acetylglucosamine:polypeptide-N- acetylglucosaminyl transferase)(Ogt) Car3 carbonic anhydrase 3(Car3) Tigar Trp53 induced glycolysis repulatory phosphatase(Tigar) Polr1a polymerase (RNA) I polypeptide Ciapin1 cytokine induced apoptosis inhibitor 1(Ciapin1) A(Polr1a) Mgll monoglyceride lipase(Mgll) Fam234b family with sequence similarity 234, member B(Fam234b) Atp2b3 ATPase, Ca++ transporting, plasma Lrrc38 leucine rich repeat containing 38(Lrrc38) membrane 3(Atp2b3) Ndufb5 NADH dehydrogenase (ubiquinone) 1 beta March7 membrane-associated ring finger (C3HC4) subcomplex, 5(Ndufb5) 7(March7) Rtn4 reticulon 4(Rtn4) Slc16a3 solute carrier family 16 (monocarboxylic acid transporters), member 3(Slc16a3) Perm1 PPARGC1 and ESRR induced regulator, Cux2 cut-like homeobox 2(Cux2) muscle 1(Perm1) Mtx2 metaxin 2(Mtx2) Fzd7 frizzled class receptor 7(Fzd7) Smyd1 SET and MYND domain containing Gadd45b growth arrest and DNA-damage-inducible 45 1(Smyd1) beta(Gadd45b) Plpp7 phospholipid phosphatase 7 Lum lumican(Lum) (inactive)(Plpp7) C1s1 complement component 1, s subcomponent Fhl3 four and a half LIM domains 3(Fhl3) 1(C1s1) Bag3 BCL2-associated athanogene 3(Bag3) Oxnad1 oxidoreductase NAD-binding domain containing 1(Oxnad1) Ttc19 tetratricopeptide repeat domain 19(Ttc19) Mga MAX gene associated(Mga) Fam213b family with sequence similarity 213, Slc38a3 solute carrier family 38, member 3(Slc38a3) member B(Fam213b) Neu2 neuraminidase 2(Neu2) Kctd20 potassium channel tetramerisation domain containing 20(Kctd20) Akap11 A kinase (PRKA) anchor protein Mybpc2 myosin binding protein C, fast-type(Mybpc2) 11(Akap11) Myh11 myosin, heavy polypeptide 11, smooth Sfxn3 sideroflexin 3(Sfxn3) muscle(Myh11) Lmod2 leiomodin 2 (cardiac)(Lmod2) Smarca2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2(Smarca2) Pdlim1 PDZ and LIM domain 1 (elfin)(Pdlim1) Suclg2 succinate-Coenzyme A ligase, GDP-forming, beta subunit(Suclg2) Zxdc ZXD family zinc finger C(Zxdc) Slc16a2 solute carrier family 16 (monocarboxylic acid transporters), member 2(Slc16a2) Tmem52 transmembrane protein 52(Tmem52) Cfd complement factor D (adipsin)(Cfd) Ndufs8 NADH dehydrogenase (ubiquinone) Fe-S Sorl1 sortilin-related receptor, LDLR class A repeats- protein 8(Ndufs8) containing(Sorl1) Me1 malic enzyme 1, NADP(+)-dependent, Dok7 docking protein 7(Dok7) cytosolic(Me1) Nqo1 NAD(P)H dehydrogenase, quinone Ly6c1 lymphocyte antigen 6 complex, locus C1(Ly6c1) 1(Nqo1l) Fam195a family with sequence similarity 195, Atp5g1 ATP synthase, H+ transporting, mitochondrial member A(Fam195a) F0 complex, subunit C1 (subunit 9)(Atp5g1) Psmd8 proteasome (prosome, macropain) 26S Gramd1b GRAM domain containing 1B(Gramd1b) subunit, non-ATPase, 8(Psmd8) Cd36 CD36 antigen(Cd36) Carnmt1 carnosine N-methyltransferase 1(Carnmt1) Vps72 vacuolar protein sorting 72(Vps72) Apbb2 amyloid beta (A4) precursor protein-binding, family B, member 2(Apbb2) D930015E06Rik RIKEN cDNA D930015E06 Chd2 chromodomain helicase DNA binding protein gene(D930015E06Rik) 2(Chd2) H2-K1 histocompatibility 2, K1, K region(H2-K1) Ttll7 tubulin tyrosine ligase-like family, member 7(Ttll7) Kalrn kalirin, RhoGEF kinase(Kalrn) Pde7a phosphodiesterase 7A(Pde7a) Hebp1 heme binding protein 1(Hebp1) Psme4 proteasome (prosome, macropain) activator subunit 4(Psme4) Amigo1 adhesion molecule with Ig like domain Chrnb1 cholinergic receptor, nicotinic, beta polypeptide 1(Amigo1) 1 (muscle)(Chrnb1) Tbc1d16 TBC1 domain family, member Nfkbia nuclear factor of kappa light polypeptide gene 16(Tbc1d16) enhancer in B cells inhibitor, alpha(Nfkbia) Gpr157 G protein-coupled receptor 157(Gpr157) Mylk4 myosin light chain kinase family, member 4(Mylk4) Actg1 actin, gamma, cytoplasmic 1(Actg1l) Mt1 metallothionein 1(Mt1) Slc25a26 solute carrier family 25 (mitochondrial Adamts8 a disintegrin-like and metallopeptidase carrier, phosphate carrier), member (reprolysin type) with thrombospondin type 1 26(Slc25a26) motif, 8(Adamts8) Zranb1 zinc finger, RAN-binding domain Lgalsl lectin, galactoside binding-like(Lgalsl) containing 1(Zranb1) Adck1 aarF domain containing kinase 1(Adck1) Ppif peptidylprolyl isomerase F (cyclophilin F)(Ppif) solute carrier family 41, member Col8a1 collagen, type VIII, alpha 1(Col8a1) Slc41a1 1(Slc41a1) Atl2 atlastin GTPase 2(Atl2) Ptprk protein tyrosine phosphatase, receptor type, K(Ptprk) Acaca acetyl-Coenzyme A carboxylase Gpt glutamic pyruvic transaminase, soluble(Gpt) alpha(Acaca) Murc muscle-related coiled-coil protein(Murc) Klhl38 kelch-like 38(Klhl38) Ddi2 DNA-damage inducible protein 2(Ddi2) Zfp956 zinc finger protein 956(Zfp956) Sorbs1 sorbin and SH3 domain containing Rhobtb3 Rho-related BTB domain containing 3(Rhobtb3) 1 (Sorbs1) Serpinb6a serine (or cysteine) peptidase inhibitor, Sema3b sema domain, immunoglobulin domain (Ig), clade B, member 6a(Serpinb6a) short basic domain, secreted, (semaphorin) 3B(Sema3b) Hhatl hedgehog acyltransferase-like(Hhatl) Tuba8 tubulin, alpha 8(Tuba8) D1Ertd622e DNA segment, Chr 1, ERATO Doi 622, B3galnt2 UDP-GalNAc:betaGlcNAc beta 1,3- expressed(D1Ertd622e) galactosaminyltransferase, polypeptide 