Extracts of <i>Andrographis paniculata</i>, methods for preparation and use thereof
11191798 · 2021-12-07
Assignee
Inventors
- Wei-Guo Su (Shanghai, CN)
- Xiong LI (Shanghai, CN)
- Weihan Zhang (Shanghai, CN)
- Bo Liu (Shanghai, CN)
- Huaqing Cai (Shanghai, CN)
- Zhilong Weng (Shanghai, CN)
- Hongqiang Wang (Shanghai, CN)
- Zhiyong Yu (Shanghai, CN)
- Lei JIANG (Shanghai, CN)
Cpc classification
A61P29/00
HUMAN NECESSITIES
A61P1/00
HUMAN NECESSITIES
International classification
A61P1/00
HUMAN NECESSITIES
A61P29/00
HUMAN NECESSITIES
Abstract
Disclosed herein are extracts of Andrographis paniculata having highly concentrated active ingredients, preparation methods and medical use for treating autoimmunity and inflammatory disease.
Claims
1. An extract of Andrographis paniculata, comprising at least 50.0% total andrographolide lactones by weight relative to the weight of the extract, wherein the total andrographolide lactones comprise AND, NAND, DAND, and DDAND, in amounts ranging from 20.0 to 50.0%, 2.0 to 15.0%, 0.5 to 6.0%, and 5.0 to 20.0%, respectively, by weight relative to the weight of the extract.
2. The extract of claim 1, wherein, the amount of total andrographolide lactones ranges from 55.0 to 75.0% by weight relative to the weight of the extract, wherein the total andrographolide lactones comprise AND, NAND, DAND, and DDAND, in amounts ranging from 20.0 to 50.0%, 4.0 to 15.0%, 0.5 to 6.0%, and 5.0 to 15.0%, respectively, by weight relative to the weight of the extract.
3. The extract of claim 1, wherein, the amount of total andrographolide lactones ranges from 55.0 to 75.0% by weight relative to the weight of the extract, wherein the total andrographolide lactones comprise AND, NAND, DAND, and DDAND, in amounts ranging from 25.0 to 45.0%, 4.0 to 12.0%, 1.0 to 5.0%, and 5.0 to 10.0%, respectively, by weight relative to the weight of the extract.
4. The extract of claim 1, wherein the amount of total andrographolide lactones ranges from 55.0 to 75.0% by weight relative to the weight of the extract, wherein the total andrographolide lactones comprise AND, NAND, DAND, and DDAND, in amounts ranging from 30.0 to 45.0%, 6.0 to 10.0%, 1.0 to 5.0%, and 5.0 to 10.0%, respectively, by weight relative to the weight of the extract.
5. A process for preparing the extract of claim 1, comprising the steps: (a) refluxing the dried aerial part of Andrographis paniculata with 80%-95% ethanol to provide a first ethanol extract; (b) adding dextrin to the first ethanol extract, and drying the resulting mixture to obtain a first solid; (c) extracting the first solid with 90-100% ethanol, collecting the ethanol phase and decolorizing it with activated charcoal, collecting the liquid phase, and removing the solvent to provide a second solid; and (d) washing the second solid with a weakly polar or non-polar organic solvent, and collecting the resulting solid residue to provide the extract of Andrographis paniculate, wherein the process further comprises the step of: (i) before step (d), washing the second solid with water and collecting the resulting solid residue; or (ii) before step (c), washing the first solid with water and collecting the resulting solid residue.
6. The extract of Andrographis paniculata according to claim 1, prepared by a process comprising the steps: (a) refluxing the dried aerial part of Andrographis paniculata with 80%-95% ethanol to provide a first ethanol extract; (b) adding dextrin to the first ethanol extract, and drying the resulting mixture to obtain a first solid; (c) extracting the first solid with 90-100% ethanol, collecting the ethanol phase and decolorizing it with activated charcoal, collecting the liquid phase, and removing the solvent to provide a second solid; (d) washing the second solid with water and collecting the resulting solid residue; and (e) washing the solid residue with a weakly polar or non-polar organic solvent, and collecting the resulting solid residue to provide the extract of Andrographis paniculata.
7. The extract of Andrographis paniculata according to claim 1, prepared by a process comprising the steps: (a) refluxing the dried aerial part of Andrographis paniculata with 80%-95% ethanol to provide a first ethanol extract; (b) adding dextrin to the first ethanol extract, and drying the resulting mixture to obtain a first solid; (c) washing the first solid with water, and collecting the resulting solid residue; (d) extracting the solid residue with 90-100% ethanol, collecting the ethanol phase and decolorizing it with activated charcoal, collecting the liquid phase, and removing the solvent to provide a second solid; (e) washing the second solid with a weakly polar or non-polar organic solvent, and collecting the resulting solid residue to provide the extract of Andrographis paniculata.
8. A pharmaceutical composition comprising an extract of claim 1 and a pharmaceutically acceptable excipient.
9. A method of treating autoimmunity and inflammatory disease in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of a pharmaceutical composition of claim 8.
10. The method of claim 9, wherein the autoimmunity and inflammatory disease is selected from rheumatoid arthritis (RA), inflammatory bowel disease (IBD), psoriasis, systemic lupus erythematosus (SLE), asthma, and chronic obstructive pulmonary disease (COPD).
11. The method of claim 9, wherein the inflammatory bowel disease is ulcerative colitis or Crohn's Disease.
12. The process of claim 5, wherein step (a) comprises refluxing the dried aerial part of Andrographis paniculata with 80%-95% ethanol twice.
13. The process of claim 5, wherein step (a) comprises (i) refluxing the dried aerial part of Andrographis paniculata with 80%-95% ethanol, (ii) extracting the solid residue with additional 80%-95% ethanol, (iii) combining the ethanol phases, and (iv) removing the solvent to provide the first ethanol extract.
14. The process of claim 5, wherein step (a) comprises (i) refluxing the dried aerial part of Andrographis paniculata with 80%-95% ethanol, (ii) extracting the solid residue with additional 80%-95% ethanol, (iii) combining the ethanol phases, and (iv) removing the solvent to provide the first ethanol extract.
15. An extract of Andrographis paniculata prepared by the process of claim 5.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DEFINITIONS
(10) As used in the present specification, the following words, phrases, and symbols are generally intended to have the meanings as set forth below, except to the extent that the context in which they are used indicates otherwise. The following abbreviations and terms have the indicated meanings throughout:
(11) As used herein, the term “the weight of the extract” refers to the weight of the extract that does not undergo further drying before next use.
