Pharmaceutical compositions for combination therapy

Abstract

The present invention relates to a combination product and its use in therapy.

Claims

1. A combination product comprising (i) A compound selected from nitazoxanide, tizoxanide, or pharmaceutical acceptable salt thereof; and (ii) A compound selected from GS-0976, GS-4997, KD-025, Aramchol and Tropifexor, or pharmaceutical acceptable salt thereof.

2. The combination product according to claim 1, wherein the combination product is a composition comprising components (i) and (ii) and a pharmaceutically acceptable carrier.

3. The combination product according to claim 1, wherein the combination product is a kit of parts comprising components (i) and (ii), for sequential, separate or simultaneous use.

4. The combination product according to claim 1, wherein components (i) and (ii) are formulated in an injectable suspension, a gel, an oil, a pill, a tablet, a suppository, a powder, a capsule, an aerosol, an ointment, a cream, a patch, or means of galenic forms for a prolonged and/or slow release.

5. A method of treating a liver fibrotic disorder, the method comprising administering to a subject in need thereof the combination product of claim 1.

6. The method according to claim 5, wherein the liver fibrotic disorder is selected from non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, drug-induced liver disease, alcohol-induced liver disease, infectious agent induced liver disease.

7. The method according to claim 6, wherein the infectious agent induced liver disease is parasite infection-induced liver fibrosis or cirrhosis, bacterial infection-induced liver fibrosis or cirrhosis, or viral infection induced liver fibrosis or cirrhosis.

8. The method according to claim 7, wherein the viral infection induced liver fibrosis or cirrhosis is HBV-infection induced liver fibrosis or cirrhosis, HCV-infection induced liver fibrosis or cirrhosis, HIV-infection induced liver fibrosis or cirrhosis, or dual HCV and HIV infection induced liver fibrosis or cirrhosis.

Description

DESCRIPTION OF THE FIGURES AND TABLES

(1) FIG. 1: Antifibrotic effect of Elafibranor and Nitazoxanide in TGFβ-induced hHSC

(2) Serum-deprived HSC were preincubated for 1 hour with Elafibranor (A) or Nitazoxanide (B), or Bezafibrate (C) before the activation with the profibrogenic cytokine TGFβ1 (1 ng/ml). After 48 hours of incubation, the expression of α-SMA was measured by ELISA. The obtained values were transformed into percentage inhibition over TGFβ1 control. Data are presented as mean (triplicates)±standard deviation (SD). The curve fitting and the calculation of half maximal inhibitory concentration (IC.sub.50) were performed with XLFit software 5.3.1.3.

(3) FIG. 2: Combination of Elafibranor with Nitazoxanide synergistically inhibits α-SMA in TGFβ1-induced hHSC

(4) Combinations were tested in a dose-response matrix format and analyzed according to the excess over Bliss (EOB) additivism model. Dilution series of Elafibranor (row) and Nitazoxanide (column) were prepared, including their respective DMSO controls. The resulting mixes were added to serum-deprived HSC, 1 hour prior to the activation with the profibrogenic cytokine TGFβ1 (1 ng/ml). (A) Percentage of α-SMA inhibition over the TGFβ1 control for all combination pairs. Data are presented as mean of quadruplicates. (B) EOB scores were calculated as described in Materials and Methods. Any compound pair with positive EOB value were considered synergistic (colored from light grey to black). The total EOB score including all combinations was also calculated. (C) Data values derived from a synergistic combination pair were plotted in a bar graph representation. Data are presented as mean (quadruplicates)±standard deviation (SD). EOHSA model was used as described in the Materials and Methods section to confirm the synergism of the selected NTZ/ELA combination pairs.

(5) FIG. 3: Hepatic collagene content

(6) 6 week-old C57BL/6 mice were fed a control (CSAA) diet, CDAA+1% CHOL (CDAAc) diet, or CDAAc diet supplemented with NTZ (30 mg/kg/day or 100 mg/kg/day for 12 weeks) or Elafibranor (1 mg/kg/day or 3 mg/kg/day) or a combination of Elafibranor and NTZ (respectively 1+30 mg/kg/day, 1+100 mg/kg/day, 3+30 mg/kg/day and 3+100 mg/kg/day). For each graph the exact amount of exposure doses was indicated.

(7) After the sacrifice, the hepatic collagen content was determined.

(8) FIG. 4: Hepatic fibrosis percentage

(9) 6 week-old C57BL/6 mice were fed a control (CSAA) diet, CDAA+1% CHOL (CDAAc) diet, or CDAAc diet supplemented with NTZ (30 mg/kg/day or 100 mg/kg/day for 12 weeks) or Elafibranor (1 mg/kg/day or 3 mg/kg/day) or a combination of Elafibranor and NTZ (respectively 1+30 mg/kg/day, 1+100 mg/kg/day, 3+30 mg/kg/day and 3+100 mg/kg/day). For each graph the exact amount of exposure doses was indicated.

(10) After the sacrifice, the hepatic fibrosis area was determined.