2(B3galnt2) Pcbp1 poly(rC) binding protein 1(Pcbp1) Ccrl2 chemokine (C-C motif) receptor-like 2(Ccrl2) Macf1 microtubule-actin crosslinking factor Itga7 integrin alpha 7(Itga7) 1(Macf1) Fbxo40 F-box protein 40(Fbxo40) Ky kyphoscoliosis peptidase(Ky) Ccdc50 coiled-coil domain containing 50(Ccdc50) Mapre2 microtubule-associated protein, RP/EB family, member 2(Mapre2) Rcl1 RNA terminal phosphate cyclase-like Rhbdl1 rhomboid, veinlet-like 1 (Drosophila)(Rhbdl1) 1(Rcl1) Myo1e myosin IE(Myo1e) Ptges2 prostaglandin E synthase 2(Ptges2) Wnt4 wingless-type MMTV integration site Plekhb2 pleckstrin homology domain containing, family family, member 4(Wnt4) B (evectins) member 2(Plekhb2) Dusp13 dual specificity phosphatase 13(Dusp13) Mtfp1 mitochondrial fission process 1(Mtfp1) Gid4 GID complex subunit 4, VID24 Rnf126 ring finger protein 126(Rnf126) homolog(Gid4) Tnip1 TNFAIP3 interacting protein 1(Tnip1) Igfbp5 insulin-like growth factor binding protein 5(Igfbp5) Pick1 protein interacting with C kinase 1(Pick1) Gpx3 glutathione peroxidase 3(Gpx3) Sdhaf4 succinate dehydrogenase complex Pik3ip1 phosphoinositide-3-kinase interacting protein assembly factor 4(Sdhaf4) 1(Pik3ip1) Fnip1 folliculin interacting protein 1(Fnip1) Prdx2 peroxiredoxin 2(Prdx2) Vegfb vascular endothelial growth factor Nudt8 nudix (nucleoside diphosphate linked moiety B(Vegfb) X)-type motif 8(Nudt8) Spsb1 splA/ryanodine receptor domain and Paqr7 progestin and adipoQ receptor family member SOCS box containing 1(Spsb1) VII(Paqr7) Cnnm4 cyclin M4(Cnnm4) Lrg1 leucine-rich alpha-2-glycoprotein 1(Lrg1) Zfp275 zinc finger protein 275(Zfp275) Esrrb estrogen related receptor, beta(Esrrb) Aldh2 aldehyde dehydrogenase 2, Ddr1 discoidin domain receptor family, member mitochondrial(Aldh2) 1(Ddr1) Akap8l A kinase (PRKA) anchor protein 8- Nup210 nucleoporin 210(Nup210) like(Akap8l) Agl amylo-1,6-glucosidase, 4-alpha- Prdx5 peroxiredoxin 5(Prdx5) glucanotransferase(Agl) Rhob ras homolog family member B(Rhob) Srsf5 serine/arginine-rich splicing factor 5(Srsf5) Strbp spermatid perinuclear RNA binding Ogdh oxoglutarate (alpha-ketoglutarate) protein(Strbp) dehydrogenase (lipoamide)(Ogdh) Rbm24 RNA binding motif protein 24(Rbm24) Fam57b family with sequence similarity 57, member B(Fam57b) Fgf1 fibroblast growth factor 1(Fgf1) Fermt2 fermitin family member 2(Fermt2) Noct nocturnin(Noct) Rtn4ip1 reticulon 4 interacting protein 1(Rtn4ip1) Camta1 calmodulin binding transcription activator Marveld1 MARVEL (membrane-associating) domain 1(Camta1) containing 1(Marveld1) Sema6c sema domain, transmembrane domain Pnpla2 patatin-like phospholipase domain containing (TM), and cytoplasmic domain, 2(Pnpla2) (semaphorin) 6C(Sema6c) Lgals1 lectin, galactose binding, soluble 1(Lgals1) Ogg1 8-oxoguanine DNA-glycosylase 1(Ogg1) Snx12 sorting nexin 12(Snx12) Phka1 phosphorylase kinase alpha 1(Phka1) Ccdc91 coiled-coil domain containing 91(Ccdc91) Cdc42ep2 CDC42 effector protein (Rho GTPase binding) 2(Cdc42ep2) Dlat dihydrolipoamide S-acetyltransferase (E2 Dnase1l1 deoxyribonuclease 1-like 1(Dnase1l1) component of pyruvate dehydrogenase complex)(Dlat) Atf7ip activating transcription factor 7 interacting Adprhl1 ADP-ribosylhydrolase like 1(Adprhl1) protein(Atf7ip) Cobll1 Cobl-like 1(Cobll1) Ctsb cathepsin B(Ctsb) Atp1a2 ATPase Na+/K+ transporting, alpha 2 Pdha1 pyruvate dehydrogenase E1 alpha 1(Pdha1) polypeptide(Atp1a2) Sdhd succinate dehydrogenase complex, subunit Tns1 tensin 1(Tns1) D, integral membrane protein(Sdhd) Hmcn2 hemicentin 2(Hmcn2) Ttc9 tetratricopeptide repeat domain 9(Ttc9) Fat3 FAT atypical cadherin 3(Fat3) Rgs5 regulator of G-protein signaling 5(Rgs5) Sdhb succinate dehydrogenase complex, subunit Gpcpd1 glycerophosphocholine phosphodiesterase B, iron sulfur (Ip)(Sdhb) 1(Gpcpd1) Gpd1 glycerol-3-phosphate dehydrogenase 1 Rmi2 RecQ mediated genome instability 2(Rmi2) (soluble)(Gpd1) Ccng1 cyclin G1(Ccng1) Fam21 family with sequence similarity 21(Fam21) Notch3 notch 3(Notch3) Slc45a4 solute carrier family 45, member 4(Slc45a4) Amotl1 angiomotin-like 1(Amotl1) Amer1 APC membrane recruitment 1(Amer1) Casq1 calsequestrin 1(Casq1) Phkg1 phosphorylase kinase gamma 1(Phkg1) Pdhb pyruvate dehydrogenase (lipoamide) Lgmn legumain(Lgmn) beta(Pdhb) 2310015K22Rik P2rx5 purinergic receptor P2X, ligand-gated ion channel, 5(P2rx5) Celf2 CUGBP, Elav-like family member Dennd5a DENN/MADD domain containing 5A(Dennd5a) 2(Celf2) Rian maternally Expressed S. Small Nucleolar Gclc glutamate-cysteine ligase, catalytic RNA Host Gene(Rian) subunit(Gclc) Atp2b4 ATPase, Ca++ transporting, plasma Capza2 capping protein (actin filament) muscle Z-line, membrane 4(Atp2b4) alpha 2(Capza2) Dusp26 dual specificity phosphatase 26 Sesn1 sestrin 1(Sesn1) (putative)(Dusp26) Abcb9 ATP-binding cassette, sub-family B Zbtb38 zinc finger and BTB domain containing (MDR/TAP), member 9(Abcb9) 38(Zbtb38) Tuba4a tubulin, alpha 4A(Tuba4a) Ppp1r15a protein phosphatase 1, regulatory (inhibitor) subunit 15A(Ppp1r15a) Rom1 rod outer segment membrane protein Nnt nicotinamide nucleotide transhydrogenase(Nnt) 1(Rom1) Sirt3 