(12) As used herein, the term “total andrographolide lactones” refers to the total of compounds existing in the extract disclosed herein with a diterpenoid-lactone as core structure. For example, the total andrographolide lactones comprises, but not limited to, AND, NAND, DAND, and DDAND.
(13) As used herein, the term “Andrographolide (AND)” refers to the compound having the CAS Registry Number as 5508-58-7.
(14) As used herein, the term “14-deoxyandrographolide (DAND)” refers to the compound having the CAS Registry Number as 4176-97-0.
(15) As used herein, the term “Neoandrographolide (NAND)” refers to the compound having the CAS Registry Number as 27215-14-1.
(16) As used herein, the term “14-Deoxy-11,12-dehydroandrographolide (DDAND)” refers to the compound having the CAS Registry Number as 42895-58-9.
(17) As used herein, the term “80%-95% ethanol” refers to an ethanol containing water (ethanol-water solvent) wherein the amount of ethanol ranges from 80 to 95% by volume relative to the total volume of the ethanol water solvent.
(18) As used herein, the term “90%-100% ethanol” refers to an ethanol containing water (ethanol-water solvent) or no water wherein the amount of ethanol ranges from 90 to 100% by volume relative to the total volume of the ethanol or ethanol-water solvent.
(19) As used herein, the term “absolute ethanol” refers to high-purity ethanol solvent containing at least 99% ethanol, such as ≥99.5% ethanol (industrial grade), ≥99.7% ethanol (chemically pure), ≥99.8% ethanol (analytically pure).
(20) As used herein, the term “subject” means mammals and non-mammals. Mammals means any member of the mamalia class including, but not limited to, humans; non-human primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, and swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice, and guinea pigs; and the like. Examples of non-mammals include, but are not limited to, birds, and the like. The term “subject” does not denote a particular age or sex. In some embodiments, the subject is a human.
(21) As used herein, the term “pharmaceutically acceptable” means the substance following this term is useful in preparing a pharmaceutical composition and is generally safe, non-toxic, and neither biologically nor otherwise undesirable, especially for human pharmaceutical use.
(22) As use herein, the term “about” means approximately, in the region of, roughly, or around. When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term “about” is used herein to modify a numerical value above and below the stated value by a variance of 20%.
(23) As used herein, the term “weakly polar or non-polar organic solvent” refers to an organic solvent selected from, for example, non-polar solvents, such as alkanes, further such as hexane, petroleum ether, and n-heptane, and from weakly polar solvent such as methyl tert-butyl ether.
(24) Embodiments
(25) Extracts of Andrographis paniculata:
(26) Provided is an extract of Andrographis paniculata comprising at least 50% of total andrographolide lactones by weight relative to the weight of the extract, wherein the total andrographolide lactones comprise AND, NAND, DAND, and DDAND, in amounts ranging from 20.0 to 50.0%, 2.0 to 15.0%, 0.5 to 6.0%, and 5.0 to 20.0%, respectively, by weight relative to the weight of the extract.
(27) In some embodiments, the extract of Andrographis paniculata comprising at least 50% of total andrographolide lactones by weight relative to the weight of the extract, wherein the total andrographolide lactones comprise AND, NAND, DAND, and DDAND, in amounts ranging from 20.0 to 50.0%, 4.0 to 15.0%, 0.5 to 6.0%, and 5.0 to 15.0%, respectively, by weight relative to the weight of the extract.
(28) In some embodiments, the amount of total andrographolide lactones ranges from 55.0 to 75.0% by weight relative to the weight of the extract.
(29) In some embodiments, the amount of total andrographolide lactones ranges from 55.0 to 70.0% by weight relative to the weight of the extract.
(30) In some embodiments, the amount of total andrographolide lactones ranges from 60.0 to 70.0% by weight relative to the weight of the extract.
(31) In some embodiments, the amount of AND ranges from 25.0 to 45.0% by weight relative to the weight of the extract.
(32) In some embodiments, the amount of AND ranges from 25.0 to 30% by weight relative to the weight of the extract.
(33) In some embodiments, the amount of AND ranges from 25.0 to 42.5% by weight relative to the weight of the extract.
(34) In some embodiments, the amount of AND ranges from 30.0 to 45.0% by weight relative to the weight of the extract.
(35) In some embodiments, the amount of NAND ranges from 2.0 to 12.0% by weight relative to the weight of the extract.
(36) In some embodiments, the amount of NAND ranges from 2.0 to 10.0% by weight relative to the weight of the extract.
(37) In some embodiments, the amount of NAND ranges from 2.0 to 9.0% by weight relative to the weight of the extract.
(38) In some embodiments, the amount of NAND ranges from 2.0 to 8.0% by weight relative to the weight of the extract.
(39) In some embodiments, the amount of NAND ranges from 2.0 to 6.0% by weight relative to the weight of the extract.
(40) In some embodiments, the amount of NAND ranges from 2.0 to 4.0% by weight relative to the weight of the extract.
(41) In some embodiments, the amount of NAND ranges from 4.0 to 12.0% by weight relative to the weight of the extract.
(42) In some embodiments, the amount of NAND ranges from 6.0 to 10.0% by weight relative to the weight of the extract.
(43) In some embodiments, the amount of NAND ranges from 6.0 to 9.0% by weight relative to the weight of the extract.
(44) In some embodiments, the amount of NAND ranges from 6.0 to 8.0% by weight relative to the weight of the extract.
(45) In some embodiments, the amount of DAND ranges from 1.0 to 5.0% by weight relative to the weight of the extract.
(46) In some embodiments, the amount of DAND ranges from 1.0 to 4.0% by weight relative to the weight of the extract.
(47) In some embodiments, the amount of DAND ranges from 2.0 to 4.0% by weight relative to the weight of the extract.
(48) In some embodiments, the amount of DDAND ranges from 5.0 to 15.0% by weight relative to the weight of the extract.
(49) In some embodiments, the amount of DDAND ranges from 10.0 to 15.0% by weight relative to the weight of the extract.
(50) In some embodiments, the amount of DDAND ranges from 5.0 to 10.0% by weight relative to the weight of the extract.
(51) In some embodiments, the amount of DDAND ranges from 6.0 to 9.0% by weight relative to the weight of the extract.
(52) In some embodiments, the amount of DDAND ranges from 7.0 to 9.0% by weight relative to the weight of the extract.