(11) FIG. 5: Hepatic αSMA gene expression

(12) FIG. 6: Hepatic CCR2 gene expression

(13) FIG. 7: Hepatic CCR5 gene expression

(14) FIG. 8: Hepatic Col1a2 gene expression

(15) FIG. 9: Hepatic MMP2 gene expression

(16) FIG. 10: Hepatic TIMP2 gene expression

(17) FIG. 11: Hepatic TGFβ1 gene expression

(18) FIG. 12: Combination of GS-0976 (A), Selonsertib (B), GKT-831 (C), KD-025 (D), Cenicriviroc (CVC) (E), Tropifexor (LJN-452) (F), and Aramchol (G) with Nitazoxanide synergistically inhibits α-SMA in TGFβ1-induced hHSC

(19) Combinations were tested in a dose-response matrix format and analyzed according to the excess over Bliss (EOB) additivism model. Dilution series of GS-0976, Selonsertib, GKT-831, KD-025, CVC, Tropifexor (LJN-452), and Aramchol (row) and Nitazoxanide (column) were prepared, including their respective DMSO controls. The resulting mixes were added to serum-deprived HSC, 1 hour prior to the activation with the profibrogenic cytokine TGFβ1 (1 ng/ml). EOB scores were calculated as described in Materials and Methods. Any compound pair with positive EOB value were considered synergistic (colored from light grey to black). Data values derived from a synergistic combination pair were plotted in a bar graph representation. Data are presented as mean (quadruplicates)±standard deviation (SD). EOHSA model was used as described in the Materials and Methods section to confirm the synergism of the selected NTZ/GS-0976 (A), Selonsertib (B), GKT-831 (C), KD-025 (D), Cenicriviroc (E), Tropifexor (F), and Aramchol (G) combination pairs.

ABBREVIATIONS USED IN THE FIGURES, IN THE TABLES, AND IN THE TEXT

(20) AP-1 Activator Protein 1 ASBTi Apical Sodium-codependent Bile acid Transporter Inhibitor ASK1 signal-regulating kinase 1 AT1 AngioTensin 1 COPD Chronic Obstructive Pulmonary Disease CTGF Connective Tissue Growth Factor DGAT DiacylGlycerol-O-AcylTransferase DMSO DiMethylSulfOxyde DNA DesoxyriboNucleic Acid DPP4 DiPeptidyl Peptidase ELISA Enzyme-Linked Immuno Assay EOB Excess Over Bliss FABAC Fatty Acid Bile Acid Conjugates FBS Fetal Bovine Serum FGF Fibroblast Growth Factor FXR Farnesoid X Receptor GDF Growth Differentiation Factor GLP-1 Glucagon-Like Peptide-1 GPCR G-Protein Coupled Receptor HBV Hepatitis B Virus HCV Hepatitis C Virus 15-HEPE 5-HydroxyEicosaPentaEnoic acid HIV Human Immunodeficiency Virus HSC Hepatic Stellate Cell IC50 half maximal inhibitory concentration iNOS inducible Nitric Oxide Synthase IPF Idiopathic Pulmonary Fibrosis LBD Ligand Binding Domain LPS LipoPolySaccharide LT LeukoTriene MAPK Mitogen-Activated Protein Kinases MMPase Matrix MetalloProtease NADPH Nicotinamide Adenine Dinucleotide PHosphate NAFLD Non-Alcoholic Fatty Liver Disease NASH Non-Alcoholic SteatoHepatitis NF-κB Nuclear Factor-kappa B NOX NADPH oxidase NSAIDs Non-Steroid Anti-Inflammatory Drugs NTZ NiTaZoxanide PAR Protease-Activated Receptor PBC Primary Biliary Cholangitis PDE PhosphoDiEsterase PDGF Platelet-Derived Growth Factor PFIC3 Progressive Familial Intrahepatic Cholestasis type 3 PFOR Pyruvate:Ferredoxin OxidoReductase PPAR Peroxisome proliferator activated receptor PPRE PPAR Response Elements PSC Primary Sclerosing Cholangitis ROCK Rho-associated protein kinase RTK Receptor Tyrosine Kinase SD Standard Deviation SGLT Sodium-GLucose Transport STAT Signal Transducers and Activators of Transcription TGFβ Transforming Growth Factor β TGFBRI TGFβ Receptors type I TGFBRII TGFβ Receptors type II THBS1 THromBoSpondin 1 THR β Thyroid Hormone Receptor β TIMP Tissue Inhibitor of MetalloProtease TLR-4 Toll Like Receptor 4 TZ TiZoxanide TZG TiZoxanide Glucuronide VAP-1 Vascular Adhesion Protein-1

EXAMPLES

(21) Materials and Methods

(22) Compounds were dissolved in dimethyl sulfoxide (DMSO, Fluka cat #41640). Lanifibranor (ARK PHARM cat #AK689102), Nitazoxanide (INTERCHIM cat #RQ550U), GKT-831 (cat #S7171, Absource Diagnstica GmbH), KD-025 (cat #S7936, Absource Diagnostica GmbH), GS-0976 (cat #HY-16901, Haoyuan Chemexpress Co), GS-4997 or Selonsertib (cat #S8292, Absource Diagnostica GmbH), Aramchol (cat #A765150, Toronto Research Chemical (TRC)), Tropifexor (LJN-452, cat #HY-107418 Haoyuan Chemexpress Co), Cenicriviroc (PB0001630-239-01/PBLJ6483, Pharmablock), Nalmefene (cat #N284400, TRC), and PBI-4050 (cat #ACDS-072808, Acadechem) were obtained commercially.

