Yeast expressing saccharolytic enzymes for consolidated bioprocessing using starch and cellulose
11193130 · 2021-12-07
Assignee
Inventors
- Elena Brevnova (Lebanon, NH)
- John E. McBride (Lyme, NH)
- Erin Wiswall (Danbury, NH)
- Kevin S. Wenger (Hanover, NH)
- Nicky Caiazza (Rancho Santa Fe, CA)
- Heidi Hau (Lebanon, NH)
- Aaron Argyros (White River Junction, VT)
- Frank Agbogbo (Lebanon, NH)
- Charles F. Rice (Hopkinton, NH)
- Trisha Barrett (Bradford, VT)
- John S. Bardsley (Newport, NH)
- Abigail Foster (South Strafford, VT)
- Anne K. Warner (Lebanon, NH)
- Mark Mellon (Grantham, NH)
- Ryan Skinner (White River Junction, VT)
- Indraneel Shikhare (Lebanon, NH)
- Riaan Den Haan (Vierlanden, ZA)
- Chhayal V. Gandhi (Lebanon, NH)
- Alan Belcher (Nashua, NH)
- Vineet B. Rajgarhia (Courbevoie, FR)
- Allan C. Froehlich (Lebanon, NH)
- Kristen M. Deleault (Canaan, NH)
- Emily Stonehouse (Lebanon, NH)
- Shital A. Tripathi (Berkeley, CA)
- Jennifer Gosselin (Lebanon, NH)
- Yin-Ying Chiu (West Lebanon, NH)
- Haowen Xu (Lebanon, NH)
Cpc classification
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Y302/01091
CHEMISTRY; METALLURGY
C12Y302/01004
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention is directed to a yeast strain, or strains, secreting a full suite, or any subset of that full suite, of enzymes to hydrolyze corn starch, corn fiber, lignocellulose, (including enzymes that hydrolyze linkages in cellulose, hemicellulose, and between lignin and carbohydrates) and to utilize pentose sugars (xylose and arabinose). The invention is also directed to the set of proteins that are well expressed in yeast for each category of enzymatic activity. The resulting strain, or strains can be used to hydrolyze starch and cellulose simultaneously. The resulting strain, or strains can be also metabolically engineered to produce less glycerol and uptake acetate. The resulting strain, or strains can also be used to produce ethanol from granular starch without liquefaction. The resulting strain, or strains, can be further used to reduce the amount of external enzyme needed to hydrolyze a biomass feedstock during an Simultaneous Saccharification and Fermentation (SSF) process, or to increase the yield of ethanol during SSF at current saccharolytic enzyme loadings. In addition, multiple enzymes of the present invention can be co-expressed in cells of the invention to provide synergistic digestive action on biomass feedstock. In some aspects, host cells expressing different heterologous saccharolytic enzymes can also be co-cultured together and used to produce ethanol from biomass feedstock.
Claims
1. A recombinant yeast host cell comprising a vector comprising a polynucleotide encoding a polypeptide comprising an amino acid sequence at least 90% identical to the amino acid sequence of SEQ ID NO: 445; and a heterologous secretion signal, wherein the recombinant yeast host cell produces at least 0.5 g of ethanol per hour per liter at 32° C. on a substrate of corn mash, corn flour or a combination thereof, and wherein the polynucleotide is operably associated with the heterologous secretion signal.
2. The recombinant yeast host cell of claim 1, wherein the heterologous polynucleotide encodes a polypeptide comprising an amino acid sequence at least 95% identical to the amino acid sequence of SEQ ID NO: 445.
3. The recombinant yeast host cell of claim 2, wherein the heterologous polynucleotide encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 445.
4. The recombinant yeast host cell of claim 1, wherein the vector is a cloning vector or an expression vector.
5. The recombinant yeast host cell of claim 1, wherein the heterologous secretion signal is a Trichoderma reesei Xyn2 secretion signal, a Saccharomyces cerevisiae invertase secretion signal, or a Saccharomyces cerevisiae alpha-mating factor 1 (AF mating) secretion signal.
6. The recombinant yeast host cell of claim 1, wherein the heterologous secretion signal has higher level of extra-cellular expression of the polypeptide when compared with a vector comprising a native secretion signal.
7. The recombinant yeast host cell of claim 1, further comprising one or more additional heterologous polynucleotides encoding one or more additional polypeptides comprising an amino acid sequence at least 90% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 443, SEQ ID NO: 287, SEQ ID NO: 450, SEQ ID NO: 451, and SEQ ID NO: 452.
8. The recombinant yeast host cell of claim 1, wherein the host cell is capable of fermenting a pentose sugar.
9. The recombinant yeast host cell of claim 8, wherein the pentose sugar is xylose or arabinose.
10. The recombinant yeast host cell of claim 9, wherein the host cell further expresses a xylose isomerase.
11. The recombinant yeast host cell of claim 10, wherein the xylose isomerase is isolated from an organism selected from the group consisting of: Piromyces, Bacterioides thetaiotaomicron, Chitinophagapinensis, Parabacteroides distasonis, and combinations thereof.
12. The recombinant yeast host cell of claim 1, further comprising one or more additional heterologous polynucleotides encoding one or more additional polypeptides comprising an amino acid sequence at least 90% identical to an amino acid sequence selected from the group consisting of: SEQ ID NO: 453, SEQ ID NO: 454, SEQ ID NO: 455, SEQ ID NO: 456, SEQ ID NO: 457, SEQ ID NO: 458, SEQ ID NO: 459, SEQ ID NO: 460, SEQ ID NO: 461, SEQ ID NO: 462, SEQ ID NO: 463, SEQ ID NO: 464, and SEQ ID NO: 465.
13. The recombinant yeast host cell of claim 1, further comprising one or more additional heterologous polynucleotides encoding one or more additional polypeptides comprising an amino acid sequence at least 90% identical to the amino acid sequence of a polypeptide selected from the group consisting of: SEQ ID NO: 447, SEQ ID NO: 448, and SEQ ID NO: 449.
14. The recombinant yeast host cell of claim 1, comprising two or more copies of the heterologous polynucleotide encoding a polypeptide comprising an amino acid sequence at least 90% identical to the amino acid sequence of SEQ ID NO: 445.
15. The recombinant yeast host cell of claim 1, comprising four or more copies of the heterologous polynucleotide encoding a polypeptide comprising an amino acid sequence at least 90% identical to the amino acid sequence of SEQ ID NO: 445.
16. The recombinant yeast host cell of claim 1, wherein the yeast strain is a Saccharomyces cerevisiae strain.
17. A method of producing ethanol comprising: (a) providing the host cell of claim 1; and (b) culturing said host cell in the presence of a substrate selected from the group consisting of: corn mash, corn flour, and combinations thereof for sufficient time to produce ethanol.
18. The method of claim 17, wherein the host cell is cultured at about 35 degree C.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
(60)
(61)
(62)
(63)
(64)
(65)
(66)
(67)
(68)
(69)
(70)
(71)
(72)
(73)
(74)
(75)
(76)
(77)
(78)
(79)
(80)
(81)
(82)
(83)
(84)
(85)
(86)
(87)
(88)
(89)
(90)
(91)
(92)
(93)
(94)
(95)
(96)
(97)
(98)
(99)
(100)
(101)
(102)
(103)
DETAILED DESCRIPTION OF THE INVENTION
(104) The disclosed methods and materials are useful generally in the field of engineered yeast.
Definitions
(105) A “vector,” e.g., a “plasmid” or “YAC” (yeast artificial chromosome) refers to an extrachromosomal element often carrying one or more genes that are not part of the central metabolism of the cell, and is usually in the form of a circular double-stranded DNA molecule. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear, circular, or supercoiled, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3′ untranslated sequence into a cell. Preferably, the plasmids or vectors of the present invention are stable and self-replicating.
(106) An “expression vector” is a vector that is capable of directing the expression of genes to which it is operably associated.
(107) The term “intergrated” as used herein refers to genetic elements that are placed, through molecular biology techniques, into the genome of a host cell. For example, genetic elements can be placed into the chromosomes of the host cell as opposed to in a vector such as a plasmid carried by the host cell. Methods for integrating genetic elements into the genome of a host cell are well known in the art and include homologous recombination.
(108) The term “heterologous” when used in reference to a polynucleotide, a gene, a polypeptide, or an enzyme refers to a polynucleotide, gene, polypeptide, or an enzyme not normally found in the host organism. “Heterologous” also includes a native coding region, or portion thereof, that is removed from the source organism and subsequently reintroduced into the source organism in a form that is different from the corresponding native gene, e.g., not in its natural location in the organism's genome. The heterologous polynucleotide or gene may be introduced into the host organism by, e.g., gene transfer. A heterologous gene may include a native coding region that is a portion of a chimeric gene including non-native regulatory regions that is reintroduced into the native host. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes. A heterologous polynucleotide, gene, polypeptide, or an enzyme may be derived from any source, e.g., eukaryotes, prokaryotes, viruses, or synthetic polynucleotide fragments. The term “heterologous” as used herein also refers to an element of a vector, plasmid or host cell that is derived from a source other than the endogenous source. Thus, for example, a heterologous sequence could be a sequence that is derived from a different gene or plasmid from the same host, from a different strain of host cell, or from an organism of a different taxonomic group (e.g., different kingdom, phylum, class, order, family genus, or species, or any subgroup within one of these classifications). The term “heterologous” is also used synonymously herein with the term “exogenous.”
(109) The term “domain” as used herein refers to a part of a molecule or structure that shares common physical or chemical features, for example hydrophobic, polar, globular, helical domains or properties, e.g., a DNA binding domain or an ATP binding domain. Domains can be identified by their homology to conserved structural or functional motifs. Examples of cellobiohydrolase (CBH) domains include the catalytic domain (CD) and the cellulose binding domain (CBD).
(110) A “nucleic acid,” “polynucleotide,” or “nucleic acid molecule” is a polymeric compound comprised of covalently linked subunits called nucleotides. Nucleic acid includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which may be single-stranded or double-stranded. DNA includes cDNA, genomic DNA, synthetic DNA, and semi-synthetic DNA.
(111) An “isolated nucleic acid molecule” or “isolated nucleic acid fragment” refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; “RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; “DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5′ to 3′ direction along the non-transcribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).
(112) A “gene” refers to an assembly of nucleotides that encode a polypeptide, and includes cDNA and genomic DNA nucleic acids. “Gene” also refers to a nucleic acid fragment that expresses a specific protein, including intervening sequences (introns) between individual coding segments (exons), as well as regulatory sequences preceding (5′ non-coding sequences) and following (3′ non-coding sequences) the coding sequence. “Native gene” refers to a gene as found in nature with its own regulatory sequences.
(113) A nucleic acid molecule is “hybridizable” to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength. Hybridization and washing conditions are well known and exemplified, e.g., in Sambrook, J., Fritsch, E. F. and Maniatis, T. MOLECULAR CLONING: A LABORATORY MANUAL, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1989), particularly Chapter 11 and Table 11.1 therein (hereinafter “Maniatis”, entirely incorporated herein by reference). The conditions of temperature and ionic strength determine the “stringency” of the hybridization. Stringency conditions can be adjusted to screen for moderately similar fragments, such as homologous sequences from distantly related organisms, to highly similar fragments, such as genes that duplicate functional enzymes from closely related organisms. Post-hybridization washes determine stringency conditions. One set of conditions uses a series of washes starting with 6×SSC, 0.5% SDS at room temperature for 15 min, then repeated with 2×SSC, 0.5% SDS at 45° C. for 30 min, and then repeated twice with 0.2×SSC, 0.5% SDS at 50° C. for 30 min. For more stringent conditions, washes are performed at higher temperatures in which the washes are identical to those above except for the temperature of the final two 30 min washes in 0.2×SSC, 0.5% SDS are increased to 60° C. Another set of highly stringent conditions uses two final washes in 0.1×SSC, 0.1% SDS at 65° C. An additional set of highly stringent conditions are defined by hybridization at 0.1×SSC, 0.1% SDS, 65° C. and washed with 2×SSC, 0.1% SDS followed by 0.1×SSC, 0.1% SDS.
(114) Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic acids having those sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. For hybrids of greater than 100 nucleotides in length, equations for calculating Tm have been derived (see, e.g., Maniatis at 9.50-9.51). For hybridizations with shorter nucleic acids, i.e., oligonucleotides, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see, e.g., Maniatis, at 11.7-11.8). In one embodiment the length for a hybridizable nucleic acid is at least about 10 nucleotides. Preferably a minimum length for a hybridizable nucleic acid is at least about 15 nucleotides; more preferably at least about 20 nucleotides; and most preferably the length is at least 30 nucleotides. Furthermore, the skilled artisan will recognize that the temperature and wash solution salt concentration may be adjusted as necessary according to factors such as length of the probe.
(115) The term “percent identity”, as known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, “identity” also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences.
(116) As known in the art, “similarity” between two polypeptides is determined by comparing the amino acid sequence and conserved amino acid substitutes thereto of the polypeptide to the sequence of a second polypeptide.
(117) “Identity” and “similarity” can be readily calculated by known methods, including but not limited to those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, N Y (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, N Y (1993); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, N J (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, NY (1991). Preferred methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations may be performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignments of the sequences disclosed herein were performed using the Clustal method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the Clustal method were KTUPLE 1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5.
(118) Suitable nucleic acid sequences or fragments thereof (isolated polynucleotides of the present invention) encode polypeptides that are at least about 70% to 75% identical to the amino acid sequences reported herein, at least about 80%, 85%, or 90% identical to the amino acid sequences reported herein, or at least about 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequences reported herein. Suitable nucleic acid fragments are at least about 70%, 75%, or 80% identical to the nucleic acid sequences reported herein, at least about 80%, 85%, or 90% identical to the nucleic acid sequences reported herein, or at least about 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequences reported herein. Suitable nucleic acid fragments not only have the above identities/similarities but typically encode a polypeptide having at least 50 amino acids, at least 100 amino acids, at least 150 amino acids, at least 200 amino acids, or at least 250 amino acids.
(119) A DNA or RNA “coding region” is a DNA or RNA molecule which is transcribed and/or translated into a polypeptide in a cell in vitro or in vivo when placed under the control of appropriate regulatory sequences. “Suitable regulatory regions” refer to nucleic acid regions located upstream (5′ non-coding sequences), within, or downstream (3′ non-coding sequences) of a coding region, and which influence the transcription, RNA processing or stability, or translation of the associated coding region. Regulatory regions may include promoters, translation leader sequences, RNA processing site, effector binding site and stem-loop structure. The boundaries of the coding region are determined by a start codon at the 5′ (amino) terminus and a translation stop codon at the 3′ (carboxyl) terminus. A coding region can include, but is not limited to, prokaryotic regions, cDNA from mRNA, genomic DNA molecules, synthetic DNA molecules, or RNA molecules. If the coding region is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3′ to the coding region.
(120) An “isoform” is a protein that has the same function as another protein but which is encoded by a different gene and may have small differences in its sequence.
(121) A “paralogue” is a protein encoded by a gene related by duplication within a genome.
(122) An “orthologue” is gene from a different species that has evolved from a common ancestral gene by speciation. Normally, orthologues retain the same function in the course of evolution as the ancestral gene.
(123) “Open reading frame” is abbreviated ORF and means a length of nucleic acid, either DNA, cDNA or RNA, that comprises a translation start signal or initiation codon, such as an ATG or AUG, and a termination codon and can be potentially translated into a polypeptide sequence.
(124) “Promoter” refers to a DNA fragment capable of controlling the expression of a coding sequence or functional RNA. In general, a coding region is located 3′ to a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity. A promoter is generally bounded at its 3′ terminus by the transcription initiation site and extends upstream (5′ direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter will be found a transcription initiation site (conveniently defined for example, by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
(125) A coding region is “under the control” of transcriptional and translational control elements in a cell when RNA polymerase transcribes the coding region into mRNA, which is then trans-RNA spliced (if the coding region contains introns) and translated into the protein encoded by the coding region.
(126) “Transcriptional and translational control regions” are DNA regulatory regions, such as promoters, enhancers, terminators, and the like, that provide for the expression of a coding region in a host cell. In eukaryotic cells, polyadenylation signals are control regions.
(127) The term “operably associated” refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably associated with a coding region when it is capable of affecting the expression of that coding region (i.e., that the coding region is under the transcriptional control of the promoter). Coding regions can be operably associated to regulatory regions in sense or antisense orientation.
(128) The term “expression,” as used herein, refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. Expression may also refer to translation of mRNA into a polypeptide.
(129) The term “lignocellulose” refers to material that is comprised of lignin and cellulose.
(130) A “cellulolytic enzyme” can be any enzyme involved in cellulose digestion, metabolism and/or hydrolysis. The term “cellulase” refers to a class of enzymes produced chiefly by fungi, bacteria, and protozoans that catalyze cellulolysis (i.e. the hydrolysis) of cellulose. However, there are also cellulases produced by other types of organisms such as plants and animals. Several different kinds of cellulases are known, which differ structurally and mechanistically. There are general types of cellulases based on the type of reaction catalyzed: endocellulase breaks internal bonds to disrupt the crystalline structure of cellulose and expose individual cellulose polysaccharide chains; exocellulase cleaves 2-4 units from the ends of the exposed chains produced by endocellulase, resulting in the tetrasaccharides or disaccharide such as cellobiose. There are two main types of exocellulases (or cellobiohydrolases, abbreviate CBH)—one type working processively from the reducing end, and one type working processively from the non-reducing end of cellulose; cellobiase or beta-glucosidase hydrolyses the exocellulase product into individual monosaccharides; oxidative cellulases that depolymerize cellulose by radical reactions, as for instance cellobiose dehydrogenase (acceptor); cellulose phosphorylases that depolymerize cellulose using phosphates instead of water. In the most familiar case of cellulase activity, the enzyme complex breaks down cellulose to beta-glucose. A “cellulase” can be any enzyme involved in cellulose digestion, metabolism and/or hydrolysis, including an endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, and feruoyl esterase protein.
(131) An “amylolytic enzyme” can be any enzyme involved in amylase digestion, metabolism and/or hydrolysis. The term “amylase” refers to an enzyme that breaks starch down into sugar. Amylase is present in human saliva, where it begins the chemical process of digestion. Foods that contain much starch but little sugar, such as rice and potato, taste slightly sweet as they are chewed because amylase turns some of their starch into sugar in the mouth. The pancreas also makes amylase (α-amylase) to hydrolyse dietary starch into disaccharides and trisaccharides which are converted by other enzymes to glucose to supply the body with energy. Plants and some bacteria also produce amylase. All amylases are glycoside hydrolases and act on α-1,4-glycosidic bonds. Some amylases, such as γ-amylase (glucoamylase), also act on α-1,6-glycosidic bonds. Amylase enzymes include α-amylase (EC 3.2.1.1), β-amylase (EC 3.2.1.2), and γ-amylase (EC 3.2.1.3). The α-amylases are calcium metalloenzymes, unable to function in the absence of calcium. By acting at random locations along the starch chain, α-amylase breaks down long-chain carbohydrates, ultimately yielding maltotriose and maltose from amylose, or maltose, glucose and “limit dextrin” from amylopectin. Because it can act anywhere on the substrate, α-amylase tends to be faster-acting than β-amylase. In animals, it is a major digestive enzyme and its optimum pH is about 6.7-7.0. Another form of amylase, β-amylase is also synthesized by bacteria, fungi, and plants. Working from the non-reducing end, β-amylase catalyzes the hydrolysis of the second α-1,4 glycosidic bond, cleaving off two glucose units (maltose) at a time. Many microbes produce amylase to degrade extracellular starches. In addition to cleaving the last α(1-4)glycosidic linkages at the nonreducing end of amylose and amylopectin, yielding glucose, γ-amylase will cleave α(1-6) glycosidic linkages. Another amylolytic enzyme is alpha-glucosidase that acts on maltose and other short malto-oligosaccharides produced by alpha-, beta-, and gamma-amylases, converting them to glucose. Another amylolytic enzyme is pullulanase. Pullulanase is a specific kind of glucanase, an amylolytic exoenzyme, that degrades pullulan. Pullulan is regarded as a chain of maltotriose units linked by alpha-1,6-glycosidic bonds. Pullulanase (EC 3.2.1.41) is also known as pullulan-6-glucanohydrolase (Debranching enzyme). Another amylolytic enzyme, isopullulanase, hydrolyses pullulan to isopanose (6-alpha-maltosylglucose). Isopullulanase (EC 3.2.1.57) is also known as pullulan 4-glucanohydrolase. An “amylase” can be any enzyme involved in amylase digestion, metabolism and/or hydrolysis, including α-amylase, β-amylase, glucoamylase, pullulanase, isopullulanase, and alpha-glucosidase.
(132) The term “xylanolytic activity” is intended to include the ability to hydrolyze glycosidic linkages in oligopentoses and polypentoses. The term “xylanase” is the name given to a class of enzymes which degrade the linear polysaccharide beta-1,4-xylan into xylose, thus breaking down hemicellulose, one of the major components of plant cell walls. As such, it plays a major role in micro-organisms thriving on plant sources (mammals, conversely, do not produce xylanase). Additionally, xylanases are present in fungi for the degradation of plant matter into usable nutrients. Xylanases include those enzymes that correspond to Enzyme Commission Number 3.2.1.8. A “xylose metabolizing enzyme” can be any enzyme involved in xylose digestion, metabolism and/or hydrolysis, including a xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and a xylose transaldolase protein.
(133) The term “pectinase” is a general term for enzymes, such as pectolyase, pectozyme and polygalacturonase, commonly referred to in brewing as pectic enzymes. These enzymes break down pectin, a polysaccharide substrate that is found in the cell walls of plants. One of the most studied and widely used commercial pectinases is polygalacturonase. Pectinases are commonly used in processes involving the degradation of plant materials, such as speeding up the extraction of fruit juice from fruit, including apples and sapota. Pectinases have also been used in wine production since the 1960s.
(134) A “saccharolytic enzyme” can be any enzyme involved in carbohydrate digestion, metabolism and/or hydrolysis, including amylases, cellulases, hemicellulases, cellulolytic and amylolytic accessory enzymes, inulinases, levanases, and pentose sugar utilizing enzymes.
(135) A “pentose sugar utilizing enzyme” can be any enzyme involved in pentose sugar digestion, metabolism and/or hydrolysis, including xylanase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase.
(136) Host Cells Expressing Heterologous Saccharolytic Enzymes
(137) In order to address the limitations of the previous systems, in one aspect, the present invention provides host cells expressing heterologous cellulases that can be effectively and efficiently utilized to produce products such as ethanol from cellulose. In another embodiment, the host cells express heterologous amylases that can be effectively and efficiently utilized to produce products such as ethanol from biomass feedstock, such as grain feedstock. In yet another embodiment, the host cells express heterologous enzymes that utilize pentose sugars.
(138) In some embodiments, the host cell can be a yeast. According to the present invention the yeast host cell can be, for example, from the genera Saccharomyces, Kluyveromyces, Candida, Pichia, Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces, and Yarrowia. Yeast species as host cells can include, for example, S. cerevisiae, S. bulderi, S. barnetti, S. exiguus, S. uvarum, S. diastaticus, K. lactis, K. marxianus, or K. fragilis. In some embodiments, the yeast is selected from the group consisting of Saccharomyces cerevisiae, Schizzosaccharomyces pombe, Candida albicans, Pichia pastoris, Pichia stipitis, Yarrowia lipolytica, Hansenula polymorpha, Phaffia rhodozyma, Candida utilis, Arxula adeninivorans, Debaryomyces hansenii, Debaryomyces polymorphus, Schizosaccharomyces pombe and Schwanniomyces occidentalis. In one particular embodiment, the yeast is Saccharomyces cerevisiae. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
(139) In some embodiments of the present invention, the host cell is an oleaginous cell. According to the present invention, the oleaginous host cell can be an oleaginous yeast cell. For example, the oleaginous yeast host cell can be from the genera Blakeslea, Candida, Cryptococcus, Cunninghamella, Lipomyces, Mortierella, Mucor, Phycomyces, Pythium, Rhodosporidum, Rhodotorula, Trichosporon or Yarrowia. According to the present invention, the oleaginous host cell can be an oleaginous microalgae host cell. For example, the oleaginous microalgea host cell can be from the genera Thraustochytrium or Schizochytrium.
(140) In some embodiments of the present invention, the host cell is a thermotolerant host cell. Thermotolerant host cells can be particularly useful in simultaneous saccharification and fermentation processes by allowing externally produced cellulases and ethanol-producing host cells to perform optimally in similar temperature ranges.
(141) Thermotolerant host cells of the invention can include, for example, Issatchenkia orientalis, Pichia mississippiensis, Pichia mexicana, Pichia farinosa, Clavispora opuntiae, Clavispora lusitaniae, Candida mexicana, Hansenula polymorpha and Kluyveromyces host cells.
(142) In some particular embodiments of the present invention, the host cell is a Kluyveromyces host cell. For example, the Kluyveromyces host cell can be a K. lactis, K. marxianus, K. blattae, K. phaffii, K. yarrowii, K. aestuarii, K. dobzhanskii, K. wickerhamii, K. thermotolerans, or K. waltii host cell. In one embodiment, the host cell is a K. lactis, or K. marxianus host cell. In another embodiment, the host cell is a K. marxianus host cell.
(143) In some embodiments of the present invention the thermotolerant host cell can grow at temperatures above about 30° C., about 31° C., about 32° C., about 33° C., about 34° C., about 35° C., about 36° C., about 37° C., about 38° C., about 39° C., about 40° C., about 41° C. or about 42° C. In some embodiments of the present invention the thermotolerant host cell can produce ethanol from cellulose at temperatures above about 30° C., about 31° C., about 32° C., about 33° C., about 34° C., about 35° C., about 36° C., about 37° C., about 38° C., about 39° C., about 40° C., about 41° C., about 42° C., or about 50° C.
(144) In some embodiments of the present invention, the thermotolerant host cell can grow at temperatures from about 30° C. to 60° C., about 30° C. to 55° C., about 30° C. to 50° C. C, about 40° C. to 60° C., about 40° C. to 55° C. or about 40° C. to 50° C. In some embodiments of the present invention, the thermotolterant host cell can produce ethanol from cellulose at temperatures from about 30° C. to 60° C., about 30° C. to 55° C., about 30° C. to 50° C., about 40° C. to 60° C., about 40° C. to 55° C. or about 40° C. to 50° C.
(145) Host cells are genetically engineered (transduced or transformed or transfected) with the polynucleotides encoding saccharolytic enzymes (amylases, cellulases, hemicellulases, cellulolytic and amylolytic accessory enzymes, inulinases, levanases, pentose sugar hydrolases and others) of this invention which are described in more detail herein. The polynucleotides encoding saccharolytic enzymes can be introduced to the host cell on a vector of the invention, which may be, for example, a cloning vector or an expression vector comprising a sequence encoding a heterologous saccharolytic enzyme. The host cells can comprise polynucleotides of the invention as integrated copies or plasmid copies.
(146) In certain aspects, the present invention relates to host cells containing the polynucleotide constructs described herein. In one embodiment, the host cells of the present invention express one or more heterologous polypeptides of saccharolytic enzymes. In some embodiments, the host cell comprises a combination of polynucleotides that encode heterologous saccharolytic enzymes or fragments, variants or derivatives thereof. The host cell can, for example, comprise multiple copies of the same nucleic acid sequence, for example, to increase expression levels, or the host cell can comprise a combination of unique polynucleotides. In other embodiments, the host cell comprises a single polynucleotide that encodes a heterologous saccharolytic enzyme or a fragment, variant or derivative thereof. In particular, such host cells expressing a single heterologous saccharolytic enzyme can be used in co-culture with other host cells of the invention comprising a polynucleotide that encodes at least one other heterologous saccharolytic enzyme or fragment, variant or derivative thereof.
(147) Introduction of a polynucleotide encoding a heterologous saccharolytic enzyme into a host cell can be done by methods known in the art. Introduction of polynucleotides encoding heterologous saccharolytic enzyme into, for example yeast host cells, can be effected by lithium acetate transformation, spheroplast transformation, or transformation by electroporation, as described in Current Protocols in Molecular Biology, 13.7.1-13.7.10. Introduction of the construct in other host cells can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation. (Davis, L., et al., Basic Methods in Molecular Biology, (1986)).
(148) The transformed host cells or cell cultures, as described above, can be examined for protein content of an endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase protein, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, arabinase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase. For the use of secreted heterologous saccharolytic enzymes, protein content can be determined by analyzing the host (e.g., yeast) cell supernatants. In certain embodiments, high molecular weight material can be recovered from the yeast cell supernatant either by acetone precipitation or by buffering the samples with disposable de-salting cartridges. Proteins, including tethered heterologous saccharolytic enzymes, can also be recovered and purified from recombinant yeast cell cultures by methods including spheroplast preparation and lysis, cell disruption using glass beads, and cell disruption using liquid nitrogen for example. Additional protein purification methods include ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, gel filtration, and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
(149) Protein analysis methods include methods such as the traditional Lowry method, the BCA assay, absorbance at 280 nm, or the protein assay method according to BioRad's manufacturer's protocol. Using such methods, the protein content of saccharolytic enzymes can be estimated. Additionally, to accurately measure protein concentration a heterologous cellulase can be expressed with a tag, for example a His-tag or HA-tag and purified by standard methods using, for example, antibodies against the tag, a standard nickel resin purification technique or similar approach.
(150) The transformed host cells or cell cultures, as described above, can be further analyzed for hydrolysis of cellulose, or starch, or pentose sugar utilization (e.g., by a sugar detection assay), for a particular type of saccharolytic enzyme activity (e.g., by measuring the individual endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase) or for total cellulase activity. Endoglucanase activity can be determined, for example, by measuring an increase of reducing ends in an endoglucanase specific CMC or hydroxyethylcellulose (HEC) substrate. Cellobiohydrolase activity can be measured, for example, by using insoluble cellulosic substrates such as the amorphous substrate phosphoric acid swollen cellulose (PASC) or microcrystalline cellulose (Avicel) and determining the extent of the substrate's hydrolysis. ß-glucosidase activity can be measured by a variety of assays, e.g., using cellobiose. Assays for activity of other saccharolytic enzyme types are known in the art and are exemplified below.
(151) A total saccharolytic enzyme activity, which can include the activity of endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase protein, alpha-amylase, beta-amylase, glucoamylase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, pullulanase, isopullulanase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and xylose transaldolase can hydrolyze biomass feedstocks synergistically. For example, total cellulase activity can thus be measured using insoluble substrates including pure cellulosic substrates such as Whatman No. 1 filter paper, cotton linter, microcrystalline cellulose, bacterial cellulose, algal cellulose, and cellulose-containing substrates such as dyed cellulose, alpha-cellulose or pretreated lignocellulose. Specific activity of cellulases can also be detected by methods known to one of ordinary skill in the art, such as by the Avicel assay (described supra) that would be normalized by protein (cellulase) concentration measured for the sample. Total saccharolytic activity could be also measured using complex substrate containing starch, cellulose and hemicellulose such as corn mash by measuring released monomeric sugars. In such an assay different groups of enzymes could work in “indirect” when one group of enzymes such as cellulases can make substrate for another group of enzymes such as amylases more accessible through hydrolysis of cellulolytic substrate around amylolytic substrate. This mechanism can also work vice versa.
(152) One aspect of the invention is thus related to the efficient production of saccharolytic enzymes to aid in the digestion and utilization of starch, cellulose, and pentose sugars, and generation of products such as ethanol. A “saccharolytic enzyme” can be any enzyme involved in carbohydrate digestion, metabolism and/or hydrolysis, including amylases, cellulases, hemicellulases, cellulolytic and amylolytic accessory enzymes, inulinases, levanases, and pentose sugar hydrolasing enzymes. A “cellulase” can be any enzyme involved in cellulase digestion, metabolism and/or hydrolysis, including an endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, and feruoyl esterase protein. An “amylase” can be any enzyme involved in amylase digestion and/or metabolism, including alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, and alpha-glucosidase. A pentose sugar hydrolyzing enzyme can be any enzyme involved in pentose sugar digestion, and/or metabolism, including xylanase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase.
(153) In additional embodiments, the transformed host cells or cell cultures are assayed for ethanol production. Ethanol production can be measured by techniques known to one or ordinary skill in the art, e.g., by a standard HPLC refractive index method.
(154) Heterologous Saccharolytic Enzymes
(155) According to one aspect of the present invention, the expression of heterologous saccharolytic enzymes in a host cell can be used advantageously to produce products such as ethanol from biomass sources. For example, cellulases from a variety of sources can be heterologously expressed to successfully increase efficiency of ethanol production. The saccharolytic enzymes can be from fungi, yeast, bacteria, plant, protozoan or termite sources. In some embodiments, the saccharolytic enzyme is from H. grisea, T aurantiacus, T. emersonii, T. reesei, C. lacteus, C. formosanus, N. takasagoensis, C. acinaciformis, M. darwinensis, N. walkeri, S. fbuligera, C. luckowense R. speratus, Thermobfida fusca, Clostridum thermocellum, Clostridium cellulolyticum, Clostridum josui, Bacillus pumilis, Cellulomonas fimi, Saccharophagus degradans, Piromyces equii, Neocallimastix patricarum or Arabidopsis thaliana.
(156) In some embodiments, the cellulase of the invention is any cellulase disclosed in Table 4 or Table 7 produced herein. In some embodiments, the cellulase is encoded by a nucleic acid sequence at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to any one of SEQ ID NOs: 1-218. In some embodiments, the cellulase has an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%. or 100% identical to any one of SEQ ID NOs: 219-436. In some embodiments, the cellulase of the invention is any cellulase suitable for expression in an appropriate host cell.
(157) In other embodiments, the amylase of the invention is any amylase disclosed in Table 19 produced herein. In some embodiments, the amylase is encoded by a nucleic acid sequence at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to any one of SEQ ID NOs: 437-441. In some embodiments, the cellulase has an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to any one of SEQ ID NOs: 442-446. In some embodiments, the amylase of the invention is any amylase suitable for expression in an appropriate host cell.
(158) In some embodiments of the invention, multiple saccharolytic enzymes from a single organism are co-expressed in the same host cell. In some embodiments of the invention, multiple saccharolytic enzymes from different organisms are co-expressed in the same host cell. In particular, saccharolytic enzymes from two, three, four, five, six, seven, eight, nine or more organisms can be co-expressed in the same host cell. Similarly, the invention can encompass co-cultures of yeast strains, wherein the yeast strains express different saccharolytic enzymes. Co-cultures can include yeast strains expressing heterologous saccharolytic enzymes from the same organisms or from different organisms. Co-cultures can include yeast strains expressing saccharolytic enzymes from two, three, four, five, six, seven, eight, nine or more organisms.
(159) Lignocellulases of the present invention include both endoglucanases and exoglucanases. Other lignocellulases of the invention include accesory enzymes which can act on the lignocellulosic material. The lignocellulases can be, for example, endoglucanases, glucosidases, cellobiohydrolases, xylanases, glucanases, xylosidases, xylan esterases, arabinofuranosidases, galactosidases, cellobiose phosphorylases, cellodextrin phosphorylases, mannanases, mannosidases, xyloglucanases, endoxylanases, glucuronidases, acetylxylanesterases, arabinofuranohydrolases, swollenins, glucuronyl esterases, expansins, pectinases, and feruoyl esterases. In some embodiments, the lignocellulases of the invention can be any suitable enzyme for digesting the desired lignocellulosic material.
(160) In certain embodiments of the invention, the lignocellulase can be an endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, and feruoyl esterase paralogue or orthologue. In particular embodiments, the lignocellulase is derived from any species named in Tables 4 and 7. In one particular embodiment, the lignocellulase comprises an amino acid sequence selected from SEQ ID NOs: 219-436. In certain other embodiments, the lignocellulase comprises an amino acid sequence that is at least about 70, about 80, about 90, about 95, about 96, about 97, about 98, about 99, or 100% identical to an amino acid sequence selected from SEQ ID NOs: 219-436.
(161) In other embodiments of the invention, the amylases can be alpha-amylases, beta-amylases, glucoamylases, alpha-glucosidases, pullulanase, or isopullulanase paralogues or orthologues.
(162) As a practical matter, whether any polypeptide is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a polypeptide of the present invention can be determined conventionally using known computer programs. Methods for determining percent identity, as discussed in more detail below in relation to polynucleotide identity, are also relevant for evaluating polypeptide sequence identity.
(163) In some particular embodiments of the invention, the saccharolytic enzyme comprises a sequence selected from the saccharolytic enzymes disclosed in Table 4, or Table 7, or Table 19 presented herein. The saccharolytic enzymes of the invention also include saccharolytic enzymes that comprise a sequence at least about 70, about 80, about 90, about 95, about 96, about 97, about 98, about 99 or 100% identical to the sequences of Table 4, or Table 7, or Table 19. Amino acid and nucleic acid sequences are readily determined for a gene, protein or other element by a accession number upon consulting the proper database, for example Genebank. However, sequences for the genes and proteins of the present invention are also disclosed herein (SEQ ID NOs: 1-445).
(164) Some embodiments of the invention encompass a polypeptide comprising at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, or 500 or more consecutive amino acids of any of SEQ ID NOs: 219-445, or domains, fragments, variants, or derivatives.
(165) In certain aspects of the invention, the polypeptides and polynucleotides of the present invention are provided in an isolated form, e.g., purified to homogeneity.
(166) The present invention also encompasses polypeptides which comprise, or alternatively consist of, an amino acid sequence which is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% similar to the polypeptide of any of SEQ ID NOs: 219-436, or SEQ ID NOs:442-446, and to portions of such polypeptide with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
(167) As known in the art “similarity” between two polypeptides is determined by comparing the amino acid sequence and conserved amino acid substitutes thereto of the polypeptide to the sequence of a second polypeptide.
(168) The present invention further relates to a domain, fragment, variant, derivative, or analog of the polypeptide of any of SEQ ID NOs: 219-436, or SEQ ID NOs:442-446.
(169) Fragments or portions of the polypeptides of the present invention can be employed for producing the corresponding full-length polypeptide by peptide synthesis. Therefore, the fragments can be employed as intermediates for producing the full-length polypeptides.
(170) Fragments of lignocellulases of the invention encompass domains, proteolytic fragments, deletion fragments and in particular, fragments of any of the genes named in Tables 4 and 7, which retain any specific biological activity of the endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, and feruoyl esterase proteins. Polypeptide fragments further include any portion of the polypeptide which retains a catalytic activity of endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, and feruoyl esterase protein.
(171) Fragments of amylases of the invention encompass domains, proteolytic fragments, deletion fragments and in particular, fragments of any of the genes named in Tables 15, 16, and 19, which retain any specific biological activity of the alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, and alpha-glucosidase proteins. Polypeptide fragments further include any portion of the polypeptide which retains a catalytic activity of alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, and alpha-glucosidase protein.