(53) Methods for Preparation:
(54) Method 1:
(55) Further provided is a first method of preparing the extract of Andrographis paniculata, comprising: refluxing the dried aerial part of Andrographis paniculata with 80%-95% ethanol; optionally extracting the solid residue with additional 80%-95% ethanol, combining the ethanol phase; collecting the ethanol phase and removing the solvent to provide a first ethanol extract; adding dextrin to the first ethanol extract; and drying the resulting mixture to obtain a first solid; extracting the first solid with 90-100% ethanol; collecting the ethanol phase and decolorizing with activated charcoal; collecting the liquid phase and removing the solvent to provide a second solid; washing the second solid with water; collecting the resulting solid residue; and washing the solid residue obtained after the water-washing step with a weakly polar or non-polar organic solvent; collecting the resulting solid residue to provide the extract of Andrographis paniculata.
(56) In some embodiments, the dried aerial part of Andrographis paniculata was crushed before being subject to extraction with 80-95% ethanol.
(57) In some embodiments, the 80-95% ethanol used in the first step is 89-91% ethanol.
(58) In some embodiments, the 80-95% ethanol used in the first step is 90% ethanol.
(59) In some embodiments, the refluxing of the dried aerial part of Andrographis paniculata with 80-95% ethanol is performed twice (i.e., extracting the solid residue with additional 80%-95% ethanol once), each time for about 2 hours, i.e., 96 to 144 minutes, such as 110 to 130 minutes. In some embodiments, the optional extraction of the solid residue with additional 80%-95% ethanol is performed by refluxing the residue solids with additional 80%-95% ethanol for about 2 hours, i.e., 96 to 144 minutes, such as 110 to 130 minutes.
(60) In some embodiments, the ratio of the dried aerial part of Andrographis paniculata to 80-95% ethanol (or to the additional 80-95% ethanol) (kg/L) ranges from 1:4 to 1:10, such as from 1:5 to 1:6.
(61) In some embodiments, the first ethanol extract has a density of 1.0-1.1 g/ml.
(62) In some embodiments, the amount of dextrin added is about 3% (i.e., 2.4 to 3.6%) by weight of the dried aerial part of Andrographis paniculata used. In some embodiments, dextrin was added in the form of a solution, such as in the form of water solution.
(63) In some embodiments, the extraction of the first solid with 90-100% ethanol is performed 1-2 times, such as 2 times, each time for about 1 hour, i.e., 48 to 72 minutes, such as 55 to 65 minutes.
(64) In some embodiments, the 90-100% ethanol used in the third step is absolute ethanol.
(65) In some embodiments, the 90-100% ethanol used in the third step is 95% ethanol.
(66) In some embodiments, the extraction of the first solid with 90-100% ethanol can utilize any one of the following extraction processes: (1) stirring at room temperature, (2) stirring while heating at 30-80° C., or (3) a refluxing extraction process. In some embodiments, the extraction with 90-100% ethanol refers to a refluxing extraction process, i.e., refluxing in 90-100% ethanol, such as refluxing in absolute ethanol.
(67) In some embodiments, the amount of activated charcoal used is 5-20%, such as 20%, by weight, of the first solid obtained after dextrin addition.
(68) In some embodiments, the decolorization with activated charcoal was performed at 50-80° C., such as 58-63° C., for an appropriate time as recognized by one of ordinary skill in the art.
(69) In some embodiments, the water-washing step refers to stirring in water at 70-90° C., such as 80-85° C., for an appropriate time as recognized by one of ordinary skill in the art. In some embodiments, the ratio of the first solid obtained after dextrin addition to the water (kg/L) ranges from 1:5 to 1:15, such as from 1:8-1:12, or 1:10.
(70) In some embodiments, the water-washing step is performed one or more times, such as once or twice.
(71) In some embodiments, the weakly polar or non-polar organic solvent can be selected from, for example, non-polar solvents, such as alkanes, further such as hexane, petroleum ether, and n-heptane, and from weakly polar solvent such as methyl tert-butyl ether. In some embodiments, the weakly polar or non-polar organic solvent is n-heptane.
(72) In some embodiments, prior to the step of washing with weakly polar or non-polar organic solvent, the solid residue obtained in the water-washing step is dissolved in absolute ethanol and concentrated to afford a solid.
(73) In some embodiments, the step of washing with weakly polar or non-polar organic solvent is performed at 15-30° C., such as 20-30° C., for an appropriate time as recognized by one of ordinary skill in the art. In some embodiments, the step of washing with weakly polar or non-polar organic solvent refers to stirring in the weakly polar or non-polar organic solvent at 15-30° C., such as 20-30° C., for an appropriate time as recognized by one of ordinary skill in the art.
(74) Method 2:
(75) Further provided is a second method of preparing the extract of Andrographis paniculata, as disclosed herein, comprising: refluxing the dried aerial part of Andrographis paniculata with 80%-95% ethanol; optionally extracting the solid residue with additional 80%-95% ethanol, combining the ethanol phase; collecting the ethanol phase and removing the solvent to provide a first ethanol extract; adding dextrin to the first ethanol extract; and drying the resulting mixture to obtain a first solid; washing the first solid with water; collecting the resulting solid residue; extracting the solid residue obtained in the water-washing step with 90-100% ethanol; collecting the ethanol phase and decolorizing with activated charcoal; collecting the liquid phase and removing the solvent to provide a second solid; washing the second solid with a weakly polar or non-polar organic solvent; collecting the resulting solid residue to provide the extract of Andrographis paniculata.
(76) In some embodiments, the dried aerial part of Andrographis paniculata was crushed before being subject to extraction with 80-95% ethanol.
(77) In some embodiments, the 80-95% ethanol used in the first step is 89-91% ethanol.
(78) In some embodiments, the 80-95% ethanol used in the first step is 90% ethanol.
(79) In some embodiments, the refluxing of the dried aerial part of Andrographis paniculata with 80-95% ethanol is performed twice (i.e., extracting the solid residue with additional 80%-95% ethanol once), each time for about 2 hours, i.e., 96 to 144 minutes, such as 110 to 130 minutes. In some embodiments, the optional extraction of the solid residue with additional 80%-95% ethanol is performed by refluxing the residue solids with additional 80%-95% ethanol for about two hours, i.e., 96 to 144 minutes, such as 110 to 130 minutes.
(80) In some embodiments, the ratio of the dried aerial part of Andrographis paniculata to 80-95% ethanol (or to the additional 80-95% ethanol) (kg/L) ranges from 1:5 to 1:10, such as from 1:5 to 1:6.
(81) In some embodiments, the first ethanol extract has a density of 1.0-1.1 g/ml.
(82) In some embodiments, the amount of dextrin added is about 3% (i.e., 2.4 to 3.6%) by weight of the dried aerial part of Andrographis paniculata used. In some embodiments, dextrin was added in the form of a solution, such as in the form of water solution.