(23) hHSC Culture

(24) The human primary hepatic stellate cells (hHSC) (Innoprot) were cultured in STeCM medium (ScienCell cat #5301) that was supplemented with 2% fetal bovine serum (FBS, ScienCell cat #0010), 1% penicillin/streptomycin (ScienCell cat #0503) and stellate cell growth supplement (SteCGS; ScienCell cat #5352). Cell-culture flasks were coated with Poly-L Lysine (Sigma cat #P4707) for a better adherence.

(25) Preparation of Compositions

(26) 2 Components Combination Matrix (NTZ/Component (ii))

(27) For these experiments, a checkerboard matrix was generated. NTZ and selected component (ii) stocks were serially diluted in DMSO in 5-points series in a row (component (ii)) and a 6-points series in a column (NTZ) of a 96-well plate. Subsequently, the 5×6 combination matrix was generated by 1:1 mixing of all single agent concentrations. The test concentrations for each compound were chosen based on the respective IC.sub.50 of each compound as single agent obtained by measuring α-SMA content in the HSC model stimulated with TGF-β1. Then, 2-fold and 4-fold higher and lower concentrations were selected.

(28) Activation of hHSC with TGF-β1 and Compound Treatment

(29) The human primary hepatic stellate cells (hHSC) (Innoprot) were cultured under standard conditions, as described above. The cells were subsequently plated at a density of 2×10.sup.4 cells/well into 96-well plates for the measure of α-SMA by ELISA. The next day, cell-culture medium was removed, and cells were washed with PBS (Invitrogen cat #14190). hHSC were deprived for 24 hours in serum-free and SteCGS-free medium. For the treatments with NTZ, Elafibranor, component (ii) and the respective NTZ/component (ii) or Elafibranor combinations, the serum-deprived hHSC were preincubated for 1 hour with the compounds followed by addition of the profibrogenic stimuli TGF-β1 (PeproTech cat #100-21, 1 ng/mL) in serum-free and SteCGS-free medium for an additional 48 hour period.

(30) α-SMA ELISA

(31) The level of α-SMA was measured using a Sandwich ELISA. Briefly, the wells of an ELISA plate were first coated with the capture antibody (mouse monoclonal anti-ACTA2, Abnova) at 4° C. overnight. After 3 washes in PBS+0.2% Tween 20, a blocking solution consisting of PBS+0.2% BSA was added for one hour followed by another washing cycle. The cell lysates were transferred into the wells for binding to the capture antibody for a period of 2 h at room temperature. After the washing procedure, the detection antibody (biotinylated mouse monoclonal anti-ACTA2, Abnova) was added for 2 hours at room temperature followed by 3 washes. For the detection, an HRP-conjugated Streptavidin (R&D Systems cat #DY998) was first applied for 30 min at room temperature. After washing, the HRP substrate TMB (BD, #555214) was added and incubated for 7 min at room temperature in the dark. Upon oxidation, TMB forms a water-soluble blue reaction product that becomes yellow with addition of sulfuric acid (solution stop), enabling accurate measurement of the intensity at 450 nm using a spectrophotometer. The developed color is directly proportional to the amount of α-SMA present in the lysate.

(32) Determination of Synergism by Excess Over Bliss (EOB) Method and Confirmation by EOSHA (Excess Over Highest Single Agent)

(33) The values obtained in the αSMA ELISA assays were first transformed into percentage inhibitions over TGF-β1 control. Then, using these percentage inhibitions, EOB (Excess Over Bliss) was determined to define the synergistic effects of drug combinations. Expected Bliss additivism score (E) was firstly determined by the equation:
E=(A+B)−(A×B)
where A and B are the percentage inhibition of NTZ (A) and component (ii) or Elafibranor (B) at a given dose. The difference between the Bliss expectation and the observed inhibition of the combined NTZ/component (ii) or Elafibranor at the same dose is the ‘Excess over Bliss’ score. Excess over Bliss score=0 indicates that the combination treatment is additive (as expected for independent pathway effects); Excess over Bliss score>0 indicates activity greater than additive (synergy); and Excess over Bliss score<0 indicates the combination is less than additive (antagonism).

(34) For the combination NTZ+component (ii) or Elafibranor, an additional total Bliss score was calculated by summation of all EOB.

(35) EOHSA is a standard measure of synergy used by the FDA for evaluation of drug combinations and is calculated as the difference of the effect produced by the drug combination and the greatest effect produced by each of the combination's single agents at the same concentrations as when combined (Borisy et al., 2003). For synergistic combinations identified by the EOB method, the experimental % inhibition were plotted in a bar graph and the significance of the observed differences between NTZ/component (ii) or Elafibranor and single agent were estimated by one-way ANOVA and uncorrected Fisher's LSD post-hoc (*: p<0.05; **: p<0.01; ***: p<0.001).

(36) Evaluation of Elafibranor, Nitazoxanide and the Combination Elafibranor+Nitazoxanide in a Chronic CDAA+1% Cholesterol Model if Fibrosing NASH (12 Weeks)

(37) Experimental Design

(38) The choline-deficient and L-amino acid-defined (CDAA) diet lacks choline, which is essential for hepatic β-oxidation and very low density lipoprotein production, and is believed to induce hepatocytes to store fat and subsequently cause cellular damage. The CDAA diet-induced rodent model develops fibrosis within a relatively short period of time, ideal for rapidly studying the reversibility of NASH pathology, particularly fibrosis.

(39) Increased cholesterol intake accelerates liver fibrosis in several mouse models of NASH. The exacerbation of liver fibrosis mainly involves free cholesterol accumulation in hepatic stellate cells, that sensitizes the cells to transforming growth factor β(TGFβ) and subsequently aggravates liver fibrosis.