(172) The variant, derivative or analog of the polypeptide of any of SEQ ID NOs: 219-436, or SEQ ID NOs:442-446 may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide for purification of the polypeptide or (v) one in which a fragment of the polypeptide is soluble, i.e., not membrane bound, yet still binds ligands to the membrane bound receptor. Such variants, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
(173) The polypeptides of the present invention further include variants of the polypeptides. A “variant” of the polypeptide can be a conservative variant, or an allelic variant. As used herein, a conservative variant refers to alterations in the amino acid sequence that do not adversely affect the biological functions of the protein. A substitution, insertion or deletion is said to adversely affect the protein when the altered sequence prevents or disrupts a biological function associated with the protein. For example, the overall charge, structure or hydrophobic-hydrophilic properties of the protein can be altered without adversely affecting a biological activity. Accordingly, the amino acid sequence can be altered, for example to render the peptide more hydrophobic or hydrophilic, without adversely affecting the biological activities of the protein.
(174) By an “allelic variant” is intended alternate forms of a gene occupying a given locus on a chromosome of an organism. Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985). Non-naturally occurring variants may be produced using art-known mutagenesis techniques. Allelic variants, though possessing a slightly different amino acid sequence than those recited above, will still have the same or similar biological functions associated with the endoglucanases, glucosidases, cellobiohydrolases, xylanases, glucanases, xylosidases, xylan esterases, arabinofuranosidases, galactosidases, cellobiose phosphorylases, cellodextrin phosphorylases, mannanases, mannosidases, xyloglucanases, endoxylanases, glucuronidases, acetylxylanesterases, arabinofuranohydrolases, swollenins, glucuronyl esterases, expansins, pectinases, feruoyl esterases, alpha-amylase, beta-amylase, glucoamylase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase of the invention. The allelic variants, the conservative substitution variants, and members of the endoglucanase, cellobiohydrolase, β-glucosidase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, or alpha-glucosidase protein families, can have an amino acid sequence having at least 75%, at least 80%, at least 90%, at least 95% amino acid sequence identity with endoglucanases, glucosidases, cellobiohydrolases, xylanases, glucanases, xylosidases, xylan esterases, arabinofuranosidases, galactosidases, cellobiose phosphorylases, cellodextrin phosphorylases, mannanases, mannosidases, xyloglucanases, endoxylanases, glucuronidases, acetylxylanesterases, arabinofuranohydrolases, swollenins, glucuronyl esterases, expansins, pectinases, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, and beta-glucosidase amino acid sequence set forth in any one of SEQ ID NOs: 219-436, and SEQ ID NOs: 442-446. Identity or homology with respect to such sequences is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the known peptides, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology, and not considering any conservative substitutions as part of the sequence identity. N-terminal, C-terminal or internal extensions, deletions, or insertions into the peptide sequence shall not be construed as affecting homology.
(175) Thus, in one aspect the proteins and peptides of the present invention include molecules comprising the amino acid sequence of SEQ ID NOs: 219-436, or and SEQ ID NOs: 442-446 or fragments thereof having a consecutive sequence of at least about 3, 4, 5, 6, 10, 15, 20, 25, 30, 35 or more amino acid residues of the endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, and beta-glucosidase polypeptide sequences; amino acid sequence variants of such sequences wherein at least one amino acid residue has been inserted N- or C-terminal to, or within, the disclosed sequence; amino acid sequence variants of the disclosed sequences, or their fragments as defined above, that have been substituted by another residue. Contemplated variants further include those containing predetermined mutations by, e.g., homologous recombination, site-directed or PCR mutagenesis, and the corresponding proteins of other animal species, including but not limited to bacterial, fungal, insect, rabbit, rat, porcine, bovine, ovine, equine and non-human primate species, the alleles or other naturally occurring variants of the family of proteins; and derivatives wherein the protein has been covalently modified by substitution, chemical, enzymatic, or other appropriate means with a moiety other than a naturally occurring amino acid (for example, a detectable moiety such as an enzyme or radioisotope).
(176) Using known methods of protein engineering and recombinant DNA technology, variants may be generated to improve or alter the characteristics of the polypeptides of saccharolytic enzymes. For instance, one or more amino acids can be deleted from the N-terminus or C-terminus of the secreted protein without substantial loss of biological function.
(177) Thus, in another aspect the invention further includes endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and xylose transaldolase polypeptide variants which show substantial biological activity. Such variants include deletions, insertions, inversions, repeats, and substitutions selected according to general rules known in the art so as have little effect on activity.
(178) The skilled artisan is fully aware of amino acid substitutions that are either less likely or not likely to significantly effect protein function (e.g., replacing one aliphatic amino acid with a second aliphatic amino acid), as further described below.
(179) For example, guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie et al., “Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions,” Science 247:1306-1310 (1990), wherein the authors indicate that there are two main strategies for studying the tolerance of an amino acid sequence to change.
(180) The first strategy exploits the tolerance of amino acid substitutions by natural selection during the process of evolution. By comparing amino acid sequences in different species, conserved amino acids can be identified. These conserved amino acids are likely important for protein function. In contrast, the amino acid positions where substitutions have been tolerated by natural selection indicates that these positions are not critical for protein function. Thus, positions tolerating amino acid substitution could be modified while still maintaining biological activity of the protein.
(181) The second strategy uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene to identify regions critical for protein function. For example, site directed mutagenesis or alanine-scanning mutagenesis (introduction of single alanine mutations at every residue in the molecule) can be used. (Cunningham and Wells, Science 244:1081-1085 (1989).) The resulting mutant molecules can then be tested for biological activity.
(182) As the authors state, these two strategies have revealed that proteins are often surprisingly tolerant of amino acid substitutions. The authors further indicate which amino acid changes are likely to be permissive at certain amino acid positions in the protein. For example, most buried (within the tertiary structure of the protein) amino acid residues require nonpolar side chains, whereas few features of surface side chains are generally conserved. Moreover, tolerated conservative amino acid substitutions involve replacement of the aliphatic or hydrophobic amino acids Ala, Val, Leu and Ile; replacement of the hydroxyl residues Ser and Thr; replacement of the acidic residues Asp and Glu; replacement of the amide residues Asn and Gln, replacement of the basic residues Lys, Arg, and His; replacement of the aromatic residues Phe, Tyr, and Trp, and replacement of the small-sized amino acids Ala, Ser, Thr, Met, and Gly.
(183) The terms “derivative” and “analog” refer to a polypeptide differing from the endoglucanases, glucosidases, cellobiohydrolases, xylanases, glucanases, xylosidases, xylan esterases, arabinofuranosidases, galactosidases, cellobiose phosphorylases, cellodextrin phosphorylases, mannanases, mannosidases, xyloglucanases, endoxylanases, glucuronidases, acetylxylanesterases, arabinofuranohydrolases, swollenins, glucuronyl esterases, expansins, pectinases, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and xylose transaldolase polypeptides as disclosed herein, but retaining essential properties thereof. Generally, derivatives and analogs are overall closely similar, and, in many regions, identical to the endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and xylose transaldolase polypeptides disclosed herein. The terms “derivative” and “analog” when referring to endoglucanases, glucosidases, cellobiohydrolases, xylanases, glucanases, xylosidases, xylan esterases, arabinofuranosidases, galactosidases, cellobiose phosphorylases, cellodextrin phosphorylases, mannanases, mannosidases, xyloglucanases, endoxylanases, glucuronidases, acetylxylanesterases, arabinofuranohydrolases, swollenins, glucuronyl esterases, expansins, pectinases, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and xylose transaldolase polypeptides include any polypeptides which retain at least some of the activity of the corresponding native polypeptide, e.g., the exoglucanase activity, or the activity of the its catalytic domain.
(184) Derivatives of the saccharolytic enzymes disclosed herein, are polypeptides which have been altered so as to exhibit features not found on the native polypeptide. Derivatives can be covalently modified by substitution, chemical, enzymatic, or other appropriate means with a moiety other than a naturally occurring amino acid (for example, a detectable moiety such as an enzyme or radioisotope). Examples of derivatives include fusion proteins.
(185) An analog is another form of an endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and xylose transaldolase polypeptide of the present invention. An “analog” also retains substantially the same biological function or activity as the polypeptide of interest, e.g., functions as a xylanase. An analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
(186) The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide. In some particular embodiments, the polypeptide is a recombinant polypeptide.
(187) Also provided in the present invention are allelic variants, orthologs, and/or species homologs. Procedures known in the art can be used to obtain full-length genes, allelic variants, splice variants, full-length coding portions, orthologs, and/or species homologs of genes corresponding to any of SEQ ID NOs: 1-218, or SEQ ID NOs: 437-441 using information from the sequences disclosed herein or the clones deposited with the ATCC. For example, allelic variants and/or species homologs may be isolated and identified by making suitable probes or primers from the sequences provided herein and screening a suitable nucleic acid source for allelic variants and/or the desired homologue.
(188) Combinations of Saccharolytic Enzymes
(189) In some embodiments of the present invention, the host cell expresses a combination of heterologous saccharolytic enzymes. For example, the host cell can contain at least two heterologous saccharolytic enzymes, at least three heterologous saccharolytic enzymes, at least four heterologous saccharolytic enzymes, at least five heterologous saccharolytic enzymes, at least six heterologous saccharolytic enzymes, at least seven heterologous saccharolytic enzymes, at least eight heterologous saccharolytic enzymes, at least nine heterologous saccharolytic enzymes, at least ten heterologous saccharolytic enzymes, at least eleven heterologous saccharolytic enzymes, at least twelve heterologous saccharolytic enzymes, at least thirteen heterologous saccharolytic enzymes, at least fourteen heterologous saccharolytic enzymes, or at least fifteen heterologous saccharolytic enzymes. The heterologous saccharolytic enzymes in the host cell can be from the same or from different species. In one embodiment the host cell expresses heterologous enzymes comprising cellobiohydrolases, endo-gluconases, beta-glucosidases, xylanases, xylosidases, glucoamylases, alpha-amylases, alpha-glucosidases, pullulanases, isopullulanases, pectinases, and acetylxylan esterases.
(190) Tethered and Secreted Saccharolytic Enzymes
(191) According to the present invention, the saccharolytic enzymes can be either tethered or secreted. As used herein, a protein is “tethered” to an organism's cell surface if at least one terminus of the protein is bound, covalently and/or electrostatically for example, to the cell membrane or cell wall. It will be appreciated that a tethered protein can include one or more enzymatic regions that can be joined to one or more other types of regions at the nucleic acid and/or protein levels (e.g., a promoter, a terminator, an anchoring domain, a linker, a signaling region, etc.). While the one or more enzymatic regions may not be directly bound to the cell membrane or cell wall (e.g., such as when binding occurs via an anchoring domain), the protein is nonetheless considered a “tethered enzyme” according to the present specification.
(192) Tethering can, for example, be accomplished by incorporation of an anchoring domain into a recombinant protein that is heterologously expressed by a cell, or by prenylation, fatty acyl linkage, glycosyl phosphatidyl inositol anchors or other suitable molecular anchors which may anchor the tethered protein to the cell membrane or cell wall of the host cell. A tethered protein can be tethered at its amino terminal end or optionally at its carboxy terminal end.
(193) As used herein, “secreted” means released into the extracellular milieu, for example into the media. Although tethered proteins may have secretion signals as part of their immature amino acid sequence, they are maintained as attached to the cell surface, and do not fall within the scope of secreted proteins as used herein.
(194) As used herein, “flexible linker sequence” refers to an amino acid sequence which links two amino acid sequences, for example, a cell wall anchoring amino acid sequence with an amino acid sequence that contains the desired enzymatic activity. The flexible linker sequence allows for necessary freedom for the amino acid sequence that contains the desired enzymatic activity to have reduced steric hindrance with respect to proximity to the cell and may also facilitate proper folding of the amino acid sequence that contains the desired enzymatic activity.
(195) In some embodiments of the present invention, the tethered cellulase enzymes are tethered by a flexible linker sequence linked to an anchoring domain. In some embodiments, the anchoring domain is of CWP2 (for carboxy terminal anchoring) or FLO1 (for amino terminal anchoring) from S. cerevisiae.
(196) In some embodiments, heterologous secretion signals may be added to the expression vectors of the present invention to facilitate the extra-cellular expression of cellulase proteins. In some embodiments, the heterologous secretion signal is the secretion signal from T. reesei Xyn2. In other embodiments, the heterologous secretion signal is the S. cerevisiae Invertase signal. In yet other embodiments, the heterologous secretion signal is the S. cerevisiae AF mating signal.
(197) Fusion Proteins Comprising Saccharolytic Enzymes
(198) The present invention also encompasses fusion proteins. For example, the fusion proteins can be a fusion of a heterologous saccharolytic enzyme and a second peptide. The heterologous saccharolytic enzyme and the second peptide can be fused directly or indirectly, for example, through a linker sequence. The fusion protein can comprise for example, a second peptide that is N-terminal to the heterologous saccharolytic enzyme and/or a second peptide that is C-terminal to the heterologous saccharolytic enzyme. Thus, in certain embodiments, the polypeptide of the present invention comprises a first polypeptide and a second polypeptide, wherein the first polypeptide comprises a heterologous saccharolytic enzyme.
(199) According to one aspect of the present invention, the fusion protein can comprise a first and second polypeptide wherein the first polypeptide comprises a heterologous saccharolytic enzyme and the second polypeptide comprises a signal sequence. According to another embodiment, the fusion protein can comprise a first and second polypeptide, wherein the first polypeptide comprises a heterologous saccharolytic enzyme and the second polypeptide comprises a polypeptide used to facilitate purification or identification or a reporter peptide. The polypeptide used to facilitate purification or identification or the reporter peptide can be, for example, a HIS-tag, a GST-tag, an HA-tag, a FLAG-tag, a MYC-tag, or a fluorescent protein.
(200) According to yet another embodiment, the fusion protein can comprise a first and second polypeptide, wherein the first polypeptide comprises a heterologous saccharolytic enzyme and the second polypeptide comprises an anchoring peptide. In some embodiments, the anchoring domain is of CWP2 (for carboxy terminal anchoring) or FLO1 (for amino terminal anchoring) from S. cerevisiae.
(201) According to yet another embodiment, the fusion protein can comprise a first and second polypeptide, wherein the first polypeptide comprises a heterologous saccharolytic enzyme and the second polypeptide comprises a cellulose binding module (CBM or SBM). In some embodiments, the CBM is from, for example, T. reesei Cbh1 or Cbh2 or from C. lucknowense Cbh2b. In some particular embodiments, the CBM is fused to a endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase.
(202) In certain embodiments, the polypeptide of the present invention encompasses a fusion protein comprising a first polypeptide and a second polypeptide, wherein the first polypeptide is an endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase. and the second polypeptide is selected from a polypeptide encoded by a domain or fragment of a saccharolytic enzyme disclosed herein. In certain embodiments, the polypeptides of the present invention encompasses a fusion protein comprising a first saccharolytic enzyme polypeptide, where the first polypeptide is a domain, derivative or fragment of any saccharolytic enzyme polypeptide disclosed herein, and a second polypeptide, where the second polypeptide is a T. emersonii Cbh1, H. grisea Cbh1, or T. aurantiacusi Cbh1, T. emersonii Cbh2, T. reesei Cbh1 or T. reesei Cbh2, C. lucknowense Cbh2b, or domain, fragment, variant, or derivative thereof. In additional embodiments, the first polypeptide is either N-terminal or C-terminal to the second polypeptide. In certain other embodiments, the first polypeptide and/or the second polypeptide are encoded by codon-optimized polynucleotides, for example, polynucleotides codon-optimized for S. cerevisiae or Kluveromyces.
(203) In certain other embodiments, the first polypeptide and the second polypeptide are fused via a linker sequence. The linker sequence can, in some embodiments, be encoded by a codon-optimized polynucelotide. (Codon-optimized polynucleotides are described in more detail below.) An amino acid sequence corresponding to a codon-optimized linker 1 according to the invention is a flexible linker—strep tag—TEV site—FLAG—flexible linker fusion and corresponds to GGGGSGGGGS AWHPQFGG ENLYFQG DYKDDDK GGGGSGGGGS
(204) An exemplary DNA sequence is as follows:
(205) TABLE-US-00001 (SEQ ID NO: 41) GGAGGAGGTGGTTCAGGAGGTGGTGGGTCTGCTTGGCATCCACAATTTG GAGGAGGCGGTGGTGAAAATCTGTATTTCCAGGGAGGCGGAGGTGATTA CAAGGATGACGACAAAGGAGGTGGTGGATCAGGAGGTGGTGGCTCC
(206) An amino acid sequence corresponding to optimized linker 2 is a flexible linker—strep tag—linker—TEV site—flexible linker and corresponds to GGGGSGGGGS WSHPQFEK GG ENLYFQG GGGGSGGGGS. The DNA sequence is as follows:
(207) TABLE-US-00002 ggtggcggtggatctggaggaggcggttcttggtctcacccacaatttg aaaagggtggagaaaacttgtactttcaaggcggtggtggaggttctgg cggaggtggctccggctca.
Co-Cultures
(208) In another aspect, the present invention is directed to co-cultures comprising at least two yeast host cells wherein the at least two yeast host cells each comprise an isolated polynucleotide encoding a saccharolytic enzyme. As used herein, “co-culture” refers to growing two different strains or species of host cells together in the same vessel. In some embodiments of the invention, at least one host cell of the co-culture comprises a heterologous polynucleotide comprising a nucleic acid which encodes an endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, alpha-glucosidase, pullulanase, isopullulanase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase at least one host cell of the co-culture comprises a heterologous polynucleotide comprising a nucleic acid which encodes a different endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, alpha-glucosidase, beta-glucosidase, pullulanase, isopullulanase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and xylose transaldolase and at least one host cell comprises a heterologous polynucleotide comprising a nucleic acid which encodes a still different endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, alpha-glucosidase, beta-glucosidase, pullulanase, isopullulanase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase.
(209) The co-culture can comprise two or more strains of yeast host cells and the heterologous saccharolytic enzymes can be expressed in any combination in the two or more strains of host cells. For example, according to the present invention, the co-culture can comprise two strains: one strain of host cells that expresses an endoglucanase and a second strain of host cells that expresses a β-glucosidase, a cellobiohydrolase and a second cellobiohydrolase. Similarly, the co-culture can comprise one strain of host cells that expresses two saccharolytic enzymes, for example an endoglucanase and a beta-glucosidase and a second strain of host cells that expresses one or more saccharolytic enzymes, for example one or more endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase. The co-culture can, in addition to the at least two host cells comprising heterologous saccharolytic enzymes, also include other host cells which do not comprise heterologous saccharolytic enzymes. The co-culture can comprise one strain expressing an endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase; and a second host cell expressing an endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase.
(210) The various host cell strains in the co-culture can be present in equal numbers, or one strain or species of host cell can significantly outnumber another second strain or species of host cells. For example, in a co-culture comprising two strains or species of host cells the ratio of one host cell to another can be about 1:1, 1:2, 1:3, 1:4, 1:5, 1:10, 1:100, 1:500 or 1:1000. Similarly, in a co-culture comprising three or more strains or species of host cells, the strains or species of host cells may be present in equal or unequal numbers.
(211) Biomass feedstocks contain varying proportions of starch, lignocellulose, and pentose sugars. Therefore, in one aspect, yeast strains express different saccharolytic enzymes at different levels. In one embodiment, the one or more amylolytic enzymes are expressed at higher levels in yeast strain(s) as compared to one or more lignocellulases and/or the one or more pentose sugar utilizing enzymes. In another embodiment, the one or more lignocellulases are expressed at higher levels in yeast strain(s) as compared to one or more amylolytic enzymes and/or the one or more pentose sugar utilizing enzymes. In yet another embodiment, the one or more pentose sugar utilizing enzymes are expressed at higher levels in yeast strain(s) as compared to one or more lignocellulases and/or the one or more amylolytic enzymes. In still another embodiment, the one or more amylolytic enzymes, one or more cellulases, and one or more pentose sugar utilizing enzymes are all expressed at approximately equal levels in the yeast strain(s). In some embodiments of the present invention, the ratio of expression of amylolytic enzymes to cellulolytic enzymes in the yeast strain(s) is about 1:5, about 1:2, about 1:1, about 2:1, or about 5:1. In some embodiments of the present invention, the relative expression levels of the amylolytic enzymes and cellulolytic enzymes can be determined using chromatographic techniques, such as HPLC, ion-exchange chromatography, size exclusion chromatography, or by 2D gel electrophoresis, immunoblotting, mass spectrometry, MALDI_TOF, or functional assays.
(212) The co-cultures of the present invention can include tethered saccharolytic enzymes, secreted saccharolytic enzymes or both tethered and secreted saccharolytic enzymes. For example, in some embodiments of the invention, the co-culture comprises at least one yeast host cell comprising a polynucleotide encoding a secreted heterologous saccharolytic enzymes. In another embodiment, the co-culture comprises at least one yeast host cell comprising a polynucleotide encoding a tethered heterologous saccharolytic enzymes. In one embodiment, all of the heterologous saccharolytic enzymes in the co-culture are secreted, and in another embodiment, all of the heterologous saccharolytic enzymes in the co-culture are tethered. In addition, other saccharolytic enzymes, such as externally added saccharolytic enzymes may be present in the co-culture.
(213) Polynucleotides Encoding Heterologous Saccharolytic Enzymes
(214) In another aspect, the present invention includes isolated polynucleotides encoding saccharolytic enzymes of the present invention. Thus, the polynucleotides of the invention can encode endoglucanases, exoglucanases, amylases, or pentose sugar utilizing enzymes. The polynucleotides can encode an endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase.
(215) The present invention also encompasses an isolated polynucleotide comprising a nucleic acid that is at least about 70%, 75%, or 80% identical, at least about 90% to about 95% identical, or at least about 96%, 97%, 98%, 99% or 100% identical to a nucleic acid encoding an endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase disclosed herein.
(216) The present invention also encompasses variants of the saccharolytic enzymes genes, as described above. Variants may contain alterations in the coding regions, non-coding regions, or both. Examples are polynucleotide variants containing alterations which produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded polypeptide. In certain embodiments, nucleotide variants are produced by silent substitutions due to the degeneracy of the genetic code. In further embodiments, endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and xylose transaldolase polynucleotide variants can be produced for a variety of reasons, e.g., to optimize codon expression for a particular host. Codon-optimized polynucleotides of the present invention are discussed further below.
(217) The present invention also encompasses an isolated polynucleotide encoding a fusion protein. In certain embodiments, the nucleic acid encoding a fusion protein comprises a first polynucleotide encoding for a endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and xylose transaldolase as disclosed herein and a CBD (as described above).
(218) In further embodiments, the first and second polynucleotides are in the same orientation, or the second polynucleotide is in the reverse orientation of the first polynucleotide. In additional embodiments, the first polynucleotide encodes a polypeptide that is either N-terminal or C-terminal to the polypeptide encoded by the second polynucleotide. In certain other embodiments, the first polynucleotide and/or the second polynucleotide are encoded by codon-optimized polynucleotides, for example, polynucleotides codon-optimized for S. cerevisiae, Kluyveromyces or for both S. cerevisiae and Kluyveromyces.
(219) Also provided in the present invention are allelic variants, orthologs, and/or species homologs. Procedures known in the art can be used to obtain full-length genes, allelic variants, splice variants, full-length coding portions, orthologs, and/or species homologs of genes corresponding to any of SEQ ID NOs: 1-218, or any of SEQ ID NOs: 437-441, using information from the sequences disclosed herein or the clones deposited with the ATCC or otherwise publically available. For example, allelic variants and/or species homologs may be isolated and identified by making suitable probes or primers from the sequences provided herein and screening a suitable nucleic acid source for allelic variants and/or the desired homologue.
(220) By a nucleic acid having a nucleotide sequence at least, for example, 95% “identical” to a reference nucleotide sequence of the present invention, it is intended that the nucleotide sequence of the nucleic acid is identical to the reference sequence except that the nucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the particular polypeptide. In other words, to obtain a nucleic acid having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. The query sequence may be an entire sequence shown of any of SEQ ID NOs: 1-218, or any of SEQ ID NOs: 437-441, or any fragment or domain specified as described herein.
(221) As a practical matter, whether any particular nucleic acid molecule or polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide sequence or polypeptide of the present invention can be determined conventionally using known computer programs. A method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6:237-245.) In a sequence alignment the query and subject sequences are both DNA sequences. An RNA sequence can be compared by converting U's to T's. The result of said global sequence alignment is in percent identity. Preferred parameters used in a FASTDB alignment of DNA sequences to calculate percent identity are: Matrix=Unitary, k-tuple=4, Mismatch Penalty=1, Joining Penalty=30, Randomization Group Length=0, Cutoff Score=1, Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or the length of the subject nucleotide sequence, whichever is shorter.
(222) If the subject sequence is shorter than the query sequence because of 5′ or 3′ deletions, not because of internal deletions, a manual correction must be made to the results. This is because the FASTDB program does not account for 5′ and 3′ truncations of the subject sequence when calculating percent identity. For subject sequences truncated at the 5′ or 3′ ends, relative to the query sequence, the percent identity is corrected by calculating the number of bases of the query sequence that are 5′ and 3′ of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This corrected score is what is used for the purposes of the present invention. Only bases outside the 5′ and 3′ bases of the subject sequence, as displayed by the FASTDB alignment, which are not matched/aligned with the query sequence, are calculated for the purposes of manually adjusting the percent identity score.
(223) For example, a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity. The deletions occur at the 5′ end of the subject sequence and therefore, the FASTDB alignment does not show a matched/alignment of the first 10 bases at 5′ end. The 10 unpaired bases represent 10% of the sequence (number of bases at the 5′ and 3′ ends not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases were perfectly matched the final percent identity would be 90%. In another example, a 90 base subject sequence is compared with a 100 base query sequence. This time the deletions are internal deletions so that there are no bases on the 5′ or 3′ of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected. Once again, only bases 5′ and 3′ of the subject sequence which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to be made for the purposes of the present invention.
(224) Some embodiments of the invention encompass a nucleic acid molecule comprising at least 10, 20, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, or 800 consecutive nucleotides or more of any of SEQ ID NOs: 1-218, or any of SEQ ID NOs: 437-441, or domains, fragments, variants, or derivatives thereof.
(225) The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double stranded or single-stranded, and if single stranded can be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide can be identical to the coding sequence encoding SEQ ID NO: 219-436, or SEQ ID NO: 442-446, or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the nucleic acid sequences of any one of SEQ ID NOs: 1-218, or any one of SEQ ID NOs: 437-441.
(226) In certain embodiments, the present invention provides an isolated polynucleotide comprising a nucleic acid fragment which encodes at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, or at least 100 or more contiguous amino acids of SEQ ID NOs: 219-436, or SEQ ID NO: 442-446.
(227) The polynucleotide encoding for the mature polypeptide of SEQ ID NOs: 219-436, or SEQ ID NO: 442-446 may include: only the coding sequence for the mature polypeptide; the coding sequence of any domain of the mature polypeptide; and the coding sequence for the mature polypeptide (or domain-encoding sequence) together with non coding sequence, such as introns or non-coding sequence 5′ and/or 3′ of the coding sequence for the mature polypeptide.
(228) Thus, the term “polynucleotide encoding a polypeptide” encompasses a polynucleotide which includes only sequences encoding for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequences.
(229) In further aspects of the invention, nucleic acid molecules having sequences at least about 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequences disclosed herein, encode a polypeptide having an endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and xylose transaldolase. functional activity.
(230) Of course, due to the degeneracy of the genetic code, one of ordinary skill in the art will immediately recognize that a large portion of the nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of any of SEQ ID NOs: 1-218, or any of SEQ ID NOs: 437-441, or fragments thereof, will encode polypeptides having functional activity. In fact, since degenerate variants of any of these nucleotide sequences all encode the same polypeptide, in many instances, this will be clear to the skilled artisan even without performing the above described comparison assay. It will be further recognized in the art that, for such nucleic acid molecules that are not degenerate variants, a reasonable number will also encode a polypeptide having functional activity.
(231) The polynucleotides of the present invention also comprise nucleic acids encoding an endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and xylose transaldolase, or domain, fragment, variant, or derivative thereof, fused to a polynucleotide encoding a marker sequence which allows for detection of the polynucleotide of the present invention. In one embodiment of the invention, expression of the marker is independent from expression of the saccharolytic enzyme. The marker sequence may be a yeast selectable marker selected from the group consisting of URA3, HIS3, LEU2, TRP1, LYS2, ADE2 or any other suitable selectable marker known in the art. Casey, G. P. et al., “A convenient dominant selection marker for gene transfer in industrial strains of Saccharomyces yeast: SMR1 encoded resistance to the herbicide sulfometuron methyl,” J. Inst. Brew. 94:93-97 (1988).
(232) Codon Optimized Polynucleotides
(233) According to one embodiment of the invention, the polynucleotides encoding heterologous saccharolytic enzymes can be codon-optimized. As used herein the term “codon-optimized coding region” means a nucleic acid coding region that has been adapted for expression in the cells of a given organism by replacing at least one, or more than one, or a significant number, of codons with one or more codons that are more frequently used in the genes of that organism.
(234) In general, highly expressed genes in an organism are biased towards codons that are recognized by the most abundant tRNA species in that organism. One measure of this bias is the “codon adaptation index” or “CAI,” which measures the extent to which the codons used to encode each amino acid in a particular gene are those which occur most frequently in a reference set of highly expressed genes from an organism.
(235) The CAI of codon optimized sequences of the present invention corresponds to between about 0.8 and 1.0, between about 0.8 and 0.9, or about 1.0. A codon optimized sequence may be further modified for expression in a particular organism, depending on that organism's biological constraints. For example, large runs of “As” or “Ts” (e.g., runs greater than 4, 5, 6, 7, 8, 9, or 10 consecutive bases) can be removed from the sequences if these are known to effect transcription negatively. Furthermore, specific restriction enzyme sites may be removed for molecular cloning purposes. Examples of such restriction enzyme sites include PacI, AscI, BamHI, BglII, EcoRI and XhoI. Additionally, the DNA sequence can be checked for direct repeats, inverted repeats and mirror repeats with lengths of ten bases or longer, which can be modified manually by replacing codons with “second best” codons, i.e., codons that occur at the second highest frequency within the particular organism for which the sequence is being optimized.
(236) Deviations in the nucleotide sequence that comprise the codons encoding the amino acids of any polypeptide chain allow for variations in the sequence coding for the gene. Since each codon consists of three nucleotides, and the nucleotides comprising DNA are restricted to four specific bases, there are 64 possible combinations of nucleotides, 61 of which encode amino acids (the remaining three codons encode signals ending translation). The “genetic code” which shows which codons encode which amino acids is reproduced herein as Table 1. As a result, many amino acids are designated by more than one codon. For example, the amino acids alanine and proline are coded for by four triplets, serine and arginine by six, whereas tryptophan and methionine are coded by just one triplet. This degeneracy allows for DNA base composition to vary over a wide range without altering the amino acid sequence of the proteins encoded by the DNA.
(237) TABLE-US-00003 TABLE 1 The Standard Genetic Code T C A G T TTT Phe (F) TCT Ser (S) TAT Tyr (Y) TGT Cys (C) TTC Phe (F) TCC Ser (S) TAC Tyr (Y) TGC TTA Leu (L) TCA Ser (S) TAA Ter TGA Ter TTG Leu (L) TCG Ser (S) TAG Ter TGG Trp (W) C CTT Leu (L) CCT Pro (P) CAT His (H) CGT Arg (R) CTC Leu (L) CCC Pro (P) CAC His (H) CGC Arg (R) CTA Leu (L) CCA Pro (P) CAA Gln (Q) CGA Arg (R) CTG Leu (L) CCG Pro (P) CAG Gln (Q) CGG Arg (R) A ATT Ile (I) ACT Thr (T) AAT Asn (N) AGT Ser (S) ATC Ile (I) ACC Thr (T) AAC Asn (N) AGC Ser (S) ATA Ile (I) ACA Thr (T) AAA Lys (K) AGA Arg (R) ATG Met (M) ACG Thr (T) AAG Lys (K) AGG Arg (R) G GTT Val (V) GCT Ala (A) GAT Asp (D) GGT Gly (G) GTC Val (V) GCC Ala (A) GAC Asp (D) GGC Gly (G) GTA Val (V) GCA Ala (A) GAA Glu (E) GGA Gly (G) GTG Val (V) GCG Ala (A) GAG Glu (E) GGG Gly (G)
(238) Many organisms display a bias for use of particular codons to code for insertion of a particular amino acid in a growing peptide chain. Codon preference or codon bias, differences in codon usage between organisms, is afforded by degeneracy of the genetic code, and is well documented among many organisms. Codon bias often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, inter alia, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization.
(239) Given the large number of gene sequences available for a wide variety of animal, plant and microbial species, it is possible to calculate the relative frequencies of codon usage. Codon usage Tables are readily available, for example, at http://phenotype.biosci.umbc.edu/codon/sgd/index.php (visited May 7, 2008) or at http://www.kazusa.or.jp/codon/ (visited Mar. 20, 2008), and these tables can be adapted in a number of ways. See Nakamura, Y., et al., “Codon usage tabulated from the international DNA sequence databases: status for the year 2000,” Nucl. Acids Res. 28:292 (2000). Codon usage tables for yeast, calculated from GenBank Release 128.0 [15 Feb. 2002], are reproduced below as Table 2. This Table uses mRNA nomenclature, and so instead of thymine (T) which is found in DNA, the tables use uracil (U) which is found in RNA. The Table has been adapted so that frequencies are calculated for each amino acid, rather than for all 64 codons.
(240) TABLE-US-00004 TABLE 2 Codon Usage Table for Saccharomyces cerevisiae Genes Frequency per Amino Acid Codon Number hundred Phe UUU 170666 26.1 Phe UUC 120510 18.4 Total Leu UUA 170884 26.2 Leu UUG 177573 27.2 Leu CUU 80076 12.3 Leu CUC 35545 5.4 Leu CUA 87619 13.4 Leu CUG 68494 10.5 Total Ile AUU 196893 30.1 Ile AUC 112176 17.2 Ile AUA 116254 17.8 Total Met AUG 136805 20.9 Total Val GUU 144243 22.1 Val GUC 76947 11.8 Val GUA 76927 11.8 Val GUG 70337 10.8 Total Ser UCU 153557 23.5 Ser UCC 92923 14.2 Ser UCA 122028 18.7 Ser UCG 55951 8.6 Ser AGU 92466 14.2 Ser AGC 63726 9.8 Total Pro CCU 88263 13.5 Pro CCC 44309 6.8 Pro CCA 119641 18.3 Pro CCG 34597 5.3 Total Thr ACU 132522 20.3 Thr ACC 83207 12.7 Thr ACA 116084 17.8 Thr ACG 52045 8.0 Total Ala GCU 138358 21.2 Ala GCC 82357 12.6 Ala GCA 105910 16.2 Ala GCG 40358 6.2 Total Tyr UAU 122728 18.8 Tyr UAC 96596 14.8 Total His CAU 89007 13.6 His CAC 50785 7.8 Total Gln CAA 178251 27.3 Gln CAG 79121 12.1 Total Asn AAU 233124 35.7 Asn AAC 162199 24.8 Total Lys AAA 273618 41.9 Lys AAG 201361 30.8 Total Asp GAU 245641 37.6 Asp GAC 132048 20.2 Total Glu GAA 297944 45.6 Glu GAG 125717 19.2 Total Cys UGU 52903 8.1 Cys UGC 31095 4.8 Total Trp UGG 67789 10.4 Total Arg CGU 41791 6.4 Arg CGC 16993 2.6 Arg CGA 19562 3.0 Arg CGG 11351 1.7 Arg AGA 139081 21.3 Arg AGG 60289 9.2 Total Gly GGU 156109 23.9 Gly GGC 63903 9.8 Gly GGA 71216 10.9 Gly GGG 39359 6.0 Total Stop UAA 6913 1.1 Stop UAG 3312 0.5 Stop UGA 4447 0.7
(241) By utilizing this or similar Tables, one of ordinary skill in the art can apply the frequencies to any given polypeptide sequence, and produce a nucleic acid fragment of a codon-optimized coding region which encodes the polypeptide, but which uses codons optimal for a given species. Codon-optimized coding regions can be designed by various different methods.
(242) In one method, a codon usage Table is used to find the single most frequent codon used for any given amino acid, and that codon is used each time that particular amino acid appears in the polypeptide sequence. For example, referring to Table 2 above, for leucine, the most frequent codon is UUG, which is used 27.2% of the time. Thus all the leucine residues in a given amino acid sequence would be assigned the codon UUG.
(243) In another method, the actual frequencies of the codons are distributed randomly throughout the coding sequence. Thus, using this method for optimization, if a hypothetical polypeptide sequence had 100 leucine residues, referring to Table 2 for frequency of usage in the S. cerevisiae, about 5, or 5% of the leucine codons would be CUC, about 11, or 11% of the leucine codons would be CUG, about 12, or 12% of the leucine codons would be CUU, about 13, or 13% of the leucine codons would be CUA, about 26, or 26% of the leucine codons would be UUA, and about 27, or 27% of the leucine codons would be UUG.
(244) These frequencies would be distributed randomly throughout the leucine codons in the coding region encoding the hypothetical polypeptide. As will be understood by those of ordinary skill in the art, the distribution of codons in the sequence can vary significantly using this method; however, the sequence always encodes the same polypeptide.
(245) When using the methods above, the term “about” is used precisely to account for fractional percentages of codon frequencies for a given amino acid. As used herein, “about” is defined as one amino acid more or one amino acid less than the value given. The whole number value of amino acids is rounded up if the fractional frequency of usage is 0.50 or greater, and is rounded down if the fractional frequency of use is 0.49 or less. Using again the example of the frequency of usage of leucine in human genes for a hypothetical polypeptide having 62 leucine residues, the fractional frequency of codon usage would be calculated by multiplying 62 by the frequencies for the various codons. Thus, 7.28 percent of 62 equals 4.51 UUA codons, or “about 5,” i.e., 4, 5, or 6 UUA codons, 12.66 percent of 62 equals 7.85 UUG codons or “about 8,” i.e., 7, 8, or 9 UUG codons, 12.87 percent of 62 equals 7.98 CUU codons, or “about 8,” i.e., 7, 8, or 9 CUU codons, 19.56 percent of 62 equals 12.13 CUC codons or “about 12,” i.e., 11, 12, or 13 CUC codons, 7.00 percent of 62 equals 4.34 CUA codons or “about 4,” i.e., 3, 4, or 5 CUA codons, and 40.62 percent of 62 equals 25.19 CUG codons, or “about 25,” i.e., 24, 25, or 26 CUG codons.
(246) Randomly assigning codons at an optimized frequency to encode a given polypeptide sequence, can be done manually by calculating codon frequencies for each amino acid, and then assigning the codons to the polypeptide sequence randomly. Additionally, various algorithms and computer software programs are readily available to those of ordinary skill in the art. For example, the “EditSeq” function in the Lasergene Package, available from DNAstar, Inc., Madison, Wis., the backtranslation function in the VectorNTI Suite, available from InforMax, Inc., Bethesda, Md., and the “backtranslate” function in the GCG—Wisconsin Package, available from Accelrys, Inc., San Diego, Calif. In addition, various resources are publicly available to codon-optimize coding region sequences, e.g., the “backtranslation” function at http://www.entelechon.com/2008/10/backtranslation-tool/ (visited May 30, 2010). Constructing a rudimentary algorithm to assign codons based on a given frequency can also easily be accomplished with basic mathematical functions by one of ordinary skill in the art.