(83) In some embodiments, the water-washing step refers to stirring in water at 70-90° C., such as 80-85° C. In some embodiments, the ratio of the first solid obtained after dextrin addition to the water (kg/L) ranges from 1:5 to 1:15, such as from 1:8-1:12, or 1:10.
(84) In some embodiments, the water-washing step is performed one or more times, such as once or twice, for an appropriate time as recognized by one of ordinary skill in the art.
(85) In some embodiments, the extraction with 90-100% ethanol is performed 1-2 times, such as twice, each time for about 1 hour, i.e., 48 minutes to 72 minutes, such as 55 to 65 minutes.
(86) In some embodiments, the 90-100% ethanol used in the fourth step is absolute ethanol.
(87) In some embodiments, the 90-100% ethanol used in the fourth step is 95% ethanol.
(88) In some embodiments, the extraction with 90-100% ethanol can be any one of the following extraction processes: (1) stirring at room temperature, (2) stirring while heating at 30-80° C., or (3) a refluxing extraction process. In some embodiments, the extraction with absolute ethanol refers to a refluxing extraction process, i.e., refluxing in 90-100% ethanol, such as refluxing in absolute ethanol.
(89) In some embodiments, the amount of activated charcoal used is 5-20%, such as 20%, by weight, of the first solid obtained after dextrin addition.
(90) In some embodiments, the decolorization with activated charcoal was performed at 50-80° C., such as 70-80° C., for an appropriate time as recognized by one of ordinary skill in the art.
(91) In some embodiments, the weakly polar or non-polar organic solvent can be selected from, for example, non-polar solvents, such as alkanes, further such as hexane, petroleum ether, and n-heptane, and from weakly polar solvent such as methyl tert-butyl ether. In some embodiments, the weakly polar or non-polar organic solvent is n-heptane.
(92) In some embodiments, the step of washing with weakly polar or non-polar organic solvent is performed at 15-30° C., such as 20-30° C., for an appropriate time as recognized by one of ordinary skill in the art. In some embodiments, the step of washing with weakly polar or non-polar organic solvent refers to stirring in the weakly polar or non-polar organic solvent at 15-30° C., such as 20-30° C., for an appropriate time as recognized by one of ordinary skill in the art.
(93) Use of the Extracts Disclosed Herein
(94) Further disclosed is a method of treating autoimmunity and inflammatory diseases in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of the extract as disclosed herein.
(95) Further disclosed is a use of the extract as disclosed herein for treating autoimmunity and inflammatory diseases in a subject.
(96) Further disclosed is a use of the extract as disclosed herein in the manufacture of a medicament for treating autoimmunity and inflammatory diseases in a subject.
(97) In some embodiment, the autoimmunity and inflammatory diseases is selected from rheumatoid arthritis (RA), inflammatory bowel disease (IBD), psoriasis, systemic lupus erythematosus (SLE), asthma, and chronic obstructive pulmonary disease (COPD).
(98) In some embodiment, the inflammatory bowel disease is Crohn's disease (CD).
(99) In some embodiments, the inflammatory bowel disease is ulcerative colitis (UC).
(100) In some embodiments, the extract is in the form a pharmaceutically acceptable composition comprising the extract as disclosed herein.
(101) In some embodiments, the expression level of FGF1 and/or FGF2 in the subject is elevated after administering to the subject the therapeutically effective amount of the extract as disclosed herein.
(102) Composition
(103) Further disclosed is a pharmaceutical composition comprising the extract as disclosed herein and a pharmaceutically acceptable excipient (e.g. a pharmaceutically acceptable carrier).
(104) The pharmaceutical composition comprising the extract disclosed herein, and a pharmaceutically acceptable excipient, can be administered orally in solid dosage forms, such as capsules and tablets.
(105) Gelatin capsules containing the extract and powdered excipients, such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, silicon dioxide and the like, can also be used. Similar diluents can be used to make compressed tablets. Both tablets and capsules can be manufactured as sustained release products to provide for continuous release of medication over a period of time. Compressed tablets can be sugar coated or film coated to mask any unpleasant taste and protect the tablet from the atmosphere, or enteric coated for selective disintegration in the gastrointestinal tract. For example, the tablets can be film-coated with a paste prepared by mixing excipients comprising hypromellose, propylene glycol, titanium dioxide, and purified water.
(106) A pharmaceutically acceptable excipient is, for example, selected from excipients that are compatible with the extract disclosed herein and not deleterious to the subject to be treated. For example, solubilizing agents, such as cyclodextrins (which can form specific, more soluble complexes with the at least one compound and/or at least one pharmaceutically acceptable salt disclosed herein), can be utilized as pharmaceutical excipients for delivery of the extracts disclosed herein. Examples of other excipients include colloidal silicon dioxide, magnesium stearate, cellulose, sodium lauryl sulfate, and pigments such as D&C Yellow #10. Suitable pharmaceutically acceptable excipients are disclosed in Remington's Pharmaceutical Sciences, A. Osol, a standard reference text in the art.
(107) Useful pharmaceutical dosage forms for administration of the extract disclosed herein include, but are not limited to, hard and soft gelatin capsules, and tablets.
(108) The dosage administered will be dependent on factors, such as the age, health and weight of the recipient, the extent of disease, type of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired. In general, a daily dosage of the active ingredient can vary, for example, from 0.1 to 10,000, such as from 0.1 to 2000 milligrams per day. For example, 10-500 milligrams once or multiple times per day may be effective to obtain the desired results.
(109) In some embodiments, the extract disclosed herein can be present in an amount of 1, 5, 10, 15, 20, 25, 50, 75, 80, 85, 90, 95, 100, 125, 150, 200, 250, 300, 400 or 500 mg in a tablet or capsule.
(110) Analytical Methods
(111) 1. qHNMR (Quantitative HNMR) Method for Determination the Amount of the Total Andrographolide Lactones in the Extracts:
(112) The amount of the total andrographolide lactones in the extracts was analyzed via qHNMR method detecting three typical types (namely as type A, type B, and type C) of diterpenoid lactones. For example, AND belongs to type A, DAND and NAND belong to type B, and DDAND belongs to type C.
(113) 1.1 Instruments and Parameters:
(114) NMR: Varian 400-MR or equivalent;
(115) Probe: Varian 400 ASW PFG
(116) Data acquisition and processing system: VNMRJ 4.0
(117) Pulse sequence: s2pul
(118) Temperature: 20-30° C.