(40) In the current study, we examined the effects of nitazoxanide on liver fibrosis in C57Bl/6J mice fed a CDAA diet supplemented with 1% cholesterol.

(41) The preventive effects of alone, NTZ alone and the combination of both were assessed in a fibrosing NASH-model of mice fed a CDAA+1% cholesterol diet. 6 week-old male C57Bl/6J mice were fed a control (CSAA) diet, CDAA+1% cholesterol diet, or CDAA+1% cholesterol diet supplemented with 1, and 3 mg/kg/day, NTZ 30 and 100 mg/kg/day or combined drugs (1 and 3 mg/kg/day combined to NTZ 30 and 100 mg/kg/day) for 12 weeks.

(42) The body weight and the food intake were monitored twice per week. On the last day of treatment, mice were sacrificed after a 6 h fasting period. The liver was rapidly excised for biochemical and histological studies.

(43) All animal procedures were performed according to standard protocols and in accordance with the standard recommendations for the proper care and use of laboratory animals. 6 weeks-old C57BL/6 male mice were fed for 12 weeks according to an experimental plan detailed in the table 1:

(44) TABLE-US-00001 TABLE 1 Experimental plan Dose Number Diet Compound mg/kg/day of mice CSAA 8 12 1 8 3 8 CDAA + 1% Chol NTZ 30 8 100 8 +NTZ 1 + 30 8  1 + 100 8 3 + 30 8  3 + 100 8

(45) The control was the CSAA diet.

(46) Some mice were fed with the CDAAc diet.

(47) Some mice were fed with CDAAc diet supplemented with Elafibranor at 1 or 3 mg/kg/day.

(48) Some mice were fed with CDAAc diet supplemented with NTZ at 30 or 100 mg/kg/day.

(49) Some mice were fed with CDAAc diet supplemented with Elafibranor+NTZ combination at different ratios: 1+30, 1+100, 3+30 and 3+100 mg/kg/day.

(50) The group corresponding to CDAAc diet supplemented with NTZ at 30 mg/kg is also named C57Bl/6J mice fed CDAA diet+nitazoxanide 0.02% (wt/wt) corresponding to the theoretical dose of 30 mg/kg/day.

(51) The group corresponding to CDAAc diet supplemented with NTZ at 100 mg/kg is also named C57Bl/6J mice fed CDAA diet+nitazoxanide 0.0667% (wt/wt) corresponding to the theoretical dose of 100 mg/kg/day.

(52) The food was purchased from Ssniff® company (Soest, Germany).

(53) Nitazoxanide (cf reference in Table 1) was incorporated by Ssniff® into CDAA+1% chol diet in powder form to the required dose.

(54) The reference and batch number of nitazoxanide are summarized in the table Table 2:

(55) TABLE-US-00002 TABLE 2 Nitazoxanide references Laboratory Compound code (INN) External ID Genfit ID Supplier Reference Batch Nitazoxanide GFE 50455 GSL022597.08 Interchim RQ550 1501

(56) For each dose a calculation of the exact doses was done according to the following example.

(57) This allows taking in count the exact dose of each product that was exactly consumed by each group of mice.

(58) Calculation of the Actual Treatment Doses:

(59) Example with nitazoxanide 0.02% (wt/wt) Food intake is expressed in grams of food/grams of animal/day 0.02% of nitazoxanide in diet 0.02 g of cpd/100 g of food=0.2 mg of cpd/g of food Actual dose of cpd: 0.2 mg of cpd/gram of food/gram of animal/day (0.2 mg of cpd/gram of food/gram of animal/day)×1000=(0.2 mg of cpd/gram of food/kg of animal/day)=200 mg of cpd/gram of food/kg of animal per day

(60) Consequently, multiplying by 200 the food intake value expressed in grams of food/grams of animal/day; the obtained value corresponds to the actual administered dose expressed in mg of NTZ/kg of animal/day.

(61) In the same manner: For the dose of NTZ 0.00667% wt/wt, the actual treatment dose was obtained by multiplying the food intake value (grams of food/grams of animal/day) by 66.7. For the dose of NTZ 0.0667% wt/wt, the actual treatment dose was obtained by multiplying the food intake value (grams of food/grams of animal/day) by 667.

(62) According to the calculation the calculated dose versus estimated dose are given in the following tables 3 and 4.

(63) TABLE-US-00003 TABLE 3 estimated and calculated doses for each compound a different doses Groups GFT505 NTZ Estimated doses 1 mpk   3 mpk   30 mpk  100 mpk Calculated doses 1 mpk 2.8 mpk 26.3 mpk 78.1 mpk

(64) TABLE-US-00004 TABLE 4 estimated and calculated doses for each combinations at different doses Combo 1 Combo 2 Combo 3 Combo 4 Groups GFT505 NTZ GFT505 NTZ GFT505 NTZ GFT505 NTZ Estimated   1 mpk   30 mpk   1 mpk  100 mpk   3 mpk   30 mpk   3 mpk  100 mpk doses Calculated 0.9 mpk 26.4 mpk 0.9 mpk 79.4 mpk 2.9 mpk 27.4 mpk 2.8 mpk 77.7 mpk doses

(65) The body weight and food intake were recorded twice a week throughout the study.