(247) A number of options are available for synthesizing codon optimized coding regions designed by any of the methods described above, using standard and routine molecular biological manipulations well known to those of ordinary skill in the art. In one approach, a series of complementary oligonucleotide pairs of 80-90 nucleotides each in length and spanning the length of the desired sequence is synthesized by standard methods. These oligonucleotide pairs are synthesized such that upon annealing, they form double stranded fragments of 80-90 base pairs, containing cohesive ends, e.g., each oligonucleotide in the pair is synthesized to extend 3, 4, 5, 6, 7, 8, 9, 10, or more bases beyond the region that is complementary to the other oligonucleotide in the pair. The single-stranded ends of each pair of oligonucleotides is designed to anneal with the single-stranded end of another pair of oligonucleotides. The oligonucleotide pairs are allowed to anneal, and approximately five to six of these double-stranded fragments are then allowed to anneal together via the cohesive single stranded ends, and then they ligated together and cloned into a standard bacterial cloning vector, for example, a TOPO® vector available from Invitrogen Corporation, Carlsbad, Calif. The construct is then sequenced by standard methods. Several of these constructs consisting of 5 to 6 fragments of 80 to 90 base pair fragments ligated together, i.e., fragments of about 500 base pairs, are prepared, such that the entire desired sequence is represented in a series of plasmid constructs. The inserts of these plasmids are then cut with appropriate restriction enzymes and ligated together to form the final construct. The final construct is then cloned into a standard bacterial cloning vector, and sequenced. Additional methods would be immediately apparent to the skilled artisan. In addition, gene synthesis is readily available commercially.
(248) In certain embodiments, an entire polypeptide sequence, or fragment, variant, or derivative thereof is codon optimized by any of the methods described herein. Various desired fragments, variants or derivatives are designed, and each is then codon-optimized individually. In addition, partially codon-optimized coding regions of the present invention can be designed and constructed. For example, the invention includes a nucleic acid fragment of a codon-optimized coding region encoding a polypeptide in which at least about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the codon positions have been codon-optimized for a given species. That is, they contain a codon that is preferentially used in the genes of a desired species, e.g., a yeast species such as Saccharomyces cerevisiae or Kluveromyces, in place of a codon that is normally used in the native nucleic acid sequence.
(249) In additional embodiments, a full-length polypeptide sequence is codon-optimized for a given species resulting in a codon-optimized coding region encoding the entire polypeptide, and then nucleic acid fragments of the codon-optimized coding region, which encode fragments, variants, and derivatives of the polypeptide are made from the original codon-optimized coding region. As would be well understood by those of ordinary skill in the art, if codons have been randomly assigned to the full-length coding region based on their frequency of use in a given species, nucleic acid fragments encoding fragments, variants, and derivatives would not necessarily be fully codon optimized for the given species. However, such sequences are still much closer to the codon usage of the desired species than the native codon usage. The advantage of this approach is that synthesizing codon-optimized nucleic acid fragments encoding each fragment, variant, and derivative of a given polypeptide, although routine, would be time consuming and would result in significant expense.
(250) The codon-optimized coding regions can be, for example, versions encoding an endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase, arabinofuranosidase, galactosidase, cellobiose phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin, pectinase, feruoyl esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase as disclosed herein, or domains, fragments, variants, or derivatives thereof.
(251) Codon optimization is carried out for a particular species by methods described herein, for example, in certain embodiments codon-optimized coding regions encoding polypeptides disclosed in the present application or domains, fragments, variants, or derivatives thereof are optimized according to yeast codon usage, e.g., Saccharomyces cerevisiae, Kluyveromyces lactis and/or Kluyveromyces marxianus. Also provided are polynucleotides, vectors, and other expression constructs comprising codon-optimized coding regions encoding polypeptides disclosed herein, or domains, fragments, variants, or derivatives thereof, and various methods of using such polynucleotides, vectors and other expression constructs.
(252) In certain embodiments described herein, a codon-optimized coding region encoding any of SEQ ID NOs: 219-436, or any of SEQ ID NOs: 442-446, or domain, fragment, variant, or derivative thereof, is optimized according to codon usage in yeast (e.g. Saccharomyces cerevisiae, Kluyveromyces lactis or Kluyveromyces marxianus). In some embodiments, the sequences are codon-optimized specifically for expression in Saccharomyces cerevisiae. Alternatively, a codon-optimized coding region encoding any of SEQ ID NOs: 219-436, or any of SEQ ID NOs: 442-446 may be optimized according to codon usage in any plant, animal, or microbial species.
(253) Vectors and Methods of Using Vectors in Host Cells
(254) In another aspect, the present invention relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
(255) Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the present invention. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
(256) The polynucleotides of the present invention can be employed for producing polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; and yeast plasmids. However, any other vector may be used as long as it is replicable and viable in the host.
(257) The appropriate DNA sequence can be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
(258) The DNA sequence in the expression vector is operatively associated with an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. Representative examples of such promoters are as follows:
(259) TABLE-US-00005 Gene Organism Systematic name Reason for use/benefits PGK1 S. cerevisiae YCR012W Strong constitutive promoter ENO1 S. cerevisiae YGR254W Strong constitutive promoter TDH3 S. cerevisiae YGR192C Strong constitutive promoter TDH2 S. cerevisiae YJR009C Strong constitutive promoter TDH1 S. cerevisiae YJL052W Strong constitutive promoter ENO2 S. cerevisiae YHR174W Strong constitutive promoter GPM1 S. cerevisiae YKL152C Strong constitutive promoter TPI1 S. cerevisiae YDR050C Strong constitutive promoter
(260) Additionally, promoter sequences from stress and starvation response genes are useful in the present invention. In some embodiments, promoter regions from the S. cerevisiae genes GAC1, GET3, GLC7, GSH1, GSH2, HSF1, HSP12, LCB5, LRE1, LSP1, NBP2, PDC1, PIL1, PIM1, SGT2, SLG1, WHI2, WSC2, WSC3, WSC4, YAP1, YDC1, HSP104, HSP26, ENA1, MSN2, MSN4, SIP2, SIP4, SIP5, DPL1, IRS4, KOG1, PEP4, HAP4, PRB1, TAX4, ZPR1, ATG1, ATG2, ATG10, ATG11, ATG12, ATG13, ATG14, ATG15, ATG16, ATG17, ATG18, and ATG19 may be used. Any suitable promoter to drive gene expression in the host cells of the invention may be used. Additionally the E. coli, lac or trp, and other promoters known to control expression of genes in prokaryotic or lower eukaryotic cells can be used.
(261) In addition, the expression vectors may contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as URA3, HIS3, LEU2, TRP1, LYS2 or ADE2, dihydrofolate reductase, neomycin (G418) resistance or zeocin resistance for eukaryotic cell culture, or tetracycline or ampicillin resistance in E. coli.
(262) The expression vector may also contain a ribosome binding site for translation initiation and/or a transcription terminator. The vector may also include appropriate sequences for amplifying expression, or may include additional regulatory regions.
(263) The vector containing the appropriate DNA sequence as disclosed herein, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
(264) Thus, in certain aspects, the present invention relates to host cells containing the above-described constructs. The host cell can be a host cell as described elsewhere in the application. The host cell can be, for example, a lower eukaryotic cell, such as a yeast cell, e.g., Saccharomyces cerevisiae or Kluyveromyces, or the host cell can be a prokaryotic cell, such as a bacterial cell.
(265) As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, Streptomyces, Salmonella typhimurium; thermophilic or mesophlic bacteria; fungal cells, such as yeast; and plant cells, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
(266) Appropriate fungal hosts include yeast. In certain aspects of the invention the yeast is selected from the group consisting of Saccharomyces cerevisiae, Kluyveromyces lactis, Schizzosaccharomyces pombe, Candida albicans, Pichia pastoris, Pichia stipitis, Yarrowia lipolytica, Hansenula polymorpha, Phaffia rhodozyma, Candida utilis, Arxula adeninivorans, Debaryomyces hansenii, Debaryomyces polymorphus, Schwanniomyces occidentalis, Issatchenkia orientalis, Kluyveromyces marxianus, Blakeslea, Candida, Cryptococcus, Cunninghamella, Lipomyces, Mortierella, Mucor, Phycomces, Pythium, Rhodosporidium, Rhodotorula, Trichosporon and Yarrowia.
(267) Methods of Using Host Cells to Produce Ethanol or Other Fermentation Products
(268) In another aspect, the present invention is directed to the use of host cells and co-cultures to produce ethanol or other products from a biomass feedstock comprising starch, lignocellulosic matter, hexose and pentose sugars. Such methods can be accomplished, for example, by contacting a biomass feedstock with a host cell or a co-culture of the present invention. Fermentation products include, but are not limited to products such as butanol, acetate, amino acids, and vitamins.
(269) Numerous biomass feedstocks can be used in accordance with the present invention. Substrates for saccharolytic enzyme activity assays can be divided into two categories, soluble and insoluble, based on their solubility in water. Soluble substrates include alpha-dextrins, cellodextrins or derivatives, carboxymethyl cellulose (CMC), or hydroxyethyl cellulose (HEC). Insoluble substrates include insoluble starch, crystalline cellulose, microcrystalline cellulose (Avicel), amorphous cellulose, such as phosphoric acid swollen cellulose (PASC), dyed or fluorescent cellulose, and lignocellulosic biomass. These substrates are generally highly ordered cellulosic material and thus only sparingly soluble.
(270) It will be appreciated that suitable lignocellulosic material may be any feedstock that contains soluble and/or insoluble cellulose, where the insoluble cellulose may be in a crystalline or non-crystalline form. In various embodiments, the lignocellulosic biomass comprises, for example, wood, corn, corn stover, sawdust, bark, leaves, agricultural and forestry residues, grasses such as switchgrass, ruminant digestion products, municipal wastes, paper mill effluent, newspaper, cardboard or combinations thereof.
(271) In some embodiments, the invention is directed to a method for hydrolyzing a biomass feedstock, for example a biomass feedstock as described above, by contacting the biomass feedstock with a host cell of the invention. In some embodiments, the invention is directed to a method for hydrolyzing a biomass feedstock, for example a biomass feedstock as described above, by contacting the feedstock with a co-culture comprising yeast cells expressing heterologous saccharolytic enzymes.
(272) In some embodiments of the present invention, the necessity of adding external saccharolytic enzymes to the fermentation medium is reduced because cells of the invention express polypeptides of the invention.
(273) In some embodiments, the invention is directed to a method for fermenting a biomass feedstock. Such methods can be accomplished, for example, by culturing a host cell or co-culture in a medium that contains insoluble biomass feedstock to allow saccharification and fermentation of the biomass feedstock.
(274) In addition to the enzymes of the present invention, in some embodiments, host cells of the present invention can have further genetic modifications to make them more suitable for fermenting biomass feedstock to ethanol. For example, host cells of the present invention may express xylose isomerase and/or arabinose isomerase inorder to more efficiently use pentose sugars for fermentation. In some embodiments, the xylose isomerase is from a Pyromyces species. In addition to a xylose isomerase, host cells of the invention, in some embodiments, can over-express genes related to the pentose phosphate pathway. These genes include, but are not limited to transkelolase and transaldolase genes. Components of the pentose phosphate pathway are known to those skilled in the art and are useful in aiding assimilation of carbons derived from pentose sugars into fermentation processes. (See, e.g. WO 03/062430, WO 06/009434, and US 2006/0234364). In some embodiments, a host cell is able to use xylose and other pentose sugars such as arabinose by incorporating the carbons from pentose sugars into fermentative pathways via the pentose phosphate pathway. The xylose-utilizing host cell heterologously expresses xylose isomerase, e.g. Pyromyces sp. E2 XylA, overexpresses xylulokinase, ribulose 5-phosphate isomerase, ribulose 5-phophate epimerase, transketolase and transaldolase, and does not express an aldose reductase such as the GRE3 gene (encoding an aldose reductase).
(275) The production of ethanol can, according to the present invention, be performed at temperatures of at least about 25° C., about 28° C., about 30° C., about 31° C., about 32° C., about 33° C., about 34° C., about 35° C., about 36° C., about 37° C., about 38° C., about 39° C., about 40° C., about 41° C., about 42° C., or about 50° C. In some embodiments of the present invention, the thermotolerant host cell can produce ethanol from cellulose at temperatures above about 30° C., about 31° C., about 32° C., about 33° C., about 34° C., about 35° C., about 36° C., about 37° C., about 38° C., about 39° C., about 40° C., about 41° C., about 42° C., or about 50° C. In some embodiments of the present invention, the thermotolterant host cell can produce ethanol from cellulose at temperatures from about 30° C. to 60° C., about 30° C. to 55° C., about 30° C. to 50° C., about 40° C. to 60° C., about 40° C. to 55° C. or about 40° C. to 50° C.
(276) In some embodiments, methods of producing ethanol can comprise contacting a biomass feedstock with a host cell or co-culture of the invention and additionally contacting the biomass feedstock with externally produced saccharolytic enzymes. Exemplary externally produced saccharolytic enzymes are commercially available and are known to those of skill in the art and are further exemplified below.
(277) Therefore, the invention is also directed to methods of reducing the amount of externally produced saccharolytic enzymes required to produce a given amount of ethanol from the biomass feedstock comprising contacting the saccharolytic enzyme with externally produced saccharolytic enzymes and with a host cell or co-culture of the invention. In some embodiments, the same amount of ethanol production can be achieved using at least about 5%, 10%, 15%, 20%, 25%, 30%, or 50% fewer externally produced saccharolytic enzymes.
(278) In some embodiments, the methods comprise producing ethanol at a particular rate. For example, in some embodiments, ethanol is produced at a rate of at least about 0.1 mg per hour per liter, at least about 0.25 mg per hour per liter, at least about 0.5 mg per hour per liter, at least about 0.75 mg per hour per liter, at least about 1.0 mg per hour per liter, at least about 2.0 mg per hour per liter, at least about 5.0 mg per hour per liter, at least about 10 mg per hour per liter, at least about 15 mg per hour per liter, at least about 20.0 mg per hour per liter, at least about 25 mg per hour per liter, at least about 30 mg per hour per liter, at least about 50 mg per hour per liter, at least about 100 mg per hour per liter, at least about 200 mg per hour per liter, or at least about 500 mg per hour per liter.
(279) In some embodiments, the host cells of the present invention can produce ethanol at a rate of at least about 0.1 mg per hour per liter, at least about 0.25 mg per hour per liter, at least about 0.5 mg per hour per liter, at least about 0.75 mg per hour per liter, at least about 1.0 mg per hour per liter, at least about 2.0 mg per hour per liter, at least about 5.0 mg per hour per liter, at least about 10 mg per hour per liter, at least about 15 mg per hour per liter, at least about 20.0 mg per hour per liter, at least about 25 mg per hour per liter, at least about 30 mg per hour per liter, at least about 50 mg per hour per liter, at least about 100 mg per hour per liter, at least about 200 mg per hour per liter, or at least about 500 mg per hour per liter more than a control strain (lacking heterologous biomass feedstock hydrolyzing enzymes) and grown under the same conditions. In some embodiments, the ethanol can be produced in the absence of any externally added saccharolytic enzymes.
(280) Ethanol production can be measured using any method known in the art. For example, the quantity of ethanol in fermentation samples can be assessed using HPLC analysis. Many ethanol assay kits are commercially available that use, for example, alcohol oxidase enzyme based assays. Methods of determining ethanol production are within the scope of those skilled in the art from the teachings herein.
(281) Synergistic Activity of Sacchcarolytic Enzymes
(282) In some embodiments, the expression of two or more enzymes of the present invention results in synergistic enzymatic activity with respect to substrate digestion. For example, the presence of two distinct paralogs or orthologs containing the same enzymatic activity can significantly enhance the digestion of a substrate compared to a comprarable amount of either enzyme by itself. Alternatively, synergistically acting enzymes do not need to have exactly identical chemical activity, but can still operate to liberate sugars in a capacity greater than either is capable of individually. Without wishing to be bound by a particular theory, it is thought that although the catalytic activity of the enzymes can be the same, the different characteristics of the enzymes with respect to the regions surrounding the chemical substrate as well as other differing properties of the enzymes aid in digesting the varied biomass feedstock components. In some embodiments, enzymatic synergy allows biomass feedstock digestion and fermentation to take place using reduced amounts of external saccharolytic enzymes. In some embodiments, the two or more enzymes acting synergistically are endoglucanases, glucosidases, cellobiohydrolases, xylanases, glucanases, xylosidases, xylan esterases, arabinofuranosidases, galactosidases, cellobiose phosphorylases, cellodextrin phosphorylases, mannanases, mannosidases, xyloglucanases, endoxylanases, glucuronidases, acetylxylanesterases, arabinofuranohydrolases, swollenins, glucuronyl esterases, expansins, pectinases, feruoyl esterases, alpha-amylase, beta-amylase, glucoamylase, pullulanase, isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase as disclosed herein. In some embodiments, the two or more enzymes acting synergistically do not have the same enzymatic activity. In other embodiments, the two or more enzymes acting synergistically have the same enzyme activity. In some embodiments, the enzyme pairs acting synergistically are (Streptomyces avermitilis endo-1,4-beta-glucanase celA2 (Accession No. NP_823030.1) and Streptomyces avermitilis endo-1,4-beta-glucanase celA5 (Accession No. NP_828072.1)); (Streptomyces avermitilis endo-1,4-beta-glucanase celA2 (Accession No. NP_823030.1) and Bacillus subtilis endo-1,4-beta-glucanase (Accession No CAB13696.2)); (Streptomyces avermitilis endo-1,4-beta-glucanase celA3 (Accession No. NP_823032.1) and Streptomyces avermitilis endo-1,4-beta-glucanase (Accession No. NP_826394.1)); (Streptomyces avermitilis endo-1,4-beta-glucanase celA4 (Accession No. NP_823744.1) and Streptomyces avermitilis xylanase (Accession No. NP_827548.1)); (Bacillus subtilis endo-1,4-beta-glucanase (Accession No CAB13696.2) and Streptomyces avermitilis endo-1,4-beta-glucanase (Accession No. NP_826394.1)); (Streptomyces avermitilis endo-1,4-beta-glucanase celA4 (Accession No. NP_823744.1) and Bacillus subtilis endo-1,4-beta-glucanase (Accession No CAB13696.2)); (Streptomyces avermitilis endo-1,4-beta-glucanase celA5 (Accession No. NP_828072.1) and Streptomyces avermitilis endo-1,4-beta-glucanase celA4 (Accession No. NP_823744.1)); (Streptomyces avermitilis endo-1,4-beta-glucanase celA5 (Accession No. NP_828072.1) and Clostridium phytofermentans xylanase (Accession No. YP_001557750.1)); (Saccharophagus degradans 2-40 mannanase (Accession No. YP_525985.1) and Streptomyces avermitilis endo-1,4-beta-glucanase (Accession No. NP_826394.1)); (Streptomyces avermitilis xylanase (Accession No. NP_827548.1) and Saccharophagus degradans 2-40 mannanase (Accession No. YP_525985.1)); (Clostridium phytofermentans xylanase (Accession No. YP_001557750.1) and Streptomyces avermitilis xylanase (Accession No. NP_827548.1)); (Clostridium phytofermentans xylanase (Accession No. YP_001557750.1) and Streptomyces avermitilis xylanase (Accession No. NP_827548.1)); (Streptomyces avermitilis endo-1,4-beta-glucanase celA5 (Accession No. NP_828072.1) and Streptomyces avermitilis xylanase (Accession No. NP_827548.1)); (Streptomyces avermitilis endo-1,4-beta-glucanase (Accession No. NP_823744.1) and Saccharophagus degradans 2-40 mannanase (Accession No. YP_525985.1)); (Streptomyces avermitilis endo-1,4-beta-glucanase celA2 (Accession No. NP_823030.1) and Saccharophagus degradans 2-40 mannanase (Accession No. YP_525985.1)); (Streptomyces avermitilis endo-1,4-beta-glucanase (Accession No. NP_823744.1) and Streptomyces avermitilis endo-1,4-beta-glucanase celA3 (Accession No. NP_823032.1)); (Streptomyces avermitilis endo-1,4-beta-glucanase (Accession No. NP_823744.1) and Clostridium phytofermentans xylanase (Accession No. YP_001557750.1)); (Streptomyces avermitilis xylanase (Accession No. NP_827548.1) and Streptomyces avermitilis endo-1,4-beta-glucanase celA3 (Accession No. NP_823032.1)); or (Streptomyces avermitilis endo-1,4-beta-glucanase celA4 (Accession No. NP_823744.1) and Streptomyces avermitilis endo-1,4-beta-glucanase (Accession No. NP_826394.1)); (SEQ ID NO: 443 and SEQ ID NO: 444); (SEQ ID NO: 443 and SEQ ID NO: 445); (SEQ ID NO: 445 and SEQ ID NO: 446); (SEQ ID NO: 443 and SEQ ID NO: 445); (SEQ ID NO: 442 and SEQ ID NO: 445); (SEQ ID NO: 444 and Bacillus subtilis arabinoxylanase (Accession No. CAB13699.1)); (SEQ ID NO: 444 and Bacillus subtilis arabinoxylanase (Accession No. CAB13699.1)); (SEQ ID NO: 444 and Bacillus subtilis arabinan endo-1,5-alpha-L-arabinosidase (Accession No. CAB15969.1)); (SEQ ID NO: 444 and Bacillus subtilis arabinan-endo 1,5-alpha-L-arabinase (Accession No. CAA99586.1)); (SEQ ID NO: 444 and Bacillus subtilis arabinan endo-1,5-alpha-L-arabinosidase (Accession No. AL009126)); (SEQ ID NO: 444 and Bacillus subtilis endo-arabinase (Accession No. D85132)); (SEQ ID NO: 444 and Clostridium phytofermentans arabinogalactan endo-1,4-beta-galactosidase (Accession No. CP000885)); (SEQ ID NO: 444 and Bacillus licheniformis arabinan-endo 1,5-alpha-L-arabinase (Accession No. AAU40201.1); (SEQ ID NO: 444 and Bacillus licheniformis arabinan-endo 1,5-alpha-L-arabinase (Accession No. AAU41895.1); (SEQ ID NO: 444 and Bacillus licheniformis arabinogalactan endo-1,4-beta-galactosidase (Accession No. AAU43089.1); (SEQ ID NO: 444 and Bacillus licheniformis arabinan endo-1,5-alpha-L-arabinosidase (Accession No. AAU43033.1); (SEQ ID NO: 444 and Bacillus licheniformis arabinan endo-1,4-beta-xylanase (Accession No. AAU39947.1); (SEQ ID NO: 444 and Thermoanaerobacterium saccharolyticum arabinogalactan endo-1,4-beta-galactosidase; (SEQ ID NO: 444 and Thermoanaerobacterium saccharolyticum alpha-N-arabinofuranosidase); (SEQ ID NO: 444 and Streptomyces avermitilis endo-1,4-beta-xylanase xynD (Accession No. 827557.1); (SEQ ID NO: 444 and Bacillus subtilis endo-1,4-beta-xylanase xynA (Accession No. CAB13776.1); (SEQ ID NO: 444 and Clostridium phytofermentans xylanase (Accession No. YP_001558623.1); (SEQ ID NO: 444 and Clostridium phytofermentans xylanase (Accession No. YP_001557750.1); (SEQ ID NO: 444 and Thermobifida fusca endo-1,4-beta-D-xylanase (xyl11) (Accession No. AAV64879.1); (SEQ ID NO: 444 and Clostridium thermocellum xylanase (Accession No. YP_001038519.1); (SEQ ID NO: 444 and Clostridium stercorarium endo-xylanase (Accession No. CAD48307); (SEQ ID NO: 444 and Clostridium stercorarium xynC (CelX—celloxylanase) (Accession No. CAD48314); (SEQ ID NO: 444 and Aspergillus niger alpha-glucosidase (Accession No. BAA23616.1)); (SEQ ID NO: 444 and Thermoanaerobacterium saccharolyticum glucoamylase).
(283) In other embodiments, the enzyme triplets acting synergistically include, but are not limited to (SEQ ID NO: 442, SEQ ID NO: 445 and SEQ ID NO: 446); (SEQ ID NO: 444, SEQ ID NO: 445 and SEQ ID NO: 446); or (SEQ ID NO: 442, SEQ ID NO: 445 and SEQ ID NO: 446).
(284) In yet other embodiments, the enzyme combinations acting synergistically include, but are not limited to (SEQ ID NO: 442, SEQ ID NO: 444, SEQ ID NO: 445 and SEQ ID NO: 446); (SEQ ID NO: 443, SEQ ID NO: 444, SEQ ID NO: 445 and SEQ ID NO: 446).
(285) In other embodiments, enzymatic synergy may be achieved by expressing 3, 4, 5, 6, or 7 or more enzymes with the same catalytic activity. In one embodiment, two or more enzymes acting synergistically with same enzymatic activity include, but are not limited to (SEQ ID NO: 444 and SEQ ID NO: 444); (SEQ ID NO: 445 and SEQ ID NO: 445).
(286) Glycerol Reduction
(287) Anaerobic growth conditions require the production of endogenouse electron acceptors, such as the coenzyme nicotinamide adenine dinucleotide (NAD.sup.+). In cellular redox reactions, the NAD.sup.+/NADH couple plays a vital role as a reservoir and carrier of reducing equivalents. Ansell, R., et al., EMBO J. 16:2179-87 (1997). Cellular glycerol production, which generates an NAD.sup.+, serves as a redox valve to remove excess reducing power during anaerobic fermentation in yeast. Glycerol production is, however, an energetically wasteful process that expends ATP and results in the loss of a reduced three-carbon compound. Ansell, R., et al., EMBO J. 16:2179-87 (1997). To generate glycerol from a starting glucose molecule, glycerol 3-phosphate dehydrogenase (GPD) reduces dihydroxyacetone phosphate to glycerol 3-phosphate and glycerol 3-phosphatase (GPP) dephosphorylates glycerol 3-phosphate to glycerol. Despite being energetically wasteful, glycerol production is a necessary metabolic process for anaerobic growth as deleting GPD activity completely inhibits growth under anaeroblic conditions. See Ansell, R., et al., EMBO J. 16:2179-87 (1997).
(288) GPD is encoded by two isogenes, gpd1 and gpd2. GPD1 encodes the major isoform in anaerobically growing cells, while GPD2 is required for glycerol production in the absence of oxygen, which stimulates its expression. Pahlman, A-K., et al., J. Biol. Chem. 276:3555-63 (2001). The first step in the conversion of dihydroxyacetone phosphate to glycerol by GPD is rate controlling. Guo, Z. P., et al., Metab. Eng. 13:49-59 (2011). GPP is also encoded by two isogenes, gpp1 and gpp2. The deletion of GPP genes arrests growth when shifted to anaerobic conditions, demonstrating that GPP is important for cellular tolerance to osmotic and anaerobic stress. See Pahlman, A-K., et al., J. Biol. Chem. 276:3555-63 (2001).
(289) Because glycerol is a major by-product of anaerobic production of ethanol, many efforts have been made to delete cellular production of glycerol. However, because of the reducing equivalents produced by glycerol synthesis, deletion of the glycerol synthesis pathway cannot be done without compensating for this valuable metabolic function. Attempts to delete glycerol production and engineer alternate electron acceptors have been made. Lidén, G., et al., Appl. Env. Microbiol. 62:3894-96 (1996); Medina, V. G., et al., Appl. Env. Microbiol. 76:190-195 (2010). Lidén and Medina both deleted the gpd1 and gpd2 genes and attempted to bypass glycerol formation using additional carbon sources. Lidén engineered a xylose reductase from Pichia stipitis into an S. cerevisiae gpd1/2 deletion strain. The xylose reductase activity facilitated the anaerobic growth of the glycerol-deleted strain in the presence of xylose. See Lidén, G., et al., Appl. Env. Microbiol. 62:3894-96 (1996). Medina engineered an acetylaldehyde dehydrogenase, mhpF, from E. coli into an S. cerevisiae gpd1/2 deletion strain to convert acetyl-CoA to acetaldehyde. The acetylaldehyde dehydrogenase activity facilitated the anaerobic growth of the glycerol-deletion strain in the presence of acetic acid but not in the presence of glucose as the sole source of carbon. Medina, V. G., et al., Appl. Env. Microbiol. 76:190-195 (2010); see also EP 2277989. Medina noted several issues with the mhpF-containing strain that needed to be addressed before implementing industrially, including significantly reduced growth and product formation rates than yeast comprising GPD1 and GPD2.
(290) Additional attempts to redirect flux from glycerol to ethanol have included the engineering of a non-phosphorylating NADP+-dependent glyceraldehydes-3-phosphate dehydrogenase (GAPN) into yeast, either with or without the simultaneous knockout of GPD1. Bro, C., et al., Metab. Eng. 8:102-111 (2006); U.S. Patent Appl. Pub. No. US2006/0257983; Guo, Z. P., et al., Metab. Eng. 13:49-59 (2011). However, other cellular mechanisms exist to control the production and accumulation of glycerol, including glycerol exporters such as FPS1, that do not require the engineering of alternate NADP+/NADPH coupling or deletion of glycerol synthesis genes. Tamás, M. J., et al., Mol. Microbiol. 31:1087-1004 (1999).
(291) FPS1 is a channel protein located in the plasma membrane that controls the accumulation and release of glycerol in yeast osmoregulation. Null mutants of this strain accumulate large amounts of intracellular glycerol, grow much slower than wild-type, and consume the sugar substrate at a slower rate. Tamás, M. J., et al., Mol. Microbiol. 31:1087-1004 (1999). Despite slower growth under anaerobic conditions, an fps1Δ strain can serve as an alternative to eliminating NAD.sup.+-dependant glycerol activity. An fps1Δ strain has reduced glycerol formation yet has a completely functional NAD.sup.+-dependant glycerol synthesis pathway. Alternatively, rather than deleting endogenous FPS1, constitutively active mutants of FPS1 or homologs from other organisms can be used to regulate glycerol synthesis while keep the NAD.sup.+-dependant glycerol activity intact. In embodiments of the invention that modulate FPS1, the recombinant host cells can still synthesize and retain glycerol and achieve improved robustness relative to strains that are unable to make glycerol.
(292) In one embodiment, one or more endogenous glycerol-producing or regulating genes are deleted to create yeast strains with altered glycerol production. In another embodiment, one or more endogenous glycerol-producing genes are downregulated to create yeast strains with altered glycerol production. In still another embodiment, one or more endogenous glycerol-regulating genes are downregulated to create yeast strains with altered glycerol production. In yet another embodiment, one or more endogenous glycerol-regulating genes are downregulated to create yeast strains with altered glycerol production. In one embodiment, glycerol production in such yeast strains is downregulated in comparison with wild type yeast cell.
(293) Pyruvate Formate Lyase (PFL)
(294) The conversion of the pyruvate to acetyl-CoA and formate is performed by pyruvate formate lyase (PFL). In E. coli, PFL is the primary enzyme responsible for the production of formate. PFL is a dimer of PflB that requires the activating enzyme PflAE, which is encoded by pflA, radical S-adenosylmethionine, and a single electron donor. See Waks, Z., and Silver, P. A., Appl. Env. Microbiol. 75:1867-1875 (2009). Waks and Silver engineered strains of S. cerevisiae to secrete formate by the addition of PFL and AdhE from E. coli and deletion of endogenous formate dehydrogenases and to produce hydrogen in a two-step process using E. coli. Waks and Silver, however, did not combine formate production with the removal of glycerol formation, and the use of formate as an alternate electron acceptor for the reduction of glycerol was not proposed or evaluated.
(295) PFL enzymes for use in the recombinant host cells of the invention can come from a bacterial or eukaryotic source. Examples of bacterial PFL include, but are not limited to, Bacillus licheniformis DSM13, Bacillus licheniformis ATCC14580, Streptococcus thermophilus CNRZ1066, Streptococcus thermophilus LMG18311, Streptococcus thermophilus LMD-9, Lactobacillus plantarum WCFS1 (Gene Accession No. lp_2598), Lactobacillus plantarum WCFS1 (Gene Accession No. lp_3313), Lactobacillus plantarum JDM1 (Gene Accession No. JDM1_2695), Lactobacillus plantarum JDM1 (Gene Accession No. JDM1_2087), Lactobacillus casei b123, Lactobacillus casei ATCC 334, Bifidobacterium adolescentis, Bifidobacterium longum NCC2705, Bifidobacterium longum DJO10A, Bifidobacterium animalis DSM 10140, Clostridium cellulolyticum, or Escherichia coli. Additional PFL enzymes may be from the PFL1 family, the RNR pfl superfamily, or the PFL2 superfamily.
(296) Examples of eukaryotic PFL include, but are not limited to, Chlamydomonas reinhardtii PflA1, Piromyces sp. E2, or Neocallimastix frontalis, Acetabularia acetabulum, Haematococcus pluvialis, Volvox carteri, Ostreococcus tauri, Ostreococcus lucimarinus, Micromonas pusilla, Micromonas sp., Porphyra haitanensis, and Cyanophora paradoxa), an opisthokont (Amoebidium parasiticum), an amoebozoan (Mastigamoeba balamuthi), a stramenopile (Thalassiosira pseudonana (2)) and a haptophyte (Prymnesium parvum), M. pusilla, Micromonas sp. O. tauri and O. lucimarinus) an amoebozoan (M. balamuthi), and a stramenopile (T. pseudonana). See Stairs, C. W., et al., “Eukaryotic pyruvate formate lyase and its activating enzyme were acquired laterally from a firmicute,” Mol. Biol. and Evol., published on-line on Feb. 3, 2011, at http://mbe.oxfordjournals.org/.
(297) Acetaldehyde/Alcohol Dehydrogenases
(298) Engineering of acetaldehyde dehydrogenases, alcohol dehydrogenases, and/or bifunctional acetylaldehyde/alcohol dehydrogenases into a cell can increase the production of ethanol. However, because the production of ethanol is redox neutral, an acetaldehyde/alcohol dehydrogenase activity cannot serve as an alternative for the redox balancing that the production of glycerol provides to a cell in anaerobic metabolism. When Medina attempted to express an acetylaldehyde dehydrogenase, mhpF, from E. coli in an S. cerevisiae gpd1/2 deletion strain, the strain did not grow under anaerobic conditions in the presence of glucose as the sole source of carbon. Medina, V. G., et al., Appl. Env. Microbiol. 76:190-195 (2010); see also EP 2277989. Rather, the anaerobic growth of the glycerol-deletion strain required the presence of acetic acid. However, an acetylaldehyde dehydrogenase has not been expressed in combination with PFL or with the recombinant host cells of the invention. Additionally, replacing the endogenous acetylaldehyde dehydrogenase activity with either an improved acetaldehyde dehydrogenase or using a bifunctional acetaldehyde/alcohol dehydrogenase (AADH) can positively affect the in vivo kinetics of the reaction providing for improved growth of the host strain.
(299) Improving Conversion of Acetyl-CoA to Ethanol
(300) To improve the conversion of acetyl-CoA to ethanol, endogenous yeast genes can be replaced or complimented with either an improved acetaldehyde dehydrogenase (e.g., from C. phytofermentans or other source) to convert acetyl-CoA to acetaldehyde, or a bifunctional acetaldehyde/alcohol dehydrogenase (AADH) to convert acetyl-CoA to acetaldehyde and acetaldehyde to ethanol. By engineering in one or more such enzymes, the in vivo kinetics of the conversion of acetyl-CoA to ethanol can be increased, providing for improved growth of the host strain. The bi-functional alcohol/aldehyde dehydrogenase can come from a variety of microbial sources, including but not limited to E. coli, C. acetobutylicum, T. saccharolyticum, C. thermocellum, C. phytofermentans, Piromyces SP E2, or Bifidobacterium adolescentis.
(301) When glycerol deletion strains are grown anaerobically, they are not capable of growth or fermentation and cannot consume sugar during glycolysis. However, if these glycerol deletion strains are complemented with an AADH, the strains are able to grow with the supplementation of acetate in the media.
(302) AADH enzymes for use in the recombinant host cells of the invention can come from a bacterial or eukaryotic source. Examples of bacterial AADH include, but are not limited to, Clostridium phytofermentans, Escherichia coli, Bacillus coagulans, Bacillus lentus, Bacillus licheniformis, Bacillus pumilus, Bacillus subtilis, Bacteroides amylophilus, Bacteroides capillosus, Bacteroides ruminocola, Bacteroides suis, Bifidobacterium adolescentis, Bifidobacterium animalis, Bifidobacterium bifzdum, Bifidobacterium infantis, Bifidobacterium longum, Bifidobacterium thermophilum, Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus buchneri (cattle only), Lactobacillus bulgaricus, Lactobacillus casei, Lactobacillus cellobiosus, Lactobacillus curvatus, Lactobacillus delbruekii, Lactobacillus farciminis (swine only), Lactobacillus fermentum, Lactobacillus helveticus, Lactobacillus lactis, Lactobacillus plantarum, Lactobacillus reuterii, Leuconostoc mesenteroides, Pediococcus acidilacticii, Pediococcus pentosaceus, Propionibacterium acidpropionici (cattle only), Propionibacterium freudenreichii, Propionibacterium shermanii, Enterococcus cremoris, Enterococcus diacetylactis, Enterococcus faecium, Enterococcus intermedius, Enterococcus lactis, or Enterococcus thermophiles.
(303) Xylose Metabolism
(304) Xylose is a five-carbon monosaccharide that can be metabolized into useful products by a variety of organisms. There are two main pathways of xylose metabolism, each unique in the characteristic enzymes they utilize. One pathway is called the “Xylose Reductase-Xylitol Dehydrogenase” or XR-XDH pathway. Xylose reductase (XR) and xylitol dehydrogenase (XDH) are the two main enzymes used in this method of xylose degradation. XR, encoded by the XYL1 gene, is responsible for the reduction of xylose to xylitol and is aided by cofactors NADH or NADPH. Xylitol is then oxidized to xylulose by XDH, which is expressed through the XYL2 gene, and accomplished exclusively with the cofactor NAD*. Because of the varying cofactors needed in this pathway and the degree to which they are available for usage, an imbalance can result in an overproduction of xylitol byproduct and an inefficient production of desirable ethanol. Varying expression of the XR and XDH enzyme levels have been tested in the laboratory in the attempt to optimize the efficiency of the xylose metabolism pathway.
(305) The other pathway for xylose metabolism is called the “Xylose Isomerase” (XI) pathway. Enzyme XI is responsible for direct conversion of xylose into xylulose, and does not proceed via a xylitol intermediate. Both pathways create xylulose, although the enzymes utilized are different. After production of xylulose both the XR-XDH and XI pathways proceed through the enzyme xylulokinase (XK), encoded on gene XKS1, to further modify xylulose into xylulose-5-phosphate where it then enters the pentose phosphate pathway for further catabolism.