sirtuin 3(Sirt3) Ypel3 yippee-like 3 (Drosophila)(Ypel3) Plbd1 phospholipase B domain containing Rhno1 RAD9-HUS1-RAD1 interacting nuclear orphan 1(Plbd1) 1(Rhno1) Ctsc cathepsin C(Ctsc) Mrps36 mitochondrial ribosomal protein S36(Mrps36) Inha inhibin alpha(Inha) Fam234a family with sequence similarity 234, member A(Fam234a) Camk2a calcium/calmodulin-dependent protein 2310001H17Rik RIKEN cDNA 2310001H17 kinase II alpha(Camk2a) gene(2310001H17Rik) Synm synemin, intermediate filament Ksr1 kinase suppressor of ras 1(Ksr1) protein(Synm) Hivep3 human immunodeficiency virus type I Tcp11l2 t-complex 11 (mouse) like 2(Tcp11l2) enhancer binding protein 3(Hivep3) Pecam1 platelet/endothelial cell adhesion molecule B4galt1 UDP-Gal:betaGlcNAc beta 1,4- 1(Pecam1) galactosyltransferase, polypeptide 1 (B4galt1) Tbrg4 transforming growth factor beta regulated Wnk1 WNK lysine deficient protein kinase 1(Wnk1) gene 4(Tbrg4) Chid1 chitinase domain containing 1(Chid1) Hccs holocytochrome c synthetase(Hccs) Gm14698 Zranb2 zinc finger, RAN-binding domain containing 2(Zranb2) Mrm1 mitochondrial rRNA methyltransferase Atp2a3 ATPase, Ca++ transporting, ubiquitous(Atp2a3) 1(Mrm1) Calm2 calmodulin 2(Calm2) Mapk12 mitogen-activated protein kinase 12(Mapk12) Nrap nebulin-related anchoring protein(Nrap) Smtnl2 smoothelin-like 2(Smtnl2) Acaa2 acetyl-Coenzyme A acyltransferase 2 Mybpc1 myosin binding protein C, slow-type(Mybpc1) (mitochondrial 3-oxoacyl-Coenzyme A thiolase)(Acaa2) Gys1 glycogen synthase 1, muscle(Gys1) Abcd2 ATP-binding cassette, sub-family D (ALD), member 2(Abcd2) Plekhh3 pleckstrin homology domain containing, Mb21d2 Mab-21 domain containing 2(Mb21d2) family H (with MyTH4 domain) member 3(Plekhh3) Atp5g3 ATP synthase, H+transporting, Tmem25 transmembrane protein 25(Tmem25) mitochondrial F0 complex, subunit C3 (subunit 9)(Atp5g3) Lrp4 low density lipoprotein receptor-related Abca9 ATP-bindingcassette, sub-family A (ABC1), protein 4(Lrp4) member 9(Abca9) Mrpl47 mitochondrial ribosomal protein Tgfb2 transforming growth factor, beta 2(Tgfb2) L47(Mrpl47) Coq10a coenzyme Q10A(Coq10a) Fam210a family with sequence similarity 210, member A(Fam210a) Mb myoglobin(Mb) Lace1 lactation elevated 1(Lace1) Sccpdh saccharopine dehydrogenase Pigp phosphatidylinositol glycan anchor biosynthesis, (putative)(Sccpdh) class P(Pigp) Khdrbs3 KH domain containing, RNA binding, Fgd4 FYVE, RhoGEF and PH domain containing signal transduction associated 3(Khdrbs3) 4(Fgd4) Dhrs7c dehydrogenase/reductase (SDR family) Htatsf1 HIV TAT specific factor 1(Htatsf1) member 7C(Dhrs7c) Cebpb CCAAT/enhancer binding protein Ablim1 actin-binding LIM protein 1(Ablim1) (C/EBP), beta(Cebpb) Epb41l4b erythrocyte membrane protein band 4.1 Cul3 cullin 3(Cul3) like 4b(Epb41l4b) Txnrd1 thioredoxin reductase 1(Txnrd1) Acta2 actin, alpha 2, smooth muscle, aorta(Acta2) Sel1l3 sel-1 suppressor of lin-12-like 3 (C. Scn4a sodium channel, voltage-gated, type IV, elegans)(Sel1l3) alpha(Scn4a) Ar androgen receptor(Ar) Kcnab1 potassium voltage-gated channel, shaker-related subfamily, beta member 1(Kcnab1) Pam peptidylglycine alpha-amidating Acadsb acyl-Coenzyme A dehydrogenase, monooxygenase(Pam) short/branched chain(Acadsb) Dcun1d5 DCN1, defective in cullin neddylation 1, Adipor2 adiponectin receptor 2(Adipor2) domain containing 5 (S. cerevisiae)(Dcun1d5) Dcakd dephospho-CoA kinase domain Kremen1 kringle containing transmembrane protein containing(Dcakd) 1(Kremen1) Cdk18 cyclin-dependent kinase 18(Cdk18) Glb1l2 galactosidase, beta l-like 2(Glb1l2) Pias1 protein inhibitor of activated STAT Pabpc1 poly(A) binding protein, cytoplasmic 1(Pabpc1) 1(Pias1) Phc1 polyhomeotic-like 1 (Drosophila)(Phc1) Eif3a eukaryotic translation initiation factor 3, subunit A(Eif3a) Klhl24 kelch-like 24(Klhl24) Rhou ras homolog family member U(Rhou) Slc38a4 solute carrier family 38, member Tet2 tet methylcytosine dioxygenase 2(Tet2) 4(Slc38a4) Nhs Nance-Horan syndrome (human)(Nhs) Cog6 component of oligomeric golgi complex 6(Cog6) Gatad2b GATA zinc finger domain containing Ccdc80 coiled-coil domain containing 80(Ccdc80) 2B(Gatad2b) Tnfrsf21 tumor necrosis factor receptor superfamily, Cox7a1 cytochrome c oxidase subunit VIIa 1(Cox7a1) member 21(Tnfrsf21) Cited4 Cbp/p300-interacting transactivator, with Slmo2 slowmo homolog 2 (Drosophila)(Slmo2) Glu/Asp-rich carboxy-terminal domain, 4(Cited4) Ltbp4 latent transforming growth factor beta Adcy9 adenylate cyclase 9(Adcy9) binding protein 4(Ltbp4) 0610012G03Rik RIKEN cDNA 0610012G03 Atad1 ATPase family, AAA domain containing gene(0610012G03Rik) 1(Atad1)
[0130] In addition to its ability to bind T.sub.3, μ-crystallin also is a ketimine reductase, with its activity inhibited by T.sub.3 binding. Although this activity is likely inhibited by the high intracellular levels of T.sub.3 in Crym tg muscle, five genes involved in lysine degradation (a pathway including substrates that μ-crystallin acts on in its capacity as a ketimine reductase), compared to controls, with Aldh2, Ogdh and Dist increasing in expression and Sccpdh and Setd7 decreasing in expression.