(119) Spectral width: 6378 Hz
(120) Delay time: 12 s
(121) Pulse width: 10 degree
(122) Acquisition time: 2.569 s
(123) Number of Scans: 32
(124) 1.2 Reagents
(125) Deuterated reagent: DMSO-d6 (containing tetramethylsilane, TMS), J&K
(126) Internal standard: 2,3,5-Triiodobenzoic acid (TIBZ), Amethyst
(127) Reference substance: AND, Guilin Sanleng Biotech Co. Ltd DAND, In-house production DDAND, In-house production
1.3 Preparation of Sample Solution
(128) Sample of the extract (75±5 mg) and TIBZ (21±2 mg) were accurately weighed and added into a 5 ml centrifuge tube. Then, DMSO-d6 (1 ml) was added. Shake and sonicate for at least 20 min until the sample was dissolved completely, and then allow to reach room temperature. Transfer 0.5 ml of the solution into an NMR tube.
(129) 1.4 Sample Measurement
(130) 1.4.1 Calibration and Integration
(131) a. The chemical shift of TMS was set as 0 ppm. Perform manual integral method. b. The integral interval of TIBZ was 8.246 to 8.360 ppm. When the TIBZ peak shifted, the integral interval can be appropriately adjusted, with integral width keeping unchanged, to let the TIBZ peak locate in the middle of the integral interval. c. The integral interval of type A of the diterpenoid lactones was 6.578-6.670 ppm. d. The integral interval of type B of the diterpenoid lactones was 7.430-7.490 ppm. e. The integral interval of type C of the diterpenoid lactones was 7.610-7.680 ppm. f. The peak area of TIBZ was set as 1000.
1.4.2 Results and Calculation
(132) The content of type A of the diterpenoid lactones (X.sub.A %) was calculated according to the following equation:
(133)
(134) wherein, As is the peak area of type A of the diterpenoid lactones Ar is the peak area of TIBZ Mr is the weight of TIBZ, mg Pr is the purity of TIBZ, % Wr is the molecule weight of TIBZ Ms is the weight of the sample Ws is the molecule weight of AND
(135) Similarly, the contents of type B and C of the diterpenoid lactones (X.sub.B % and X.sub.C %) were calculated as above.
(136) The content of the total andrographolide lactones in the sample (X.sub.sum %) was calculated as follows:
X.sub.sum %=X.sub.A %+X.sub.B %+X.sub.C %.
2. HPLC Method for Determination of AND, NAND, DAND, and DDAND
2.1 Instruments and Parameters:
(137) Chromatographic system: Waters Alliance™ 2695 HPLC, or equivalent
(138) Column: Agilent Zorbax Extend C18, 3.5 um, 150 mm×4.6 mm (PN:763953-902)
(139) Detector: 2487 dual wavelength detector
(140) Detection wavelength: 220 nm
(141) Mobile phase: Phase A: water Phase B: acetonitrile Gradient table:
(142) TABLE-US-00001 Time % A % B 0 90 10 5 82 18 23 81 19 26 72 28 47 69 31 49 10 90 53 10 90 55 90 10 60 90 10
(143) Flow rate: 1.0 ml/min
(144) Column temperature: 35° C.
(145) Injection volume: 10 ul
(146) Elution time: 60 min
(147) 2.2 Preparation of Reference Solution:
(148) 2.2.1 Diluent
(149) Methanol.
(150) 2.2.2 Preparation of Stock Solution
(151) DAND (50±1 mg) was accurately weighed and added into a 50 ml volumetric flask (Flask I). Then, diluent (about 40 ml) was added. Shaking and sonicating Flask I for at least 10 min until DAND was dissolved completely. After allowing to reach room temperature, diluted to desired volume with the diluent.
(152) AND (75±1 mg), NAND (25±1 mg), and DDAND (25±1 mg) were accurately weighed and added into a 50 ml volumetric flask (Flask II). The solution (5 ml) prepared in Flask I was accurately pipetted into Flask II. Then, diluent (about 35 ml) was added. Shaking and sonicating for at least 15 min until the solids were dissolved completely. After allowing to reach room temperature, diluted to desired volume with the diluent.
(153) 2.2.3 Preparation of Working Standard Solution
(154) The stock solution (10 ml) was accurately pipetted into a 50 ml volumetric flask, which was subsequently diluted to desired volume with the diluent.
(155) 2.3 Preparation of Sample Solution
(156) The extract sample (100±1 mg) was accurately weighed and added to a 100 ml volumetric flask. Diluent (about 80 ml) was added. Shaking and sonicating for at least 15 min until the sample was dissolved completely. After allowing to reach room temperature, diluted to desired volume with the diluent.
(157) 2.4 Results and Calculation
(158) The content of AND in the sample (X %) was calculated according to the following equation:
(159)
(160) wherein, X %: The content of AND in the sample A.sub.spl: Absorption value of AND in the sample A.sub.s: Absorption value of AND in working standard solution C.sub.s: Concentration of AND in working standard solution, mg/ml D: Sample dilution factor, 100 W: Weight of the sample, mg
(161) Similarly, the contents of NAND, DAND, and DDAND in the sample can be calculated as above.
EXAMPLES
(162) The examples below are intended to be purely exemplary and should not be considered to be limiting in any way. Efforts have been made to ensure accuracy with respect to numbers used (for example, amount, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in degrees Centigrade.
Example 1
Preparation of the Extract of Andrographis paniculata
(163) The dried aerial part of Andrographis paniculata (300 kg) was extracted with 89-91% ethanol (1800 L) by refluxing for 2 hours. The ethanol phase was collected and 89-91% ethanol (1500 L) was added to the residue, which was followed by refluxing for 2 hours again. The ethanol solutions were sieved through an 80 mesh screen and combined, and then was concentrated under reduced pressure (temperature: ≤65° C., pressure: −0.045.sup.˜−0.100 MPa) and sieved through a 40 mesh screen to afford a wet mixture having a density of 1.022 g/ml. Dextrin (9 kg, available from Roquette, France, Product Code: TACKIDEX B167) was dissolved in water (143.96 L) and then was added to the wet mixture, which was then spray-dried (inlet: 185-195° C.; outlet: 95-115° C.) to give 26.45 kg solid powder.
(164) The solid powder (120 g of the 26.45 kg obtained in the above step) was added to absolute ethanol (1.2 L). The mixture was stirred at 70-75° C. for 1 hour, which was followed by immediate filtration. Activated charcoal (24 g) was added to the filtrate. The resulting mixture was stirred for 1 hour at 60° C., followed by immediate filtration. The ethanol filtrate was concentrated to afford 59.5 g solid.
(165) The solid (52 g of the 59.5 g obtained in the above step) was added to 520 mL H.sub.2O. The resulting mixture was stirred for 1 h at 80° C. and filtered. The filter cake was dissolved in absolute ethanol and concentrated to afford 19.2 g solid.