(306) Studies on flux through the pentose phosphate pathway during xylose metabolism have revealed that limiting the speed of this step may be beneficial to the efficiency of fermentation to ethanol. Modifications to this flux that may improve ethanol production include a) lowering phosphoglucose isomerase activity, b) deleting the GND1 gene, and c) deleting the ZWF1 gene (Jeppsson et al., Appl. Environ. Microbiol. 68:1604-09 (2002)). Since the pentose phosphate pathway produces additional NADPH during metabolism, limiting this step will help to correct the already evident imbalance between NAD(P)H and NAD.sup.+ cofactors and reduce xylitol byproduct. Another experiment comparing the two xylose metabolizing pathways revealed that the XI pathway was best able to metabolize xylose to produce the greatest ethanol yield, while the XR-XDH pathway reached a much faster rate of ethanol production (Karhumaa et al., Microb Cell Fact. 2007 Feb. 5; 6:5). See also International Publication No. WO2006/009434, incorporated herein by reference in its entirety.
(307) In some embodiments, the recombinant microorganisms of the invention have the ability to metabolize xylose using one or more of the above enzymes.
(308) Arabinose Metabolism
(309) Arabinose is a five-carbon monosaccharide that can be metabolized into useful products by a variety of organisms. L-Arabinose residues are found widely distributed among many heteropolysaccharides of different plant tissues, such as arabinans, arabinogalactans, xylans and arabinoxylans. Bacillus species in the soil participate in the early stages of plant material decomposition, and B. subtilis secretes three enzymes, an endo-arabanase and two arabinosidases, capable of releasing arabinosyl oligomers and L-arabinose from plant cell.
(310) Three pathways for L-arabinose metabolism in microorganisms have been described. Many bacteria, including Escherichia coli, use arabinose isomerase (AraA; E.C. 5.3.1.4), ribulokinase (AraB; E.C. 2.7.1.16), and ribulose phosphate epimerase (AraD; E.C. 5.1.3.4) to sequentially convert L-arabinose to D-xylulose-5-phosphate through L-ribulose and L-ribulose 5-phosphate. See, e.g., Sa-Nogueira I, et al., Microbiology 143:957-69 (1997). The D-xylulose-5-phosphate then enters the pentose phosphate pathway for further catabolism. In the second pathway, L-arabinose is converted to L-2-keto-3-deoxyarabonate (L-KDA) by the consecutive action of enzymes arabinose dehydrogenase (ADH), arabinolactone (AL), and arabinonate dehydratase (AraC). See, e.g., Watanabe, S, et al., J. Biol. Chem. 281: 2612-2623 (2006). L-KDA can be further metabolized in two alternative pathways: 1) L-KDA conversion to 2-ketoglutarate via 2-ketoglutaric semialdehyde (KGSA) by L-KDA dehydratase and KGSA dehydrogenase or 2) L-KDA conversion to pyruvate and glycolaldehyde by L-KDA aldolase. In the third, fungal pathway, L-arabinose is converted to D-xylulose-5-phosphate through L-arabinitol, L-xylulose, and xylitol, by enzymes such as NAD(P)H-dependent aldose reductase (AR), L-arabinitol 4-dehydrogenase (ALDH), L-xylulose reductase (LXR), xylitol dehydrogenase (XylD), and xylulokinase (XylB). These, and additional proteins involved in arabinose metabolism and regulation may be found at http://www.nmpdr.org/FIG/wiki/rest.cgi/NmpdrPlugin/SeedViewer?page=Subsystems;subsystem=L-Arabinose_utilization, visited Mar. 21, 2011, which is incorporated by reference herein in its entirety.
(311) AraC protein regulates expression of its own synthesis and the other genes of the Ara system. See Schleif, R., Trends Genet. 16(12):559-65 (2000). In the E. coli, the AraC protein positively and negatively regulates expression of the proteins required for the uptake and catabolism of the sugar L-arabinose. Homologs of AraC, such as regulatory proteins RhaR and RhaS of the rhamnose operon, have been identified that contain regions homologous to the DNA-binding domain of AraC (Leal, T. F. and de Sa-Nogueira, I., FEMS Microbiol Lett. 241(1):41-48 (2004)). Such arabinose regulatory proteins are referred to as the AraC/XylS family. See also, Mota, L. J., et al., Mol. Microbiol. 33(3):476-89 (1999); Mota, L. J., et al., J Bacteriol. 183(14):4190-201 (2001).
(312) In E. coli, the transport of L-arabinose across the E. coli cytoplasmic membrane requires the expression of either the high-affinity transport operon, araFGH, a binding protein-dependent system on the low-affinity transport operon, araE, a proton symporter. Additional arabinose transporters include those identified from K. marxianus and P. guilliermondii, disclosed in U.S. Pat. No. 7,846,712, which is incorporated by reference herein.
(313) In some embodiments, the recombinant microorganisms of the invention have the ability to metabolize arabinose using one or more of the above enzymes.
(314) The following embodiments of the invention will now be described in more detail by way of these non-limiting Examples.
EXAMPLES
Example 1: Expression of Fungal Lignocellulase System Components in Yeast
(315) In order to generate strains expressing these various enzymes, and in anticipation of co-expressing them, several promoter and terminator pairs were created to use as expression vectors. The promoter terminator pairs, and the enzyme types that were tested under their control are listed in Table 3. Genes encoding various enzyme activities were cloned into vector pMU1531 by standard molecular biology procedures (See e.g. Maniatis, “Molecular Cloning” Cold Spring Harbor Press).
(316) TABLE-US-00006 TABLE 3 Promoters and terminators used for expression of fungal and bacterial genes. # Promoter Terminator Genes expressed 1 ENO1 ENO1 EG1, EG2, EG3, xylanase (GH11 and GH10), xylosidase (GH43, GH3), complete bacterial library 2 ENO1 PYK1 EG1 3 ADH1 PDC1 fungal GH10 xylanase, Cp Xyl10 (bacterial) 4 ADH2 CYC1 Beta-mannase, GH11 xylanase 5 ENO2 TDH3 EG6 6 FBA1 PGI1 EG4 7 GPM1 TPI1 EG5 8 HXT7 PMA1 GH3 xylosidase, CIP1 9 PDC1 ENO2 TfCel9A, GH74 xyloglucanase 10 PGI1 HXT7 GH10 xylanase 11 PMA1 ADH1 EG2, 12 TDH3 GPM1 GH43 xylosidase 13 TPI1 FBA1 EG3 14 HXT2 ACT1 GH27 (AGLI) 15 PFK1 HXT2 CE1 (AXE) 16 HXT3 PFK1 GH62 (AXH) 17 PFK2 HXT3 CE1 (FAEA) 18 PYK1 PFK2 CE1 (FAEB) 19 TEF1 ADH2 SWO 20 ADH3 TEF1 GH2 (beta-mannosidase) 21 TEF2 ADH3 GH67 (alpha-glucuronidase) 22 GND1 TEF2 CIP2 23 ACT1 GND1 GH54 (ABF1) 24 TAL1 SOL1 alpha-expansin 25 TKL1 ADH5 beta-expansin
(317) TABLE-US-00007 TABLE 4 Fungal enzyme system components expressed in yeast. Cazy family/ enzyme type/ synonym Activity Organism Accession # Strain # Plasmid # GH7B (EG1) Endoglucanase Aspergillus XP_747897 M1311 pMU1626 fumigatus GH7B (EG1) Endoglucanase Neosartorya XP_001257357 M1312 pMU1627 fischeri GH7B (EG1) Endoglucanase Aspergillus XP_001270378 M1313 pMU1628 clavatus GH7B (EG1) Endoglucanase Aspergillus XP_001217291 M1270 pMU1561 terreus GH7B (EG1) Endoglucanase Trichoderma ACZ34302 M1317 pMU1632 longibrachiatum GH7B (EG1) Endoglucanase Penicillium XP_002152969 M1318 pMU1633 marneffei GH7B (EG1) Endoglucanase Chaetomium XP_001229968 M1310 pMU1625 globosum GH7B (EG1) Endoglucanase Neurospora XP_956431 M1271 pMU1562 crassa GH7B (EG1) Endoglucanase Aspergillus oryzae BAA22589 M1314 pMU1629 GH7B (EG1) Endoglucanase Thielavia AAE25067 M1315 pMU1630 heterothallica GH7B (EG1) Endoglucanase Fusarium AAG09047 M1272 pMU1563 oxysporum GH7B (EG1) Endoglucanase Humicola insolens 1DYM_A M1316 pMU1631 GH7B (EG1) Endoglucanase Pyrenophora XP_001935476 M1319 pMU1634 tritici-repentis GH7B (EG1) Endoglucanase Magnaporthe XP_370166 M1273 pMU1564 grisea GH7B (EG1) Endoglucanase Fusarium XP_388429 M1274 pMU1565 graminearum GH7B (EG1) Endoglucanase Hypocrea P07981 M1276 pMU1574 jecorina GH5 (EG2) Endoglucanase Hypocrea P07982 M1138 pMU1400 jecorina GH5 (EG2) Endoglucanase Chrysosporium RDH160 pRDH160 lucknowense GH5 (EG2) Endoglucanase Polyporus BAF75943.1 RDH163 pRDH163 arcularius GH5 (EG2) Endoglucanase Aspergillus BAB62317.1 RDH145 pRDH145 kawachii GH5 (EG2) Endoglucanase Heterodera CAC12958.1 RDH146 pRDH146 schachtii GH5 (EG2) Endoglucanase Orpinomyces sp. AAD04193.1 RDH148 pRDH148 GH5 (EG2) Endoglucanase Irpex lacteus BAD67544.1 RDH149 pRDH149 GH5 (EG2) Endoglucanase Chaetomium XP_001220409.1 RDH159 pRDH159 globosum GH5 (EG2) Endoglucanase Aspergillus niger XP_001397982.1 RDH161 pRDH161 GH5 (EG2) Endoglucanase Penicillium ABY28340.1 RDH162 pRDH162 decumbens GH12A Endoglucanase Trichoderma BAA20140 RDH164 pRDH164 (EG3) reesei GH12A Endoglucanase Phanerochaete AAU12276 RDH167 pRDH167 (EG3) chrysosporium GH12A Endoglucanase Stachybotrys AAM77710 RDH165 pRDH165 (EG3) echinata GH12A Endoglucanase Neosartorya XP_001261563 RDH166 pRDH166 (EG3) fischeri GH12A Endoglucanase Chaetomium AAM77701 RDH168 pRDH168 (EG3) brasiliense GH61A Endoglucanase Chaetomium EAQ86340 M1391 pMU1746 (EG4) globosum GH61A Endoglucanase Aspergillus CAF31975 M1392 pMU1747 (EG4) fumigatus GH61A Endoglucanase Humicola insolens CAG27577 M1393 pMU1748 (EG4) GH61A Endoglucanase Neosartorya XP_001267517 M1394 pMU1749 (EG4) fischeri GH61A Endoglucanase Thielavia ACE10231 M1418 pMU1779 (EG4) terrestris GH45A Endoglucanase Chrysosporium ACH15008 M1395 pMU1750 (EG5) lucknowense GH45A Endoglucanase Chaetomium XP_001226436 M1420 pMU1753 (EG5) globosum GH45A Endoglucanase Acremonium ACE10216 M1421 YML only (EG5) thermophilum GH45A Endoglucanase Humicola insolens CAB42307 M1396 pMU1751 (EG5) GH45A Endoglucanase Thielavia CAH03187 M1418 pMU1779 (EG5) terrestris GH6 (EG6) Endoglucanase Chrysosporium AAQ38151 M1422 YML only lucknowense GH6 (EG6) Endoglucanase Magnaporthe EDJ97375 M1397 pMU1752 grisea GH6 (EG6) Endoglucanase Chaetomium EAQ84577 M1398 pMU1753 globosum GH6 (EG6) Endoglucanase Humicola insolens 1DYS_B M1399 pMU1754 GH6 (EG6) Endoglucanase Neurospera XP_957415 M1400 pMU1755 crassa GH74A Xyloglucanase Trichoderma AAP57752 M1423 YML only (EGL6) reesei GH74A Xyloglucanase Aspergillus niger AAK77227 M1424 YML only (EGL6) GH74A Xyloglucanase Aspergillus BAA29031 M1425 YML only (EGL6) aculeatus GH74A Xyloglucanase Neosartorya XP_001261776 M1426 YML only (EGL6) fischeri GH11 Endoxylanase Chaetomium CAD48749 RDH170 pRDH170 thermophilum GH11 Endoxylanase Trichoderma ABK59833 RDH169 pRDH169 reesei (synthetic version) GH11 Endoxylanase Trichoderma ABK59833 RDH182 pRDH182 reesei (native version) GH10 Endoxylanase Chrysosporium AAQ38147 RDH183 pRDH183 lucknowense GH10 Endoxylanase Aureobasidium BAE71410 RDH171 pRDH171 pullulans GH3 beta-xylosidase Aspergillus niger XP_001389416 RDH181 pRDH181 GH3 beta-xylosidase Aspergillus CAA73902 RDH179 pRDH179 nidulans GH43 beta-xylosidase Cochliobolus AAC67554 RDH175 pRDH175 (BXL1) carbonum GH43 beta-xylosidase Penicillium BAC75546 RDH176 pRDH176 (BXL1) herquei GH43 beta-xylosidase Pyrenophora XP_001940956 RDH177 pRDH177 (BXL1) tritici-repentis MAN1 beta-mannase Aspergillus AAA67426 pMU1903 (endo-enzyme) aculeatus GH2 beta- Aspergillus niger Q9UUZ3 M1491 pMU1912 mannosidase (exo-enzyme) GH2 beta- Aspergillus BAA29029 M1492 pMU1913 mannosidase aculeatus (exo-enzyme) GH2 beta- Neosartorya XP_001258000 M1493 pMU1914 mannosidase fischeri (exo-enzyme) GH67 alpha- Trichoderma CAA92949 M1494 pMU1915 glucuronidase reesei GH67 alpha- Aspergillus niger CAC38119 M1547 YML only glucuronidase GH67 alpha- Talaromyces AAL33576 M1549 YML only glucuronidase emersonii CE1 (AXE) acetylxylanesterase Aspergillus niger XP_001395572 M1513 pMU1933 CE1 (AXE) acetylxylanesterase Trichoderma Q99034 M1512 pMU1932 reesei CE1 (AXE) acetylxylanesterase Neosartorya XP_001262186 M1514 pMU1934 fischeri GH27 (AGLI) alpha- Trichoderma CAA93244 M1550 YML only galactosidase reesei (AGLI) GH54 arabinofuranosidase Aspergillus niger AAA93264 M1511 pMU1930 (ABF1) GH62 (ABF2, arabinofuranosidase, Trichoderma AAP57750 M1483 pMU1904 AXHA) 1,4-beta- reesei D-arabinoxylan arabinofuranohydrolase GH62 (ABF2, arabinofuranosidase, Chaetomium XP_001223478 M1479 pMU1885 AXHA) 1,4-beta- globosum D-arabinoxylan arabinofuranohydrolase GH62 (ABF2, arabinofuranosidase, Aspergillus niger XP_001389998 M1481 pMU1890 AXHA) 1,4-beta- D-arabinoxylan arabinofuranohydrolase SWO Swollenin Penicillium ACH57439 M1471 pMU1876 (expansin) decumbens SWO Swollenin Neosartorya XP_001257521 M1472 pMU1877 (expansin) fischeri SWO Swollenin Talaromyces EED19018 M1473 pMU1878 (expansin) stipitatus SWO Swollenin Trichoderma CAB92328 M1515 pMU1931 (expansin) reesei CIP1 Unknown Trichoderma AAP57751 M1484 pMU1905 reesei CIP1 Unknown Chaetomium XP_001228455 M1485 pMU1906 globosum CIP1 Unknown Magnaporthe XP_365869 M1486 pMU1907 grisea CIP2 glucuronyl Trichoderma AAP57749 M1482 pMU1891 esterase reesei CIP2 glucuronyl Chaetomium XP_001226041 M1474 pMU1879 esterase globosum CIP2 glucuronyl Aspergillus XP_751313 M1480 pMU1886 esterase fumigatus alpha- alpha-expansin Populus alba BAB39482 M1488 pMU1909 expansin alpha- alpha-expansin Vitis lubrusca BAC66697 M1487 pMU1908 expansin beta-expansin beta-expansin Triticum aestivum AAS48881 M1490 pMU1911 beta-expansin beta-expansin Eucalyptus AAZ08315 M1489 pMU1910 globulus CE1 (FAEA) Feruoyl esterase Aspergillus niger XP_001393337 M1475 pMU1880 (FAEA) CE1 (FAEA) Feruoyl esterase Aspergillus XP_001211092 Please pMU1884 (FAEA) terreus provide CE1 (FAEB) Feruoyl esterase Talaromyces EED17739 M1476 pMU1881 (FAEB) stipitatus CE1 (FAEB) Feruoyl esterase Chaetomium XP_001228412 M1477 pMU1882 (FAEB) globosum
Example 2: Characterizing the Expression and Activity of Auxillary Cellulases
(318) Following strain construction, strains expressing the fungal EG1 candidates were grown in 50 mL shake flask cultures with 100 ug/mL zeocin and tested for activity on CMC and avicel.
(319) The PHW assay was carried out with a pretreated wood substrate (MS149), both in the presence and absence of yeast made, purified CBH1 and CBH2 (2 mg/g of each), and Novozyme 188 BGL. 2 mL of supernatant was used from each EG1 expressing strain in the assay. A strain expressing TrEG2 from the same plasmid was again used as a control. The results from these assays can be found in
(320) Given the strong performance of M1311 in CMC, avicel and PHW assays, and the fact that it has a native CBD, the Aspergillus fumigatus enzyme was chosen as the best EG1 candidate.
(321) In order to investigate other EG2-type endoglucanases and to investigate EG3-type endoglucanases for enhancement of current cellulase expression configurations. The choice of additional cel5 sequences was based on sequences with relatively good homology to the T. reesei eg2 or Aspergillus kawachii egA, the most successfully expressed cel5 genes from the first round of testing. The choice of cel12 sequences to be tested was based on sequences with relatively good homology to the T. reesei eg3 although sequences with homology greater than 95% were disregarded. Table 4 indicates the genes chosen for synthesis as well as the designation of the expression vector. All the genes were cloned under control of the ENO1 promoter/terminator using the pMU1531 expression plasmid.
(322) The plasmids were all transformed to S. cerevisiae M0509 (an industrially hearty strain expressing xylose isomerase) using YPD containing 250 μg/ml zeocin as selective medium and transformants were confirmed with PCR. Along with the reference strain (containing pMU1531) and a strain expressing the T. reesei eg2 (pRDH180), the eg2 eg3 expressing strains were tested for activity on avicel and CMC. The strains were grown in YPD or double strength SC medium (3.4 g/L YNB; 3 g/L amino acid pool; 10 g/L ammonium sulfate; 20 g/L glucose) that was buffered to pH 6 (20 g/L succinic acid; 12 g/L NaOH, set pH to 6 with NaOH). Glucose was added after autoclaving of the other components from a 50% glucose stock solution. Zeocin was added to a final concentration of 100 μg/ml for liquid cultures. 10 mL cultures in 125 mL erlenmeyer flasks were grown at 30° C. for three days (YPD) or four days (SC).
(323) Three flasks were inoculated for each strain. After incubation, samples were taken for gel analysis, protein determination and activity measurement. After centrifugation of the samples, 12 μl of each was taken, added to 5 μl of protein loading buffer and boiled for 5 minutes. The samples were subsequently loaded on a 10% SDS-PAGE and separated, followed by silver staining (
(324) From the gel it appeared that not all strains produced a visible band in the expected size range (see Table 5 for predicted sizes). The Tr.EG2 appeared as a band of about 55 kDa. As it was predicted to be approximately 44 kDa, the extra weight may represent hyperglycosylation. The EG2s of C. lucknowense, A. niger, and P. decumbens were also visible in the same approximate size range with the P. decumbens product being slightly smaller at ˜50 kDa. From the gel it appeared that far more C. lucknowense EG2 protein was produced compared to the other EG2s. From
(325) To screen for EG activity, 5 μl of the cultures used for quantitative assays were spotted on SC.sup.−URA plates containing 0.2% of either CMC or barley-β-glucan (
(326) All strains were tested for activity using the high-throughput avicel conversion method as prescribed. Activity on CMC was determined with a similar assay while omitting the Novozyme 188 and starting with 1% CMC. The DNS used for the assay procedure contained phenol. Activity data from strains grown on YPD and SC can be seen in
(327) From the activity data it would appear that the strain expressing T. reesei eg2 (pRDH180) produced the highest levels of secreted activity. The EG2 from C. lucknowense displayed the next best activity on both substrates. The T. reesei EG3 and N. fischeri EG3 appear to be the superior enzymes for yeast expression from this group (cel12, will subsequently be tested on PHW).
(328) Strain M0509 was also transformed with 2 um plasmids containing EG4s, EG5s, EG6s, and xyloglucanases (GH74/XG). These strains were then spotted on YNB plates with CMC, grown overnight at 30 degrees and stained with Congo red to check for activity of the cloned gene (Data for some of the strains shown in
(329) The candidates were also tested for activity in the PHW assay in the presence of other enzymes. Purified, yeast made CBH1, CBH2, EG2, and BGL were used as partners for the assay loaded at a 4 mg enzyme protein per gram of solids, and a 40%:40%:15%:5% (by mass) mixture (
(330) The data in
(331) The XG candidates, and several EG4, 5, and 6 candidate genes along with the best candidates from the previous round of assays for EG4, 5, and 6 were used in a PHW assay (
Example 3: Cloning and Expression of 5 Synthetic Xylanases and 5 Synthetic Xylosidases in S. cerevisiae
(332) Xylanases and xylosidases were examined for expression in yeast in order to broaden the enzymatic activity spectrum of the yeast made lignocellulolytic system. Xylanases were selected from the public databases and their functional expression in yeast was tested on substituted xylans. Xylosidases were selected based on homology to A. niger xlnD (a GH family 3 enzyme) and to include xylosidases from GH family 43. Table 5 (condensed version of Table 4) indicates the genes chosen for synthesis as well as the designation of the expression vector. All the genes were cloned under control of the ENO1 promoter/terminator using the pMU1531 expression plasmid. The plasmids were all transformed to S. cerevisiae M0509 and transformants were confirmed with PCR.
(333) TABLE-US-00008 TABLE 5 Xylanase and xylosidase encoding genes expressed in S. cerevisiae. GH Expression Theoretical size Organism & Gene: Family: plasmid: (kDaa) Xylanases: T. reesei xyn2 (native sequence) 11 pRDH182 21.0 T. reesei xyn2 (synthetic) 11 pRDH169 21.0 Chaetomium thermophilum 11 pRDH170 27.8 xyn11A Aureobasidium pullulans var. 10 pRDH171 39.9 melanigenum xyn10 Cryptococcus albidus xylanase 10 pRDH172 35.8 Aspergillus niger xylanase D 43 pRDH174 35.4 Xylosidases: Aspergillus niger xlnD - native 3 pRDH181 86.7 sequence (S.c.MFα secretion signal) Cochliobolus carbonum 43 pRDH175 36.8 β-xylosidase Penicillium herquei xylosidase 43 pRDH176 37.4 Pyrenophora tritici-repentis β- 43 pRDH177 36.9 xylosidase Aspergillus nidulans xylosidase 3 pRDH179 87.1
(334) Along with the reference strain (containing pMU1531), a strain expressing the native sequence of T.r.xyn2 (pRDH182) and a strain expressing the native sequence of A.n.xlnD (pRDH181), the xylanase/xylosidase expressing strains were tested for activity on 100 birchwood glucuronoxylan (Roth) and pNP-xylopyranoside (pNPX). The strains were grown in YPD or buffered double strength SC medium (pH 6). Zeocin was added to a final concentration of 100 μg/mL for liquid cultures. 10 mL Cultures in 125 mL Erlenmeyer flasks were incubated at 30° C. for three days (YPD) or four days (SC). Three flasks were inoculated for each strain. After incubation, samples were taken for gel analysis, protein determination and activity measurement. After centrifugation of the samples, 12 μL of each was taken, added to 5 μL of protein loading buffer and boiled for 5 minutes. The samples were subsequently loaded on a 10% SDS-PAGE and separated, followed by silver staining (
(335) From the gel it appeared that not all strains produced a visible band in the expected size range (see Table 5 for predicted sizes). (A) The Tr.XYN2 appeared as a band of about 21 kDa as predicted. The Chaetomium thermophilum XYN11A is visible as a faint band of about 36 kDa, larger than the expected 27.8 kDa. The Aureobasidium pullulans XYN10 is visible as a prominent band at ˜50 kDa. The Cryptococcus albidus and Aspergillus niger xylanases are also visible as bands slightly larger than predicted but these gene products yielded no activity in liquid assays (
(336) To screen for xylanase activity, 5 μL of the cultures used for quantitative assays were spotted on an SC-URA plate containing 0.2% RBB-xylan and incubated for 24 hours (
(337) All strains were tested for activity on birchwood glucuronoxylan (Roth) and pNP-xylopyranoside (pNPX). Xylanase assays were performed essentially as described in La Grange et al. (1996, Appl. Environ. Microbiol. 62, 1036-1044). Reactions were miniaturized for use in a 96-well PCR plate. 5 μL supernatant was added to 45 μL 1% glucuronoxylan and incubated at 35° C. for 5 minutes. Reactions were stopped by adding 75 μL DNS before heating at 99° C. for 5 minutes. A standard curve was set using xylose. Xylosidase assays were performed in the same manner as for β-glucosidase assays (see above protocol) but with pNPX as substrate at pH5, 35° C. for 2-5 minutes depending on the activity. Activity data from strains grown on YPD and SC can be seen in
(338) From the activity data it would appear that the strain expressing the native T.r.xyn2 (pRDH182) produced the highest levels of secreted xylanase activity. It was surprising that the strain containing a codon optimized version of this gene (sequence verified) displayed no secreted activity. The GH family 11 xylanase encoded by Chaetomium thermophilum xyn11A did give notable activity, however, far less than that generated by the strain expressing native Tr.xyn2. The strain expressing Aureobasidium pullulans xyn10 (GH family 10) also yielded appreciable activity. This is particularly encouraging as it is known that family 10 xylanases often have only 10% of the specific activity of GH family 11 enzymes. However, family 10 xylanases are less restricted in their action by side chain substitutions on the xylan backbone. Somewhat surprisingly, the GH family 43 xylosidases encoded by the genes from Cochliobolus carbonum and Pyrenophora tritici-repentis gave substantial xylanase activity. These enzymes are also classed as “exo-xylanases” and it will be very interesting to see how they interact with other xylan degrading enzymes. The strains producing these two enzymes also displayed far greater xylosidase activity on pNPX than the strain expressing native A.n.xlnD. Furthermore, the strain expressing native A.n.xlnD secreted only about 36% of the total xylanase activity it produced when grown in YPD whereas 76% and 99% of the C. carbonum and P. tritici-repentis heterologous xylosidases were secreted. The secreted xylosidase activities of the strains producing C. carbonum and P. tritici-repentis xylosidases in YPD were respectively 3.3 and 6.9 fold higher than the secreted activity of the strain expressing native A.n.xlnD.
(339) An assay assessing synergy of the best xylanases and xylosidases identified is shown in
(340) 1. 100 μl supernatant of REF strain
(341) 2. 50 μl supernatant of REF strain, 50 μl supernatant of RDH182 strain (T.r.xyn2)
(342) 3. 50 μl supernatant of REF strain, 50 μl supernatant of RDH171 strain (A.p.xyn10)
(343) 4. 50 μl supernatant of REF strain, 50 μl supernatant of RDH177 strain (P.tr.xld)
(344) 5. 50 μl supernatant of RDH182 strain (Tr.xyn2), 50 μl supernatant of RDH177 strain (P.tr.xld)
(345) 6. 50 μl supernatant of RDH171 strain (A.p.xyn10), 50 μl supernatant of RDH177 strain (P.tr.xld)
(346) The mixtures were shaken on a microtiter plate shaker at 1000 rpm, 35° C. for 22 hours. DNS assays were performed to ascertain the amounts of reducing sugar formed (
(347) Derivatives of M0509 expressing the T. reesei Xyn2 (xylanase, pRDH182), and the P.t.r. GH43 xylosidase (xylosidase, pRDH177), or both the enzymes (pMU1819 below) were created. A cassette to integrate both enzymes was created so that both enzymes could be integrated at the rDNA locus. (
Example 4: Screening of Fungal Accessory Enzymes
(348) Assays for arabinofuranosidase activity and esterase activity were carried out to assess whether any of the accessory enzymes were functional. The arabinofuranosidase assay was carried out as follows: Substrate (1 mM 4-nitrophenyl-L-arabinofuranoside (Sigma #N-3641)) was made up in 50 mM citrate buffer pH 5.4 and preheated to 35 C. 20 ul of yeast supernatant plus 180 ul of substrate was added to 96 well plate, and incubated at 35 degrees for 30 minutes. The reaction was stopped by adding 100 ul of 1M Na.sub.2CO.sub.3 and an OD measurement was taken at 405 nM. Zoomerase (1 ul) at a concentration of 177 ug/ul was added in a total of 20 ul citrate buffer. The esterase activity assay was carried out as follows: A 200 mM stock of substrate (4-Nitrophenol Acetate-Sigma N-8130) was made up in DMSO; 50 ul of this stock was added to 10 mls of citrate buffer pH 5.4 to make a 1 mM final concentration. 50 ul of supernatant to be tested was added to a 96 well flat bottom plate plus 100 ul of substrate solution. The reaction was incubated at 35 degrees for 30 minutes and the OD at 410 nm was taken.
(349)
(350) PHW assays were set up to screen several accessory components and assess their impact in the presence of other yeast made enzymes.
(351)
Example 5: Testing Endoglucanases for Possible Xylanase Activity
(352) It was shown previously that fungal and bacterial xylanases of GH10 and GH11 produce ethylxylanopyranoside (EXP) during fermentation. In order to find xylanases that do not produce EXP several fungal and bacterial enzymes belonging to different GH families were tested for xylanase activity. Enzymes from GH families 5, 7, 8, 10, 11, 12, 16, 26, 43, 44, and 51 were screened for activity on xylan as members of these families have been reported to contain some xylanase activity. Cultures were grown in YPD for 72 h and the supernatants were evaluated on the birchwood xylanase assay (
(353)
Example 6: Expression of Bacterial Lignocellulolytic Enzyme System Components in Yeast
(354) Several potential bacterial donors of lignocellulolytic enzymes are listed in Table 6, with preference given to mesophilic organisms with noncomplexed cellulases. At the same time bacteria from different groups (aerobic vs. anaerobic and meso vs. thermo) were selected, to provide diversity. Also, preferred donors were chosen if the functional expression of their genes in yeast was previously reported (Thermobifida fusca, Cellulomonas fimi, Clostridium phytofermentans, etc.). GC content of bacterial genomes also influenced the choice of donor. The preference was given to the organisms with GC content that is not too far from S. cerevisiae GC content—38% (see Table 6), although the organisms with high GC content also were not completely ruled out based on successful expression in yeast of native cel9A from T. fusca that has 67.5 GC content.
(355) Table 7 gives the full list of the bacterial genes screened for expression in yeast. All the genes except those indicated were successfully amplified by PCR from genomic DNA and transformed into yeast strain together with the 2 vector backbone for cloning via yeast mediated ligation. The enzymes not cloned from genomic DNA were available as codon optimized versions.