TABLE-US-00011 TABLE 10 Significant Biological GO Terms FDR Fold adj. p GO biological process complete Enrichment Value sensory perception of smell (GO: 0007608) <0.01 1.81E−09 Unclassified (UNCLASSIFIED) 0.32 2.46E−05 G-protein coupled receptor signaling pathway (GO: 0007186) 0.35 6.14E−05 tricarboxylic acid cycle (GO: 0006099) 12.19 6.47E−05 glucose metabolic process (GO: 0006006) 6.04 7.16E−05 pyruvate metabolic process (GO: 0006090) 7.2 2.43E−04 2-oxoglutarate metabolic process (GO: 0006103) 14.47 3.98E−04 cellular response to oxygen-containing compound (GO: 1901701) 2.17 7.89E−04 NADPH oxidation (GO: 0070995) 28.04 9.17E−04 glycogen biosynthetic process (GO: 0005978) 13.86 2.02E−03 monocarboxylic acid biosynthetic process (GO: 0072330) 3.72 2.02E−03 striated muscle contraction (GO: 0006941) 4.71 2.61E−03 regulation of cellular component organization (GO: 0051128) 1.56 2.79E−03 fatty acid metabolic process (GO: 0006631) 2.9 3.11E−03 regulation of actin filament-based process (GO: 0032970) 2.58 3.48E−03 response to mechanical stimulus (GO: 0009612) 3.9 3.51E−03 response to hypoxia (GO: 0001666) 3.47 3.66E−03 positive regulation of small molecule metabolic process (GO: 0062013) 3.41 4.28E−03 carbohydrate catabolic process (GO: 0016052) 5.24 4.74E−03 negative regulation of cell death (GO: 0060548) 1.86 4.98E−03 oxaloacetate metabolic process (GO: 0006107) 14.02 7.47E−03 regulation of glycolytic process (GO: 0006110) 7.63 7.60E−03
Example 10: Global Protein Expression (LC.MS/MS)
[0131] Proteomic analysis was performed using liquid chromatography-tandem mass spectrometry (LC.MS/MS) followed by bioinformatic assessment (see Table 11). GO analysis was performed on the 85 significantly differentially expressed proteins using the PANTHER Classification System, which resulted in 7 statistically significant ontological classes. Four of the terms related to muscle while one was for oxidation-reduction process (see Table 12). Eleven proteins that were significantly differentially expressed in Crym tg mice compared to controls were associated with the “oxidation-reduction process” gene ontology. Five of those proteins increased in expression in Crym tg mice compared to controls while 6 decreased. See Table 13. The second column lists the abundance ratio of the proteins expressed as the average abundance of Crym tg/control protein. The false discovery rate corrected p value for each protein is listed in the third column (n=6; α=0.05). Although the gene products revealed by LC.MS/MS and RNA-seq showed minimal overlap, the significant ontological terms in the proteomic study were similar to those found in the transcriptomic study.
TABLE-US-00012 TABLE 11 Significantly Differentially Expressed Proteins in Crym tg Muscle Abundance Abundance Ratio: Ratio Adj. P- (Crym)/ Value: Accession Description (BL6) (Crym)/(BL6) Q8K339 DNA/RNA-binding protein KIN17 OS = Mus 1000 5.06415E−16 musculus GN = Kin PE = 1 SV = 1 Q8CG76 Aflatoxin B1 aldehyde reductase member 2 1000 5.06415E−16 OS = Mus musculus GN = Akr7a2 PE = 1 SV = 3 Q3TJZ6 Protein FAM98A OS = Mus musculus 1000 5.06415E−16 GN = Fam98a PE = 1 SV = 1 Q8QZR5 Alanine aminotransferase 1 OS = Mus musculus 1000 5.06415E−16 GN = Gpt PE = 1 SV = 3 P00416 Cytochrome c oxidase subunit 3 OS = Mus 1000 5.06415E−16 musculus GN = mt-Co3 PE = 1 SV = 2 P06728 Apolipoprotein A-IV OS = Mus musculus 1000 5.06415E−16 GN = Apoa4 PE = 1 SV = 3 Q99PE2 Ankyrin repeat family A protein 2 OS = Mus 1000 5.06415E−16 musculus GN = Ankra2 PE = 1 SV = 1 Q8BP92 Reticulocalbin-2 OS = Mus musculus GN = Rcn2 1000 5.06415E−16 PE = 1 SV = 1 P24527 Leukotriene A-4 hydrolase OS = Mus musculus 1000 5.06415E−16 GN = Lta4h PE = 1 SV = 4 E9Q1Y9 Keratin 83 OS = Mus musculus GN = Krt83 PE = 1 0.001 5.06415E−16 SV = 1 Q9DCF9 Translocon-associated protein subunit gamma 0.001 5.06415E−16 OS = Mus musculus GN = Ssr3 PE = 1 SV = 1 Q61897 Keratin, type I cuticular Ha3-II OS = Mus 0.001 5.06415E−16 musculus GN = Krt33b PE = 1 SV = 2 P16627 Heat shock 70 kDa protein l-like OS = Mus 0.001 5.06415E−16 musculus GN = Hspa1l PE = 1 SV = 4 Q9D638 Keratin-associated protein 3-2 OS = Mus musculus 0.001 5.06415E−16 GN = Krtap3-2 PE = 3 SV = 2 Q5FW53 Myosin-binding protein H-like