(166) The solid (19 g of the 19.2 g obtained in the above step) was added to 570 mL n-heptane. The resulting mixture was stirred for 24 h at room temperature and filtered. The filter cake was dried to give 17 g extract of Andrographis paniculata.
(167) The components of the extract were identified by the analytical methods as described above. The results are shown in Table 1 below.
Example 2
Preparation of the Extract of Andrographis paniculata
(168) The dried aerial part of Andrographis paniculata (300 kg) was extracted with 89-91% ethanol (1800 L) by refluxing for 2 hours. The ethanol phase was collected and 89-91% ethanol (1500 L) was added to the residue, which was followed by refluxing for 2 hours again. The ethanol solutions were sieved through an 80 mesh screen and combined, and then was concentrated under reduced pressure (temperature: ≤65° C., pressure: −0.045˜−0.100 MPa) and sieved through a 40 mesh screen to afford a wet mixture having a density of 1.005 g/ml. Dextrin (9 kg) was dissolved in water (134.29 L) and then was added to the wet mixture, which was then spray-dried (inlet: 185-195° C.; outlet: 95-115° C.) to give 33.44 kg solid powder
(169) The solid powder (1.615 kg of the 33.44 kg obtained in the above step) was added to absolute ethanol (16.15 L). The mixture was stirred at 70˜75° C. for 1 hour, which was followed by immediate filtration. Activated charcoal (323 g) was added to the filtrate. The resulting mixture was stirred for 1 hour at 60° C. and followed by immediate filtration. The ethanol solution was concentrated to afford 805.8 g solid.
(170) The solid (781.3 g of the 805.8 g obtained in the above step) was added to water (7.8 L). The resulting mixture was stirred for 1 h at 80˜85° C. and filtered. The filter cake was dissolved in absolute ethanol and concentrated to afford 318.2 g solid.
(171) The solid (278.8 g of the 318.2 g obtained in the above step) was added to n-heptane (8.4 L). The resulting mixture was stirred for 24 h at 23-25° C. and filtered. The filter cake was dried to give 252.8 g extract of Andrographis paniculata.
(172) The components of the extract were identified by the analytical methods as describe above. The results are shown in Table 1 below.
Example 3
Preparation of the Extract of Andrographis paniculata
(173) The dried aerial part of Andrographis paniculata (300 kg) was extracted with 89-91% ethanol (1800 L) by refluxing for 2 hours. The ethanol phase was collected, and 89-91% ethanol (1500 L) was added to the residue, which was followed by refluxing for 2 hours again. The ethanol solutions were sieved through an 80 mesh screen and combined, and then was concentrated under reduced pressure (temperature: ≤65° C., pressure: −0.045˜−0.100 MPa) and sieved through a 40 mesh screen to afford a wet mixture having a density of 1.005 g/ml. Dextrin (9 kg) was dissolved in water (134.29 L) and then was added to the wet mixture, which was then spray-dried (inlet: 185-195° C.; outlet: 95-115° C.) to give 33.44 kg solid powder.
(174) The solid powder (200.01 g of the 33.44 kg obtained in the above step) was added to water (2 L) and stirred at 80-82° C. for 1 hour. After standing at 80-82° C. for 40 min, the supernatant liquid was discarded, and the solid residue was added to water (2 L) following by stirring at 80-82° C. for 1 hour. The resulting mixture was placed at 80-82° C. for a further 60 min. The supernatant liquid was dumped, and the solid residue was added to absolute ethanol (2 L). The mixture was stirred and heating at 75-77° C. for 1 hour, followed by immediate filtration.
(175) Activated charcoal (40.0 g) was added to the filtrate obtained in the previous step. The resulting mixture was stirred for 1 hour at 75-77° C. followed by immediate filtration. The filtrate was concentrated, which was subsequently grinded and sieved through 60 mesh screen to afford 34.27 g solid.
(176) The solid (30.0 g of the 34.27 g obtained in the above step) was added to n-heptane (0.9 L). The resulting mixture was stirred for 3 h at 25-26° C. and followed by immediate filtration. The filter cake was dried, grinded, and sieved through 60 mesh screen to give 29.25 g extract of Andrographis paniculata.
(177) The components of the extract were identified by the analytical methods as describe above. The results are shown in Table 1 below.
Example 4
Preparation of the Extract of Andrographis paniculata
(178) The dried aerial part of Andrographis paniculata (300 kg) was extracted with 89-91% ethanol (1800 L) by refluxing for 2 hours. The ethanol phase was collected and 89-91% ethanol (1500 L) was added to the residue, which was followed by refluxing for 2 hours again. The ethanol solutions were sieved through an 80 mesh screen and combined, and then was concentrated under reduced pressure (temperature: ≤65° C., pressure: −0.045.sup.˜−0.100 MPa) and sieved through a 40 mesh screen to afford a wet mixture having a density of 1.002 g/ml. Dextrin (9 kg) was dissolved in water (143.88 L) and then was added to the wet mixture, which was then spray-dried (inlet: 185-195° C.; outlet: 95-115° C.) to give 27.10 kg solid powder.
(179) The solid powder (4 kg of the 27.10 kg obtained in the above step) was added to water (40 L) and stirred for 1 hour (inner temperature 80° C.). After standing at 88° C. (inner temperature 80° C.) for 80 min, the supernatant liquid was removed out. Water (40 L) was added and stirred for 1 hour (inner temperature 80° C.). After standing at 88° C. (inner temperature 80° C.) for further 60 min, the supernatant liquid was removed out. Absolute ethanol (40 L) was added and stirred at 82-85° C. (inner temperature 75-76° C.) for 1 hour.
(180) And then activated charcoal (0.8 kg) was added and stirred for 1 hour at 82° C. (inner temperature 75-76° C.), followed by immediate filtration. The filtrate was concentrated to dryness, which was subsequently grinded and sieved through a 60 mesh screen to afford 710 g solid.
(181) The solid (700 g of 710 g obtained in the above step) was added to n-heptane (210 L). The resulting mixture was stirred for 3 h at room temperature (inner temperature 26-27° C.), followed by immediate filtration. The filter cake was dried, grinded, and sieved through a 60 mesh screen to give 653.1 g extract of Andrographis paniculata.
(182) The components of the extract were identified by the analytical methods as describe above. The results are shown in Table 1 below.
Examples 5-11
Preparation of the Extract of Andrographis paniculata
(183) Similarly, Examples 5-11 of the extract of Andrographis paniculata disclosed herein were obtained according to the procedure as described in Example 4. The components of the extract were identified by the analytical methods as described above. The results are shown in Table 1 below.