(356) TABLE-US-00009 TABLE 6 Characteristics of various bacterial donors of cellulolytic enzymes, DBM-disulphide bonds machinery. Oxygen Growth Growth GC Organism relation temp. pH Cellulase system content DBM Streptomyces avermitilis Aerobe Meso 7 Noncomplexed, cell free 70.7 + Saccharophagus degradans Aerobe Meso 7.6 Noncomplexed, cell free 45.8 + Bacillus subtilis Facult. Meso 6.8 Noncomplexed, cell free 43.5 + Clostridium cellulolyticum Anaerobe Meso 7.5 Combined 37.4 + Clostridium phytofermentans Anaerobe Meso 7 Noncomplexed, cell free 35.3 + Thermobifida fusca Aerobe Thermo 7.4 Noncomplexed, cell free 67.5 + Clostridium thermocellum Anaerobe Thermo 6.7 Combined 39 −
(357) TABLE-US-00010 TABLE 7 Bacterial genes screened for expression in Saccharomyces cerevisiae. In certain figures and examples, BC # designates the enzyme used in that experiment. Organism Activity GHF Gene or locus taq Protein ID BC # MESOPHILES Aerobes Streptomyces Exo 6 1,4-beta- NP_821732.1 1 avermitilis cellobiosidase guxA1 Streptomyces Exo 6 1,4-beta- NP_823029.1 2 avermitilis cellobiosidase guxA2 Streptomyces exo/endo 48 1,4-beta- NP_823031.1 3 avermitilis cellobiosidase guxA3 Streptomyces endoglucahase/ 12 endo-1,4-beta- NP_821730.1 4 avermitilis xylanase? glucanase celA1 Streptomyces Endo endo-1,4-beta- NP_823030.1 5 avermitilis glucanase celA2 Streptomyces endo endo-1,4-beta- NP_823032.1 6 avermitilis glucanase celA3 Streptomyces endoglucahase/ 12 endo-1,4-beta- NP_823744.1 7 avermitilis xylanase? glucanase celA4 Streptomyces endo 6 endo-1,4-beta- NP_826394.1 8 avermitilis glucanase Streptomyces endo 6 endo-1,4-beta- NP_828072.1 9 avermitilis glucanase celA5 Streptomyces endoxylanase 10 beta-1,4-xylanase NP_823272.1 10 avermitilis Streptomyces endoxylanase 10 beta-1,4-xylanase NP_826161.1 11 avermitilis Streptomyces xylanase/ 43 xylanase NP_827548.1 12 avermitilis xylosidase ? Streptomyces xylanase/xylosidase ? 43 endo-1,4-beta- NP_827557.1 13 avermitilis xylanase xynD Streptomyces xylosidase 39 1,4-beta-xylosidase NP_822628.1 14 avermitilis xynB1 Streptomyces xylanase/ 43 beta-xylosidase NP_823285.1 15 avermitilis xylosidase ? Streptomyces xylosidase/ 3 1,4-beta-xylosidase NP_826159.1 16 avermitilis glucosidase? xynB2 Streptomyces xylosidase 39 1,4-beta-xylosidase NP_827745.1 17 avermitilis xynB3 Streptomyces beta-glucosidase 1 beta-glucosidase NP_822977.1 18 avermitilis bglC1 Streptomyces beta-glucosidase 1 beta-glucosidase NP_826430.1 19 avermitilis bglC2 Streptomyces beta-glucosidase 1 beta-glucosidase NP_826775.1 20 avermitilis bglC3 Streptomyces Acetyl xylan AXE1 NP_822477.1 21 avermitilis esterase Streptomyces Acetyl xylan AXE1 NP_822632.1 22 avermitilis esterase Streptomyces arabinofuranosidase/ 43 abfA NP_822218.1 23 avermitilis xylanase Streptomyces arabinofuranosidase/ abfB NP_822290.1 24 avermitilis xylanase Streptomyces arabinofuranosidase abfA NP_826920.1 25 avermitilis Streptomyces arabinofuranosidase/ abfB BAC74043.1 26 avermitilis galactosidase Streptomyces arabinofuranosidase SAV_6756 BAC74467.1 27 avermitilis Streptomyces galactosidase agaA1 BAC68338.1 28 avermitilis Streptomyces galactosidase agaA3 BAC68787.1 29 avermitilis Streptomyces galactosidase agaB2 BAC69185.1 30 avermitilis Saccharophagus Endo 5? Sde_2993 YP_528462.1 31 degradans 2-40 Saccharophagus Endo 5? Sde_2996 YP_528465.1 32 degradans 2-40 Saccharophagus Endo 5? Sde_3023 YP_528492.1 33 degradans 2-40 Saccharophagus Endo 5 cel5A ABD82260.1 34 degradans 2-40 Saccharophagus Endo 5 cel5E ABD82186.1 35 degradans 2-40 Saccharophagus Endo 5 cel5F ABD80834.1 36 degradans 2-40 Saccharophagus Endo 5 cel5J ABD81754.1 37 degradans 2-40 Saccharophagus Endo 9 cel9A ABD79898.1 38 degradans 2-40 Saccharophagus beta-glucosidase 3 ced3A ABD81757.1 39 degradans 2-40 Saccharophagus beta-glucosidase 3 ced3B ABD79509.1 40 degradans 2-40 Saccharophagus beta-glucosidase 1 bgl1A ABD82858.1 41 degradans 2-40 Saccharophagus beta-glucosidase 1 bgl1B ABD80656.1 42 degradans 2-40 Saccharophagus Cellobiose 94 Cep94A ABD80580.1 43 degradans 2-40 phosphorylase Saccharophagus Cellodextrin 94 Cep94B ABD80168.1 44 degradans 2-40 phosphorylase Saccharophagus mannanase Sde_0509 YP_525985.1 45 degradans 2-40 Saccharophagus mannosidase 2 Sde_0169 YP_525645.1 46 degradans 2-40 Facultative Anaerobes Bacillus subtilis synergy with expansin exlX CAB13755.1 47 endo/exo Bacillus subtilis endo/exo? endo-1,4-beta- CAB13696.2 48 glucanase eglS Bacillus subtilis endo/exo 30 endo-xylanase xynC CAB13698.1 49 xlylanase? Bacillus subtilis endo/exo 43 endo-1,4-beta- CAB13699.1 50 xlylanase? xylanase xynD Bacillus subtilis endo xlylanase 11 endo-1,4-beta- CAB13776.1 51 xylanase xynA Bacillus subtilis xylanase/ 43 xylan beta-1,4- CAB13642.2 52 xylosidase ? xylosidase xynB Anaerobes Clostridium Exo/Endo 9 Cphy_3367 YP_001560459.1 53 phytofermentans Clostridium Exo/Endo 48 Cphy_3368 YP_001560460.1 54 phytofermentans Clostridium Endo 5 Cphy_2058 YP_001559165.1 55 phytofermentans Clostridium Endo 5 Cphy_3202 celulase B YP_001560295.1 56 phytofermentans Clostridium Endo 5 Cphy_1163 YP_001558280.1 57 phytofermentans Clostridium beta-glucosidase 3 Cphy_3329 YP_001560421.1 58 phytofermentans Clostridium beta-glucosidase 3 Cphy_1125 YP_001558242.1 59 phytofermentans Clostridium xylanase 10 Cphy_1510 YP_001558623.1 60 phytofermentans Clostridium xylanase 10 Cphy_0624 YP_001557750.1 61 phytofermentans Clostridium xylanase 11 Cphy_2105 XynA YP_001559210.1 62 phytofermentans Clostridium xylanase 10 Cphy_2108 YP_001559213.1 63 phytofermentans Clostridium xylanase/ 8 Cphy_3207 Y YP_001560300.1 64 phytofermentans endoglucanase Clostridium Xylosidase/ 43 Cphy_0191 YP_001557317.1 65 phytofermentans Arabinofuranosidase Clostridium Xylosidase/ 43 Cphy_0875 YP_001558000.1 66 phytofermentans Arabinofuranosidase Clostridium Arabinofuranosidase Cphy_1169 YP_001558286.1 67 phytofermentans Clostridium Mannanase 26 Cphy_1071 YP_001558190.1 68 phytofermentans Clostridium Mannosidase 26 Cphy_2128 YP_001559233.1 69 phytofermentans Clostridium Mannosidase 26 Cphy_2276 YP_001559376.1 70 phytofermentans Clostridium Galactosidase Cphy_1936 YP_001559043.1 71 phytofermentans Clostridium Endo 5 cel5I AAL79562.1 72 cellulolyticum Clostridium Exo/Endo 48 CelCCF (dockerin) AAB41452.1 73 cellulolyticum Cel48F-yeast CO template pMU914 Clostridium Xylosidase 39 Ccel_1259 YP_002505595 74 cellulolyticum Clostridium Endo 9 Ccel_2226 YP_002506548.1 75 cellulolyticum Clostridium Endo/Exo 9 Ccel_0732 YP_002505091.1 76 cellulolyticum (dockerin) Cel9E- yeast CO template pMU913 Clostridium Endo 5 Ccel_1099 YP_002505438.1 77 cellulolyticum (dockerin) Cel5A- yeast CO template pMU967 Clostridium Endo/Exo 9 Ccel_2392 YP_002506705.1 78 cellulolyticum (dockerin) Clostridium Endo 9 Ccel_0731 YP_002505090.1 79 cellulolyticum (dockerin) Cel9G- yeast CO template pMU892 Clostridium Endo/Exo 5 Ccel_0840 YP_002505196.1 80 cellulolyticum (dockerin) Cel5D- yeast CO template pMU891 Clostridium Endo/Exo 8 CelCCC (dockerin) AAA73867.1 81 cellulolyticum Cel8C-yeast CO template pMU969 THERMOPHILES Aerobes Thermobifida fusca xylanase 10 endo-1,4-beta ABL73883.1 82 xylanase (Umxyn10A) Thermobifida fusca xylanase 11 endo-1,4-beta-D- AAV64879.1 83 xylanase (xyl11) Thermobifida fusca endo 6 Endoglucanase AAZ55112.1 84 Thermobifida fusca exo/endo? 5 Cellulase AAZ56745.1 85 Thermobifida fusca beta-glucosidase 3 exo-1,4-beta- AAZ55642.1 86 glucosidase Thermobifida fusca beta-glucosidase 1 beta-glucosidase AAZ55664.1 87 Thermobifida fusca exo/endo 48 cellulose 1,4-beta- YP_290015.1 88 cellobiosidase Thermobifida fusca synergy with CBD E8 AAZ55700.1 89 endo/exo Thermobifida fusca exo 6 celC (E3) YP_288681.1 90 Thermobifida fusca endo 5 celE (E5) YP_288962.1 91 Thermobifida fusca endo 5 cel5B AAP56348.1 92 (Endoglucanase) Thermobifida fusca endo 9 celA (E1) AAC06387.1 93 Thermobifida fusca endo 6 celB (E2) YP_289135.1 94 Thermobifida fusca endo/exo? 9 Tfu_1627 (1,4-beta- YP_289685.1 95 cellobiosidase) Anaerobes Clostridium Endo 8 celA (dockerin) YP_001036701.1 96 thermocellum Clostridium Endo/Exo 48 celY (cel48Y) CAI06105.1 97 thermocellum Clostridium Endo 9 Cthe_0625 YP_001037053.1 98 thermocellum (dockerin) Clostridium Endo 5 celC CAC27410.1 99 thermocellum Clostridium Endo 5 Cthe_1471 YP_001037893.1 100 thermocellum Clostridium xylanase 10 Cthe_2119 YP_001038519.1 101 thermocellum Clostridium beta-glucosidase 1 bglA CAA42814.1 102 thermocellum Clostridium beta-glucosidase 3 bglB CAA33665.1 103 thermocellum Clostridium arabinofuranosidase 51 Cthe_2548 YP_001038942.1 104 thermocellum Clostridium arabinofuranosidase 54 Cthe_1273 YP_001037698.1 105 thermocellum Clostridium Endo/Exo 9 Cthe_0040 (Cel9I) YP_001036474.1 106 thermocellum Clostridium Endo/Exo 9 Cthe_0412 YP_001036843.1 107 thermocellum (dockerin) Clostridium Endo/Exo 9 Cthe_0825 YP_001037253.1 108 thermocellum (dockerin) Clostridium Endo-xylanase 11 xynA CAD48307 109 stercorarium Clostridium Endo-xylanase 10 xynB (CelW- CAD48313 110 stercorarium celloxylanase) Clostridium Endo-xylanase 10 xynC (CelX- CAD48314 111 stercorarium celloxylanase) Clostridium Xylosidase 3 bxlB (b-Xylosidase AJ508405 112 stercorarium B) Clostridium Xylosidase 39 bxlA (b-Xylosidase AJ508404 113 stercorarium A) Clostridium Xylosidase/beta- 3 bglZ (beta- CAB08072 114 stercorarium glucosidase glucosidase) Clostridium arabinofuranosidase 43 arfA (alpha- AJ508406 115 stercorarium arabinofuranosidase A) Clostridium arabinofuranosidase 51 arfB (alpha- AAC28125 116 stercorarium arabinofuranosidase B) Clostridium Endo 9 celZ (Cs-Cel9Z- CAA39010 117 stercorarium Avicellase I) Clostridium Exo 48 celY (Cs-Cel48Y- CAA93280 118 stercorarium Avicellase II) Anaerocellum Endo (Exo?) 48 celA (1,4-beta- CAB06786 119 thermophilum glucanase) Anaerocellum Endo 5 celD (EG) CAB01405 120 thermophilum Anaerocellum Endo-xylanase 10 xynA (1,4-beta-D- CAA93627 121 thermophilum xylan xylanhydrolase) Anaerocellum Endo 5 celB (EG5) Z86104 122 thermophilum Anaerocellum Endo? 5 Athe_1866 (endo- YP_002573059 123 thermophilum 1,4-beta- mannosidase) Anaerocellum Endo? 5 Athe_0594 YP_002572493 124 thermophilum (“cellulase”) Thermobifida fusca endo/exo 9 Cel9A, TfCel9A- 125 yeast CO gene from restriction digest of pMU1248
Example 7: Screening Bacterial Endoglucanases for Expression/Activity in Yeast
(358) All of the bacterial endoglucanases were pre-screened for secreted activity on CMC (
(359)
Example 8: Synergy of Bacterial Endoglucanases with Yeast Made CBHs on PHW
(360) In order to determine which bacterial endoglucanase increase pretreated lignocellulose conversion by CBHs, the PHW assay was performed with several yeast made bacterial EGs selected by screening on CMC in the presence of yeast made purified CBH1 and CBH2 (
(361)
(362) Previous work had demonstrated that the T. fusca Cel9A gene is well expressed in yeast. We have generated a yeast codon optimized version of this gene and expressed it and the native sequence under control of the strong ENO1 promoter. This resulted in activity on avicel that was roughly equivalent to that measured for CBH1 candidates (8% conversion in 48 hours, with only Novozymes 188 present as a background). This indicated that both the native and the codon optimized version of the gene were well expressed. Thus, this candidate enzyme was tested for synergy with yeast made, purified CBHs, and T. reesei EG2 in a PHW assay (
(363) TABLE-US-00011 TABLE 8 List of bacterial endoglucanases demonstrated functional expression in yeast (see FIG. 22). BC# Donor organism GHF Gene or locus taq 4 Streptomyces avermitilis 12 endo-1,4-beta-glucanase celA1 34 Saccharophagus degradans 5 cel5A 48 Bacillus subtilis endo-1,4-beta-glucanase eglS 56 Clostridium phytofermentans 5 Cphy_3202 celulase B 72 Clostridium cellulolyticum 5 cel5I 77 Clostridium cellulolyticum 5 Ccel_1099 (yeast CO) 80 Clostridium cellulolyticum 5 Ccel_0840 (yeast CO) 81 Clostridium cellulolyticum 8 CelCCC (yeast CO) 91 Thermobifida fusca 5 celE (E5) 93 Thermobifida fusca 9 celA (E1) 94 Thermobifida fusca 6 celB (E2) 95 Thermobifida fusca 9 Tfu_1627 96 Clostridium thermocellum 8 celA 99 Clostridium thermocellum 5 celC 108 Clostridium thermocellum 9 Cthe_0825 125 Thermobifida fusca 9 Cel9A
Example 9: Characterizing Bacterial Xylanases for Expression/Activity in Yeast
(364) Screening was carried out for bacterial genes annotated as xylanases using birchwood xylan as the substrate—see protocol above (
(365)
(366) TABLE-US-00012 TABLE 9 List of bacterial xylanases demonstrated functional expression in yeast (see FIG. 25). BC# Donor organism GHF Gene or locus taq 13 Streptomyces avermitilis 43 endo-1,4-beta-xylanase xynD 51 Bacillus subtilis 11 endo-1,4-beta-xylanase xynA 60 Clostridium phytofermentans 10 Cphy_1510 61 Clostridium phytofermentans 10 Cphy_0624 83 Thermobifida fusca 11 endo-1,4-beta-D- xylanase (xyl11) 109 Clostridium stercorarium 11 xynA 110 Clostridium stercorarium 10 xynB (CelW-celloxylanase) 111 Clostridium stercorarium 10 xynC (CelX-celloxylanase)
Example 10: Synergy of Bacterial Xylanases with Yeast Made CBHs and EG
(367) In order to test synergy of yeast made enzymes with bacterial xylanases, a PHW assay was performed with several yeast made bacterial xylanases previously selected by screening on xylan in the presence of yeast made purified CBH1, CBH2, TrEG2, and yeast made GH43 xylosidase (from Pyrenophora tritici-repentis) (
(368)
Example 11: Cloning and Screening Thermoanaerobacter saccharolyticum Xylanases
(369) T. saccharolyticum xylanases were cloned from genomic DNA and fused to the Enol promoter for expression in S. cerevisiae. A total of 12 xylanase-related genes were cloned into the pMU1575 backbone (Table 4). The strains were screened for both xylanase and xylosidase activities using the birchwood xylanase assay and the pNPX xylosidase assay, respectively (
(370) TABLE-US-00013 TABLE 10 Description of T. saccharolyticum xylanases cloned and expressed in yeast. Sample Contig Gene SP Gene Annotation GH Vector # TsX1 Contig7 or0901 Trans endo-1,4-beta-xylanase precursor 11 pMU1988 TsX2 Contig12 or1447 No Xylan 1,4-beta-xylosidase 39 pMU1989 TsX3 Contig12 or1446 No Xylan 1,4-beta-xylosidase. 52 pMU1990 TsX4 Contig12 or1454 Trans Cellulose 1,4-beta-cellobiosidase- 10 pMU1991 Beta-14-xylanase xynA TsX5 Contig12 or1455 No Glycosyl hydrolase family 10 10 pMU1992 TsX6 Contig12 or1186 SP xylanase/chitin deacetylase pMU1993 TsX7 Contig0 or0277 No xylulokinase pMU1994 TsX8 Contig0 or0278 No xylose isomerase xylA pMU1995 TsX9 Contig0 or0277 No xylulokinase - No SP pMU1996 TsX10 Contig0 or0278 No xylose isomerase xylA - No SP pMU1997
Example 12: Screening of Bacterial Genes with Mannanase Activity
(371) In order to find an easy, high-throughput screen for cellulases, mannanases, and xylanases, 4 Azurine-Crosslinked Polysaccharides (AZCL) from Megazymes were tested in an agar plate assay. In this assay the enzyme hydrolyzes the insoluble polysaccharide, releasing the soluble dye-labeled fragments to provide a “zone of dyeing”. Galactomannan, debranched arabinan, and xylan AZCL attached substrates were tested by the plate assay. Clones with putative xylanase, and mannanase activity provided colored zones; however, no arabinase activity was detected on the debranched arabinan.
(372) Xylanases that demonstrated activity by this plate assay matched the ones that were active in previously applied birchwood xylan assay (see above). Three functionally secreted yeast made bacterial mannanases (BC68, BC69, and BC70 from C. phytofermentens) were discovered by the mannanase plate assay.
(373) Bacterial accessory enzymes expressed by yeast were also screened for synergy with yeast made enzymes (CBH1, CBH2, EG2, BGL, xylanase, xylosidase) by PHW assay without any external enzymes added (
(374) TABLE-US-00014 TABLE 11 Summary of functional, “best in class” components expressed in yeast. Hardwood and Paper sludge Additional for Paper sludge Cazy family/ Well-Expressed Type of Activity enzyme type Candidates Accession Number exoglucanase GH7A (CBH1) T. emersonii See underlined orf CBH1 + HgCBD in pMU1392 GH6A (CBH2) C. lucknowense See omnibus patent CBH2 application endoglucanase GH7B (EG1) A. fumigatus EG1 XP_747897 GH5A (EG2) T. reesei EG2 See omnibus patent application GH12A (EG3) N. fischeri EG3 XP_001261563 GH61A (EG4) T. terrestris EG4 ACE10231 GH45A (EG5) C. lucknowense ACH15008 EG5 GH6 (EG6) N. crassa EG6 XP_957415 GH5 (bact.) C. cellulolyticum YP_002505438.1 Cel5A GH? (bact.) B. subtilis EGLS CAB13696.2 GH9 (bact.) T. fusca Cel9A AAC06387.1 GH8 (bact.) C. cellulolyticum AAA73867.1 Cel8c xyloglucanase GH74A (EGL6) A. niger XG AAK77227 β-glucosidase BGLI S. fibuligera BGLI See Omnibus patent application xylanase GH11 (XYN2) T. reesei xyn2 ABK59833 GH10 A. niger xyn10 CAA03655.1 β-xylosidase GH3 A. niger Xld3 XP_001389416 GH43 (BXL1) Pyrenophora XP_001940956 tritici-repentis BXL beta-mannase GH5 (MAN1) A. aculeatus MAN5 AAA67426 beta- GH2/GH26 C. phytofermentens mannosidase mannosidase acetylxylanesterase CE1 (AXE) N. fischerii AXE1 XP_001262186 arabinofuranosidase GH54 (ABF1) A. niger ABFB AAA93264 ferulic CE1 (FAEA) A. niger FAEA XP_001393337 acid/cinnamoyl CE1 (FAEB) T. stipitatus FAEB EED17739 esterase A-glucuronidase GH67 Pichia stipitis ABN67901 glucuronyl CIP2 C. globosum XP_001226041 esterase
Example 13: Combinations of Components to Enhance Hydrolysis: Effect of Different EG Combinations (Pair Wise Combinations) on PHW Conversion by Yeast Made CBHs in the Presence of External Enzymes (EE)
(375) In order to determine if different EGs were synergistic with each other, PHW assays were used to analyze EG combinations with the goal of determining synergistic relationships. If the EGs had similar functions, then combinations of the EGs should be no better than a single EG (either) loaded at twice the concentration. However, if the EGs were synergistic, then combinations should yield greater hydrolysis than a 2× concentration of either enzyme.
(376) To test pair wise combinations, a PHW assay was performed with the supernatants of yeast strains expressing individual EGs (Table 4) combined in pairs (1 ml+1 ml) in all possible combinations. The EG expressing strains were patched on YPD+Zeo plates for 1 day (except M1023 that was patched on SD-URA), inoculated in YPD in shake flasks and grown for 72 hours. The strain expressing an empty vector was used as negative control (2 ml, NC). The strains expressing single EGs (2 ml or 1 ml+1mlNC) were used as positive controls. All samples including NC were supplemented with 1 mg/g CBH1, 1 mg/g CBH2, and 1 mg/g AB BGL (
(377) TABLE-US-00015 TABLE 12 Yeast strains expressing EGs of different GH families GHF Strain Organism Donor Gene Host GH7 M1311 Fungi Aspergillus fumigatus EG1 M0509 GH5 M1450 Fungi Trichoderma reesei EG2 M0749 GH12 M1378 Fungi Neosartorya fischeri EG3 M0509 GH61 M1391 Fungi Chaetomium globosum EG4 M0509 GH45 M1420 Fungi Chaetomium globosum EG5 M0544 GH6 M1400 Fungi Neurospera crassa EG6 M0509 GH8 M1456 Bacteria Clostridium cellulolyticum Cel8C(BC81) M0749 GH9 M1023 Bacteria Thermobifida fusca Cel9A(BC125) M0749 GHX M1454 Bacteria Bacillus subtilis EglS(BC48) M0749
(378) All EGs expressed on 2u plasmid under ENO pr/tt containing URA3 and Zeo markers. Backbone vector pMU1531 for fungal EGs; pMU1575 for bacterial EGs. Fungal EGs have native signal sequences; bacterial EGs attached to S.c. Invertase signal. Strains with fungal EGs were selected on YPD+Zeo plates; strains with bacterial EGs were selected on SD-URA-plates.
(379) As can be seen from
(380) In order to analyze the EG pairs experiment data the Tables 13A and 13B were composed based on
(381) 1. EG combinations have a definite advantage in PHW cellulose conversion compared to single EGs.
(382) 2. In early PHW conversion time points each of the 9 EGs (from separate families) are synergistic with some other EG.
(383) 3. The synergy effect becomes less noticeable at the later time of conversion.
(384) In order to select the most efficient EG couples, the best EG pairs were ranged based on both parameters: activity and synergy, for both time-points (Table 14). The pairs in bold boxes in the Table 14 are present in all four “winning” groups and considered as the most efficient EG combinations for these experimental conditions.
(385) TABLE-US-00016 TABLE 13 Data analysis of experiment with different EG combinations. GH 5 7 12 61 45 6 8 9 x A PHW glucose 27 h 5 0.38 0 0 0 0 0 0 28 21 7 0.39 0.35 17 7 0 0 0 15 16 12 0.44 0.79 0.32 12 13 0 0 10 0 61 0.36 0.53 0.65 0.20 ? ? 0 15 10 45 0.30 0.45 0.65 ? 0 7 14 0 8 6 0.28 0.46 0.35 ? 0.21 0 18 0 6 8 0.18 0.31 0.37 0.10 0.28 0.47 0 6 17 9 1.09 0.82 0.67 0.82 0.44 0.35 0.57 0.41 5 x 0.95 0.78 0.41 0.46 0.19 0.18 0.40 0.55 0 B PHW glucose 48 h 5 0.83 4 7 0 0 4 0 9 0 7 1.00 0.48 5 6 8 7 5 11 0 12 1.09 0.92 0.76 8 3 6 0 12 0 61 0.91 0.94 1.05 0.73 ? ? ? 5 0 45 0.55 0.76 0.88 ? 0.40 0 0 0 0 6 1.00 0.79 1.00 ? 0.41 0.54 0 0 0 8 0.65 0.64 0.82 ? 0.35 0.49 0.46 0 0 9 1.27 1.35 1.40 1.13 0.76 0.81 0.96 0.95 0 x 0.48 0.45 0.57 0.36 0.17 0.33 0.20 0.70 0
(386) Bold inner numbers denote activity—increase in glucose release compared to NegCont (CBHs+EE), g/l (EG couple activity minus NC); Non-bold inner numbers denote—Synergy—increase in glucose release compared to the more active component of the couple, % (100%*EG couple act. divided by EG max act. minus 100%). A—27 h time-point; B—48 h time-point.
(387) TABLE-US-00017 TABLE 14 Data analysis of experiment with different EG combinations (see FIGS. 28 and Table 13). Activity Synergy 27 hrs 48 hrs 27 hrs 48 hrs Rang EG couple Activity EG couple Activity EG couple Synergy EG couple Synergy # GH/GH g/l GH/GH g/l GH/GH % GH/GH % 1 5/9 1.09 9/12 1.40 5/9 28 9/12 12 2 5/X 0.95 9/7 1.35 5/ 21 9/7 11 3 9/7 0.82 9/5 1.27 6/8 18 9/5 9 4 9/61 0.82 9/61 1.13 7/12 17 7/45 8 5 7/12 0.79 5/12 1.09 X/8 17 61/12 8 6 7/X 0.78 61/12 1.05 7/X 16 5/12 7 7 9/12 0.67 6/12 1.00 9/7 15 7/6 7 8 61/12 0.65 6/5 1.00 9/61 15 7/61 6 9 12/45 0.65 7/5 1.00 45/8 14 12/6 6 10 12/45 13 7/12 5 11 61/12 12 7/8 5 12 9/12 10 9/61 5
(388) In this Table the best performing EG pairs based on activity and synergy data from Table 13 listed in the order of performance starting with the best pairs. Four groups of the best performers were formed for two different parameters (activity and synergy) and for two different time-points: 27 and 48 hrs. The pairs in bold boxes are the pairs that present in all 4 groups.
Example 14: Testing of Higher EG Combinations for Enhanced PHW Activity
(389) Based on the EG pairs screening above, an experiment was designed in which the most efficient EG pairs were combined with each of the remaining EGs from Table 14. The PHW assay was performed with all possible triple EG combinations at the presence of external enzymes (EE, see composition above) and yeast made CBHs (
(390)
(391) The best triplets were combined with each of the remaining EGs and the PHW assay was repeated again at two different concentrations of EE (
(392) 1. EG combinations have a definite advantage in PHW glycan conversion compared to single EGs.
(393) 2. Which EG combination is the best depends on the EE load and time of conversion.
(394) 3. At all times and EE loads tested the best EG combos include: Cel9A(GH9), EG3(GH12), EG1(GH7) and EG2(GH5).
(395) 4. At lower EE loadings, the combination of GH5, GH9, GH7, and GH12 appears the best.
(396) The data for the best single EGs (GH9 and GH5) and the best four EGs together (GH9, GH5, GH12, GH7) were plotted as a time course of PHW conversion at the presence 2 mg/g EE next to the controls—2 mg/g and 4 mg/g EE without EGs added (supernatant of empty vector added instead) (
Example 15: Expression of a “Complete” System of Enzymatic Components to Digest Lignocellulose
(397) The technical challenge of developing a “complete” or mostly complete lignocellulolytic enzyme system for expression in yeast, is that this system is likely to consist of many components. These components will need to be expressed in multiple copies in order to generate enough activity to be meaningful. Thus, developing tools for multi-gene, multicopy expression are very useful in this context.
(398) Transferable System for Expressing Multiple Genes in Multiple Copies
(399) Expressing multiple copies of the ˜25 gene types listed in Table 4, in addition to the “core” enzymes (CBH1, CBH2, EG2, and BGL) already produced in yeast, will require new molecular tools. Repeated integration with marker removal will be labor intensive. In addition to this, a system that would make the enzyme system transferable between strains would extremely valuable since new hosts are continually being created.
(400) Expressing large pieces of DNA is a solution to the problem outlined above. Among the options for expressing large pieces of DNA are CEN based plasmids and Yeast artificial chromosomes (YACs). “CEN” refers to centromeric, and CEN elements allow high fidelity dispersion of genetic elements into mother and daughter cells during cell division. First developed in 1987 (Burke D T, Carle G F, Olson M V, “,” Science. 1987 May 15; 236(4803):806-12), YACs have been used for cloning very large pieces of DNA for expression in non-yeast hosts (e.g. in mice; Schedl, 1993), and for genome sequencing (e.g. Krzywinski M, Wallis J, Gösele C, et al., “Integrated and sequence-ordered BAC- and YAC-based physical maps for the rat genome,” Genome Res. 2004 April; 14(4):766-79). They are able to maintain up to 3 megabases of DNA. Of particular interest for our project, YACs have been developed whose copy number can be amplified (Smith D R, Smyth A P, Moir D T., “Amplification of large artificial chromosomes,” Proc Natl Acad Sci USA. 1990 November; 87(21):8242-6). This is based on disrupting CEN function, and selecting for cells with asymmetric segregation of the YAC. The authors showed that the system developed could increase the copy number of a 560 Kb YAC to 13 copies, and of 120 Kb YAC to 20 copies. After 20 generations the 560 Kb YAC had fallen to 8.2 copies, and the 120 Kb YAC had fallen to 11.3 copies. These results indicate that even these very large DNA fragments, with no, or little selective benefit to the cell can be maintained with decent stability. The copy number feature for YACs was originally created in CEN plasmids (Chlebowicz-Sledziewska E, Sledziewski A Z., “Construction of multicopy yeast plasmids with regulated centromere function,” Gene. 1985; 39(1):25-31), and these plasmids are likely the easiest option for expressing the ˜20 kb piece of DNA that would comprise the “major” activities. In addition to these features, researchers (Spencer F, Simchen G. “Transfer of YAC clones to new yeast hosts,” Methods Mol Biol. 1996; 54:239-52) have shown that YACs can be transferred from one yeast host to another, as well as being modified by homologous recombination.
(401) For enzymes that are deemed necessary in only a single, or double copy-“minor” components—a single large integrative construct can be built, which will save the effort of producing a large CEN plasmid, and create a more stable system.
Example 16: Assembly of Large Vectors for Expression of Multiple Genes
(402) Assembly of genes into large constructs by homologous recombination is well known in S. cerevisiae (Shao Z, Zhao H, Zhao H., “DNA assembler, an in vivo genetic method for rapid construction of biochemical pathways,” Nucleic Acids Res. 2009 February; 37(2):e16. Epub 2008 Dec. 12)(Oldenburg K R, Vo K T, Michaelis S, Paddon C., “Recombination-mediated PCR-directed plasmid construction in vivo in yeast,” Nucleic Acids Res. 1997 Jan. 15; 25(2):451-2). This represents a tool for both routine cloning and for combining many genetic elements at once. Using the enzymes tested above, we were able to assemble large CEN constructs for expression of multiple genes in multiple copies. These vectors were constructed with one of two markers (hph or zeocin marker), with the ARS1 origin of replication from S. cerevisiae, with a disruptable centromere (CEN 4), and with a 2 micron element present. This disruptable element was made by placing the inducible Gall promoter upstream of the centromere. During growth on galactose, the plasmid becomes unstable.
(403)
(404) As outlined above, a similar CEN vector and strain were created with the zeocin marker (pMU1666). EG1, EG4, EG5 and EG6 were successfully assembled by YML into CEN vectors with the zeocin marker (strain M1553). PCR tests were done to confirm the junctions between EG cassettes and between vector and cassettes for the first (EG1) and last (EG4) cassettes.
(405) CEN vectors were also built that had either 7 genes or 11 genes via yeast mediated ligation. Schematics for these two vectors are shown in
Example 17: Amplification of CEN Vectors for Multicopy Expression
(406) Strain M1509 produced very few slow-growing colonies at TO at a hygromycin concentration of 1000 μg/ml. After growth in YP+galactose, there was an increased number of colonies on hygromcin 1000. These colonies also grew faster on YPD+hygromycin 1000 than colonies before the galactose treatment. This suggested that the copy number may have increased with the galactose treatment allowing faster growth and more colonies on the high hygromycin concentration plate. However, a CMC assay revealed that the endoglucanase activity both before and after the galactose treatment remained almost the same (
(407) Outgrowth was also done in YPD without antibiotic for about 10 generations and the CMC activity before and after the outgrowth remained fairly similar indicating the stability of the plasmid (
(408) As noted above, M1553 is a strain containing a CEN vector with the zeocin resistance cassette and four endoglucanases EG1, EG4, EG5 and EG6. This strain was tested for antibiotic resistance and EG activity. Initially M1553 could grow up to a zeocin concentration of 50 μg/ml in YPD plates, and this strain passaged in YPG (galactose) and zeocin at 50 μg/ml showed colonies when plated on YPD plates with zeocin at 100 μg/m. These zeocin (100)-resistant colonies also grew on YPD-zeo 500 ug/mL plates when re-streaked. Ten colonies from the YPD-zeo 100 ug/mL plate were compared against ten original CEN strain colonies grown on YPD-zeo 50 ug/mL. Serial dilutions 1:5, 1:10, 1:20 and 1:40 were made from culture supernatants and a CMC assay was carried out on the diluted supernatants.
(409)
(410) This demonstrates that growth in galactose to disrupt CEN function coupled with selection via the zeocin marker can result in vector amplification.
Example 18: Activity of a CEN Vector with Multiple EGs on PHW
(411) A CEN vector with the zeocin resistance marker expressing the A. fumigatus EG1, C. globosum EG4, C. lucknowense EG5, and C. globosum EG6 from different promoters and terminators was created in M0544 as described above. This vector was tested for its effect on PHW hydrolysis in an unamplified state along with strains expressing EG3 and Cel9A from 2 micron vectors (
Example 19: Screening of Amylolytic Enzymes for Expression in Yeast
(412) Over one hundred amylolytic, cellulolytic, and accessory enzymes from yeast, fungi, bacteria and plants were screened for functional expression in yeast. Most of the enzymes that were selected for screening are summarized in Tables 15 and 16. The bacterial enzymes marked “BC” are described in Table 7. The enzymes from Tables 15 and 16 were expressed in yeast and screened by multiple assays individually or in combinations. Table 15 includes 67 genes (first 10 overlap with Table 16). For 32 genes functional expression in yeast was confirmed (in bold boxes). Table 16 contains 81 genes; for 18 genes functional expression in yeast was confirmed (in bold boxes). The information about gene sequences was obtained from NCBI database or from proprietary Mascoma genome sequencing data (marked * in the Table 16). The genes were either synthesized (GeneArt or DNA2.0) or PCR amplified. Synthetic genes were either native DNA sequences or codon optimized for S. cerevisiae. When PCR was used to obtain genes, either genomic DNA or cDNA was used as template. The genes used are described in the Tables 15, 16, or Table 7. The sequences of the important genes used for construction of CBP strains are listed in Table 19. The genes were expressed under ENO1 promoter and terminator from 2-micron plasmid pMU1575 (
(413) TABLE-US-00018 TABLE 15 Amylolytic and other enzymes that were approved by FDA for feed and/or food use screened for functional expression in yeast. Grey boxes indicate enzymes that demonstrated functional expression in yeast. SE# AE# Organism Source Enzyme Protein ID 1 6 Bacteria Bacillus subtilis Alpha-amylase AAA22194.1 2 13 Bacteria Bacillus subtilis Alpha-amylase ACM91731.1 3 14 Bacteria Bacillus subtilis Alpha-amylase CAL64397.1 4 17 Bacteria Bacillus subtilis Maltogenic AAF23874.1 alpha-amylase 5 15 Bacteria Bacillus subtilis Pullulanase AAC00283.1 6 16 Bacteria Bacillus subtilis Isomaltase? AAG23399.1 7 18 Bacteria Bacillus subtilis Isomaltase? BAA23408.1 8 19 Bacteria Bacillus subtilis Isomaltase? ZP_03592917.1 9 20 Bacteria Bacillus subtilis Isomaltase? BAA22245.1 10 2 Yeast Saccharomyces Glucoamylase AAA35107.1 cerevisiae 11 Fungi Aspergillus Glucoamylase AAP04499.1 niger 12 Fungi Aspergillus Glucoamylase BAA01540.1 oryzae 13 Fungi Rhizopus Glucoamylase BAA00033.1 oryzae 14 Fungi Aspergillus Alpha- BAA23616.1 niger glucosidase 15 Bacteria Bacillus Alpha-amylase CAA01355.1 licheniformis 16 Bacteria Bacillus Pullulanase AAU24646.1 licheniformis 17 Bacteria Bacillus Pullulanase ABE68909.1 acidopullulyticus 18 Bacteria Bacillus subtilis Protease ABJ99976.1 19 Bacteria Bacillus Protease AAZ77709.1 licheniformis 20 Fungi Aspergillus Beta-glucosidase CAB75696.1 niger 21 Fungi Talaromyces CBH1 AAL89553 emersonii 22 Fungi Trichoderma CBH2 AAA34210.1 reesei 23 Fungi Trichoderma EG1 AAA34212.1 longibrachiatum 24 Fungi Trichoderma EG2 ABA64553.1 reesei 25 Fungi Trichoderma EG3 BAA20140.1 reesei 26 Fungi Trichoderma Xylanase CAA49294.1 reesei 27 Fungi Aspergillus Xylosidase CAK37179.1 niger 28 Fungi Aspergillus Xylosidase/Arabi CAK39870.1 niger nofuranosidase 29 Fungi Aspergillus Ferulic acid CAA70510.1 niger esterase 30 Fungi Aspergillus Alpha-amylase CAA36967.1 niger 31 Fungi Aspergillus Alpha-amylase CAA36966.1 niger 32 Fungi Aspergillus Xylanase AAS46914.1 niger 33 Fungi Aspergillus Xylanase AAS46913.1 niger 34 Fungi Aspergillus Xylanase CAA03655.1 niger 35 Fungi Aspergillus Isopullulanase BAA19473.1 niger 36 Fungi Aspergillus Alpha-amylase XP_001402054.1 niger 37 Fungi Aspergillus Endopolygalacturonase XP_001389562.1 niger 38 Fungi Aspergillus Pectinase CAK42510.1 niger 39 Fungi Aspergillus Arabinofuranosidase CAK42333.1 niger 40 Fungi Aspergillus Protease XP_001401093.1 niger 41 Plant Zea mays Pullulanase NP_001104920.1 42 Plant Oryza sativa Pullulanase ACY56113.1 43 Plant Zea mays Isoamylase ACG43008.1 44 Fungi Aspergillus Lipase ABG73613.1 niger 45 Fungi Aspergillus Lipase ABG73614.1 niger 46 Bacteria Bacillus Xylanase ABF61784.1 licheniformis 47 Fungi Humicola Xylanase CAA53632.1 insolens 48 Fungi Talaromyces Xylanase CAD34597.1 emersonii 49 Fungi Trichoderma Xylanase AAQ67413.1 viride 50 Plant Triticum Pullulanase ABL84490.1 aestivum 51 Yeast Saccharomyces Endopolygalacturonase NP_012687.1 cerevisiae 52 Yeast Kluyveromyces Endopolygalacturonase AAR84199.1 marxianus 53 Bacteria Bacillus subtilis Pectin lyase NP_389746.1 54 Bacteria Bacillus Polygalacturonase YP_080606.1 licheniformis 55 Bacteria Bacillus Pectin lyase YP_079258.1 licheniformis 56 Fungi Aspergillus Endopolygalacturonase CAB72125.1 niger 57 Fungi Aspergillus Endopolygalacturonase CAB72126.1 niger 58 Fungi Aspergillus Endopolygalacturonase XP_001390812.1 niger 59 Fungi Aspergillus Endopolygalacturonase CAB72931.1 niger 60 Fungi Aspergillus Endopolygalacturonase CAK44164.1 niger 61 Fungi Aspergillus Pectin lyase CAK48529.1 niger 62 Fungi Aspergillus Pectin lyase CAK37997.1 niger 63 Fungi Aspergillus Pectin lyase AAW03313.1 niger 64 Fungi Aspergillus Pectin lyase CAK47350.1 niger 65 Fungi Aspergillus Pectin lyase ACE00421.1 niger 66 Fungi Trichoderma Acetyl Xylan Q99034 reesei Esterase 67 Fungi Aspergillus Feruoyl esterase XP_001393337 niger 60 Fungi Aspergillus Endopolygalacturonase CAK44164.1 niger 61 Fungi Aspergillus Pectin lyase CAK48529.1 niger 62 Fungi Aspergillus Pectin lyase CAK37997.1 niger 63 Fungi Aspergillus Pectin lyase AAW03313.1 niger 64 Fungi Aspergillus Pectin lyase CAK47350.1 niger 65 Fungi Aspergillus Pectin lyase ACE00421.1 niger 66 Fungi Trichoderma Acetyl Xylan Q99034 reesei Esterase 67 Fungi Aspergillus Feruoyl esterase XP_001393337 niger
(414) TABLE-US-00019 TABLE 16 Amylolytic and other enzymes screened for functional expression in yeast. ORGANISM SOURCE ENZYME PROTEIN ID 1 Yeast Alpha-amylase CAA29233.1 2 Yeast Saccharomyces Glucoamylase AAA35107.1 cerevisiae 3 Yeast
Glucoamylase AAA33923.1 4 Yeast
Alpha-glucosidase CAA39501.1 5 Yeast
Alpha-amylase AAB21151.2 6 Bacteria
Alpha-amylase AAA22194.1 7 Yeast
Alpha-amylase CAA51912.1 8 Yeast
Glucoamylase CAA41120.1 9 Yeast
Glucoamylase CAC83969.1 10 Yeast
Alpha-glucosidase CAF31354.1 11 Yeast Lipomyces Alpha-amylase (pullulanase?) AAC49622.1 kononenkoae 12 Yeast
Alpha-amylase AAO12212.1 13 Bacteria
Alpha-amylase ACM91731.1 14 Bacteria Bacillus subtilis Alpha-amylase CAL64397.1 15 Bacteria Bacillus subtilis Pullulanase AAC00283.1 16 Bacteria Bacillus subtilis Isomaltase? AAG23399.1 17 Bacteria Bacillus subtilis Maltogenic alpha-amylase AAF23874.1 18 Bacteria Bacillus subtilis Isomaltase? BAA23408.1 19 Bacteria Bacillus subtilis Isomaltase? ZP_03592917.1 20 Bacteria Bacillus subtilis Isomaltase? BAA22245.1 21 Bacteria Clostridium Alpha-amylase ABX42302 phytofermentans 22 Bacteria Clostridium Alpha-amylase/pullulanase ABX42665 phytofermentans Type I 23 Bacteria Clostridium Pullulanase ABX42692 phytofermentans 24 Bacteria Clostridium Alpha-amylase ABX42702 phytofermentans 25 Bacteria Clostridium Alpha-amylase ABX42703 phytofermentans 26 Bacteria Clostridium amylo-1,6-glucosidase ABX42704 phytofermentans (debranching) 27 Bacteria Clostridium Alpha-amylase ABX42705 phytofermentans 28 Bacteria Clostridium Alpha-amylase/neopullulanase ABX42711 phytofermentans 29 Bacteria Clostridium Alpha-glucosidase ABX44132 phytofermentans 30 Bacteria Clostridium Alpha-xylosidase ABX40605 phytofermentans 31 Bacteria
Alpha-xylosidase/alpha- ABX42246 glucosidase 32 Bacteria Clostridium Alpha-amylase ABN52030 thermocellum 33 Bacteria Clostridium Glucoamylase ABN53008 thermocellum 34 Bacteria Clostridium Amylo-alpha-1,6-glucosidase ABN51356 thermocellum (debranching) 35 Bacteria Clostridium Amylo-alpha-1,6-glucosidase ACL76625 cellulolyticum (debranching) 36 Bacteria Clostridium Glucoamylase ACL74721 cellulolyticum 37 Bacteria Thermobifida fusca Alpha-amylase AAZ54623 38 Bacteria Thermobifida fusca Alpha-amylase/maltotriose- AAZ55023 producing alpha-amylase 39 Bacteria Thermobifida fusca Alpha-glucosidase AAZ54871 40 Bacteria Thermobifida fusca Glucoamylase? AAZ54084 41 Bacteria Thermobifida fusca Glucoamylase? AAZ55383 42 Bacteria Thermobifida fusca Alpha-glucosidase/Alpha- AAZ55648 xylosidase 43 Bacteria Anaerocellum Alpha-amylase/pullulanase ACM59580 thermophilum Type I 44 Bacteria Anaerocellum Alpha-amylase/pullulanase ACM59734 thermophilum Type I 45 Bacteria Anaerocellum Glucoamylase (GH 15-related) ACM59378 thermophilum 46 Bacteria Anaerocellum alpha-xylosidase ACM61134 thermophilum 47 Bacteria Thermoanaerobacterium Alpha- * saccharolyticum amylase/amylopullulanase 48 Bacteria Thermoanaerobacterium alpha- * saccharolyticum amylase/cyclomaltodextrinase 49 Bacteria
Glucoamylase * 50 Bacteria Thermoanaerobacterium Glucoamylase * saccharolyticum 51 Bacteria Thermoanaerobacterium Amylopullulanase AAA19800 saccharolyticum 52 Bacteria Streptomyces Alpha-amylase/oligo-1,6- BAC69017 avermitilis glucosidase 53 Bacteria Streptomyces alpha-glucosidase BAC69435 avermitilis 54 Bacteria Streptomyces Isoamylase/glycogen BAC69862 avermitilis debranching enzyme 55 Bacteria Streptomyces Isoamylase/glycogen BAC70500 avermitilis debranching enzyme 56 Bacteria Streptomyces alpha-glucosidase BAC73692 avermitilis 57 Bacteria Streptomyces Alpha-amylase BAC73693 avermitilis 58 Bacteria Streptomyces Pullulanase BAC73694 avermitilis 59 Bacteria Streptomyces Amylo-alpha-1,6-glucosidase BAC69169 avermitilis (debranching) 60 Bacteria Streptomyces Amylo-alpha-1,6-glucosidase BAC73363 avermitilis (debranching) 61 Bacteria Streptomyces Amylo-alpha-1,6-glucosidase BAC73364 avermitilis (debranching) 62 Bacteria Streptomyces Glucoamylase (GH 15-related) NP_827612 avermitilis 63 Bacteria Streptomyces Glucoamylase (GH 15-related) NP_827679 avermitilis 64 Bacteria Streptomyces Glucoamylase (GH 15-related) NP_821272 avermitilis 65 Bacteria Streptomyces Glucoamylase (GH 15-related) NP_823108 avermitilis 66 Bacteria Bacillus subtilis ARA1 arabinoxylanase CAB13699.1 67 Bacteria
ARA2 arabinan endo-1,5- CAB15969.1 alpha-L-arabinosidase 68 Bacteria Bacillus subtilis ARA3 arabinan-endo 1,5-alpha- CAA99586.1 L-arabinase 69 Bacteria Bacillus subtilis ARA4 arabinan endo-1,5-alpha- AL009126 L-arabinosidase 70 Bacteria
ARA5 endo-arabinase D85132 71 Bacteria Clostridium ARA6 Arabinogalactan endo- CP000885 phytofermentans 1,4-beta-galactosidase 72 Bacteria
ARA7 arabinan-endo 1,5- AAU40201.1 alpha-L-arabinase 73 Bacteria
ARA8 arabinan-endo 1,5- AAU41895.1 alpha-L-arabinase 74 Bacteria Bacillus ARA9 arabinogalactan endo- AAU43089.1 licheniformis 1,4-beta-galactosidase 75 Bacteria Bacillus ARA10 arabinan endo-1,5- AAU43033.1 licheniformis alpha-L-arabinosidase 76 Bacteria Bacillus ARA11 endo-1,4-beta-xylanase AAU39947.1 licheniformis 77 Bacteria Thermoanaerobacterium ARA12 Arabinogalactan endo- * saccharolyticum 1,4-beta-galactosidase 78 Bacteria Thermoanaerobacterium ARA13 Alpha-N- * saccharolyticum arabinofuranosidase 79 Yeast Arxula adeninivorans Glucoamylase CAA86997.1 80 Bacteria Klebsiella Pullulanase ACI10956.1 pneumoniae 81 Fungi Hormoconis resinae Glucoamylase CAA48243.1 82 Fungi Aureobasidium Glucoamylase ADN65121.1 pullulans * - the gene sequence was obtained from genome sequence sequenced by Mascoma.