OS = Mus musculus 0.001 5.06415E−16 GN = Mybphl PE = 1 SV = 1 Q8VDQ1 Prostaglandin reductase 2 OS = Mus musculus 0.001 5.06415E−16 GN = Ptgr2 PE = 1 SV = 2 A0A140T8T7 Collagen alpha-5(VI) chain OS = Mus musculus 0.001 5.06415E−16 GN = Col6a5 PE = 1 SV = 1 O54983 Ketimine reductase mu-crystallin OS = Mus 13.205 5.06415E−16 musculus GN = Crym PE = 1 SV = 1 A3KGU9 Spectrin alpha chain, non-erythrocytic 1 OS = Mus 0.304 5.06415E−16 musculus GN = Sptanl PE = 1 SV = 2 Q80XN0 D-beta-hydroxybutyrate dehydrogenase, 0.314 5.06415E−16 mitochondrial OS = Mus musculus GN = Bdhl PE = 1 SV = 2 Q91V41 Ras-related protein Rab-14 OS = Mus musculus 0.352 5.06415E−16 GN = Rab14 PE = 1 SV = 3 E9Q8Y0 Myosin regulatory light chain 2, 2.672 5.06415E−16 ventricular/cardiac muscle isoform OS = Mus musculus GN = Myl2 PE = 1 SV = 1 P50462 Cysteine and glycine-rich protein 3 OS = Mus 0.435 5.06415E−16 musculus GN = Csrp3 PE = 1 SV = 1 Q9WV06 Ankyrin repeat domain-containing protein 2 0.388 3.08626E−12 OS = Mus musculus GN = Ankrd2 PE = 1 SV = 3 P21812 Mast cell protease 4 OS = Mus musculus 2.127 3.08626E−12 GN = Mcpt4 PE = 1 SV = 1 P29391 Ferritin light chain 1 OS = Mus musculus GN = Ftl1 0.531 1.76191E−09 PE = 1 SV = 2 P97861 Keratin, type II cuticular Hb6 OS = Mus musculus 0.541 6.35461E−09 GN = Krt86 PE = 2 SV = 2 Q61033 Lamina-associated polypeptide 2, isoforms 2.298 1.32401E−08 alpha/zeta OS = Mus musculus GN = Tmpo PE = 1 SV = 4 P70695 Fructose-1,6-bisphosphatase isozyme 2 OS = Mus 1.724 9.85824E−08 musculus GN = Fbp2 PE = 1 SV = 2 A0A087WRF2 Arf-GAP with GTPase, ANK repeat and PH 0.565 1.12072E−07 domain-containing protein 1 OS = Mus musculus GN = Agap1 PE = 1 SV = 1 Q9DCL9 Multifunctional protein ADE2 OS = Mus musculus 0.427 1.68913E−07 GN = Paics PE = 1 SV = 4 Q640L5 Coiled-coil domain-containing protein 18 1.689 3.43509E−07 OS = Mus musculus GN = Ccdc18 PE = 1 SV = 1 P23927 Alpha-crystallin B chain OS = Mus musculus 0.576 3.48308E−07 GN = Cryab PE = 1 SV = 2 Q3U381 Zinc finger protein 692 OS = Mus musculus 0.508 2.38708E−06 GN = Znf692 PE = 2 SV = 1 Q9D8B3 Charged multivesicular body protein 4b OS = Mus 0.539 3.0525E−05 musculus GN = Chmp4b PE = 1 SV = 2 Q05722 Collagen alpha-1(IX) chain OS = Mus musculus 0.55 3.7709E−05 GN = Col9a1 PE = 2 SV = 2 Q8JZN5 Acyl-CoA dehydrogenase family member 9, 1.574 5.20719E−05 mitochondrial OS = Mus musculus GN = Acad9 PE = 1 SV = 2 F6ZDS4 Nucleoprotein TPR OS = Mus musculus GN = Tpr 1.526 9.5752E−05 PE = 1 SV = 1 F6ZHD8 1,4-alpha-glucan-branching enzyme OS = Mus 0.639 0.000109695 musculus GN = Gbe1 PE = 1 SV = 2 P00329 Alcohol dehydrogenase 1 OS = Mus musculus 0.577 0.000163926 GN = Adh1 PE = 1 SV = 2 Q6W8Q3 Purkinje cell protein 4-like protein 1 OS = Mus 0.511 0.000166742 musculus GN = Pcp4l1 PE = 1 SV = 1 A0A1Y7VM56 NAD-dependent protein deacylase sirtuin-5, 1.773 0.000270852 mitochondrial OS = Mus musculus GN = Sirt5 PE = 1 SV = 1 Q4VAE3 Transmembrane protein 65 OS = Mus musculus 0.563 0.000503491 GN = Tmem65 PE = 1 SV = 1 P26039 Talin-1 OS = Mus musculus GN = Tln1 PE = 1 SV = 2 0.54 0.00078635 A2AEX6 Four and a half LIM domains protein 1 OS = Mus 0.672 0.001101028 musculus GN = Fhl1 PE = 1 SV = 1 O35367 Keratocan OS = Mus musculus GN = Kera PE = 2 1.445 0.00111612 SV = 1 Q8OVH0 B-cell scaffold protein with ankyrin repeats 0.546 0.001363127 OS = Mus musculus GN = Bank1 PE = 1 SV = 3 A0A0R4J0J0 Palmdelphin OS = Mus musculus GN = Palmd PE = 1 0.676 0.001363127 SV = 1 Q8VCT4 Carboxylesterase 1D OS = Mus musculus 1.538 0.00136542 GN = Cesld PE = 1 SV = 1 Q9QXT0 Protein canopy homolog 2 OS = Mus musculus 1.634 0.002602884 GN = Cnpy2 PE = 1 SV = 1 E9QQ57 Periaxin OS = Mus musculus GN = Prx PE = 1 SV = 1 0.656 0.002609724 Q9JMC3 DnaJ homolog subfamily A member 4 OS = Mus 0.605 0.002781199 musculus GN = Dnaja4 PE = 1 SV = 1 A0A0A6YVU8 MCG119397 OS = Mus musculus GN = Gm9774 PE = 4 SV = 1 0.576 0.002855412 A0A0R4J135 Selenium-binding protein 2 OS = Mus musculus 1.403 0.003127834 GN = Selenbp2 PE = 1 SV = 1 P54071 Isocitrate dehydrogenase [NADP], mitochondrial 1.389 0.00459371 OS = Mus musculus GN = Idh2 PE = 1 SV = 3 A2AQP0 Myosin-7B OS = Mus musculus GN = Myh7b PE = 3 1.381 0.005681633 SV = 1 A2AT68 Titin (Fragment) OS = Mus musculus GN = Ttn 