(184) TABLE-US-00002 TABLE 1 The content of 4 single compounds, total andrographolide lactones in the extract from Andrographis paniculata Total andrographolide AND NAND DAND DDAND Lactones Examples (%) (%) (%) (%) (%) Example 1 26.7% 8.2% 1.8% 6.6% 56.8% Example 2 28.4% 7.4% 2.0% 6.9% 56.7% Example 3 37.5% 7.1% 2.3% 8.0% 62.29% Example 4 38.3% 6.7% 2.2% 7.8% 61.40% Example 5 39.9% 7.1% 2.2% 8.2% 64.04% Example 6 37.0% 6.6% 2.1% 7.7% 60.01% Example 7 38.3% 6.7% 3.2% 9.5% Example 8 35.1% 3.2% 1.8% 14.5% 62.7% Example 9 33.5% 4.7% 4.2% 12.2% 62.9% Example 10 36.6% 6.7% 2.1% 7.7% 61.3% Example 11 41.1% 7.1% 2.2% 8.5% 67.9% The following embodiments are also within the scope of this disclosure
(185) 1. An extract of Andrographis paniculata comprising at least 50% of total andrographolide lactones by weight relative to the weight of the extract, wherein the andrographolide lactones comprise AND, NAND, DAND, and DDAND, with amount ranging from 20.0 to 50.0%, 2.0 to 15.0%, 0.5 to 6.0%, and 5.0 to 20.0%, respectively, by weight relative to the weight of the extract.
(186) 2. The extract of embodiment 1, wherein the extract of Andrographis paniculata comprising at least 50% of total andrographolide lactones by weight relative to the weight of the extract, wherein the andrographolide lactones comprise AND, NAND, DAND, and DDAND, with amount ranging from 20.0 to 50.0%, 4.0 to 15.0%, 0.5 to 6.0%, and 5.0 to 15.0%, respectively, by weight relative to the weight of the extract.
(187) 3. The extract of embodiment 1, wherein the amount of total andrographolide lactones ranges from 55.0 to 75.0% by weight relative to the weight of the extract.
(188) 4. The extract of any one of embodiment 1-3, wherein the amount of total andrographolide lactones ranges from 55.0 to 70.0% by weight relative to the weight of the extract.
(189) 5. The extract of any one of embodiment 4, wherein the amount of total andrographolide lactones ranges from 60.0 to 70.0% by weight relative to the weight of the extract.
(190) 6. The extract of any one of embodiments 1-5, wherein the amount of AND ranges from 25.0 to 45.0% by weight relative to the weight of the extract.
(191) 7. The extract of any one of embodiment 6, wherein the amount of AND ranges from 25.0 to 30.0% by weight relative to the weight of the extract
(192) 8. The extract of any one of embodiment 6, wherein the amount of AND ranges from 30.0 to 45.0% by weight relative to the weight of the extract.
(193) 9. The extract of any one of embodiments 1-8, wherein amount of NAND ranges from 2.0 to 12.0% by weight relative to the weight of the extract.
(194) 10. The extract of any one of embodiment 9, the amount of NAND ranges from 2.0 to 10.0% by weight relative to the weight of the extract.
(195) 11. The extract of any one of embodiment 10, the amount of NAND ranges from 2.0 to 9.0% by weight relative to the weight of the extract.
(196) 12. The extract of any one of embodiment 11, the amount of NAND ranges from 2.0 to 8.0% by weight relative to the weight of the extract.
(197) 13. The extract of any one of embodiment 12, the amount of NAND ranges from 2.0 to 6.0% by weight relative to the weight of the extract.
(198) 14. The extract of any one of embodiment 13, the amount of NAND ranges from 2.0 to 4.0% by weight relative to the weight of the extract.
(199) 15. The extract of any one of embodiments 1-8, wherein the amount of NAND ranges from 4.0 to 12.0% by weight relative to the weight of the extract.
(200) 16. The extract of any one of embodiment 15, wherein the amount of NAND ranges from 6.0 to 10.0% by weight relative to the weight of the extract.
(201) 17. The extract of any one of embodiment 16, wherein the amount of NAND ranges from 6.0 to 9.0% by weight relative to the weight of the extract.
(202) 18. The extract of any one of embodiments 1-17, wherein the amount of DAND ranges from 1.0 to 5.0% by weight relative to the weight of the extract.
(203) 19. The extract of any one of embodiment 18, wherein the amount of DAND ranges from 1.0 to 4.0% by weight relative to the weight of the extract.
(204) 20. The extract of any one of embodiments 1-19, the amount of DDAND ranges from 5.0 to 15.0% by weight relative to the weight of the extract.
(205) 21. The extract of any one of embodiments 1-19, the amount of DDAND ranges from 10.0 to 15.0% by weight relative to the weight of the extract.
(206) 22. The extract of any one of embodiment9 20, wherein the amount of DDAND ranges from 5.0 to 10.0% by weight relative to the weight of the extract.
(207) 23. The extract of any one of embodiment 22, wherein the amount of DDAND ranges from 6.0 to 9.0% by weight relative to the weight of the extract.
(208) 24. A pharmaceutical composition comprising an extract of any one of embodiments 1-23 and a pharmaceutically acceptable excipient.
(209) 25. A method of treating inflammatory bowel disease (IBD) in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of a pharmaceutical composition of embodiment 24.
(210) 26. The method of embodiment 25, wherein the inflammatory bowel disease (IBD) is Crohn's disease or ulcerative colitis.
(211) In Vitro Bioassay
(212) Assay 1: Inhibition of IL-1β Expression
(213) Lamna propria dendritic cells and macrophages are key antigen-presenting cells that are found in the inflamed mucosa in patients with IBD. Upon activation, which occurs in response to components of the commensal microbiota and Toll-like receptor signaling, these cells produce large amounts of pro-inflammatory cytokines, such as IL-1β, etc. A significantly increased level of IL-1β was found in the intestinal mucosa of the patients with CD and UC when compared with healthy subjects, indicating an increased activation of the IL-1β in the disease. A great amount of evidence suggested that IL-1β has a prominent role in the initiation of colonic inflammation. The inhibition of IL-1β has been linked to effective therapeutic treatment of IBD, such as CD and UC. [Neurath M F. Cytokines in inflammatory bowel disease. Nat Rev Immunol. 2014 May; 14(5):329-42]
(214) Human THP-1 monocytic cells induced by LPS, a chemical from outer membrane of Gram-negative bacteria, were utilized to evaluate inhibitory activity of the samples disclosed herein and Andrographis paniculata extract Standard 1 in vitro. Standard 1 is within the scope of disclosure of WO 2009/059158, and was prepared using the extract preparation method disclosed in WO2009/059158.