(415) TABLE-US-00020 TABLE 17 Activity screening summary for yeast made alpha-amylases (AA), glucoamylases (GA), and alpha-glucosidases (AGL). Amount of pluses reflects relative activity level. NT—not tested. CO—codon optimized. Strains express individual enzymes on 2u vector pMU1575 in M0509 or M0139 background strains. Activity Assay DNS GHK Corn Starch Starch Maltose Mash AE# SE# Source Enzyme AA/GA GA AGL All Strain* 1 Saccharomycopsis fibuligera AA ++ − + M1910 5 Debaryomyces occidentalis AA ++ − + M1911 6 1 Bacillus subtilis AA ++ + + ++ M1912 7 Debaryomyces occidentalis AA ++ − − ++ M1913 11 Lipomyces kononenkoae AA − − − NT 12 Lipomyces kononenkoae AA + + − NT M1914 13 2 Bacillus subtilis AA ++ + − + M1915 15 Bacillus licheniformis AA ++ − − ++ M1916 30 Aspergillus niger AA − − − − 2 10 Saccharomyces cerevisiae GA − − − − 3 Debaryomyces occidentalis GA − + ++ − M1917 8 Saccharomycopsis fibuligera GA +++ +++ +++ +++ M1918 8CO Saccharomycopsis fibuligera GA + + + NT 9 Saccharomycopsis fibuligera GA +++ +++ +++ NT M1919 49 T. sacch GA + ++ ++ +++ M1920 11 Aspergillus niger GA ++ +++ + +++ M1921 11CO Aspergillus niger GA − − − − 12 Aspergillus oryzae GA − − − NT 13 Rhizopus oryzae GA − − − NT 4 Pseudozyma tsukubaensis AGL − − − + M1922 10 Saccharomycopsis fibuligera AGL − − +++ NT M1923 14 Aspergillus riiger AGL − − +++ +++ M1924 *Strains expressing individual enzymes on 2u vector pMU1575 in M0509 or M0139 background strains genes PCRed NT Not tested genes ordered from GeneArt − No Activity genes ordered from DNA 2.0 + Some Activity ++ Good Activity +++ Best Activity
Example 20: Screening of Amylolytic and Accessory Enzymes for Synergy with AE8
(416) Particular combinations of hydrolytic enzymes were selected for the best conversion of particular substrates such as corn mash. This was achieved due to screening of over one hundred enzymes for functional expression in yeast, synergy with each other, and performance in industrially relevant bioprocess conditions. Particular combinations include: AE9; AE9+AE8; AE9+AE1; AE9+AE7; AE9+AE10; AE9+AE8+AE10; AE9+AE7+AE10; AE9+AE7+AE8+AE10; AL1+AE8+AE9+AE10; and all other combinations of AE1, AE7, AE8, AE9, and AL10 (see Tables 16 and 19). Other particular combinations of hydrolytic enzymes that demonstrated high glucose release from substrates such as pretreated corn fiber and corn syrup (concentrated liquid fraction left after corn mash fermentation) include: “core” cellulases, xylanase, xylosidase, glucoamylase (AE9), alpha-amylase (AE7), isopullulanase (SE35), alpha-glucosidase (AE10), acetylxylan esterase (T. reesei AXE), and pectinase.
(417) The enzymes that had the best secreted activity in yeast were combined and screened for the best synergy with each other.
(418) The effect of arabinases and xylanases on glucose release from non pretreated corn fiber in the presence of AE8 was also analyzed (
Example 21: Screening Industrial Strains for High Ethanol Yield and Heterologous Protein Production
(419) In order to choose the industrial host strain for engineering amylases several industrial and Mascoma developed strains were screened for production of ethanol from liquefied corn mash in the presence of standard dose of commercial glucoamylases (data not shown). Two of the best performing strains, M0212 which is a well established high performance ethanologen, and M0139 which is a high performance ethanologen from the distillery industry, were chosen for further evaluation. Since success of the CBP process is dependent on sufficient expression of heterologous genes in an industrial yeast strain, the strains were compared for their ability to express amylases. Three strains were evaluated: two strains selected for high ethanol yield, M0212 and M0139, and M0749—a Mascoma robust strain that does not achieve the ethanol titers of M0212 and M0139 but is known to produce high levels of heterologous proteins (McBride et al., WO 2010/06000056, 2010). The activity levels of three different glucoamylases (AE3, AE8, and AE49) were measured in culture supernatants of the above strains when expressed from a multicopy 2μ pMU1575 plasmid. The results are shown in
Example 22: Engineering of Marker Free Stable Amylolytic Strains in Industrial Background
(420) Two approaches were utilized to engineer strains expressing amylolytic enzymes: random integration and directed integration. In both cases the genes were stably integrated into the genome. When using a radon integration approach, amylolytic genes were integrated into delta sites by selection of a linked auxotrophic marker. Several genes were integrated at the same time in different combinations and transformants were screened on starch containing URA-plates. When the directed integration approach was used, the genes were integrated into designated loci. Both approaches are described in more details below.
(421) Construction of Strains by Random Integration
(422) In order to study the potential of random integration and the starch plate selection approach for strain construction, four integrative constructs with the most active amylolytic enzymes were built (
(423) Construction of Strains by Directed Integration
(424) The directed integration approach creates transgenic strains with integration events that are easier to characterize. Any mistargeting events can be easily identified with a Southern blot. Additionally, strains engineered by directed approach are potentially more stable since each expression cassette at the chromosome is integrated into a unique site (not tested). URA3 and FCY1 negative selection approaches were both developed. FCY1 was eventually chosen as the marker of choice since fcy mutation did not effect robustness of the strains. Using this technology, many clean strains were built in the industrial strain background.
(425)
Example 23: Evaluation of Amylolytic Strains by Corn Mash Fermentation
(426) Several amylolytic CBP strains that demonstrated the highest activity in screening assays were evaluated for their ability to produce ethanol from liquefied corn mash. The strains used for this experiment were built by either directed or random integration and express different combinations of amylases from Saccharomycopsis fibuligera (Tables 18, 19). Background non-amylolytic M0139 strain was used as control. Fermentations were performed in sealed shake flasks on corn mash obtained from Valero bio-refinery at 30% solids (TS) at a fermentation temperature of 32° C. at a shaking speed of 125 rpm. The fermentations were performed using 500 ppm urea as the only nutrient source. Standard dose (0.45 AGU/g TS) of commercial glucoamylase glucoamylase (Spirizyme Ultra, Novozymes) was added to the control strain M0139. All other strains were fermented without any exogenous enzymes added. The ethanol produced after 60 hours of fermentation shown in
(427) TABLE-US-00021 TABLE 18 Description of strains used for fermentation in FIG. 52. The genes AE8, AE9, and AE10 described in Tables 16 and 19. Strain Description M0139 Non-CBP strain with full commercial dose of Glucoamylase (GA) M1973 Directed Integration (DI) of 2AE8, 2AE9 at FCY site M2016 Directed Integration (DI) of 4AE9 at FCY site M2022 DI of MO1973 with 4 copies AE8 and 4 copies AE9 at APT2 site T6-2 Random Integration (RI) of AE9 and AE10 at delta sites
(428) TABLE-US-00022 TABLE 19 Protein and DNA sequences of amylases used to build CBP strains. Seq Seq# Name Gene Source Protein DNA 1 AE1 Gene was obtained MQISKAALLASLAALVY atgcaaatttcaaaagctgctttgcttgcctcatt by PCR with AQPVTLFKRETNADKW ggctgcccttgtttatgctcaaccagtgactctat Saccharomycopsis RSQSIYQIVTDRFARTD tcaaaagagaaactaatgctgataaatggag fibuligera GDTSASCNTEDRLYCG atcacagtctatttatcaaattgtcactgacaga genomic DNA as GSFQGIIKKLDYIKDMG tttgctagaaccgatggtgatacaagtgcttcct template FTAIWISPVVENIPDNTA gtaacacagaagatagactttactgtggtggtt (ATCC#9947) YGYAYHGYWMKNIYKI ctttccaaggcatcataaagaagttggattaca NENFGTADDLKSLAQE tcaaagatatgggctttactgctatttggatttctc LHDRDMLLMVDIVTNH cagttgttgaaaacattcccgataacacagca YGSDGSGDSIDYSEYT tatggttatgcttatcatggttactggatgaaga PFNDQKYFHNYCLISNY acatatacaaaattaatgaaaactttggtactg DDQAQVQSCWEGDSS ctgatgatttgaagtctttggcacaagaattgca VALPDLRTEDSDVASVF cgatcgtgatatgttgttaatggtcgatatcgtta NSWVKDFVGNYSIDGL ccaaccattacggcagtgatggcagtggaga RIDSAKHVDQGFFPDF tagtatcgattactcagagtacaccccgttcaa VSASGVYSVGEVFQGD cgaccaaaagtacttccataactactgtcttatt PAYTCPYQNYIPGVSN tcaaactatgatgaccaagctcaggttcaaag YPLYYPTTRFFKTTDSS ttgctgggaaggtgactcttcagttgcattacca SSELTQMISSVASSCSD gatttgagaacggaagatagcgacgtggcct PTLLTNFVENHDNERFA cagttttcaattcttgggttaaagattttgttggca SMTSDQSLISNAIAFVLL attactcaattgatggtttaagaattgatagtgct GDGIPVIYYGQEQGLS aaacatgtggaccaaggctttttcccggattttg GKSDPNNREALWLSGY ttagtgcatctggagtttactcagtaggcgaagt NKESDYYKLIAKANAAR tttccaaggagacccagcttatacatgcccata NAAVYQDSSYATSQLS ccaaaattacattccaggggttagtaattatcc VIFSNDHVIATKRGSVV attgtactacccaaccacgagattttttaaaact SVFNNLGSSGSSDVTIS actgattcaagttccagtgagttgactcaaatg NTGYSSGEDLVEVLTC atttcaagcgttgcttccagttgttcggatccaa STVSGSSDLQVSIQGG ctttgttgacaaactttgtagaaaatcacgataa QPQIFVPAKYASDICS tgaaaggttcgcttcaatgaccagcgaccaa agtttgatttctaatgctattgcatttgtccttttggg tgatggtattcctgtcatttactatggacaagaa caaggcttgagcggaaaaagtgacccaaac aacagagaggccttgtggttatccggctacaa caaagagagtgactattacaagctcattgcca aagctaatgctgccagaaacgccgccgtttat caagactcaagctatgccacctcgcagctttct gtgatcttttcaaatgaccatgttattgcaacaa aaagaggcagcgttgtttctgttttcaacaacct tggttccagcggttcttctgatgtgactatttcca acacaggttacagttccggtgaggatttggtag aagttttgacatgcagtactgttagcggcagct ctgacttacaagtttctatccaaggtggtcaac cacaaatctttgttcctgctaaatatgcttctgac atttgttca 2 AE7 Gene was obtained MKFATILSTTALALSSLV atgaaatttgcaactatcttaagtacaactgctc by PCR with ASKPIFLSKRDAGSSAA ttgcgctatcaagtttggttgcatccaagccaat Debaryomyces AAWRSESIYQLVTDRF tttcttaagcaaaagggatgctggcagctctgc occidentalis ARTDGSTSATCNTGDR tgctgcagcttggcgttctgaatctatctatcaa genomic VYCGGTFQGIIDKLDYI cttgttaccgatagatttgccagaactgacgga DNA as template QGMGFTAIWISPVVEQI tcgacttcagctacttgtaatactggagataga (ATCC#26077) PDDTGYGYAYHGYWM gtatactgtgggggtactttccaaggtattattg KDIYAINSNFGTADDLK acaaattggattacatccaaggtatgggtttca NLSNELHKRNMKLMVD ctgctatttggatttctccagttgttgaacaaattc IVTNHYAWNGAGSSVA ctgatgatactggttatggttatgcttaccacgg YSNYNPFNQQSYFHDY ctattggatgaaagatatttacgctataaattca CLITNYDDQTNVEDCW aattttggtactgccgatgacttgaagaatctttc EGDNTVSLPDLRTEDS aaatgaattgcataagagaaatatgaagctta DVSSIFNLWVAELVSNY tggttgatattgttactaaccattatgcttggaat SIDGLRIDSAKHVDESF ggtgccggtagcagtgttgcttactccaactac YPSFQSAAGVYLLGEV aatccattcaaccaacaatcctacttccacgat YDGDPAYTCPYQNYMS tattgtttaattacaaattacgatgatcaaacca GVTNYPLYYPMLRFFQ atgttgaagattgctgggaaggcgataatact GTSNSVDELNAMISSLE gttagtttaccagatcttcgtactgaggattcag SDCKDITLLGNFIENHD atgttagctctattttcaatctgtgggttgctgagtt QPRLPSYTSDSALIKNAI agtttctaattactcaattgatggtttaaggattg AFNLMSDGIPIIYYGQE acagtgctaagcatgttgatgaatcattctacc QGYSGSSDPNNREAL catcattccaaagtgctgcaggtgtctatcttctt WLSGYSTSNGYYKLISS ggagaagtttatgacggtgatccagcttacact VNQIRNQAIYKDSKYTT tgcccataccaaaactatatgtcaggggttact YWSDVLYASGHVIALQ aactatcctttgtactatccaatgttaagattcttt RGADDQRIVSVFNNLG caaggtacttctaactctgtcgatgaattaaatg SSGSQTVTFSTKYSGG ctatgatttcaagtttagaaagtgattgtaagga EKVVDVLTCQTSYANS tattactttattgggtaatttcattgaaaaccatg DSTLTVSISGGAPRIYA atcaaccaagattaccatcttatacttctgatag PASLIANSGICNF tgccttaatcaaaaatgcaattgcgtttaatttaa tgtcagatggtattccaattatttactacggtcaa gaacaaggttacagtggtagctccgatccaa acaacagagaagcattatggttatctggttaca gcactagtaatggttactacaaacttatctcttc agttaatcaaattagaaaccaagccatttataa ggatagcaaatacactacttattggagtgatgt gttatacgcttcaggtcatgttattgctcttcaaa gaggtgcagacgaccaaagaattgtttctgtct ttaacaatttaggctcaagcggatctcaaactg taacattcagtactaaatacagcggtggagaa aaagtcgttgacgttttaacttgtcaaacttcata cgccaactcggatagtactttaactgtctctatt agtggtggcgctccaagaatttatgctcctgctt ctcttattgcaaattctggaatttgcaacttc 3 AE8 Gene was obtained MRFGVLISVFAAIVSALP atgagattcggtgttttaatctccgtctttgctgct by PCR with LQEGPLNKRAYPSFEA attgttagtgctttacctttgcaagaaggtcctttg Saccharomycopsis YSNYKVDRTDLETFLDK aacaaaagagcctatccttcttttgaagcttatt fibuLigera QKEVSLYYLLQNIAYPE caaactataaagttgacagaactgacttggaa genomic DNA as GQFNNGVPGTVIASPS accttcttggacaaacaaaaagaagtatcttta tern plate TSNPDYYYQWTRDSAI tactatcttttacaaaacattgcttatcctgaagg (ATCC#9947) TFLTVLSELEDNNFNTT ccaatttaataatggtgttcctggtactgttattgc LAKAVEYYINTSYNLQR ttctccatcaacctctaatccggactactattac TSNPSGSFDDENHKGL caatggaccagagattccgcaattacatttttg GEPKFNTDGSAYTGAW acagttctttctgaactagaagataataacttca GRPQNDGPALRAYAIS ataccactttggccaaggcagttgagtactac RYLNDVNSLNEGKLVLT attaacaccagttacaaccttcaaagaacca DSGGINFSSTEDIYKNII gtaacccaagtggcagctttgatgatgaaaat KPDLEYVIGYWDSTGF cataaaggcttgggagaaccaaaatttaaca DLWEENQGRHFFTSLV cagatggttctgcatacaccggagcttggggg QQKALAYAVDIAKSFDD agaccgcaaaatgatggtcctgctttgagagc GDFANTLSSTASTLESY ttatgctatcagtagatacttgaatgatgtcaatt LSGSDGGFVNTDVNHI ctttaaatgaaggtaaattagtattgactgattc VENPDLLQQNSRQGLD aggtggtatcaacttttcttcaactgaagatattt SATYIGPLLTHDIGESSS acaaaaatatcatcaaaccagacttggaatat TPFDVDNEYVLQSYYLL gttatagggtactgggattctactgggtttgatct LEDNKDRYFVNSAYSA ttgggaggaaaaccaaggcagacactttttta GAAIGRYPEDVYNGDG caagcttggttcaacagaaagcccttgcttatg SSEGNPWFLATAYAAQ ctgtcgatattgccaaaagttttgacgacggcg VPYKLAYDAKSASNDITI actttgcgaacacactttcttcgactgcttctacc NKINYDFFNKYIVDLSTI ctcgaaagttatttgagtggcagtgatggtgga NSAYQSSDSVTIKSGS tttgttaatactgatgttaaccacattgttgaaaa DEFNTVADNLVTFGDS cccagatttgcttcaacaaaactctagacaag FLQVILDHINDDGSLNE gtctagattcagccacatatattggcccactttt QLNRYTGYSTGAYSLT gactcatgatattggtgaaagcagctcaactc WSSGALLEAIRLRNKVK catttgatgttgacaatgagtatgttttgcaatca ALA tattacttgttattggaggataacaaagacaga tactttgttaacagtgcttattctgctggtgcagct attggcagatacccagaagatgtttacaatggt gatggttcatctgaaggcaatccatggttcttag ctactgcctatgctgcccaagttccatacaaac ttgcttatgatgcaaagtcggcctcaaatgaca ttaccattaacaagattaactacgatttttttaac aagtatattgttgatttatctaccatcaattctgctt accagtcttctgatagtgtcaccattaaaagtg gctctgatgaatttaacacggttgctgataatttg gtcacattcggtgattcctttttgcaagtcattttg gatcatattaatgatgatggctccttgaatgaac aacttaacagatataccggttattccaccggtg cctactctttgacatggagcagtggtgctcttctt gaagctattagacttagaaataaggtcaagg ctttggcttaa 4 AE9 Gene was codon MIRLTVFLTAVFAAVAS atgatcagattgaccgttttcttgaccgctgttttt optimized for CVPVELDKRNTGHFQA gctgctgttgcttcttgtgttccagttgaattggat S.cerevisiae and YSGYTVARSNFTQWIH aagagaaacaccggtcatttccaagcttattct synthetized by EQPAVSWYYLLQNIDY ggttataccgttgctagatctaacttcacccaat GeneArt PEGQFKSAKPGVVVAS ggattcatgaacaaccagctgtttcttggtacta (PubMed#CAC83969.1) PSTSEPDYFYQWTRDT cttgttgcaaaacatcgattacccagaaggtc AITFLSLIAEVEDHSFSN aattcaaatctgctaaaccaggtgttgttgttgct TTLAKVVEYYISNTYTL tctccatctacatctgaaccagattacttctacc QRVSNPSGNFDSPNHD aatggactagagataccgctattaccttcttgtc GLGEPKFNVDDTAYTA cttgattgctgaagttgaagatcattctttctcca SWGRPQNDGPALRAY acactaccttggctaaggttgtcgaatattacat AISRYLNAVAKHNNGKL ttccaacacctacaccttgcaaagagtttctaat LLAGQNGIPYSSASDIY ccatccggtaacttcgattctccaaatcatgatg WKIIKPDLQHVSTHWST gtttgggtgaacctaagttcaacgttgatgatac SGFDLWEENQGTHFFT tgcttatacagcttcttggggtagaccacaaaa ALVQLKALSYGIPLSKT tgatggtccagctttgagagcttacgctatttcta YNDPGFTSWLEKQKDA gatacttgaacgctgttgctaagcacaacaac LNSYINSSGFVNSGKKH ggtaaattattattggccggtcaaaacggtattc IVESPQLSSRGGLDSAT cttattcttctgcttccgatatctactggaagatta YIAALITHDIGDDDTYTP ttaagccagacttgcaacatgtttctactcattg FNVDNSYVLNSLYYLLV gtctacctctggttttgatttgtgggaagaaaatc DNKNRYKINGNYKAGA aaggtactcatttcttcaccgctttggttcaattg AVGRYPEDVYNGVGTS aaggctttgtcttacggtattccattgtctaagac EGNPWQLATAYAGQTF ctacaatgatccaggtttcacttcttggttggaa YTLAYNSLKNKKNLVIE aaacaaaaggatgccttgaactcctacattaa KLNYDLYNSFIADLSKID ctcttccggtttcgttaactctggtaaaaagcac SSYASKDSLTLTYGSD atcgttgaatctccacaattgtcatctagaggtg NYKNVIKSLLQFGDSFL gtttggattctgctacttatattgctgccttgatca KVLLDHIDDNGQLTEEI cccatgatatcggtgatgatgatacttacaccc NRYTGFQAGAVSLTWS cattcaatgttgataactcctacgttttgaactcc SGSLLSANRARNKLIEL ttgtattacctattggtcgacaacaagaacaga L tacaagatcaacggtaactacaaagctggtg ctgctgttggtagatatcctgaagatgtttacaa cggtgttggtacttctgaaggtaatccatggca attggctactgcttatgctggtcaaactttttaca ccttggcctacaattccttgaagaacaagaag aacttggtcatcgaaaagttgaactacgacttg tacaactccttcattgctgatttgtccaagattga ttcttcctacgcttctaaggattctttgactttgacc tacggttccgataactacaagaacgttatcaa gtccttgttgcaattcggtgactcattcttgaagg ttttgttggatcacatcgatgacaacggtcaatt gactgaagaaatcaacagatacaccggttttc aagctggtgcagtttctttgacttggtcatctggtt ctttgttgtctgctaatagagccagaaacaagtt gatcgaattattg 5 AE10 Gene was codon MIWLKLSLYSLAFALFA atgatctggttgaagttgtccttgtactctttggctt optimized for DAAPVSSGEEAETSSS ttgctttgtttgctgatgctgctccagtttcttctggt S.cerevisiae and TSSSAPAQITVDNELTL gaagaagctgaaacttctagctctacttcttcat synthetized by GVSQVPNIVNKTAIDAN ctgctccagctcaaattaccgttgataacgaat GeneArt EAAKGYDLVNVTTTAK tgaccttgggtgtttctcaagttccaaacatcgtt (PubMed#CAF31354.1) GLTGILKLNEATNIYGY aacaagaccgctattgatgctaatgaagctgc DFDYLNLSVEYQSDDR taaaggttacgatttggttaacgttactactactg LNVHIEPVDTDNVFILPE ctaagggtttgaccggtattttgaagttgaatga SLVAKPSADDGDKIESF agccactaacatctacggttacgatttcgatta HFGGSSDLVFEYSSKN cttgaacttgtccgtcgaataccaatccgatga FGFEILRKSTGKSIFSTI tagattgaacgttcacatcgaaccagttgatac GNPLVFSNQFIQFNTSL cgataacgttttcattttgccagaatccttggttg PKDHFITGLGESIHGFR ctaaaccatctgctgatgatggtgataagatcg NEPGIVKTLYANDIANPI aatcttttcatttcggtggttcctccgatttggttttt DGNIYGVHPFYIDQRFD gaatactcttccaagaacttcggtttcgaaatct TNATHGVYWRTSAIQE tgagaaagtctaccggtaagtctattttctccac VAVGNESLTWRALSGI tattggtaacccattggttttctccaatcaattcat VDLYFFSGPKPKDVIQQ ccaattcaacacatccttgccaaaggatcattt YVKEVGLPTFQPYWAL cattactggtttgggtgaatccatccatggtttta GYHQCRWGYDTIEELD gaaatgaaccaggtatcgtcaaaaccttgtac EVVENFKNFDIPLETIW gctaatgatattgccaacccaatcgatggtaat SDIDYMDSYKDFTNDP atctatggtgttcacccattctacatcgatcaaa HRYPLEKYQQFLDKLH gatttgataccaacgctacccatggtgtttattg ENNQHYVPIIDAAIYVPN gagaacttctgccattcaagaagttgctgttggt PENATDNDYDVFHYGN aacgaatccttgacttggagagctttgtctggta ETDVFLKNPDGSLYIGA tagttgacttgtactttttctccggtccaaaacct VWPGYTVFPDFLSENI aaggatgtcattcaacaatacgtcaaagaagt QKYWTKVFKDWYQQIK tggtttgccaacttttcaaccatattgggctttgg FDGIWLDMNEVSSFCV gttaccatcaatgtagatggggttacgatacca GSCGSGKITDNPVHPP tcgaagaattggatgaagtcgtcgaaaacttc FAVGGEATEFPEGFNK aagaacttcgatattccattggaaaccatctgg TNGTEYASFTSSLAAAS tccgatatcgattacatggattcctacaaggatt PTSDEDSSASSTSASID tcaccaacgatccacatagatacccattggaa SLNTLAPGKGNINYPPY aagtaccaacaattcttggacaagttgcacga AINNDQGDHDLATHAV aaacaatcaacactacgttccaattattgatgc SPNATHQDGTLEYDVH cgctatctacgttccaaatccagaaaatgctac NLYGYLETNATFEALLEI cgataacgattacgatgttttccattacggtaac QPNKRPFIISRSSFAGS gaaaccgacgtttttttgaagaatccagatggtt GRQTGHWGGDNYSQF ccttgtacattggtgctgtttggccaggttatact RSAYFSIAQAFSFGLSG gtttttccagatttcttgtccgaaaacatccaaa IPFFGADVCGFNGNSD agtactggaccaaggttttcaaggactggtatc YELCSRWMQLGSFFPF aacaaatcaagttcgatggtatctggttggata YRNHNILGAISQEPYVW tgaacgaagtttcttctttctgtgttggttcttgtggt ESVTEATKTSMQIRYLL tctggtaagattactgataacccagttcatcca LPYYYTLLHEAHITGIPIL ccatttgctgttggtggtgaagctactgaatttcc RAFAWQFPENKNVSTV agaaggtttcaacaagaccaacggtactgaa DTQFFVGDALVVTPALE tacgcttctttcacttcttctttggctgctgcttctcc QGVDTVKGTFPGSGNE aacttctgatgaagattcttctgcttcttctacctct EVYYDWYTHEKQNFTD gcttctattgattctttgaacactttggctccaggt GKNETLQAPLGHIPLHI aagggtaatattaactatccaccatacgccat RGGHILPTQEPAYTTTE caacaacgatcaaggtgatcatgatttggcta SRQNPWGLIVALDKDG ctcatgctgtttctccaaatgctactcatcaagat KAEGKLYSDDGESYEV ggtactttggaatacgatgtccataacttgtacg EESLFVNFIASDNTLLST gttacttggaaactaacgctactttcgaagcctt SYGEYEVEQPLANITIL gttggaaatccaacctaacaaaagaccattc GVENKPKEVKFDDSKV atcatctccagatcttcatttgctggttctggtag DFTFENNTIFVTGLDDQ acaaactggtcattggggtggtgataattactct TEDGAFAKHFKLSW caattcagatctgcctacttctctattgctcaagc tttttctttcggtttgtccggtattccattttttggtgct gatgtttgtggtttcaacggtaattccgattacga attgtgttccagatggatgcaattgggttcattttt cccattctacagaaaccacaacattttgggtgc catttctcaagaaccatacgtttgggaatctgtt actgaagctactaagacctccatgcaaatca gatatttgttgttgccttactactacaccttgttgc atgaagctcatattaccggtatcccaattttgag agcttttgcttggcaattcccagaaaacaaga acgtttctaccgttgatacccaattctttgttggtg atgctttggttgttactccagctttggaacaaggt gttgatactgttaagggtacttttccaggttctggt aacgaagaagtttactacgattggtacaccca cgaaaagcaaaatttcactgacggtaagaac gaaacattgcaagctccattgggtcatattcca ttgcatattagaggtggtcatatcttgccaactc aagaaccagcttacactactactgaatctaga caaaatccatggggtttgatagttgccttggata aggatggtaaagccgaaggtaaattatactcc gatgatggtgaatcctacgaagttgaagaatc cttgttcgttaacttcattgcttccgataatacctt gttgtctacctcttacggtgaatatgaagtcgaa caaccattggccaacattactattttgggtgttg aaaacaagccaaaagaagttaagttcgacg attccaaggttgatttcaccttcgaaaacaaca ccattttcgttaccggtttggatgatcaaactga agatggtgcttttgctaagcactttaagttgtcttg g
Example 24: Evaluation of CBP Strains Performance on Raw Corn Mash
(429) The performance of selected CBP strains was also evaluated by fermentation of non-liquefied corn starch (
Example 25: Improving Strain Performance by Evolution
(430) Yeast is known for its ability of adjustment to very broad range of conditions. This property could be used to increase yeast ethanol and high temperature resistance and improve performance (ethanol yield) at certain relevant conditions such as during fermentation of corn mash. To explore this possibility as a tool to develop better CBP yeast strains that are able to reach higher ethanol yield, one of the best CBP strains M1973 was evolved by using serial transfer in corn mash. Serial transfer fermentations were carried out using shake flasks containing 35% TS liquefied corn mash with industrial medium grown at 35° C. and 150 rpm. At 3 days intervals, 10 ml were transferred to fresh medium of the same composition (5 transfers). At each transfer starting with the second the temperature was raised 1 degree. At the last transfer it was 38° C. After 5 transfers (˜500 hours), the cell were plated on YPD plates for evaluation. The evolved strain was evaluated by fermentation on liquefied corn mash at two different temperatures (32° C. and 35° C.) and two different concentrations of solids (30% and 35%). Original M1973 strain from the freezer stock was used as control (
Example 26: Process Flow Sheet with CBP Strains
(431) The example of CBP process in presented on
Example 27: Screening and Characterization of Industrial Yeast Strains
(432) The objective of this study was finding an industrial host that will combine high temperature/ethanol tolerance and high heterologous protein secretion. Several industrial yeast strains were obtained from various commercial sources (Table 20). In order to better understand the strains' relations with each other, all strains were genotyped as described by Ness et al., 1993 (
(433) The industrial strains were compared for their ability to grow at high temperature (
(434) In order to compare ability of industrial strains to express heterologous proteins, the host strains from Table 20 were transformed with the same expression construct of AE9—Saccharomycopsis fibuligera glucoamylase gene (Accession No. CAC83969.1). Four copies of AE9 were directly integrated into FCY locus. FCY was used as negative marker. The construct used was similar to the one used for M2016 construction (Example 23). The map of the expression construct used in this experiment shown on
(435) Transformants for each host that were the most active on starch (Table 22) were tested in shake flask fermentation on raw corn flour and conventional corn mash together with non-transformed hosts (
(436) TABLE-US-00023 TABLE 20 Industrial ethanologen strains used in the study. Strain Mascoma# name Producer Reference M139 N96 Anchor wine www.anchorwineyeast.com/ yeast pdf/N_96.pdf M212 Ethanol LaSaffre www.lesaffreyeastcorp.com/ Red (old) home/ M2390 Ethanol LaSaffre www.pahc.com/Phibro/Performance- Red (new) Products/Catalog/23/Ethanol-Red.html M2394 FALI ABMauri www.alcoholyeast.com/downloads/doc1.pdf M2393 Premier LaSaffre mountainhomebrew.com/ Cuvee premiercuvee-5grampackage.aspx M2392 Lalvin ICV- Lallemand www.lalvinyeast.com/images/library/ K1 ICV-K1_Yeast.pdf M2391 Lalvin EC- Lallemand store.homebrewheaven.com/lalvin- 1118 ec-1118-champagne-wine-yeast-p1076.aspx M2507 NABC Bio- North www.na-bio.com/index.php?option= Ferm XR America com_content&view=article&id=74&Itemid=263 Bioproducts
(437) TABLE-US-00024 TABLE 21 Summary of industrial strains screening. The summary is based on the data shown on FIGS. 56 and 58. EtOH 41C on Main Genotyping growth flour Mascoma# application pattern rate g/l M0139 Wine M139 like 0.03 132 M0212 Ethanol M212 like 0.21 141 M2390 Ethanol M212 like 0.16 143 M2394 Ethanol M212 like 0.17 143 M2393 Wine M139 like 0.03 132 M2392 Wine New 0.08 124 M2391 Wine M139 like 0.18 146 M2507 Ethanol M212 like 0.35 147
(438) TABLE-US-00025 TABLE 22 Industrial strains transformed with 4 copies of Saccharomycopsis fibuligera glucoamylase gene (NCBI#CAC83969.1) and their most active on starch transformants selected by starch assay (FIG. 59). Strain M2111 was made the same way as M2016, only more colonies (84) were screened by starch assay. Several the most active colonies were screened by industrial corn mash fermentation and the best performing strain was named M2111. Host strain Transformant M139 M2400, M2111 M212 M2399 M2390 M2395 M2394 M2398 M2393 M2397 M2391 M2396
Example 28: Increasing Heterologous GA Production by High Ethanol/Temperature Tolerant Yeast Strain
(439) The objective of this study was engineering ethanol/temperature tolerant industrial yeast strain expressing high level of heterologous glucoamylase. The strain M2111 was made the same way as M2016 (Example 23), only more colonies (84) were screened by starch assay. Even though it was demonstrated that ethanologen M2390 host has much higher ethanol/temperature tolerance compared to wine strain M0139 and performs significantly better at high solids or high temp conditions when supplemented with high dose of exogenous enzyme (Example 28), M2111 transformant derived from M0139 (Table 22) has much higher AE9 secretion level compared to M2395 derived from robust M2390 (
(440) Seventeen of the most active transformants were screened for CBP performance by minivial fermentation assay with corn flour and homemade mash (
(441) Time course fermentation of conventional mash (
Example 28: Increasing Heterologous GA Production Effects Exogenous Enzyme Dose Reduction
(442)
Example 29: Stability of Glucoamylase Expression
(443) Stability of GA expression was tested for several M2390+AE9 strains. Data for strains M2519 and M2691 are shown in
Example 30: Screening Saccharolytic Genes for Functional Expression in Yeast
(444) Multiple genes encoding for saccharolytic enzymes were screened for functional expression in yeast (Table 23). The genes were either synthesized by GeneArt (now Life Technologies) or isolated by PCR from genomic DNA. Some genes were expressed with native signal sequences and in others native signal sequence was replaced by S. cerevisiae invertase signal sequence. Some synthetic genes were codon optimized for expression in S. cerevisiae (by GeneArt) and others were synthesized with native DNA sequence. All genes were expressed under ENO1 promoter and terminator from 2-micron plasmid pMU1575. The genes were inserted between PacI/AscI sites of pMU1575 either by cloning or yeast mediated ligation. Expression contracts were transformed into an industrial background Mascoma strain M1744 and selected on minimal URA deficient media. Transformants were grown in YPD for 3 days and supernatants were analyzed for activity on starch, pullulan, xylan, pNPX (xylosidase activity), maltose and pectin (
(445) TABLE-US-00026 TABLE 23 Genes analyzed for functional expression in yeast. For most genes protein sequence was obtained from NCBI database. For genes marked with “* “DNA gene sequence was obtained from Mascoma Thermoanaerobacterium saccharolyticum genome sequence data. Signal Codon ID Organism Source Enzyme NCBI# Gene sequence optimization SE12 Fungi Aspergillus oryzae Glucoamylase BAA01540.1 Synthetic Native None SE13 Fungi Rhizopus oryzae Glucoamylase BAA00033.1 Synthetic Native None SE28 Fungi Aspergillus niger Xylosidase CAK39870.1 Synthetic Native None Arabinofuranosidase SE32 Fungi Xylanase AAS46914.1 Synthetic Native None SE33 Fungi
Xylanase AAS46913.1 Synthetic Native None SE34 Fungi
Xylanase CAA03655.1 Synthetic Native None SE35 Fungi
Isopullulanase BAA19473.1 Synthetic Native None SE37 Fungi Aspergillus niger Endopolygalacturonase XP 001389562.1 Synthetic S.c. Invertase S.cerevisia SE38 Fungi Aspergillus niger Endopolygalacturonase CAK42510.1 Synthetic S.c. Invertase S.cerevisia SE41 Plant
Pullulanase NP 001104920.1 Synthetic S.c. Invertase
SE42 Plant Oryza sativa Pullulanase ACY56113.1 Synthetic S.c. Invertase S.cerevisia SE43 Plant Zea mays Isoamylase ACG43008.1 Synthetic S.c. Invertase S.cerevisia SE47 Fungi
Xylanase CAA53632.1 Synthetic Native None SE48 Fungi
Xylanase CAD34597.1 Synthetic Native None SE49 Fungi Trichoderma viride Xylanase AAQ67413.1 Synthetic Native None SE50 Plant Triticum aestivum Pullulanase ABL84490.1 Synthetic S.c. Invertase S.cerevisia SE51 Yeast Saccharomyces Endopolygalacturonase NP 012687.1 Native Native cerevisiae SE52 Yeast Kluyveromyces Endopolygalacturonase AAR84199.1 Native Native marxianus SE53 Bacteria Bacillus subtilis Pectin lyase NP 389746.1 Native S.c. Invertase SE54 Bacteria Bacillus licheniformis Polygalacturonase YP 080606.1 Native S.c. Invertase SE55 Bacteria Bacillus licheniformis Pectin lyase YP 079258.1 Native S.c. Invertase SE56 Fungi Aspergillus niger Endopolygalacturonase CAB72125.1 Synthetic S.c. Invertase S.cerevisia SE57 Fungi Aspergillus niger Endopolygalacturonase CAB72126.1 Synthetic S.c. Invertase S.cerevisia SE58 Fungi Aspergillus niger Endopolygalacturonase XP 001390812.1 Synthetic S.c. Invertase S.cerevisia SE59 Fungi Aspergillus niger Endopolygalacturonase CAB72931.1 Synthetic S.c. Invertase S.cerevisia SE60 Fungi Aspergillus niger Endopolygalacturonase CAK44164.1 Synthetic S.c. Invertase S.cerevisia SE61 Fungi
Pectin lyase CAK48529.1 Synthetic S.c. Invertase
SE62 Fungi
Pectin lyase CAK37997.1 Synthetic S.c. Invertase
SE63 Fungi Aspergillus niger Pectin lyase AAW03313.1 Synthetic S.c. Invertase S.cerevisia SE64 Fungi
Pectin lyase CAK47350.1 Synthetic S.c. Invertase
SE65 Fungi Aspergillus niger Pectin lyase ACE00421.1 Synthetic S.c. Invertase S.cerevisia AE11 Yeast Lipomyces Alpha-amylase AAC49622.1 Synthetic Native None kononenkoae AE79 Yeast Arxula adeninivorans Glucoamylase CAA86997.1 Synthetic Native None AE81 Fungi Hormoconis resinae Glucoamylase CAA48243.1 Synthetic Native None AE82 Fungi
Glucoamylase ADN65121.1 Synthetic S.c. Invertase S.cerevisia AE83 Bacteria Thermoanaerobacterium Polygalacturonase Contig1 Gene Native S.c. Invertase saccharolyticum or0164* AE84 Bacteria Thermoanaerobacterium Polygalacturonase Contig1 Gene Native S.c. Invertase saccharolyticum or0344*
Example 31: Identifying Enzymes and their Combinations that Increase Sugars Release from Industrial Corn Substrates
(446) Distiller corn syrup, which is a soluble fraction left from processing corn to ethanol, was one of the substrates used to identify enzymes that will allow releasing more sugars from corn mash. Corn syrup contains soluble oligosaccharides that are left undigested in corn mash hydrolysis/fermentation process. Several yeast-made enzymes were tested for conversion of corn syrup. Several enzymes: CBH1, CBH2, EG2, BGL, XYL, and XLD were purified by ion exchange and hydrophobic interaction chromatography on the FPLC from yeast supernatants (Table 24). For others yeast strains expressing enzymes were grown for 3 days in YPD and supernatants were used as enzyme source. Table 24 summarizes the information on enzymes used in this experiment. Supernatants of two enzymes were mixed in equal ratio by volume. Supernatants of single enzymes were mixed with supernatant of empty strain control M0139.