(66) At the end of the treatment period, animals were anesthetized with isoflurane and blood samples were taken as described below. Animals were then sacrificed by cervical dislocation and beheaded for brain excision and weighing. The liver was also collected and weighed. Part of the liver was fixed in 4% formalin, embedded in paraffin and used for histological analyses. The remaining liver was snap frozen in liquid nitrogen and kept at −80° C. until use for further analyses.

(67) Blood sampling was performed at sacrifice following a 6-hour fasting period. Blood samples were withdrawn under anesthesia by retro orbital puncture. Heparin tubes containing blood were rapidly centrifuged (15 minutes at 4,000 rpm/4° C.) and the plasma fraction was collected. Plasma aliquots were stored at −20° C. until further analyses.

(68) Plasma Biochemistry

(69) Alanine Amino Transferase (ALT)

(70) The plasmatic concentration of ALT was determined using the appropriate Randox kit for Daytona automate (Randox, cat #AL 3801). Briefly, the ALT within the plasma sample enzymatically transforms α-oxoglutarate and L-alanine into L-glutamate and pyruvate. In the presence of NADH, the generated pyruvate is converted by lactate dehydrogenase to form L-lactate and NAD.sup.+. The kinetics of the reaction is studied and allows the plasmatic level of ALT to be calculated. Results are expressed in U/L.

(71) Aspartate Amino Transferase (AST)

(72) The plasmatic concentration of AST was determined using the appropriate Randox kit for Daytona automate (Randox, cat #AS 3804). Briefly, the AST within the plasma sample enzymatically transforms α-oxoglutarate and L-aspartate into L-glutamate and oxaloacetate. In the presence of NADH, the generated oxaloacetate is converted by malate dehydrogenase to form L-malate and NAD.sup.+. The kinetics of the reaction is studied and allows the plasmatic levels of AST to be calculated. Results are expressed in U/L.

(73) Histology

(74) At sacrifice, liver samples were processed for histological analysis and examined as follows.

(75) Tissue Embedding and Sectioning

(76) The liver slices were first fixed for 12 hours in formalin 4% solution. Then, the liver pieces were washed 30 minutes in PBS, and dehydrated in ethanol solutions (successive baths at 70, 80, 95 and 100% ethanol). The liver pieces were incubated in three different baths of Xylene (Sigma-Aldrich cat #534056), followed by two baths in liquid paraffin (60° C.). Liver pieces were then put into racks that were gently filled with Histowax® to completely cover the tissue.

(77) The paraffin blocks containing the tissue pieces were removed from the racks and stored at room temperature. The liver blocks were cut into 3 μm slices.

(78) Picrosirius Red Staining

(79) Liver sections were deparaffinized, rehydrated and incubated for 15 minutes in a solution of Fast Green FCF 0.04% (Sigma-Aldrich, cat #F7258) before rinsing in a bath of 0.5% acetic acid (Sigma-Aldrich, cat #695092). Then, the liver sections were rinsed in water and incubated 30 minutes in a solution of Fast Green FCF 0.04%-0.1% sirius red (Direct Red 80, Fluka cat #43665) in saturated aqueous picric acid (Sigma-Aldrich cat #P6744). Sections were then dehydrated, and mounted using the CV Mount medium (Leica, cat #14046430011).

(80) Histological Examinations

(81) A technician blinded to the source of each liver specimen performed histological examinations. Virtual slides were generated using the Pannoramic 250 scanner from 3D Histech. Using Quant Center software (3D Histech, including Pattern Quant and Histo Quant modules), collagen-stained areas were quantified. Briefly, Pattern Quant was used to detect the tissue and measure its surface. Then, Histo Quant was used to detect the stained collagen content and measure its surface, based on a color threshold method. The fibrosis area was then expressed as the percentage of the collagen surface to the whole tissue for each animal.

(82) Hepatic fibrosis staging was blind-evaluated, using CRN fibrosis criteria.

(83) Details on the parameters, quantification/counting, and number of fields considered are provided in the following table 5.

(84) TABLE-US-00005 TABLE 5 CRN's criteria for fibrosis Points Description Parameter in score (the entire section was considered) Fibrosis 0 No fibrosis 1 Centrilobular perisinusoidal/pericellular fibrosis or portal/periportal fibrosis 2 Centrilobular perisinusoidal/pericellular fibrosis and portal/periportal fibrosis 3 Centrilobular perisinusoidal/pericellular fibrosis and/or portal fibrosis with focal or extensive bridging fibrosis 4 Cirrhosis

(85) Statistical Analysis

(86) Experimental results were expressed as mean±standard deviation (SD) and plotted as bar graphs or curves. Statistical analyses were performed as follows: For body weight and Food intake parameters:

(87) On the one hand, CSAA diet and CDAA+1% chol groups were compared by two-way ANOVA measures on factor Time followed by a Bonferroni's test, using Sigma Plot 11.0 software ($: p<0.05; $$: p<0.01; $$$ p<0.001); on the other hand, treatment groups were compared to CDAA+1% chol diet with the same statistical analyses and software (*: p<0.05; **: p<0.01; ***: p<0.001). For the measures performed after sacrifice, CSAA vs CDAA+1% chol groups were compared by a Student t-test using Sigma Plot 11.0 software (#: p<0.05; ##: p<0.01; ###: p<0.001) and treatment groups were compared to CDAA+1% chol diet by one-way ANOVA followed by a Bonferroni's test, using Sigma Plot 11.0 software (*: p<0.05; **: p<0.01; ***: p<0.001).