1.381 0.005681633 PE = 1 SV = 1 Q9CZB0 Succinate dehydrogenase cytochrome b560 0.705 0.006105325 subunit, mitochondrial OS = Mus musculus GN = Sdhc PE = 1 SV = 1 A0A0R4J0I1 MCG1051009 OS = Mus musculus GN = Serpina3k 0.707 0.006580056 PE = 1 SV = 1 Q9D0M5 Dynein light chain 2, cytoplasmic OS = Mus 0.709 0.007407379 musculus GN = Dynll2 PE = 1 SV = 1 Q5EBG6 Heat shock protein beta-6 OS = Mus musculus 0.711 0.008191236 GN = Hspb6 PE = 1 SV = 1 P30412 Peptidyl-prolyl cis-trans isomerase C OS = Mus 0.616 0.008459428 musculus GN = Ppic PE = 1 SV = 1 F6QYE1 Calsequestrin OS = Mus musculus GN = Casq2 1.363 0.008616749 PE = 1 SV = 1 P04938 Major urinary protein 11 OS = Mus musculus 0.61 0.008847624 GN = Mup11 PE = 1 SV = 2 P16045 Galectin-1 OS = Mus musculus GN = Lgals1 PE = 1 0.715 0.008847624 SV = 3 P15626 Glutathione S-transferase Mu 2 OS = Mus 1.351 0.010822634 musculus GN = Gstm2 PE = 1 SV = 2 Q60668 Heterogeneous nuclear ribonucleoprotein D0 0.72 0.010964372 OS = Mus musculus GN = Hnrnpd PE = 1 SV = 2 P46656 Adrenodoxin, mitochondrial OS = Mus musculus 1.466 0.011591329 GN = Fdx1 PE = 1 SV = 1 P21981 Protein-glutamine gamma-glutamyltransferase 2 0.722 0.011862729 OS = Mus musculus GN = Tgm2 PE = 1 SV = 4 Q80WJ7 Protein LYRIC OS = Mus musculus GN = Mtdh 1.484 0.016201938 PE = 1 SV = 1 P14602 Heat shock protein beta-1 OS = Mus musculus 0.732 0.01962496 GN = Hspb1 PE = 1 SV = 3 F8WIV2 Serine (or cysteine) peptidase inhibitor, clade B, 0.733 0.019861099 member 6a OS = Mus musculus GN = Serpinb6a PE = 1 SV = 1 Q9D358 Low molecular weight phosphotyrosine protein 1.322 0.022273123 phosphatase OS = Mus musculus GN = Acp1 PE = 1 SV = 3 D3Z6H8 S-adenosylmethionine decarboxylase proenzyme 0.625 0.02364725 2 OS = Mus musculus GN = Amd2 PE = 1 SV = 1 Q9DCD0 6-phosphogluconate dehydrogenase, 0.625 0.02432232 decarboxylating OS = Mus musculus GN = Pgd PE = 1 SV = 3 P14148 60S ribosomal protein L7 OS = Mus musculus 1.386 0.024879354 GN = Rpl7 PE = 1 SV = 2 P14069 Protein S100-A6 OS = Mus musculus GN = S100a6 0.741 0.027720305 PE = 1 SV = 3 Q04447 Creatine kinase B-type OS = Mus musculus 0.631 0.030605959 GN = Ckb PE = 1 SV = 1 P62962 Profilin-1 OS = Mus musculus GN = Pfnl PE = 1 0.747 0.030745961 SV = 2 P20152 Vimentin OS = Mus musculus GN = Vim PE = 1 0.748 0.031738217 SV = 3 P97927 Laminin subunit alpha-4 OS = Mus musculus 0.637 0.03202606 GN = Lama4 PE = 1 SV = 2 A2CG35 Ras-related protein Rab-12 OS = Mus musculus 1.413 0.033333527 GN = Rab12 PE = 1 SV = 1 E9PXQ7 Protocadherin 10 OS = Mus musculus GN = Pcdh10 0.752 0.036907598 PE = 1 SV = 1 Q3UIU2 NADH dehydrogenase [ubiquinone] 1 beta 0.754 0.039259058 subcomplex subunit 6 OS = Mus musculus GN = Ndufb6 PE = 1 SV = 3 Q9DA97 Septin-14 OS = Mus musculus GN = Sept14 PE = 1 1.304 0.042479617 SV = 3
TABLE-US-00013 TABLE 12 Effects on glycolytic and oxidative patheway genes. Glycolytic Pathway Oxidative Pathway Fast Contractile Slow Contractile Genes Genes Genes Genes # # # # # # # # increased decreased increased decreased increased decreased increased decreased 5 11 29 20 10 43 54 8
TABLE-US-00014 TABLE 13 Proteins Involved in Oxidation-Reduction Process Differentially Expressed in Crym tg TA Muscle. Abundance Ratio: Abundance Ratio Adj. (Crym tg)/ P-Value: (Crym tg) / Gene (control) (control) Akr7a2 1000 5.064E−16 Crym 13.205 5.064E−16 Bdh1 0.314 5.064E−16 Ptgr2 0.001 5.064E−16 Acad9 1.574 5.207E−05 Adh1 0.577 1.639E−04 Idh2 1.389 4.594E−03 Sdhc 0.705 6.105E−03 Fdx1 1.466 1.159E−02 Pgd 0.625 2.432E−02 Ndufb6 0.754 3.926E−02
Example 11: Method of Treatment
[0132] AAV or small molecules are delivered to patients at appropriate doses and at a given dosing regimen as determined by the practitioner. Subject inclusion criteria include individuals with lipolytic disorders, lipogenic disorders, glycolytic disorders, gluconeogenic disorders, type 2 diabetes, obesity, or any combination thereof. Individuals are human patients and preferably do not have other major underlying health disorders. The patients will primarily be adults of any age, preferably from about 18 to about 65 years of age. The dose of AAV or of a small molecule may be given one to three times and may be separated by one week up to two month in between doses.