(447) Based on this data, several genes were selected that have a potential to improve AE9 glucoamylase expressing strain M2111 due to increased sugar release from corn mash or corn flour. The selected genes are listed in Table 26. Other candidates in Table 26 were chosen based on a rational approach based on which enzymes may have effect on sugar release based on substrate structure (Saulnier et al., Carbohydrate Polymers, 26: 279-287, 1995). All genes selected demonstrated functional expression in yeast.
(448) TABLE-US-00027 TABLE 24 Enzymes used in corn syrup assay (FIG. 24). All enzymes except AE9 were expressed on 2u plasmid under S. cerevisiae ENO1 promoter and terminator from 2-micron plasmid pMU1575. AE9 in M2111 was expressed from 4 gene copies integrated into chromosome (the same as in M2016). The genes were codon optimized for S. cerevisiae and synthesized by GeneArt. Yeast and fungal genes were expressed with native signal sequences. Bacterial gene was attached to S. cerevisiae Invertase signal sequence. ID Strain Source Enzyme Reference Enzyme prep CBH1 Talaromyces cellobiohydrolase I WO/2010/060056 HPLC purified emersonii Trichoderma reesei CBH2 Chrysosporium cellobiohydrolase II WO/2010/060056 HPLC purified lucknowense EG2 Trichoderma reesei endoglucanase II WO/2010/060056 HPLC purified BGL Saccharomycopsis beta-glucosidase WO/2010/060056 HPLC purified fibuligera XYL Clostridium Xylanase (BC60) NCBI# HPLC purified phytofermentans YP_001558623.1 XLD Pyrenophora tritici- beta-xylosidase NCBI# HPLC purified repentis XM_001940921.1 NC M139 None none none Supernatant AE9 M2111 Saccharomycopsis Glucoamylase (AE9) NCBI# Supernatant fibuligera CAC83969.1 ABF M1511 Aspergillus niger arabinofuranosidase NCBI# AAA93264 Supernatant AXE M1782 Trichoderma reesei acetylxylanesterase NCBI# Q99034 Supernatant FAE M1475 Aspergillus niger feruoyl esterase NCBI# Supernatant XP_001393337 ARA M2069 Bacillus arabinase NCBI# Supernatant licheniformis AAU41895.1 AE10 M1923 Saccharomycopsis alpha-glucosidase NCBI# Supernatant fibuligera CAF31354.1 SE35 M2614 Aspergillus niger isopullulanase NCBI# Supernatant BAA19473.1
(449) TABLE-US-00028 TABLE 25 Amounts of purified enzymes used in corn syrup assay experiment (FIG. 72) in mg of enzyme per g of total solids. Load Protein mg/g CBH1 1.6 CBH2 1.6 EG2 0.6 BGL 0.2 XYL 0.4 XLD 0.2
(450) TABLE-US-00029 TABLE 26 Enzymes selected to be expressed in M2111 strain alone or in combinations. SBD - starch binding domain. Gene ID Source Enzyme AE1 Saccharomycopsis fibuligera alpha-amylase AE3 Debaryomyces occidentalis alpha-glucosidase AE5 Debaryomyces occidentalis alpha-amylase AE7 Debaryomyces occidentalis alpha-amylase AE8 Saccharomycopsis fibuligera glucoamylase AE8 + SBD Saccharomycopsis fibuligera S.f.glucoamylase + SBD of Aspergillus niger A.n.glucoamylase (SE11) AE9 Saccharomycopsis fibuligera glucoamylase AE10 Saccharomycopsis fibuligera alpha-glucosidase AE22 Clostridium phytofermentans pullulanase AE73 (ARA) Bacillus licheniformis arabinase SE20 Aspergillus niger beta-glucosidase SE32 Aspergillus niger xylanase SE33 Aspergillus niger xylanase SE34 Aspergillus niger xylanase SE35 Aspergillus niger isopullulanase SE39 (ABF) Aspergillus niger arabinofuranosidase SE47 Humicola insolens xylanase SE48 Talaromyces emersonii xylanase SE66 (AXE) Trichoderma reseei acetyl xylan esterase SE67 (FAE) Aspergillus niger feruoyl esterase BC60 (XYL) Clostridium phytofermentans xylanase FAE2 Talaromyces stipitatus feruoyl esterase
Example 32: Construction and Screening of Improved Amylolytic Strains
(451) To make a transformation host for additional AE9 saccharolytic enzymes expression, URA3 was knocked out of M2111 and the resulting M2125 strain was used as a host for transformations. For each enzyme from Table 26 integrative expression cassette was built targeting delta sites on chromosome. URA3 gene was used as autotrophic selection marker. Each gene of interest under control of S. cerevisiae strong constitutive promoter and terminator was inserted between URA3 and Delta2 fragments of pMU2382 vector digested with BamHI and EcoRI (
(452) Transformers that released the most sugars in corn flour assay (highlighted in
(453) Remaking the M2111 strain was attempted in order to increase AE9 production. It was noticed that there is a significant activity variation between transformants even when obtained with directed integration. Therefore, screening more transformants usually yields strains with higher expression level. Only 84 transformants were screened when M2111 was selected. In order to increase AE9 expression level, M139 was transformed with the same AE9 expression construct as was used for making the M2111 strain. The expression construct was integrated into FCY locus and FCY was used as negative selection. About 1000 transformants were screened for starch activity. Several transformants demonstrated activity higher than M2111. Several of the most active on starch transformants were screened by minivials fermentation assay on homemade mash and raw corn flour. Some transformants had higher EtOH yield compared to M2111, on raw corn flour. In the follow up experiment, several best strains were screened in shake flask fermentation on the same two substrates (
(454) The best performing strains that came out of screening on homemade mash and raw corn flour were also tested on industrial corn mash (
(455) TABLE-US-00030 TABLE 27 Transformations ID (T) for corn flour activity assay data from FIG. 74. S. cerevisiae promoter used with each gene shown in parentheses. Transformation# Genes transformed 1 AE8 (TEF2p) 2 AE9 (ADH1p) 3 AE10 (FBA1p) 4 AE7 (ENO1p) 5 AE1 (ADH1p) 6 AE1 (TEF2p) 7 AE8 + SBD (ENO1p) 8 BC60 (ADH1p) 9 ARA (ENO1p) 10 BC60 (ADH1p) + ABF (ENO1p) 11 BC60 (ADH1p) + AXE (ENO1p) 12 BC60 (ADH1p) + FAE1 (PFK2p) 13 BC60 (ADH1p) + FAE2 (PYK1p) 14 BC60 (ADH1p) + FAE1 (ENO1p) 15 SE32 (ENO1p) 16 SE33 (ENO1p) 17 SE34 (ENO1p) 18 SE35 (ENO1p) 19 SE47 (ENO1p) 20 SE48 (ENO1p) 21 SE35 (ENO1p) + AE8 (TEF2p) 22 SE35 (ENO1p) + AE10 (FBA1p) 23 SE35 (ENO1p) + AE7 (ENO1p) 24 SE35 (ENO1p) + BC60 (ADH1p) + ARA (ENO1p) 25 SE32 (ENO1p) + ABF (ENO1p) + AXE (ENO1p) 26 SE34 (ENO1p) + ABF (ENO1p) + AXE (ENO1p) 27 SE35 (ENO1p) + AE8 (TEF2p) + AE7 (ENO1p) + AE10 (FBA1p) 28 AE8 (TEF2p) + AE10 (FBA1p) + AE1 (ADH1p) 29 Empty vector control 30 No DNA control 55 BC60 (ADH1p) + ARA (ENO1p)
(456) TABLE-US-00031 TABLE 28 Strains expressing additional to AE9 saccharolytic enzymes selected for screening on corn mash in shake flasks (FIG. 75). Strain # ID Strain description 1 T4-8 M2111 + AE7 2 T4-1 M2111 + AE7 3 T5-88 M2111 + AE1 4 b M2111 + AE1 + AE8 + AE10 5 d M2111 + AE1 + AE8 + AE10 6 i M2111 + AE1 + AE8 + AE10 7 o M2111 + AE1 + AE8 + AE10 8 r M2111 + AE1 + AE8 + AE10 9 M2111 Control 10 M139 Control
(457) TABLE-US-00032 TABLE 29 Strains expressing additional to AE9 saccharolytic enzymes selected for screening on corn flour in shake flasks (FIG. 76). Strain # ID Strain description 1 T2-6 M2111 + AE9 2 T11-32 M2111 + BC60 + SE66 3 T18-11 M2111 + SE35 4 T5-88 M2111 + AE1 5 T4-8 M2111 + AE7 6 b M2111 + AE1 + AE8 + AE10 7 i M2111 + AE1 + AE8 + AE10 8 p M2111 + AE1 + AE8 + AE10 9 M2111 Control 10 M139 Control
(458) TABLE-US-00033 TABLE 30 Strains expressing AE9 selected for screening on homemade corn mash in shake flasks (FIG. 77, top). Strain # ID Strain description 1 P4-19 M139 + AE9 2 P8-60 M139 + AE9 3 P11-67 M139 + AE9 4 P12-65 M139 + AE9 5 P12-17 M139 + AE9 6 M2111 Control 7 M139 Control
(459) TABLE-US-00034 TABLE 31 Strains expressing AE9 selected for screening on corn flour in shake flasks (FIG. 77, bottom). Strain Strain # ID description 1 P2-9 M139 + AE9 2 P11-20 M139 + AE9 3 P12-84 M139 + AE9 4 P12-65 M139 + AE9 5 P12-17 M139 + AE9 6 M2111 Control 7 M139 Control
(460) TABLE-US-00035 TABLE 32 The best strains from shake flask screening experiments on homemade mash and corn flour (FIGS. 75-77) selected for screening on industrial corn mash in shake flasks (FIG. 78). Strain # ID Strain description MXXXX 1 T2-6 M2111 + AE9 M2327 2 T4-1 M2111 + AE7 M2328 3 T4-8 M2111 + AE7 M2329 4 P11-67 M139 + AE9 (1000 colonies screen) M2330 5 P12-65 M139 + AE9 (1000 colonies screen) M2331 6 P12-84 M139 + AE9 (1000 colonies screen) M2332 7 T2-25 M2111 + AE3 + AE5 + AE7 (D.o. genes) M2333 8 T2-40 M2111 + AE3 + AE5 + AE7 (D.o. genes) M2334 9 T2-64 M2111 + AE3 + AE5 + AE7 (D.o. genes) M2335 10 T3-32 M2111 + AE3 + AE5 + AE7 (D.o. genes) M2336 11 M2111 Control 12 ER Control 13 M139 Control
(461) TABLE-US-00036 TABLE 33 The best strains from shake flask screening experiments on homemade mash and corn flour (FIGS. 75-77) selected for screening on industrial corn mash in shake flasks (FIG. 79). Strain # ID Strain description MXXXX 1 T5-88 M2111 + AE1 M2337 2 T18-11 M2111 + SE35 M2338 3 b M2111 + AE1 + AE8 + AE10 (S.f. genes) M2339 4 d M2111 + AE1 + AE8 + AE10 (S.f. genes) M2340 5 p M2111 + AE1 + AE8 + AE10 (S.f. genes) M2341 6 T6-88 M2111 + SE32 + ABF M2342 7 T11-12 M2111 + SE34 + AXE M2343 8 T11-45 M2111 + SE34 + AXE M2344 9 T12-81 M2111 + SE34 + FAE1 M2345 10 M2111 Control 11 ER Control 12 M139 Control
(462) TABLE-US-00037 TABLE 34 Strains selected as best performers on industrial corn mash (FIGS. 78 and 79). Strain ID Strain description T11-45 M2125 + SE34 + SE66 T2-40 M2125 + AE3 + AE5 + AE7 T4-8 M2125 + AE7 P12-84 M139 + AE9
Example 33: Stability of Strains Built by Directed and Random Integration
(463) Stability of the M2111 strain built by directed integration was tested. M2111 demonstrated remarkable stability. There was no decrease in activity up to 99 generations in non-selective YPD media (
Example 34: Integration Strategies for Directed Strains Construction Expressing Multiple Enzymes
(464)
Example 35: Expression of Several Cellulolytic Enzymes in a Single Yeast Strain for Hydrolysis of Wood
(465) From the data generated by mixing several cellulases in assays in either crude or purified form, it was determined that a strain producing multiple cellulolytic activities would increase the ability of the expressing strain to hydrolyze lignocellulose. To test this idea, strains of S. cerevisiae that expressed up to 7 enzymes simultaneously were created. Briefly, a robust, xylose utilizing strain, M1577, was first engineered to make high levels of the C. lucknowense CBH2.
(466) Two transformations were carried out in series to generate this strain. In the first step, plasmid pMU2115 was digested with NotI to create an integration cassette that targets a CBH2 expression and zeocin selection cassette to the rDNA loci. Colonies from this transformation were selected for on yeast extract (10 g/L), peptone (20 g/L), and xylose (20 g/L) containing agar with zeocin (YPX+zeo), picked, and screened for enzyme activity in an avicel assay protocol. Once the best transformant from those screened was identified, this transformant was transformed again with 2 additional constructs for CBH2 expression. One of these, pMU2143 (digested with NotI) targets a CBH2 expression construct and the kanamycin resistance marker to repeated tau1 genomic loci in S. cerevisiae. The other plasmid, pMU2142 (also digested with NotI) targets a CBH2 expression construct and the hygromycin resistance marker to repeated tyB genomic loci. Following this second transformation and selection on YPX agar plates with zeocin, hygromycin, and G418 present, colonies were again screened using the avicel assay method described below. The strain with the highest CBH2 production was stored and named M1873. M1873 is capable of producing ˜150 mg/L of CBH2 in shake flask fermentations as measured by a HPLC assay.
(467) M1873 was subsequently transformed with PCR cassettes that were assembled by yeast via homologous recombination to create a cassette that allows for co-expression of four cellulases (endoglucanases) at the S. cerevisiae FCY1 locus. These four endoglucanses were EG1 from Aspergillus fumigatus, EG2 from Trichoderma reesei, EG3 from Neosartorya fischeri, and Cel9A from Thermobifida fusca, all under control of different promoters and terminators from S. cerevisiae (ENO1 promoter/PYK1 terminator, PMA1 promoter/ENO1 terminator, TPI1 promoter/FBA1 terminator, and PDC1 promoter/ENO2 terminator). Table 35 lists the primers and templates used to generate the proper fragments for assembly. Table 37 lists all the primer sequences and the plasmid sequences are listed below as well. After transformation, strains were selected for resistant to 5-fluorocytosine, which is toxic to cells that have an intact FCY1 locus. In addition, strains were checked for their resistance to Clonat, and checked by PCR (X10821/X10824) for an in tact FCY1 locus. Strains showing Clonat resistance and no native FCY1 locus were screened for activity using the CMC activity assay, and the PHW assay. The strain producing the most glucose from PHW was stored and called M2217. The retention of CBH2 production was confirmed by the HPLC assay.
(468) After M2217 was built, a final transformation was used to generate strains that also expressed the Talaromyces emersonii CBH1 fused with the CBD from Humicola grisea (pMU1392). This was carried out in the same way as described above, only with a different set of PCR products. In addition, two pieces for the gene assembly were derived from a digestion of a plasmid, rather than as a PCR product. Table 36 lists the fragments used. Two copies of an expression cassette for a gene encoding a fusion protein between the T. emersonii CBH1 and the Humicola grisea CBD (from the H. grisea CBH1) were placed facing each other with integration flanks specific to the 6 sites of the Ty1 transposon (
(469) After this set of strains had been built a final comparison was carried out using the PHW assay. Briefly, the set of strains was grown up aerobically in YPD media for 2 days in 48 well plates. The supernatants from these cultures were added to PHW (4% total solids final concentration), along with a small amount (2 mg/g) of cellulase enzyme from Trichoderma reesei supplied by AB Enzymes and buffer. The amount of glucose released from the PHW was followed over time by HPLC. The data from this comparison can be found in
(470) A set of strains from those described above was subsequently tested for its ability to impact the amount of ethanol produced from pretreated hardwood.
(471) TABLE-US-00038 TABLE 35 PCR fragments used to assemble EG expression islands in S. cerevisiae. Piece ID No. Description Primers Template 1 FCY f1 X11631/X12837 gDNA 2 EG1 X12838/X12822 pMU1821 3 EG2 X12823/X12824 pMU1479 4 EG3 X12825/X12826 pMU1958 5 Cel9A X12827/X12828 pMU1975 6 Clonat Marker X12829/X12841 pMU227 7 FCY f2 X12842/X11634 gDNA
(472) TABLE-US-00039 TABLE 36 PCR fragments used to assemble CBH1 expression islands in S. cerevisiae. Piece ID No. Description Primers Template 1 Delta f1 X12427/X13008 gDNA 2 Eno1p- NA Digest of pMU1392 TeCBH1 + HgCBD with SmaI and AscI 3 CYC term 1 X13009/X13010 pMU2142 4 AgTef term X13011/X13012 pMU183 5 SfBGL NA pMU1260 digest with PacI/AscI 6 AgTef prom X13013/X13014 pMU183 7 CYC term 2 X13009/X13015 pMU2142 8 Delta f2 X13016/X12434 gDNA
(473) TABLE-US-00040 TABLE 37 Primers used in the construction of these strains Primer SEQ ID Name Sequence (5′-3′) Description NO X10821 AAGAGGGTGGTGTTCCTATTGGCGGAT FCY check for 526 GTCTTATCAATAACAAAGACGGAAGT GTTCTC X10824 TTTTGAAATTAACGTTCTCACCGACAA FCY check rev 527 CACAGCGTGGAATACCATACATGATG ATGGCA X11631 TTGCCAAAGTGGATTCTCCTACTCAAG FCY f1 for 528 CTTTGCAAACAT X12837 GAAGCTCGGATCAGTAGATAACCCGC FCY f1 rev 529 CTAGAAGACTAGTAGCTATGAAATTTT TAACTC X12838 GAGAGCCAGCTTAAAGAGTTAAAAAT EG1 for 530 TTCATAGCTACTAGTCTTCTAGGCGGG TTATC X12822 GTTTTTTCCCCGTCAGCGATGGTGACG EG1 rev 531 TAAACGACTAGATTTAGGACACTAATT GAATC X12823 AAAAAATGACGCGGGCAGATTCAATT EG2 for 532 AGTGTCCTAAATCTAGTCGTTTACGTC ACCATC X12824 GATGGGTTCCTAGATATAATCTCGAAG EG2 rev 533 GGAATAAGTAGGCAAAGAGGTTTAGA CATTG X12825 GTTCTAAGCTCAATGAAGAGCCAATGT EG3 for 534 CTAAACCTCTTTGCCTACTTATTCCCTT CGAG X12826 GTTTATTACATGAAGAAGAAGTTAGTT EG3 rev 535 TCTGCCTTGCTTGCTAGAGAATAAATT CAAG X12827 GTTCAACATCATCTTTTAACTTGAATTT Cel9A for 536 ATTCTCTAGCAAGCAAGGCAGAAACT AAC X12828 CGGGTGACCCGGCGGGGACGAGGCAA Cel9A rev 537 GCTAAACAGATCTCAAACAACTTAAA ATCAGTC X12829 GGCATATCAAGACCCTGCCTGGACTGA Clonat for 538 TTTTAAGTTGTTTGAGATCTGTTTAGCT TGCC X12841 ATATAAAATTAAATACGTAAATACAGC Clonat rev 539 GTGCTGCGTGCTATTAAGGGTTCTCGA GAGC X12842 CCAGTGTCGAAAACGAGCTCTCGAGA FCY f2 for 540 ACCCTTAATAGCACGCAGCACGCTGTA TTTACG X11634 TAGCCCTTGGTTGAGCTTGAGCGACGT FCY f2 rev 541 TGAGGT X12427 GGCCGCTGTTGGAATAAAAATCC Delta f1 for 542 X13008 CTCGGATCAGTAGATAACCCGCCTAGA Delta f1 rev 543 AGACTAGTGGATCGATCCCCGGGATGT TTATATTCATTGATCCTATTACATTATC AATCC X13009 ATCTGTACCAAGTTGAACGACTGGTAC CYC term 1 for 544 TCTCAATGTTTATAAGGCGCGCCACAG GCCCCTTTTCCTTTG X13010 CCGCCATCCAGTGTCGAAAACGAGCTC CYC term 1 rev 545 GTCGACAACTAAACTGGAATGTG X13011 CCTCACATTCCAGTTTAGTTGTCGACG AgTef term for 546 AGCTCGTTTTCGACACTGGATGG X13012 GCTGTTAATGATATCAAGACATCTGTC AgTef term rev 547 CTGTTTACTATTTGAGGCGCGCCTCAG TACTGACAATAAAAAGATTCTTG X13013 GCGACGCCGGCGAGGAGGGAGGTGAA AgTef prom for 548 GGAGACATTTTGTTTTTAATTAAGGTT GTTTATGTTCGGATGTGATG X13014 TTGTTGTTCCCTCACATTCCAGTTTAGT AgTef prom rev 549 TGTCGACAGCTTGCCTTGTCCC X13015 GGTGACCCGGCGGGGACAAGGCAAGC CYC term 2 rev 550 TGTCGACAACTAAACTGGAATGTG X13016 GCTCAATTAGTGGACGTTATCAGG Delta f2 for 551 X12434 CCGCGGTGAGATATATGTGGGTA Delta f2 rev 552
Example 36: Expression of Accessory Enzymes in Yeast
(474) For the proteins described below, various enzymes were expressed in yeast in their native form as well as with the addition of a cleavable His tag for the purposes of increased ease of purification. Proteins were assayed with and without the His tag to determine if the tag influenced the activity or banding pattern of the protein. If deemed necessary, tags can be removed in subsequent enzyme evaluation assays after cleavage with enterokinase and re-purification. Genes were PCR amplified or codon optimized and synthesized and cloned into vector pMU1531 that had been digested with Pac and Asc1. A C-terminal enterokinase site expressed as amino acids DDDDK, linker expressed as amino acids GGSPPS and 6×His tag expressed as amino acids HHHHHH were added by yeast via homologous recombination, and constructs were sequenced to confirm the tag sequence was intact and the gene and tag were in-frame.
(475) Colonies from transformations were grown in indicated media for 48-72 hours. Cultures supernatants were filtered through a 2 um PE filter and concentrated approximately 20-fold using 10,000 molecular weight cut off filters. Protein quality was screened via SDS-PAGE electrophoresis under non-reducing conditions.
(476) Expression of Alpha-Glucuronidase in Yeast
(477) Pichia stipitis alpha-glucuronidase, GH67 (NCBI #ABN67901) was expressed in yeast (
(478) Expression of Xyloglucanases in Yeast
(479) Several xyloglucanases (Table 38) were functionally expressed in S. cerevisiae (
(480) Secreted xyloglucanases were also characterized by Silver stained SDS-PAGE and Westen blot analysis (
(481) TABLE-US-00041 TABLE 38 Xyloglucanases expressed in Saccharomyces cerevisiae Accession Untagged Tagged Activity: Enzyme: Organism: number Plasmid size size xyloglucanase GH74A (EGL6) Trichoderma reesei AAP57752 pMU2088 87.0 kDa 88.9 kDa GH74A (EGL6) Aspergillus niger AAK77227 pMU2856 90.3 kDa 92.2 kDa GH74A (EGL6) Aspergillus aculeatus BAA29031 pMU2857 89.7 kDa 91.6 kDa GH74A (EGL6) Neosartorya fischeri XG* XP_001261776 pMU2858 89.3 kDa 91.2 kDa
Expression of Esterases in Yeast
(482) Several esterases (Table 39) were functionally expressed in S. cerevisiae. The expression was characterized by SDS-PAGE (
(483) TABLE-US-00042 TABLE 39 Esterases expressed in Saccharomyces cerevisiae Accession Untagged Tagged Activity: Enzyme: Organism: number Plasmid size size ferulic acid/ CE1 (FAEA) Aspergillus niger XP_001393337 pMU1880 30.5 kDa 32.4 kDa cinnamoyl CE1 (FAEA) Aspergillus terreus XP_001211092 pMU1884 35.5 kDa 37.4 kDa esterase CE1 (FAEB) Talaromyces stipitatus EED17739 pMU1881 37.5 kDa 39.4 kDa CE1 (FAEB) Chaetomium globosum XP_001228412 pMU1882 36.7 kDa 38.6 kDa glucuronyl CIP2 Trichoderma reesei AAP57749 pMU2097 48.2 kDa 50.1 kDa esterase CIP2 Chaelomium globosum XP_001226041 pMU2095 49.8 kDa 51.7 kDa
Expression of α-Galactosidases in Yeast
(484) Several alpha-galactosidases (Table 40) were functionally expressed in yeast (
(485) Alpha-galactosidases were also analyzed by Western blot (
(486) TABLE-US-00043 TABLE 40 Alpha-galactosidases expressed in Saccharomyces cerevisiae Accession Untagged Tagged Activity: Enzyme: Organism: number Plasmid size size alpha- GH27 (AGL I) Trichoderma reesei CAA93244 pMU2859 48.4 kDa 50.3 kDa galactosidase GH27 (AGL I) Talaromyces emersonii EU106878 pMU2860 49.3 kDa 51.2 kDa GH27 (AGL II) Trichoderma reesei Z69254 pMU2861 82.0 kDa 83.9 kDa GH27 (AGL III) Trichoderma reesei CAA93246 pMU2697 67.0 kDa 68.9 kDa
Example 37: Enzymatic Conversion of Pretreated Mixed Hardwoods
(487) To assess the effect of various enzymes on pretreated mixed hardwoods (PHW), an assay was conducted with 2% solids, pH 5.0 and 38° C. Yeast-produced and purified enzymes were assessed in the assay either with or without additional commercial enzymes. The activity of the mix with yeast-produced enzymes evaluated by the release of sugars, predominantly glucose due to the nature of the pretreatment, by HPLC using a BioRad 87H column. The data below shows the results of some of those mixing experiments.
(488)
Example 38: Enzymatic Conversion of Paper Sludge
(489) The information above was done on PHW in the presence of commercial enzymes. The following data shows the effectiveness of the purified, yeast-produced enzymes to hydrolyze paper sludge without any additional enzymes added in both a 2%, pH 5.0, 38° C. hydrolysis assay as well as an SSF. These results are compared to the same assay or fermentation with the addition of commercial enzymes.
(490) These data in
(491) TABLE-US-00044 TABLE 41 Yeast made enzyme cocktail used in paper sludge SSF. dose (mg/g Enzyme TS) TeCBH1 with Hg CBD 2.25 Cl CBH2 0.7 Sf BGL 0.1 Af EG1 0.35 Hj EG2 0.15 Tt EG4 0.05 Cl EG5 0.05 EG6 0.05 An Xyn 0.2 Ptr Xld 0.2 Total 4.1
(492) TABLE-US-00045 TABLE 42 Summary of the best yeast expressed cellulases, hemicellulases and accessory enzymes. Highlighted yellow − key enzymes for wood conversion; Yellow + Green key enzymes for paper sludge conversion (based on data shown in FIGS. 94-99). Type of Cazy family/ Well-Expressed Activity enzyme type Candidates Accession Number exoglucanase GH7A (CBH1) T. emersonii See underlined orf CBH1 + HgCBD in pMU1392 GH6A (CBH2) C. lucknowense See patent CBH2 application WO/2010/060056 endoglucanase GH7B (EG1) A. fumigatus EG1 XP_747897 GH5A (EG2) T. reesei EG2 See patent application WO/2010/060056 GH12A (EG3) N. fischeri EG3 XP_001261563 GH61A (EG4) T. terrestris EG4 ACE10231 GH45A (EG5) C. lucknowense ACH15008 EG5 GH6 (EG6) N. crassa EG6 XP_957415 GH5 (bact.) C. cellulolyticum YP_002505438.1 Ce15A GH? (bact.) B. subtilis EGLS CAB13696.2 GH9 (bact.) T. fusca Cel9A YP_290232 GH8 (bact.) C. cellulolyticum AAA73867.1 Ce18c xyloglucanase GH74A (EGL6) A. niger XG AAK77227 β-glucosidase BGLI S. fibuligera BGLI See patent application WO/2010/060056 xylanase GH11 (XYN2) T. reesei xyn2 ABK59833 GH10 A. niger xyn10 CAA03655.1 β-xylosidase GH3 A. niger Xld3 XP_001389416 GH43 (BXL1) Pyrenophora XP_001940956 tritici-repentis BXL beta-mannase GH5 (MAN 1) A. aculeatus MAN5 AAA67426 beta- GH26 C. phytofermentens YP_001559376.1 mannosidase mannosidase acetylxylane CE1 (AXE) N. fischerii AXE1 XP_001262186 sterase arabinofuran GH54 (ABF1) A. niger ABFB AAA93264 osidase ferulic CE1 (FAEA) A. niger FAEA XP_001393337 acid/cinnamoyl CE1 (FAEB) T. stipitatus FAEB EED17739 esterase A-glucuronidase GH67 Pichia stipitis ABN67901
Example 39: Strain Identification and Activities for Strains Tested on 30% TS Corn Flour
(493) Supernatants were assayed on the supernatant remaining at the end of a corn mash fermentation to determine if any of these enzymes could further hydrolyze the soluble oligomers. Cell supernatants of strains engineered with α-glucosidase activity released glucose from soluble oligomers remaining at the end of a corn mash fermentation. The increase observed was higher than cell supernatant from the background strain (M749). All samples contained a blanket dose of commercial glucoamylase.
(494) The control M0139 with 0.3 AGU/g TS GA reaches 121 g/L ethanol with potential ethanol of 127 g/L. M2111 is a bit higher with respect to both ethanol produced and potential ethanol, showing a CBP effect. There are a handful of strains that have potential ethanol of over 128 g/L, with T2-6 at 133 g/L. T2-6 (AE9) reached the highest ethanol titers as well, 125 g/L. T11-32 (BC60, AXE) also has potential ethanol over 130 g/L. All of these strains show a CBP effect over the control strain.
(495) TABLE-US-00046 TABLE 43 Groups of enzymes used in evaluation of pretreated wet cake with the addition of supernatants Protein Group Name CBH1 Big 4 Big 6 CBH2 EG2 BGL Xyl Big 2 Xld
(496) MO139 is the control strain and has no enzymatic activities. Each yeast-made purified enzyme was added to the control strain and a small benefit is seen. When added together, as seen with the Big 4 or Big 6, a large increase in hydrolysis is seen. The largest glucose and xylose yields are seen with the addition of 1 mg/g TS commercial Pectinase (Multifect) to the Big 6.
Example 40: Strain Identification and Activities Expressed in Supernatant that were Evaluated on Pretreated Wet Cake (ELN Afoster2 Corn-074
(497) Corn wet cake that was pretreated by autohydrolysis in the steam gun (30% TS, 160° C., 20 minutes) was used to evaluate the effect on hydrolysis when yeast-made purified enzymes are used in the presence of a mixture of commercial enzymes. The mixture of commercial enzymes (referred to as MM) used was 0.9 mg/g TS AB Whole Broth, 0.1 mg/g TS Multifect Pectinase and 0.1 mg/g TS Spirizyme GA. Purified CBH1 was added at a concentration of 1 mg/g TS where all other purified enzymes were added at 0.25 mg/g TS. These enzymes were added to 2% TS pretreated wet cake (PWC), 75 mM Na citrate buffer pH 5.0, 0.01% Na Azide to a total volume of 4 mLs in a 24 well plate. The hydrolysis was incubated at 35° C., 220 rpm. The 48 hour results are shown in
(498) The glucose released with just the commercial enzyme mix “MM” is 2.8 g/L. When purified yeast made enzymes are then loaded in addition to “MM,” an increasing trend in hydrolysis is observed. When all of the purified enzymes are added without “MM,” (shown in the last bar on the right side of the graph), glucose release is still observed. The addition of purified enzymes with or without commercial enzymes shows hydrolysis. Corn coarse fiber (similar to wet cake but with the protein removed) was pretreated in the steam gun at 190° C. for 10 minutes with water where another condition used 1% sulfuric acid for the pretreatment. These two substrates were evaluated in the presence of a commercial enzyme mixture with the addition of purified yeast made enzymes, similar to the previous experiment. The purpose of this particular assay was to determine the best ratio of purified CBH1 and CBH2 in the presence of 1 mg/g TS commercial enzyme mixture of C-tec:H-tec:Multifect Pectinase at ratios of 30%:45%:25% with 0.5 U/gTS Depol FAE. The various mixtures used are specified in Table 44 and the results are shown in
(499) TABLE-US-00047 TABLE 44 Mixtures of purified enzymes used to determine the optimal ratio of CBH1 to CBH2 on pretreated corn coarse fiber. The commercial mixture of C-tec: H-tec: Multifect Pectinase at ratios of 30%: 45%: 25% with 0.5 U/gTS Depol FAE was dosed at 1 mg/g TS to each sample mg/gTS ug/mL Mix 1 Mix 2 Mix 3 Mix 4 Mix 5 Mix 6 Mix 7 Mix 8 Mix 9 CBH1 245 3 2.25 1.5 0.75 0 4 2.25 2.25 2.25 CBH2 124 0 0.75 1.5 2.25 3 0 0.75 0.75 0.75 BGL 088 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 XYN (SE34) 148 0 0.5 0.33 XLD 334 0 0.5 0.33 AXE 118 1 0 0.33 Commercial 5 1 1 1 1 1 1 1 1 1 enzyme mix Total amount 3.1 3.1 3.1 3.1 3.1 4.1 4.1 4.1 4.1 of yeast made enzyme
(500) Results showed that decreasing amounts of CBH1 correlate to a decrease in glucose yields. This effect was more dramatic on the acid pretreated coarse fiber than on the 190° C., 10 min substrate. When 4 mg/g TS CBH1 only is added, there is an equal or better yield seen than when there is CBH2 present. In short, the more CBH1, the better the glucose yields. Additions of XLD, XLN and AXE (0.33 mg/g TS each) also helped boost final yields a small amount over the commercial enzyme mixture.