(88) Measurement of Hepatic Collagen Content

(89) The hepatic collagen content was determined using the appropriate QuickZyme kit (Total collagen assay, cat #QZB-totcol5). The assay is based on the detection of hydroxyproline, which is a non-proteinogenic amino acid mainly found in the triple helix of collagen. Thus, hydroxyproline in tissue hydrolysates can be used as a direct measure of the amount of collagen present in the tissue (without discrimination between procollagen, mature collagen and collagen degradation products).

(90) Complete hydrolysis of tissue samples in 6M HCl at 95° C. is required before dosing the hydroxyproline. The assay results in the generation of a chromogen with a maximum absorbance at 570 nm. Results are expressed as mg of collagen/g of liver.

(91) Procollagen III N-Terminal Propeptide (PIIINP)

(92) The plasmatic concentration of PIIINP was determined using an ELISA assay from Cloud-Clone Corp (cat #SEA573Ra), according to the manufacturer's instructions. The microtiter plate is pre-coated with an antibody specific to PIIINP. Standards or samples are added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to PIIINP. Next, Avidin conjugated to Horseradish Peroxidase (HRP) is added to each microplate well and incubated. After TMB substrate solution is added, only those wells that contain PIIINP, biotin-conjugated antibody and enzyme-conjugated Avidin will exhibit a change in color. The enzyme-substrate reaction is terminated by the addition of sulphuric acid solution and the color change is measured spectrophotometrically at a wavelength of 450 nm±10 nm. The concentration of PIIINP in the samples is then determined by comparing the OD of the samples to the standard curve. Results are expressed in pg/mL.

(93) Gene Expression

(94) RNA Extraction

(95) Hepatic Total RNA was isolated using Nucleospin® 96 Kit (Macherey Nagel) following manufacturer's instructions. 150 ng of total RNA were reverse transcribed in cDNA using M-MLV-RT (Moloney Murine Leukemia Virus Reverse Transcriptase) (Invitrogen cat #28025) in presence of RT buffer 1× (Invitrogen cat #P/NY02321), 1 mM DTT (Invitrogen cat #P/NY00147), 0.5 mM dNTPs (Promega), 200 ng pdN6 (Roche cat #11034731001) and 40 U of Ribonuclease inhibitor (Promega cat #N2515).

(96) Quantitative PCR was then carried out using the CFX96 Touch™ Real-Time PCR Detection System (Biorad). Briefly, PCR reactions were performed in 96 well plates on 5 μl of 5× diluted reverse transcription mix using the iQ SYBR Green Supermix kit (Biorad cat #170887). The experimental conditions were: 20 μL of volume reaction and 0.5 μL each of reverse and forward primers (10 pMol).

(97) TABLE-US-00006 Primer name Sequence ID Sequence (5′->3′) αSMA forward 1 CTGACAGAGGCACCACTGAA αSMA reverse 2 CATCTCCAGAGTCCAGCACA Col1α1 forward 3 AGGCGAACAAGGTGACAGAG Col1α1 reverse 4 GCCAGGAGAACCAGCAGAG Col1α2 forward 5 ATTGGAAGCCGAGGTCCCAG Col1α2 reverse 6 TTTGCCCCCAGGTATGCCAG TGFβ1 forward 7 TTGCTTCAGCTCCACAGAGA TGFβ1 reverse 8 TGGTTGTAGAGGGCAAGGAC TIMP1 forward 9 ATTCAAGGCTGTGGGAAATG TIMP1 reverse 10 CTCAGAGTACGCCAGGGAAC TIMP2 forward 11 GCATCACCCAGAAGAAGAGC TIMP2 reverse 12 GGGTCCTCGATGTCAAGAAA MMP2 forward 13 TCCCTAAGCTCATCGCAGAC MMP2 reverse 14 GCTTCCAAACTTCACGCTCT MMP7 forward 15 TAATTGGCTTCGCAAGGAGA MMP7 reverse 16 AAGGCATGACCTAGAGTGTT CC CCR2 forward 17 TAATATGTTACCTCAGTTCA TCCACGG CCR2 reverse 18 TGCTCTTCAGCTTTTTACAG CCTATC CCR5 forward 19 ATTCTCCACACCCTGTTTCG CCR5 reverse 20 GAATTCCTGGAAGGTGGTCA GAPDH forward 21 TATGACTCCACTCACGGCAA GAPDH reverse 22 TCCACGACATACTCAGCACC

(98) Expression levels were normalized using the expression of GAPDH gene as reference.

(99) For each gene, the standard curve was drawn by selecting the best points (at least three points) in order to have PCR reaction efficiency close to 100% and a correlation coefficient close to 1. Expression levels were determined using the standard curve equation for both the housekeeping gene and the target gene (taking into account the specific PCR efficiency of each target gene).

(100) Results and Conclusions:

(101) The abnormal persistence of differentiated myofibroblasts is a characteristic of many fibrotic diseases.

(102) Following liver injury, quiescent HSCs undergo a process of activation that is characterized by a differentiation into (α-SMA)-positive myofibroblasts.

(103) NTZ as a single agent was shown to confer an anti-fibrotic activity in TGFβ-induced hHSC (FIG. 1B). Since it is known that NTZ is rapidly hydrolyzed into its active metabolite tizoxanide (TZ) (Broekhuysen, Stockis et al. 2000), this metabolite was also evaluated for its antifibrotic activity in HSC. TZ showed a profile similar to the parent drug (data not shown). On the other hand, some PPAR agonists like Elafibranor also revealed an antifibrotic profile in the TGFβ induced HSC model (FIG. 1A). Other PPAR agonists like bezafibrate revealed a weak activity suggesting that PPAR agonists are not equivalent regarding their antifibrotic properties (FIG. 1C).