REFERENCES
[0133] All references listed below and throughout the specification are hereby incorporated by reference in their entirety. [0134] 1. Abe S et al. Identification of CRYM as a candidate responsible for nonsyndromic deafness, through cDNA microarray analysis of human cochlear and vestibular tissues. The American Journal of Human Genetics 72: 73-82, 2003. [0135] 2. Aguet F et al., Model-based 2.5-D deconvolution for extended depth of field in brightfield microscopy. IEEE Transactions on Image Processing 17: 1144-1153, 2008. [0136] 3. Anion D et al., Molecular evidence for increased expression of genes related to immune and chaperone function in the prefrontal cortex in schizophrenia. Biological psychiatry 62: 711-721, 2007. [0137] 4. Ashburner M et al., Gene ontology: tool for the unification of biology. Nature genetics, 2000.25(1): p. 25. [0138] 5. Augusto V et al., Skeletal muscle fiber types in C57BL6J mice. Braz J Morphol Sci, 2004. 21(2): p. 89-94. [0139] 6. Bancroft J D and Gamble M, Theory and practice of histological techniques. Elsevier health sciences, 2008. [0140] 7. Beslin A et al., Identification by photoaffinity labelling of a pyridine nucleotide-dependent tri-iodothyronine-binding protein in the cytosol of cultured astroglial cells. Biochemical Journal 305: 729-737, 1995. [0141] 8. Bianco A C and Kim B W, Deiodinases: implications of the local control of thyroid hormone action. The Journal of clinical investigation 116: 2571-2579, 2006. [0142] 9. Bishopric N H and Kedes L, Adrenergic regulation of the skeletal alpha-actin gene promoter during myocardial cell hypertrophy. Proceedings of the National Academy of Sciences 88: 2132-2136, 1991. [0143] 10. Borel F et al., Crystal structure of mouse mu-crystallin complexed with NADPH and the T.sub.3 thyroid hormone. The FEBS Journal 281: 1598-1612, 2014. [0144] 11. Briguet A et al., Histological parameters for the quantitative assessment of muscular dystrophy in the mdx-mouse. Neuromuscular disorders 14: 675-682, 2004. [0145] 12. Brooke M H and Kaiser K K, Three “myosin adenosine triphosphatase” systems: the nature of their pH lability and sulfhydryl dependence. Journal of Histochemistry & Cytochemistry 18: 670-672, 1970. [0146] 13. Burks T N et al., Losartan restores skeletal muscle remodeling and protects against disuse atrophy in sarcopenia. Science translational medicine 3: 82ra37-82ra37, 2011. [0147] 14. Chen X et al., The number of x chromosomes causes sex differences in adiposity in mice. PLoS Genet 8: e1002709, 2012. [0148] 15. Ciciliot S et al., Muscle type and fiber type specificity in muscle wasting. The international journal of biochemistry & cell biology 45: 2191-2199, 2013. [0149] 16. Clement K et al., In vivo regulation of human skeletal muscle gene expression by thyroid hormone. Genome research 12: 281-291, 2002. [0150] 17. Collie E and Muscat G E, The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element. Cell growth & differentiation: the molecular biology journal of the American Association for Cancer Research 3: 31-42, 1992. [0151] 18. Consortium GO, The Gene Ontology resource: 20 years and still GOing strong. Nucleic Acids Research, 2018. 47(D1): p. D330-D338. [0152] 19. Dixit M et al., DUX4, a candidate gene of facioscapulohumeral muscular dystrophy, encodes a transcriptional activator of PITX1. Proceedings of the National Academy of Sciences 104: 18157-18162, 2007. [0153] 20. Dorfer V et al., M S Amanda, a universal identification algorithm optimized for high accuracy tandem mass spectra. Journal of proteome research 13: 3679-3684, 2014. [0154] 21. Drexler H C et al., On marathons and Sprints: an integrated quantitative proteomics and transcriptomics analysis of differences between slow and fast muscle fibers. Molecular & Cellular Proteomics 11: M111. 010801, 2012. [0155] 22. Dubowitz V et al., Muscle biopsy: a practical approach: expert consult; online and print. Elsevier Health Sciences, 2013. [0156] 23. Ebashi S et al., Control of muscle contraction. Quarterly reviews of biophysics 2: 351-384, 1969. [0157] 24. Encarnacion-Rivera L et al., Myosoft: An automated muscle histology analysis tool using machine learning algorithm utilizing FIJI/ImageJ software. PloS one 15: e0229041, 2020. [0158] 25. Eng J K et al., A fast SEQUEST cross correlation algorithm. Journal of proteome research 7: 4598-4602, 2008. [0159] 26. Fitts R H et al., Contractile and fatigue properties of thyrotoxic rat skeletal muscle. Muscle & Nerve: Official Journal of the American Association of Electrodiagnostic Medicine 7: 470-477, 1984. [0160] 27. Friesema E C et al., Effective cellular uptake and efflux of thyroid hormone by human monocarboxylate transporter 10. Molecular endocrinology 22: 1357-1369, 2008. [0161] 28. Gagne R et al., Identification of thyroid hormone receptor binding sites in developing mouse cerebellum. BMC genomics 14: 341, 2013. [0162] 29. Giger J M et al., Rapid muscle atrophy response to unloading: pretranslational processes involving MHC and actin. Journal of Applied Physiology 107: 1204-1212, 2009. [0163] 30. Gunning P et al., Alpha-skeletal and alpha-cardiac actin genes are coexpressed in adult human skeletal muscle and heart. Molecular and cellular biology 3: 1985-1995, 1983. [0164] 31. Gustafson T A et al., Effects of thyroid hormone on alpha-actin and myosin heavy chain gene expression in cardiac and skeletal muscles of the rat: measurement of mRNA content using synthetic oligonucleotide probes. Circulation research 59: 194-201, 1986. [0165] 32. Hallen A and Cooper A J, Reciprocal control of thyroid binding and the pipecolate pathway in the brain. Neurochemical research 42: 217-243, 2017. [0166] 33. Hallen A et al., Mammalian forebrain ketimine reductase identified as μ-crystallin; potential regulation by thyroid hormones. Journal of neurochemistry 118: 379-387, 2011. [0167] 34. Hallen A et al., Insights into enzyme catalysis and thyroid hormone regulation of cerebral ketimine reductase/μ-crystallin under physiological conditions. Neurochemical research 40: 1252-1266, 2015. [0168] 35. Hashizume K et al., Evidence for the presence of two active forms of cytosolic 3, 5, 3′-triiodo-L-thyronine (T.sub.3)-binding protein (CTBP) in rat kidney. Specialized functions of two CTBPs in intracellular T.sub.3 translocation. Journal of Biological Chemistry 264: 4864-4871, 1989. [0169] 36. Homma S et al., A unique library of myogenic cells from facioscapulohumeral muscular dystrophy subjects and unaffected relatives: family, disease and cell function. European Journal of Human Genetics 20: 404-410, 2012. [0170] 37. Huang D W et al., Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature protocols, 2008. 