Example 41: Methods
(501) Yeast Strains
(502) M0509 (NCPy102; ura-3::kanMX/ura-3::kanMX gre3::loxP1gre3::loxP TAL1+loxP-PTPI-TAL1 RKI1+loxP-PTPI-RKI1 RPE1+/loxP-PTPI-RPE1 TKL+/loxP-PTPI-TKL delta::PTPI-xylA PTPI-XKS) and M0749 (NCPy102; ura-3::kanMX/ura-3::kanMX gre3::loxP gre3::loxP TAL1+loxP-PTPI-TAL1 RKI1+/loxP-PTPI-RKI1 RPE1+/loxP-PTPI-RPE1 TKL+/loxP-PTPI-TKL delta::PTPI-xylA PTPI-XKS fur1Δ::Nat/FUR1) strains derived from diploid wine strain NCP Y120 (obtained from University of Stellenbosch, South Africa) and are described in McBride et al., WO 2010/060056, 2010. M0139 (MAT a/MAT alpha) is S. cerevisiae diploid wine strain that was received from University of Stellenbosch. M1744 is derivative of M0139 with double URA3 knockout (markerless). Ethanol Red (ER) is commercially available diploid ethanologen strain that was obtained from Lesaffre Corp.
(503) Starch-DNS Assay
(504) Reagents:
(505) Dinitrosalicylic Acid Reagent Solution (DNS), 1%
(506) (Could be stored at 4° C. for several months)
(507) 3,5-dinitrosalicylic acid: 10 g Sodium sulfite: 0.5 g Sodium hydroxide: 10 g Add water to: 1 liter Calibrate DNS by glucose (use glucose samples with conc. 0, 1, 2, 3, 4, 5 and 6 g/l, calculate the slope [S])
(508) Starch 2.2%, pH 5.0
(509) (Prepare fresh before use; will be diluted by enzymes to 2%)
(510) Dissolve 1.1 g of corn starch in 50 ml of water in a boiling water bath Add 1 ml of 3M NaAc buffer pH 5.0
Procedure: 1. Aliquot starch into 96w PCR plate 150 μl/well (one well for each sample to be measured). Shake starch between refilling repeat pipette to prevent starch settling. 2. Aliquot DNS into different 96w PCR plate 50 μl/well (two wells for each sample to be measured) 3. Add 16.7 μl of enzyme sample (cells supernatant) into starch, mix and immediately take 25 μl into 50 μl of DNS (control sample at t=0) 4. Incubate enzyme/starch samples at 35° C. for 3 h in PCR machine 5. Take 25 μl of enzyme/starch samples into 50 μl of DNS (t=3 h samples) 6. Incubate DNS samples at 99° C. for 5 min to develop a color and cool down at 4° C. for 5 min (use PCR machine) 7. Transfer 50 μl of DNS sample into 96w assay plate and measure absorbance at 565 nm
Amylolytic Activity [A] Calculation (% of Starch Converted):
(511)
Should use supernatant of cell cultures with the same growth OD. If cells are grown differently, the activity should be normalized by cells density.
(512) Starch-GHK Assay
(513) Reagents:
(514) Hexokinase (HK) reagent
(515) (Could be stored at −20° C. for several months)
(516) Add 50 ml of water into HK reagent bottles (Sigma #G3293-50 mL) and mix by turning up and down (usually use 6 bottles to make stock) After complete dissolving combine reagent from all bottles and add Tris (5.45 g per 6 bottles) Prepare 22 mL aliquots in 50 mL screw cap centrifuge tubes. (One tube is sufficient to assay a 96 well microplate). Store aliquots frozen Calibrate each new stock by glucose standards and calculate the slope S (with glucose conc. 2, 1, 0.5, 0.25, 0.125, 0 g/l). The assay is linear up to 2 g/l glucose
(517) Starch 2.2%, pH 5.0
(518) (Prepare fresh before use; will be diluted by enzymes to 2%)
(519) Dissolve 1.1 g of corn starch in 50 ml of water in a boiling water bath Add 1 ml of 3M NaAc buffer pH 5.0
Procedure:
(520) 1. Aliquot starch into 96w PCR plate 150 μl/well (one well for each sample to be measured)
(521) 2. Aliquot HK reagent into 96w assay plate 200 μl/well (two wells for each sample to be measured)
(522) 3. Add 16.7 μl of enzyme sample (cells supernatant) into starch, mix and immediately take 10 μl and mix into 200 μl of HK reagent (control sample at t=0). Cover with plate film and incubate HK plate at 30 C for ≥30 min
(523) 4. Incubate enzyme/starch samples at 35° C. for 3 h in PCR machine
(524) 5. Take 10 μl of enzyme/starch samples and mix with 200 μl of HK reagent (t=3 h samples). Cover with plate film and incubate HK plate at 30 C for ≥30 min
(525) 6. Measure absorbance of both HK plates at 340 nm
(526) Amylolytic Activity [A] Calculation (g/L Glucose Released):
(527)
Should use supernatant of cell cultures with the same growth OD. If cells are grown differently, the activity should be normalized by cells density
(528) Maltose Assay
(529) Reagents:
(530) Maltose 2.2%: 1.1 g D-maltose 1 mL 3M sodium acetate buffer pH5.0 Bring to 50 mL with water
Hexokinase (HK) Reagent (See Starch-GHK Assay)
Procedure:
1. Aliquot 150 μL maltose solution into 96w PCR plate
2. Add 16.7 μL supernatant to the maltose solution
3. Incubate at 35 C in PCR machine for 3 h (during the last hour get GHK reagent from freezer and allow to thaw at room temperature—do not heat. One 50 mL tube containing 22 mL reagent is sufficient to do one 96 well plate)
4. Put 10 μL of supernatant/maltose sample into a well of the assay plate (Corning, cat #3641)
5. Add 200 μL of HK reagent and cover with plate film
6. Incubate at 35 C for ≥35 min
7. Measure absorbance at 340 nm
Amylolytic Activity [A] Calculation (g/L Glucose):
(531)
Should use supernatant of cell cultures with the same growth OD. If cells are grown differently, the activity should be normalized by cells density
(532) Corn Mash Assay
(533) Procedure:
(534) 1. Cut 1 mL tips so that there is an opening approximately 4 mm in diameter. Tips do not have to be sterile for this assay.
(535) 2. Inoculate strain to be tested in YPD. Grow with shaking for 2-3 days, 35° C. to an OD.sub.600 of approximately 8-10 (stationary phase).
(536) 3. If comparing strains, inoculate strain M0509 in YPD. Grow with shaking for 2-3 days, 35° C. to an OD.sub.600 approximately 8-10 (stationary phase). This will serve as a negative control in the assay.
(537) 4. Per 24-well plate, prepare substrate mix in a final volume of 100 mL:
(538) TABLE-US-00048 Final concentration Amount to add in CM assay Substrate/ per 100 mL Concentration (96-well Stock Solution Master Mix in Master Mix plate) Pretreated wet corn 12.12 g 4% 2% mash (~33% solids; test on LMA and adjust the amount added accordingly) 1M Na citrate (sodium 15 mL 150 mM 75 mM citrate dihydrate) pH 5.0 100X Anti-fungal/ 2 mL 2X 1X bacterial mix, Sigma #A5955 0.5% NaN3 (sodium 4 mL 0.02% 0.01% azide) in 5 mM Na citrate pH 5.0 dH20 Bring volume — — to 100 mL
5. Using cut tips, add 2 mL/well of the substrate mix prepared above to a 24-well plate. Use continuous stirring with a magnetic stirrer while dispensing the substrate. 3 replicates for each strain/condition are recommended.
6. Add 2 mL of supernatant to be assayed to each well that contains substrate mix.
7. Put 24-well reaction plate into shaker and incubate at 35° C. and 250 rpm.
8. Samples taken at 24 and 48 h sample by allowing the substrate in the plate to settle either by gravity or by centrifugation. Then transfer 150 μL of supernatant to a centrifuge tube with a 0.2 μm filter insert or a 96-well, 0.2 μm filter plate (Fisher: Millipore part #MSGVN2250) with 7.5 μL 10% sulfuric acid added. After filtration, transfer the sample to a total recovery HPLC vial for analysis on the H-column.
(539) Corn Fiber Assay
(540) Procedure:
(541) 1. Cut 5 mL tips so that there is an opening approximately 4 mm in diameter. Tips do not have to be sterile for this assay.
(542) 2. Inoculate strain to be tested in YPD. Grow with shaking for 2-3 days, 35° C. to an OD.sub.600 of approximately 8-10 (stationary phase).
(543) 3. If comparing strains, inoculate strain M0509 in YPD. Grow with shaking for 2-3 days, 35° C. to an OD.sub.600 approximately 8-10 (stationary phase). This will serve as a negative control in the assay.
(544) 4. Per 24-well plate, prepare substrate mix in a final volume of 100 mL:
(545) TABLE-US-00049 Amount to add Final Substrate/ per 100 mL Concentration concentration Stock Solution Master Mix in Master Mix in assay Washed fermentation 4.4 g 4% 2% residuals (~90% solids; test on LMA and adjust the amount added accordingly) 1M Na citrate (sodium 15 mL 150 mM 75 mM citrate dihydrate) pH 4.0 0.5% NaN3 (sodium 4 mL 0.02% 0.01% azide) in 5 mM Na citrate pH 5.0 dH20 Bring volume — — to 100 mL
5. Using cut tips, add 2 mL/well of the substrate mix prepared above to a 24-well plate. Use continuous stirring with a magnetic stirrer while dispensing the substrate. 3 replicates for each strain/condition are recommended.
6. Put 24-well reaction plate into shaker and incubate at 35° C. and 250 rpm.
7. Add 2 mL of supernatant to be assayed to each well that contains substrate mix.
Samples taken at 24 and 48 h sample by allowing the substrate in the plate to settle either by gravity or by centrifugation. Then transfer 150 μL of supernatant to a centrifuge tube with a 0.2 μm filter insert or a 96-well, 0.2 μm filter plate (Fisher: Millipore part #MSGVN2250) with 7.5 μL 10% sulfuric acid added. After filtration, transfer the sample to a total recovery HPLC vial for analysis on the H-column.
(546) CMC Conversion Assay
(547) Procedure:
(548) 1. Inoculate strains to be tested in 10 mL YPD (or other media) in 50 ml tubes and grow with shaking for 3 days 2. Prepare the 1.14% CMC substrate, 1.14 g CMC per 100 mL citrate buffer (50 mM pH5.5) autoclaved for 20-25 min. Agitate to make sure all CMC is dissolved 3. To 44 mL of 1.14% CMC add 1 mL of 0.5% of sodium azide 4. Spin cells in 50 ml tubes at max speed for 10 min 5. Add CMC to deep well 96-well plate, 450 μL/well 6. Do 4 replicates for each strain 7. Aliquot 100 μL of DNS into 96-well PCR plate 8. Add 50 μL of yeast supernatant or buffer to the substrate and mix by pipetting 9. Take T=0 sample: transfer 50 μL to the 96-well PCR plate containing DNS and mix 10. Put the deep well plate at 35° C. 800 rpm 11. Heat the PCR plate at 99° C. for 5 min and cool down to 4° C. in PCR machine 12. Transfer 50 μL to microtiter plate 13. Measure absorbance at 565 nm 14. Take samples from reaction plate after 24 and repeat steps 6-12 15. Calculate % of CMC converted at time 24 hrs using formula:
(549)
Y—% of CMC converted at 24
S—DNS/glucose calibration slope that is 0.1 for DNS from May 8, 2007 at 565 nm
A—CMC concentration at T=0 that is 10 g/L for 1% CMC
Reagents:
(550) Dinitrosalicylic Acid Reagent Solution (DNS), 1%
(551) (Could be stored at 4° C. for several months)
(552) 3,5-dinitrosalicylic acid: 10 g Sodium sulfite: 0.5 g Sodium hydroxide: 10 g Add water to: 1 liter
Calibrate DNS by glucose (use glucose samples with conc. 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 g/l, calculate the slope [S], for DNS from May 8, 2007 S=0.1)
(553) Avicel Conversion Assay (High Throughput)
(554) Procedure:
(555) 1. Inoculate strains to be tested in 600 ul YPD in deep 96-well plate. Perform 4 repeats for each strain or 4 transformants for each transformation. Grow with shaking for 3 days at 30° C. 2. Spin cells at max speed for 10 min 3. Prepare substrate mix:
(556) Substrate mix for full 96-well plate, total volume 30 ml:
(557) TABLE-US-00050 0.6 g Avicel (2%) 500 μl 3M Na Ac pH 5.0 (50 mM) 1.2 ml 0.5% Na Azide (0.02%) 30 μl BGL (Novozyme-188, Sigma) Add dH20 to 30 ml
(558) Add dH20 to 30 ml 4. Add substrate to new deep 96-well plate, 300 μl/well. Shake between additions; do not let the Avicel settle 5. Add 300 μl of yeast spined supernatant or buffer to the substrate. 6. Take T=0 sample: by multichannel pipette mix the reaction mix and transfer 100 μl to 96-well PCR plate 7. Put deep 96-well reaction plate into shaker at 35° C. and 800 rpm 8. Spin 96-well PCR plate with T=0 samples at 2000 rpm for 2 min 9. Aliquot 100 μl of DNS into new 96-well PCR plate 10. Carefully (without touching pellet) take 50 μl of super from T=0 spined 96-well PCR plate and mix it into DNS 11. Heat at 99° C. for 5 min and cool down to 4° C. in PCR machine 12. Transfer 50 μl to micro titre plate 13. Measure absorbance at 565 nm by plate reader 14. Take samples from reaction plate after 24 and 48 hrs and repeat steps 6-13 15. Calculate % of Avicel converted at time 24 and 48 hrs using formula:
(559)
Y—% of Avicel converted at 24 or 48 hrs
S—DNS/glucose calibration slope that is 0.1 for DNS from May 8, 2007 at 565 nm
A—Avicel concentration at T=0 that is 10 g/L for 1% Avicel
Reagents:
(560) Dinitrosalicylic Acid Reagent Solution (DNS), 1%
(561) (Could be stored at 4° C. for several months) 3,5-dinitrosalicylic acid: 10 g Sodium sulfite: 0.5 g Sodium hydroxide: 10 g Add water to: 1 liter Calibrate DNS by glucose (use glucose samples with conc. 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 g/l, calculate the slope [S], for DNS from May 8, 2007 S=0.1)
(562) 24-well PHW Assay
(563) Procedure: 1. Patch all strains to be tested including all controls on selective media plates. Incubate for 2 days 2. Inoculate strains to be tested in 4 ml YPD in 24 well plates (autoclaved) in triplicates. Cover plates with two sticky Rayon Films for Biological Cultures (VWR). Grow with shaking for 2-3 days, 35° C. at 225 rpm (attach plates on sticky pads in the fermentation lab shaker) 3. Per 24-well plate, prepare substrate mix in a final volume of 100 mL:
(564) TABLE-US-00051 Amount to add per 100 mL Concentration Concentration Substrate/Stock Solution Master Mix in Master Mix in PHW assay MS149 Pretreated wood 8.3 g 4% 2% (~48% solids) CaCO.sub.3 0.30 g 3 g/L 1.5 g/L 1M Na citrate (sodium 15 mL 150 mM 75 mM citrate dihydrate) pH 5.4 100X Anti-fungal/ 2 mL 2X 1X bacterial mix, Sigma #A5955 Novozyme-188 ß- 100 ul 0.140 mg/mL 0.070 mg/mL glucosidase (141 mg/mL) dH20 Bring — — volume to 100 mL 4. If testing for synergy with other enzymes, aliquot additional enzymes into appropriate wells (for instance, for synergy with yeast made CBHs, mix purified CBH1 and CBH2 to reach ratio 1:1 and aliquot the mix for the final concentration 2 mg CBH/g DW PHW). 24 well plates and tips for this assay don't have to be sterile 5. Using 5 mL cut tips, add 2 mL/well of the substrate mix prepared above to a 24-well assay plate. Use continuous stirring with a magnetic stirrer while dispensing the substrate 6. Spin cultures to be tested in 24 wp at 3000 rpm for 5 min 7. Add 2 mL of supernatants to 24-well assay plate with substrate mix using multichannel pipette with adjustable spacer for 100-1200 μl (Rainin) 8. For negative control, strain M0509 or empty vector strains could be used. For the positive control, dilute Zoomerase to 160 μg/mL (4 mg/g DW PHW) in negative control strain supernatant 9. Take T=0 sample by allowing the substrate in the plate to settle either by gravity or by centrifugation. Then transfer 200 μL of supernatant to 96 PCR wp using multichannel pipette with adjustable spacer for 20-300 μl (Rainin). The samples could be frozen at this point for future analysis 10. Put 24-well assay plate into shaker and incubate at 35° C. at 225 rpm (attach plates on sticky pads in the fermentation lab shaker) 11. Take subsequent time points, preferably 24 and 48 hours 12. For HPLC analysis aliquot 5 μL 10% sulphuric acid into 96 wp with filters (Millipore, MSGVN2250). Add 100 μl of samples. After filtration (using vacuum in analytical lab), transfer the samples to a total recovery HPLC vials for analysis on the H-column. Multichannel pipette with adjustable spacer for 20-300 μl (Rainin) could be used for transfer to make it faster. 96-well collection plate used to collect filtered samples could be recycled 13. Glucose and xylose concentration in the samples also could be measured by kits (see separate protocols)
(565) Mini Vials Fermentation Assay
(566) Procedure for Corn Mash:
(567) 1) Determine the solids content of the mash by drying it at 105° C. and weighing 2) Weigh liquid corn mash into the 10 mL pressure bottles according to the desired final % of solids 3) To each bottle add penicillin to final concentration 0.006 mg/mL, urea to final concentration 500 PPM, and water if needed to reach final weigh 4 g. 4) Add desired enzyme to each bottle. 5) Add yeast cells inoculum to final conc. 0.1 g/L DCW. 6) Cap each bottle and insert the 23 gauge needle into the stopper. 7) Incubate the bottles at desired temperature at 125 rpm. 8) At 72 hours, harvest samples and measure ethanol concentration by HPLC analysis.
Procedure for Corn Flour: 1) Mix corn flour with water according to desired final concentration 2) Add penicillin to final concentration 0.006 mg/mL and urea to final concentration 700 PPM 3) Weigh liquid substrate mix into the 10 mL pressure bottles according to the desired final % of solids. 4) Add desired enzyme to each bottle. 5) Add yeast cells inoculum to final concentration 0.1 g/L DCW. 6) Cap each bottle and insert the 23 gauge needle into the stopper. 7) Incubate the bottles at desired temperature at 125 rpm. 8) At 72 hours, harvest samples and measure ethanol concentration by HPLC analysis.
(568) Shake Flask Fermentation
(569) Procedure for Corn Mash:
(570) 1) Inoculate yeast into 50 mL of YPD and incubate for 15-18 hrs at 35° C. at 200 rpm 2) Spin cell down in 50 mL Falcon tubes, resuspend in 50 mL of water and spin again. 3) Resuspend cells in 10 mL of sterile water and determine dry cell weigh concentration by liquid moister analyzer (Sartorius). 1) Determine the solids content of the mash by drying it at 105° C. and weighing 2) Add mash into shake flasks according to desired final solids concentration 3) Add penicillin to final concentration 0.006 mg/mL, urea to final conc. 500 PPM, and water if needed to reach final weigh 50 g. 4) Add desired enzyme to each flask. 5) Dilute 0.005 g of cells in 1 mL of water and add cells to the flask (0.1 g/L inoculum) 6) Take 1 mL samples at T=24 h, T=48 h and T=72 h. Dilute samples 4× and measure ethanol and sugars concentration by HPLC analysis.
Procedure for Corn Flour: 1) Inoculate yeast into 50 mL of YPD and incubate for 15-18 hrs at 35 C at 200 rpm 2) Spin cell down in 50 mL Falcon tubes, resuspend in 50 mL of water and spin again. 3) Resuspend cells in 10 mL of sterile water and determine dry cell weigh concentration by liquid moister analyzer (Sartorius). 4) Mix corn flour with water according to desired final conc. 5) Add penicillin to final conc. 0.006 mg/mL and urea to final conc. 700 PPM 6) Weigh liquid substrate mix into shake flasks according to the desired final % of solids. 7) Add desired enzyme to each flask. 8) Dilute 0.005 g of cells in 1 mL of water and add cells to the flask (0.1 g/L inoculum) Take 2 mL samples at T=24 h, T=48 h and T=72 h. Measure ethanol and sugars concentration by HPLC analysis.
(571) Xylan Assay 1. Prepare a substrate solution: 1.0% Birchwood 4-O-methyl glucuronoxylan (Sigma) in 0.05 M Na-citrate buffer, pH 5.0. Homogenize 1.0 g in 80 ml buffer at 60° C. and heat to boiling point, on a magnetic stirrer. Cool with continued stirring, cover and stir slowly overnight. Make up to 100 ml with buffer. Store at 4° C. for a maximum of 1 week or freeze aliquots of e.g. 25 ml at −20° C. 2. Aliquot 150 μl of substrate into 96-well PCR plate 3. Add 16.7 μl of enzyme containing supernatant 4. Incubate at 35° C. for 3 h 5. Remove 25 μl of assay sample and mix with 50 μl DNS in a PCR plate 6. Boil at 99° C. for 5 min; cool at 4° C. 7. Transfer 50 μl to flat bottom corning plate 8. Read absorbance at 540 or 565 nm
(572) Xylan Plate Assay 1. Prepare substrate: mix 0.1% Azurine-Crosslinked Xylan (Megazymes) with 1.5% agar in water and autoclave for 20 min 2. Pore substrate on pre-made YPD plates and wait until solid 3. Patch yeast colonies and incubate at 35° C. for 24-48 hrs.
(573) Esterase Assay (for AXE and FAE) 1. Prepare substrate: 1M 4-Nitrophenyl acetate (Sigma N-8130) in methanol or DMSO 2. Dilute substrate to 1 mM by 50 mM Na-Citrate buffer pH5.4 3. Put 50 μl of enzymes containing yeast supernatants or controls into a 96-well analytical plate 4. Add 100 μl 4-Nitrophenyl acetate preheated (35° C.) substrate 5. Read absorbance at 410 nm over a given time course: e.g. 30 min, 1 hr and 2 hours. Incubate sample plate at 35° C. between time points. 6. Reaction can be stopped by adding 100 μl Na.sub.2CO.sub.3 (1 M).
(574) Arabinofuranosidase Assay 1. Prepare substrate: 1M 4-Nitrophenyl α-L-arabinofuranoside (pNPA) (Sigma N-3641) in methanol 2. Dilute substrate to 1 mM by 50 mM Na-Citrate buffer pH5.4 3. Put 20 μl of enzymes containing yeast supernatants or controls into a 96-well analytical plate 4. Add 180 μl 4-Nitrophenyl acetate preheated (35° C.) substrate 5. Read absorbance at 405 nm over a given time course: e.g. 30 min, 1 hr and 2 hours Incubate sample plate at 35° C. between time points 6. Reaction can be stopped by adding 100 μl Na.sub.2CO.sub.3 (1 M)
(575) PWC (Pretreated Wet Cake) Assay 1. Prepare substrate mix (70 ml for one 24-well plate): 8 g of 35% PWC (modified distiller's dried grains (MDDG) pretreated at 160 C for 20 min), 7 ml 0.5% NaAz, 5.25 ml of 1 M Na Citrate pH5, 0.7 ml of 100× anti-fungal/bacterial mix (Sigma #A5955), and water to final volume 70 ml 2. Aliquot purified enzymes into 24-well deep plate in desired amount (under 200 μl) 3. Add 2 ml of enzymes containing yeast supernatants or supernatant of empty strain (no enzymes) as control 4. Add 2 ml of substrate mix 5. Incubate at 35° C. with shaking for 48 hrs 6. Take 200 μl samples at T=0, T=24, T=48 hrs (allow the substrate in the plate to settle either by gravity or by centrifugation) into 96-well PCR plate. 7. Spin down PCR plate and transfer 100 μL of supernatant to 96-well, 0.2 μm filter plate (Fisher: Millipore #MSGVN2250) with 5 μL 10% sulphuric acid added. 8. Use filtered sample to measure ethanol and sugars concentration by HPLC.
(576) Xyloglucanase Assay (96-Well Plate)
(577) 70 μL of supernatant of 3 day old 2×SC.sup.−ura cultures were added to 280 μL of 50 mM Na-Acetate buffer (pH 5.0) containing 0.5% AZCL (Azurine-Crosslinked) tamarind xyloglucan (Megazyme catalog #I-AZXYG) in a 96-well deep plate
(578) The plate was incubated in a microtiter plate shaker at 35° C. at 800 rpm agitation
(579) Samples of 100 μL were taken at 0, 60 and 180 minutes of incubation into 96-well PCR plate spun down at 3000 rpm for 2 min after which 50 μL of the supernatant was placed in a fresh 96-well analytical plate and OD at 600 nm was measured
(580) Xyloglucanase Plate Assay
(581) Plates containing 1.5% agar+YPD were overlain with 0.1 or 0.5% AZCL (Azurine-Crosslinked) tamarind xyloglucan (Megazyme catalog #I-AZXYG) in 1.5% agar and spotted with 2 μL of overnight yeast culture. Plates were incubated overnight at 35° C. Blue zone indicated hydrolysis of substrate
(582) Pullulan Assay 1. Add 150 μl of 1% pullulan (in 100 mM NaCitrate buffer pH5.0) to each well 2. Mix 16.7 μl of enzyme supernatant 3. Incubate 3 h at 35° C. with shaking (900 rpm) 4. Remove 25 μl of assay sample and mix with 50 μl DNS (the same as in starch assay) in a PCR plate 5. Boil at 99° C. for 5 min; cool at 4° C. 6. Transfer 50 μl to flat bottom corning plate 7. Read absorbance at 565 or 540 nm
(583) Pectin Assay 1. Made 0.1% pectin solution (0.05 g of apple pectin in 50 mL of 100 mM sodium citrate buffer pH 5.0; heat to dissolve) 2. Put 50 μL enzyme contaning supernatants into wells of new 96 deep well plate (5 μL multifect pectinase in MO139 supernatant for total of 50 μL) 3. Added 450 μL pectin solution 4. Incubated at 35° C., 900 rpm for 4 hr 5. Aliquot 100 μL DNS (same as in starch assay) into 96-well PCR plate 6. Added 50 μL pectin/supernatants solution to DNS and heated at 99° C. for 5 min followed by cooling down to 4° C. 7. Transferred 50 μL to assay plate (flat-bottomed) and measured absorbance at 565 nm or 540 nm
(584) Modified Avicel Assay Protocol:
(585) Procedure:
(586) Inoculate strains to be tested in 600 ul YPD in deep 96-well plate. Do 4 repeats for each strain or 4 transformants for each transformation. Grow with shaking for 3 days at 30° C. 1. Spin cells at max speed for 10 min 2. Prepare substrate mix:
(587) Substrate Mix for Full 96-Well Plate, Total Volume 30 ml:
(588) TABLE-US-00052 0.6 g Avicel (2%) 500 μl 3M Na Ac pH 5.0 (50 mM) 1.2 ml 0.5% Na Azide (0.02%) 30 μl BGL (Novozyme-188, Sigma) 600 μl Zoomerase from 1 mg/ml stock (to get 1 mg/gm of avicel Add dH20 to 30 ml.
(589) Add dH20 to 30 ml. 3. Add substrate to new deep 96-well plate, 300 ul/well. Shake between additions, don't let Avicel to settle. 4. Add 300 μl of yeast spined supernatant or buffer to the substrate. 5. Take T=0 sample: by multichannel pipette mix the reaction mix and transfer 100 μl to 96-well PCR plate 6. Put deep 96-well reaction plate into shaker at 35° C. and 800 rpm 7. Spin 96-well PCR plate with T=0 samples at 2000 rpm for 2 min 8. Aliquot 50 μl of DNS into new 96-well PCR plate 9. Carefully (without touching pellet) take 25 μl of super from T=0 spined 96-well PCR plate and mix it into DNS 10. Heat at 99° C. for 5 min and cool down to 4° C. in PCR machine 11. Transfer 50 μl to micro titre plate. 12. Measure absorbance at 540 nm by plate reader 13. Take samples from reaction plate after 2 and 4 hrs and repeat steps 6-13 14. Calculate % of Avicel converted at time 2 and 4 hrs using formula:
(590)
Y—% of Avicel converted at 24 or 48 hrs
S—DNS/glucose calibration slope that is 0.25 for DNS at 540 nm
A—Avicel concentration at T=0 that is 10 g/L for 1% Avicel
(591) Reagents:
(592) Dinitrosalicylic Acid Reagent Solution (DNS), 1%
(593) (Could be stored at 4° C. for several months)
(594) 3,5-dinitrosalicylic acid: 10 g Sodium sulfite: 0.5 g Sodium hydroxide: 10 g Add water to: 1 liter
Calibrate DNS by glucose (use glucose samples with conc. 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 g/l, calculate the slope [S], for DNS S=0.25)
Concentration Determination of TeCBH1-HgCBM-C and ClCBH2b in Media by HPLC Analysis.
(595) For determination of the concentration of CBHs produced by strains expressing TeCBH1-HgCBM-C (M1111, expressing plasmid pMU1392) and ClCBH2b (M1873), a phenyl reversed phase method was developed on an Agilent 2100 HPLC with the MWD detector at 214 and 280 nm. In this method, the purified CBHs described above were used for generating a standard curve from 200-10 μg. The sample was injected onto a phenyl RP column (Tosoh phenyl-5PW RP, 4.6 mm×7.5 cm, 10 μm) that was equilibrated at 55° C. in 0.1% trifluoracetic acid (TFA) (w/v), 20% acetonitrile. The protein was eluted from the column at 0.75 ml/min using a linear gradient of acetonitrile with 0.1% TFA (w/v) from 20-60% in 45 minutes. After cleaning the column with 95% acetonitrile/TFA, the column was re-equilibrated. To determine the concentration of TeCBH1-HgCBM-C and C/CBH2b produced in media by various strains, the peak area of the sample was compared to the standard curve generated from the peak areas of the purified CBHs (μg/μL injected).
(596) Purification of TeCBH1-HgCBM-C and C1CBH2b for Protein Standards in the HPLC Assay.
(597) 1 or 1.5 liter of YPD medium was inoculated with a 10% volume of an overnight pre-culture of the strain producing CBH1 or CBH2 (M1111, expressing plasmid pMU1392 and M1873, respectively). The cultures were grown with shaking (210 rpm) at 30° C. After 3 days of cultivation the supernatants were harvested by removing the cells by centrifugation. The supernatants were concentrated and changed into 50 mM sodium acetate (pH 5) with a 10 kDa cut-off Pellicon PTGC membrane (Millipore). The CBH1 sample was loaded into DEAE Sepharose FF column equilibrated with 50 mM sodium acetate, pH 5.0. The bound CBH1 was eluted with linear salt gradient of from 0 to 0.35 M NaCl. The elution volumes were 15 and 20 column volumes. The fractions were tested for CBH1 activity with MULac by incubating 10 μl sample with 90 μl 2 mM MULac in 50 mM NaAc (pH 5.0), in ambient temperature for 20 minutes and stopping the reaction with 0.5 M Na.sub.2CO.sub.3. The fluorescence was measured with a Varioscan (Thermo Labsystems) microtiter plate reader (ex. 355 nm and em. 460 nm). The CBH1 proteins were visualized on SDS-PAGE and the fractions containing a single band were pooled and changed into 50 mM sodium acetate (pH 5) using 20 ml spin concentrators, 10 kDa MWCO (Vivaspin, Vivascience GmbH). A second step was then carried out in the purification where a 5 ml GE phenyl HR column was utilized to further remove media components. In this procedure, the column was equilibrated with 25 mM sodium acetate, 1.2 M ammonium sulfate, pH 5. Ammonium sulfate was added to the sample to bring the concentration in the buffer to 1.2 M and this material was injected onto the column. The protein was eluted with a linear gradient of 25 mM sodium acetate, pH 5 and fractions that were active on MULac were pooled. Purity was assessed by SDS-PAGE and concentration was determined by absorbance at 280 nm using the theoretical absorptivity value. C/CBH2b was purified using the same chromatography steps, DEAE anion exchange followed by phenyl HIC. In this purification, C/CBH2b is found in the flow through of the DEAE step and was eluted from the phenyl HIC column within the decreasing ammonium sulfate gradient. Active fractions were determined using a 1% Avicel hydrolysis assay at pH 5.0 as described above. Purity and concentration determination were determined as described above.
(598) PHW Assay 1. Prepare substrate mix (100 mL per one 24-well plate): 8.3 g of pretreated wood (48% of solids), 20 ml of 1M Na Citrate pH4.8, 2 ml of 100× anti-fungal/bacterial mix (Sigma #A5955), and water to final volume 100 ml. In some assay 0.222 ml of commercial glucoamylase (AB Enzymes #EL2008044L 63 ml/ml) is added (heat treated to remove side activities) 2. Add purified enzymes into wells of 24-well deep plate (under 200 μl) 3. Add 2 mL of enzymes containing yeast supernatants and empty strain supernatant as control 4. Using cut 5 ml tips, add 2 ml/well of the substrate mix to enzymes. Use continuous stirring with a magnetic stirrer while dispensing the substrate 5. Incubate 24-well reaction plate at 38° C. and 250 rpm 6. Take 200 μl samples at T=0, T=24, T=48 hrs (allow the substrate in the plate to settle either by gravity or by centrifugation) into 96-well PCR plate 7. Spin down PCR plate and transfer 100 μL of supernatant to 96-well, 0.2 μm filter plate (Fisher: Millipore #MSGVN2250) with 5 μL 10% sulphuric acid added 8. Use filtered sample to measure ethanol and sugars concentration by HPLC
(599) Paper Sludge Assay 1. Prepare substrate mix (100 mL per one 24-well plate): 10.5 g of paper sludge (38% of solids), 40 ml of 1M Na Citrate pH5.2, 2 ml of 100× anti-fungal/bacterial mix (Sigma #A5955), and water to final volume 100 ml. In some assays 0.222 ml of commercial thermostable β-glucosidase (AB Enzymes 63 ml/ml) is added (heat treated to remove side activities) 2. Add purified enzymes into wells of 24-well deep plate (under 200 μl) 3. Add 2 mL of enzymes containing yeast supernatants and empty strain supernatant as control 4. Using cut 5 ml tips, add 2 ml/well of the substrate mix to enzymes. Use continuous stirring with a magnetic stirrer while dispensing the substrate 5. Incubate 24-well reaction plate at 35° C. and 250 rpm 6. Take 200 μl samples at T=0, T=24, T=48 hrs (allow the substrate in the plate to settle either by gravity or by centrifugation) into 96-well PCR plate 7. Spin down PCR plate and transfer 100 μL of supernatant to 96-well, 0.2 μm filter plate (Fisher: Millipore #MSGVN2250) with 5 μL 10% sulphuric acid added 8. Use filtered sample to measure ethanol and sugars concentration by HPLC.
(600) 1-Napthyl-Acetate Esterase Assay 1. Inoculate SC or YPD medium with the stain to be tested and incubate on a rotary shaker. 2. Remove the cells by centrifugation. 3. Set up the reaction as follows in a 96 well plate:
(601) TABLE-US-00053 88 μL Citrate buffer (50 mM, pH 5.0)* 10 μL Supernatant 2 μL 1-naphtyl-acetate in ethanol (500 mM)** 100 μL Total *(Phosphate buffer can also be used but Acetate buffers cause a precipitate) **(Sigma 46010) *(Phosphate buffer can also be used but Acetate buffers cause a precipitate) **(Sigma 46010) 4. Incubate for 5-30 min at 35° C. The incubation time depend on the level of activity. 5. Stop the reaction by adding 100 μl 0.01% Fast Corrinth V salt solution. 6. Read 100 μL at 535 nm
(602) 50 mM Citrate Buffer pH 5.0
(603) TABLE-US-00054 1M Citric acid 20.5 mL 1M Na-citrate 29.5 mL This is 50 mL 1 M Citrate Phosphate buffer (pH5.0). Dilute to appropriate concentration with water.
(604) 500 mM 1-naphtyl-acetate (Mr 186 g/mol)
(605) TABLE-US-00055 1-naphtyl-acetate 0.0931 g Ethanol (100%) 1000 μl (make fresh batch each day)
(606) Fast Corrinth V Salt Solution (Sigma 227366)
(607) TABLE-US-00056 Fast Corrinth V salt (0.01%) 0.001 g Tween 20 (10%) 1 mL 1M Na-Acetate buffer pH 4.4 9 mL 10 mL
NB: Make this Solution Fresh Each Day and Keep in a Dark Bottle—Use Same Day, Very Light Sensitive.
(608) 1-Naphtol (for Standard Curve) (Sigma 31097) Prepare a 1 g/L 1-naphtol solution in the buffer used for the assay to set the standard curve. Set the standard cure between 0.025 g/L and 0.4 g/L
(609) Alpha-Galactosidase Activity Assay Using NpGal Reference: Margolles-Clark et al. 1996. Eur J Biochem. 240: 104-111. 1. Prepare solutions as indicated below 2. Patch colonies to be screened on selection plates and incubate at 30-35° C. for 48 h 3. Inoculate 600 μl YPD in 96 well plate and incubate at 35° C. with 800 rpm shaking for 48-72 h 4. Spin cells for 2 min at 2500 rpm 5. Place 20 μl supernatant into a 96 well plate 6. Add 180 μl NpGal preheated (35° C.) substrate 7. Incubate for given time course at 35° C.: e.g. 30 min, 1 hr and 2 hours (may have to go overnight according to some enzymes in literature) 8. Read absorbance at 405 nm over a given time course. Incubate sample plate at 35° C. between time points 9. Stop reaction by adding 100 μl Na.sub.2CO.sub.3 (1 M)
1 mM p-Nitrophenyl-α-D-Galactopyranoside (NpGal) (Sigma N0877) 301.32/Mol) Make a 1M Stock=0.151 g in 500 μl methanol or DMSO 1 mM Stock=10 μl of 1M stock in 9.99 ml citrate buffer
(610) TABLE-US-00057 Citrate Buffer (0.05M pH 5.4) 1 L 0.1M Citric acid: 21.01 g citric acid in 1000 ml H.sub.2O 0.1M Sodium citrate: 29.41 g of C.sub.6H.sub.5O.sub.7Na.sub.3•2H.sub.2O in 1000 ml H.sub.2O 20.5 ml of citric acid + 29.5 ml of sodium citrate, add dH.sub.2O to a total of 100 ml
INCORPORATION BY REFERENCE
(611) All documents cited herein, including journal articles or abstracts, published or corresponding U.S. or foreign patent applications, issued or foreign patents, or any other documents, are each entirely incorporated by reference herein, including all data, tables, figures, and text presented in the cited documents.
EQUIVALENTS
(612) Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.