(104) In order to evaluate if a combination of Elafibranor with NTZ could reduce fibrosis in a synergistic manner, combination matrix experiments were performed in TGFβ-induced HSCs. Briefly, NTZ and Elafibranor solutions were serially diluted in a checkerboard format generating a 42 combinations matrix covering a large panel of Elafibranor/NTZ ratios. Synergy was first determined by calculating Excess Over Bliss scores. These experiments revealed that NTZ could synergize with Elafibranor to reduce α-SMA production in activated HSCs. Several combination pairs revealed an EOB score over 10, which is indicative of a synergism (FIG. 2B). To validate the synergism, the experimental values corresponding to top EOB score were plotted in a bar graph (FIG. 2C). These graphs illustrate that the combination of NTZ with Elafibranor shows a superior antifibrotic effect that is statistically significant compared to the highest single agent (NTZ or Elafibranor). The most impressive example is represented with the combination pair NTZ at 0.6 μM and Elafibranor at 5 μM. Although NTZ shows almost no antifibrotic activity at 0.6 μM, the addition of Elafibranor at 5 μM results in a strong reduction of αSMA of 55%, which is much stronger than the effect observed with the single agents alone. In conclusion, the applicant has discovered unexpected antifibrotic activities for a combination of a compound of Formula (I) with specific PPAR agonist(s). These results suggest that a combination of a compound of Formula (I) with a PPAR agonist can be synergistic and can provide therapeutic benefits in multiple types of fibrotic diseases.

(105) The administration of a choline-deficient and L-amino acid-deficient (CDAA)+1% cholesterol diet to mice causes progressive fibrosing steatohepatitis that is pathologically similar to human non-alcoholic steatohepatitis (NASH).

(106) The CDAA+1% cholesterol diet notably induces a significant increase in the hepatic collagen, as shown in the FIG. 3.

(107) This figure also shows that administration of Elafibranor or NTZ alone decreases the hepatic collagen content. The decrease in collagen is proportional to the dose of elafibranor or NTZ administered.

(108) When a combination of Elafibranor and NTZ is administered, the decrease in collagen produced is greater than the decrease observed for each compound taken separately.

(109) There is therefore a synergistic effect of the combination of elafibranor and NTZ on the decrease in collagen production. In other words, there is a noticed anti-fibrotic effect when Elafibranor and NTZ are combined.

(110) The better effect is observed for the combination comprising Elafibranor at 2.8 mpk (mg per kilogram) and NTZ at 77.7 mpK, expressed in calculated doses.

(111) The FIG. 4 represents the results obtained with the histology, i.e. the determination of the fibrosis area which was expressed as the percentage of the collagen surface to the whole tissue for each animal.

(112) The CDAA+1% cholesterol diet notably induces a significant increase in the fibrosis percentage.

(113) The FIG. 4 also shows that administration of Elafibranor or NTZ alone decreases the fibrosis percentage. The decrease is proportional to the dose of elafibranor or NTZ administered.

(114) When a combination of Elafibranor and NTZ is administered, the decrease in fibrosis percentage is greater than the decrease observed for each compound taken separately.

(115) There is therefore a synergistic effect of the combination of elafibranor and NTZ on the decrease in the fibrosis percent. In other words, there is a noticed anti-fibrotic effect when Elafibranor and NTZ are combined.

(116) The better effect is observed for the combination comprising Elafibranor at 2.8 mpk (mg per kilogram) and NTZ at 77.7 mpK, expressed in calculated doses.

(117) The FIGS. 5 to 11 represent the gene expression of different hepatic markers of fibrosis. For all markers, the CDAA+1% cholesterol diet notably induces a significant increase in the gene expressions.

(118) It can also be noted that that administration of Elafibranor or NTZ alone decreases the level of the different gene expression. The decrease is proportional to the dose of elafibranor or NTZ administered.

(119) When a combination of Elafibranor and NTZ is administered, the decrease in the gene expression is greater than the decrease observed for each compound taken separately.

(120) There is therefore a synergistic effect of the combination of elafibranor and NTZ on the decrease in the gene expression of different hepatic markers of fibrosis. In other words, there is a noticed anti-fibrotic effect when Elafibranor and NTZ are combined.

(121) To assess the synergism with the combination of NTZ with component (ii), GS-0976, Selonsertib (GS-4997), GKT-831, KD-025, Cenicriviroc (CVC), Tropifexor (LJN-452), and Aramchol were validated on anti-fibrotic activity. The combination of NTZ with GS-0976, Selonsertib (GS-4997), GKT-831, KD-025, Cenicriviroc, Tropifexor, and Aramchol revealed an EOB score>0, which is indicative of a synergism.

(122) The combination of GS-0976 at 10 μM and NTZ at 1.25 μM resulted also in a significant and strong reduction of αSMA of 64%, which was much stronger than the effect observed with the single agents alone (FIG. 12A). The combination of Selonsertib (GS-4997) at 10 μM and NTZ at 2.5 μM also resulted in a significant and strong reduction of αSMA of 77%, which was much stronger than the effect observed with the single agents alone (FIG. 12B). The synergism was even more pronounced with the combination of GKT-831 0.3 μM and NTZ at 0.3 μM (FIG. 12C) and the combination of KD-025 at 1 μM and NTZ at 0.3 μM (FIG. 12D).