4(1): 44. [0171] 38. Huang D W et al., Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic acids research, 2008. 37(1):1-13. [0172] 39. Johansson C et al., Isometric force and endurance in skeletal muscle of mice devoid of all known thyroid hormone receptors. The Journal of physiology 547: 789-796, 2003. [0173] 40. Kalmar B et al., Determination of muscle fiber type in rodents. Current protocols in mouse biology 2: 231-243, 2012. [0174] 41. Kammoun M et al., A simplified immunohistochemical classification of skeletal muscle fibres in mouse. European journal of histochemistry: EJH 58: 2014. [0175] 42. Kim D et al., Noncoding dsRNA induces retinoic acid synthesis to stimulate hair follicle regeneration via TLR3. Nature Communications 10: 2811, 2019. [0176] 43. Kim R Y et al., mu-crystallin is a mammalian homologue of Agrobacterium ornithine cyclodeaminase and is expressed in human retina. Proceedings of the National Academy of Sciences 89: 9292-9296, 1992. [0177] 44. Klooster R et al., Comprehensive expression analysis of FSHD candidate genes at the mRNA and protein level. European Journal of Human Genetics 17: 1615, 2009. [0178] 45. Kobayashi M et al., A Novel NADPH-Dependent Cytosolic 3, 5, 3′-Triiodo-LThyronine-Binding Protein (CTBP; 5. IS) in Rat Liver: A Comparison with 4.7 S NADPH-Dependent CTBP. Endocrinology 129: 1701-1708, 1991. [0179] 46. Laemmli U K, Cleavage of structural proteins during the assembly of the head of bacteriophage T.sub.4. Nature 227: 680-685, 1970. [0180] 47. Larsen P R et al., Relationships between circulating and intracellular thyroid hormones: physiological and clinical implications. Endocrine Reviews 2: 87-102, 1981. [0181] 48. Lassche S et al., Sarcomeric dysfunction contributes to muscle weakness in facioscapulohumeral muscular dystrophy. Neurology 80: 733-737, 2013. [0182] 49. Luff A, Dynamic properties of the inferior rectus, extensor digitorum longus, diaphragm and soleus muscles of the mouse. The Journal of Physiology 313: 161-171, 1981. [0183] 50. Lukyanenko V et al., Coupling of excitation to Ca2+ release is modulated by dysferlin. The Journal of Physiology 595: 5191-5207, 2017. [0184] 51. Lusk G, Animal calorimetry twenty-fourth paper. Analysis of the oxidation of mixtures of carbohydrate and fat. Journal of Biological Chemistry 59: 41-42, 1924. [0185] 52. Martins-de-Souza D et al., Proteome analysis of the thalamus and cerebrospinal fluid reveals glycolysis dysfunction and potential biomarkers candidates for schizophrenia. Journal of psychiatric research 44: 1176-1189, 2010. [0186] 53. Mi H et al., PANTHER version 11: expanded annotation datafrom Gene Ontology and Reactome pathways, and data analysis tool enhancements. Nucleic acids research, 2016. 45(01): p. D183-D189. [0187] 54. Mori J-i et al., icotinamide adenine dinucleotide phosphate-dependent cytosolic T.sub.3 binding protein as a regulator for T.sub.3-mediated transactivation. Endocrinology 143: 1538-1544, 2002. [0188] 55. Motulsky H J and Brown R E, Detecting outliers when fitting data with nonlinear regression—a new method based on robust nonlinear regression and the false discovery rate. BMC bioinformatics 7: 123, 2006. [0189] 56. Ohkubo Y et al., Loss of μ-crystallin causes PPARγ activation and obesity in high-fat diet-fed mice. Biochemical and biophysical research communications 508: 914-920, 2019. [0190] 57. Olojo R O et al., Mice null for calsequestrin 1 exhibit deficits in functional performance and sarcoplasmic reticulum calcium handling. PLoS One 6: e27036, 2011. [0191] 58. Peter J B et al., Metabolic profiles of three fiber types of skeletal muscle inguinea pigs and rabbits. Biochemistry, 1972. 11(14): p. 2627-2633. [0192] 59. Pette D and Staron R S, Mammalian skeletal muscle fiber type transitions. In: International Review of Cytology Elsevier, 1997, p. 143-223. [0193] 60. Pirahanchi Y and Jialal I, Physiology, Thyroid Stimulating Hormone (TSH). In: StatPearls. Treasure Island (FL): StatPearls Publishing [interna], StatPearls Publishing LLC., 2019. [0194] 61. Reed P W et al., Abnormal expression of mu-crystallin in facioscapulohumeral muscular dystrophy. Experimental neurology 205: 583-586, 2007. [0195] 62. Reichmann H and De D V, Coordinate enzymatic activity of beta-oxidation and purine nucleotide cycle in a diversity of muscle and other organs of rat. Comparative biochemistry and physiology. B, Comparative biochemistry, 1991. 98(2-3): p. 327-331. [0196] 63. Sandler B et al., Thyroxine-thyroid hormone receptor interactions. Journal of Biological Chemistry 279: 55801-55808, 2004. [0197] 64. Schiaffino S and Reggiani C, Fiber types in mammalian skeletal muscles. Physiological reviews 91: 1447-1531, 2011. [0198] 65. Schindelin J et al., Fiji: an open-source platform for biological-image analysis. Nature methods 9: 676-682, 2012. [0199] 66. Seko D et al., μ-Crystallin controls muscle function through thyroid hormone action. The FASEB Journal 30: 1733-1740, 2015. [0200] 67. Sheng J-J and Jin J-P, TNNI1, TNNI2 and TNNI3: Evolution, regulation, and protein structure-function relationships. Gene 576: 385-394, 2016. [0201] 68. Siler T et al., Inhibition by somatostatin on the release of TSH induced in man by thyrotropin-releasing factor. The Journal of Clinical Endocrinology & Metabolism 38: 742-745, 1974. [0202] 69. Spangenburg E E et al., Use of BODIPY (493/503) to visualize intramuscular lipid droplets in skeletal muscle. Journal of Biomedicine and Biotechnology 2011: 2011. [0203] 70. Suzuki S et al., μ-Crystallin as an intracellular 3, 5, 3′-triiodothyronine holder in vivo. Molecular endocrinology 21: 885-894, 2007. [0204] 71. Tata J R, A cellular thyroxine-binding protein fraction. Biochimica et biophysica acta 28: 91-94, 1958. [0205] 72. Tawil R et al., Facioscapulohumeral dystrophy: the path to consensus on pathophysiology. Skeletal muscle 4: 12, 2014. [0206] 73. Taylor S C et al., The ultimate qPCR experiment: producing publication quality, reproducible data the first time. Trends in biotechnology 37: 761-774, 2019. [0207] 74. van Mullem A A et al., Effects of thyroid hormone transporters MCT8 and MCT10 on nuclear activity of T.sub.3. Molecular and cellular endocrinology 437: 252-260, 2016. [0208] 75. Vanderplanck C et al., The FSHD atrophic myotube phenotype is caused by DUX4 expression. PloS one 6: e26820, 2011. [0209] 76. Xie F et al., miRDeepFinder: a miRNA analysis tool for deep sequencing of plant small RNAs. Plant molecular biology 80: 75-84, 2012. [0210] 77. Zaiontz C, Real Statistics Resource Pack software (Release 6.8). real-statistics.com: 2020.