(123) The combination of Cenicriviroc at 3 μM and NTZ at 2.5 μM resulted also in a significant and strong reduction of αSMA of 47%, which was much stronger than the effect observed with the single agents alone (FIG. 12E). The synergism was to the same extent with the combination of Tropifexor 3 μM and NTZ at 1.3 μM (FIG. 12F). The combination with Aramchol at 3 μM and NTZ at 0.625 μM reached a reduction of αSMA of 52%.

(124) By contrast, no synergism could be observed with the combination of NTZ with Nalmefene (JKB-121), originally known as nalmetrene, an opioid antagonist and TLR-4 antagonist used primarily in the management of alcohol dependence, or PBI-4050, a potential treatment for idiopathic pulmonary fibrosis, acute lung injury, cystic fibrosis, diabetic.

(125) In conclusion, the applicant has discovered unexpected antifibrotic activities for a combination of a compound of Formula (I) with specific ROCK2 inhibitor(s), ACC inhibitor(s), dual NOX1 and NOX4 inhibitors, ASK1 inhibitor(s), Fatty Acid Bile Acid conjugates (FABAC), FXR agonists, and CCR antagonists.

(126) These results suggest that a combination of a compound of Formula (I) or Formula (II) with a ROCK2 inhibitor, an ACC inhibitor, a dual NOX1 and NOX4 inhibitor, an ASK1 inhibitor, a Fatty Acid Bile Acid Conjugate, an FXR agonist, and a CCR antagonist can be synergistic and/or can have additional effect and can also provide therapeutic benefits in multiple types of fibrotic diseases.

REFERENCES

(127) Broekhuysen, J., A. Stockis, et al. (2000). “Nitazoxanide: pharmacokinetics and metabolism in man.” Int J Clin Pharmacol Ther 38(8): 387-394. de Carvalho, L. P. S., C. M. Darby, et al. (2011). “Nitazoxanide disrupts membrane potential and intrabacterial pH homeostasis of Mycobacterium tuberculosis.” ACS Med. Chem. Lett. 2 (Copyright® 2015 American Chemical Society (ACS). All Rights Reserved.): 849-854. Di Santo, N. and J. Ehrisman (2014). “A functional perspective of nitazoxanide as a potential anticancer drug.” Mutat. Res., Fundam. Mol. Mech. Mutagen. 768 (Copyright® 2015 American Chemical Society (ACS). All Rights Reserved.): 16-21. Dubreuil, L., I. Houcke, et al. (1996). “In vitro evaluation of activities of nitazoxanide and tizoxanide against anaerobes and aerobic organisms.” Antimicrob. Agents Chemother. 40 (Copyright® 2015 American Chemical Society (ACS). All Rights Reserved.): 2266-2270. Finegold, S. M., D. Molitoris, et al. (2009). “Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.” Antimicrob. Agents Chemother. 53 (Copyright® 2015 American Chemical Society (ACS). All Rights Reserved.): 281-286. Fox, L. M. and L. D. Saravolatz (2005). “Nitazoxanide: a new thiazolide antiparasitic agent.” Clin. Infect. Dis. 40 (Copyright® 2015 American Chemical Society (ACS). All Rights Reserved.): 1173-1180. Hemphill, A., J. Mueller, et al. (2006). “Nitazoxanide, a broad-spectrum thiazolide anti-infective agent for the treatment of gastrointestinal infections.” Expert Opin. Pharmacother. 7 (Copyright® 2015 American Chemical Society (ACS). All Rights Reserved.): 953-964. Hoffman, P. S., G. Sisson, et al. (2007). “Antiparasitic drug nitazoxanide inhibits the pyruvate oxidoreductases of Helicobacter pylori, selected anaerobic bacteria and parasites, and Campylobacter jejuni.” Antimicrob. Agents Chemother. 51 (Copyright® 2015 American Chemical Society (ACS). All Rights Reserved.): 868-876. Megraudd, F., A. Occhialini, et al. (1998). “Nitazoxanide, a potential drug for eradication of Helicobacter pylori with no cross-resistance to metronidazole.” Antimicrob. Agents Chemother. 42 (Copyright® 2015 American Chemical Society (ACS). All Rights Reserved.): 2836-2840. Pankuch, G. A. and P. C. Appelbaum (2006). “Activities of tizoxanide and nitazoxanide compared to those of five other thiazolides and three other agents against anaerobic species.” Antimicrob. Agents Chemother. 50 (Copyright® 2015 American Chemical Society (ACS). All Rights Reserved.): 1112-1117. Rossignol, J.-F. (2014). “Nitazoxanide: A first-in-class broad-spectrum antiviral agent.” Antiviral Res. 110 (Copyright® 2015 American Chemical Society (ACS). All Rights Reserved.): 94-103. Rossignol, J. F. and R. Cavier (1975). 2-Benzamido-5-nitrothiazoles, S.P.R.L. Phavic, Belg. 11 pp. Rossignol, J. F. and H. Maisonneuve (1984). “Nitazoxanide in the treatment of Taenia saginata and Hymenolepis nana infections.” Am J Trop Med Hyg 33 (Copyright® 2015 U.S. National Library of Medicine.): 511-512.