(215) THP-1 cells (obtained from ATCC, Cat.: TIB-202) were maintained at 37° C. with 5% CO.sub.2 in 75 cm.sup.2 flask (Corning, Cat.: 430641) with about 20 mL culture medium (RPMI-1640 with 10% heat-inactivated FBS and 0.1% 55 mM 2-mercaptoethanol and 1% GlutaMAX). The cells were sub-cultured to 2×10.sup.5 cells/mL every 3 days or 3×10.sup.5 cells/mL every 2 days. For the assay, the THP-1 cell suspension was collected and centrifuged at 1000 rpm for 5 min. The supernatant was removed and discarded. The cells were resuspended in fresh medium. The cell density was determined and adjusted to the density of 6×10.sup.5 cells/mL. The cells were seeded into a 96-well plate (BD falcon, Cat.: 353072) and incubated at 37° C. with 5% CO.sub.2 until test samples treatment.
(216) Two examples of Andrographis paniculata extracts were serially diluted in DMSO and further diluted in medium. One of the two examples was within the scope of disclosure of WO 2009/059158 and was used as a standard 1. The other example was within the scope of the extract disclosed herein (“Example 1”). Series diluted solution was added into wells. The final concentrations for each of Standard 1 and Example 1 were: 300, 120, 48, 19.2, 7.68, 3.07, 1.23, 0.49, 0.20 and 0.08 μg/mL. The plate was incubated for 30 minutes until stimuli LPS/PMA treatment. A combination of LPS and PMA was added into wells. The final concentrations of stimuli were 1 μg/mL LPS plus 10 ng/mL PMA. Then, the plate was incubated at 37° C. with 5% CO.sub.2 for about 18 hours. The ELISA plate was also coated by adding 100 μL capture antibody working solution into each well following the kit instruction. The ELISA plate was incubated at room temperature overnight.
(217) On the second day, the cell culture plate was centrifuged at 900 rpm for 10 minutes. 120 μL/well supernatants were transferred into a fresh 96-well plate. The IL-1β production in supernatants was measured by using commercial IL-1β ELISA Kit (R&D systems, Cat. DY201). Finally, the OD value for each well was measured by a spectrophotometer. The concentration (C) of IL-1 β for each sample was determined by the blank-corrected average OD value and the IL-1 β standard curve. The inhibition ratio was calculated as follows:
(218)
where C.sub.test sample is the IL-1β concentration of cells treated with the test samples and stimuli LPS/PMA, C.sub.LPS/PMA is the IL-1β concentration of cells treated with stimuli LPS/PMA only. IC.sub.50 was calculated using 4PL model by fitting bottom value to 0 and top value to 100. The final result was expressed as relative potency by comparing Example 1 with Standard 1. The relative potency was calculated as follows:
(219)
(220) Similarly, other Andrographis paniculata extracts as disclosed herein (“Examples 2-6”) were tested. The results showed that Examples 1-6 were much more potent than Standard 1 with the relative potency of 419.2% (Mean) (n=6). The results are shown in Table 2 below.
(221) TABLE-US-00003 TABLE 2 Inhibitory potency on LPS/PMA induced IL-1β production in THP-1 cells IL-1β production relative IC.sub.50 potency % based on Example # (μg/mL) Standard 1 1 1.8 296.0% 2 2.1 343.2% 3 1.7 521.9% 4 0.9 478.5% 5 1.2 482.0% 6 0.9 393.3%
Assay 2: Inhibition of NF-κB Activation
(222) Dysregulated cytokine production and signaling mechanisms by intestinal epithelial cells, lymphocytes and macrophages have been implicated in the pathogenesis of IBD, and the transcription factor NF-κB is one of the major regulatory components in this complex system. The expression and activation of NF-κB is strongly induced in the inflamed gut of IBD patients, especially in macrophages and epithelial cells, where augmented levels of NF-κB correlated significantly with the severity of intestinal inflammation. In IBD patients, higher NF-κB expression in mucosal macrophages is accompanied by an increased capacity to produce and secrete pro-inflammatory cytokines, such as TNF-α, IL-1, IL-6, IL-12 and IL-23, etc., resulting in the perpetuation of mucosal inflammation and tissue damage. Blockade of NF-κB activation has become a therapeutic strategy in IBD. For instance, corticosteroids are able to inhibit NF-κB activation. Consistent with that, colonic mononuclear-, epithelial- and endothelial cells from glucocorticoid-treated IBD patients showed significantly lower NF-κB activation than cells from untreated patients. [Atreya I., et al. NF-κB in inflammatory bowel disease. J Intern Med. 2008 June; 263(6):591-6]
(223) Inhibitory potencies of the samples disclosed herein and Standard 1 were simultaneously evaluated in TNF-α-induced NF-κB activation in HEK293/NF-κB-luciferase reporter assay.
(224) HEK-293/NF-κB-luc stable cell line (Panomics, Cat #RC0014), an adherent cell, was used in the assay. For sustaining cell culture, the cells were incubated in cell culture dish with DMEM containing 10% FBS at 37° C. with 5% CO.sub.2. Sub-culture was performed when cells reached 90% confluence. For the assay, the cells were trypsinized and suspended in culture medium. The cell density was determined and adjusted to 3×10.sup.5 cells/mL. The cells were then seeded into a 96-well plate and incubated at 37° C. with 5% CO.sub.2 overnight.
(225) Two Andrographis paniculata extracts, Example 1 and Standard 1, and positive control IKK-2 inhibitor IV (Calbiochem, Cat #401481) were serially diluted in DMSO and further diluted in medium. Diluted solution was added into wells. The final concentrations for Standard 1 and Example 1 were: 300, 120, 48, 19.2, 7.68, 3.07, 1.23 and 0.49 μg/mL. The final concentrations for IKK-2 inhibitor IV were: 10, 4, 1.6, 0.64, 0.26, 0.10, 0.041, and 0.016 μM. The plate was incubated at 37° C. with 5% CO.sub.2 for 30 minutes. Stimuli rhTNFα was added into wells and its final concentration was 10 ng/mL. The plate was incubated at 37° C. under 5% CO.sub.2 for about 6 hours.
(226) After incubation, the cell supernatant was removed and discarded. Cell lysis buffer was added into each well. The plate was stored at −70° C. for about 20 min, and then the plate was taken out. The cell lysates were thawed and transferred into a 96-well white flat bottom plate. The NF-κB activation was measure by using commercial Steady-Glo® Luciferase Assay System (Promega, Cat #E2520). The luminescence (L) was measured by the instrument Victor3 (Perkin Elmer). The inhibition ratio was calculated as follows:
(227)
where L.sub.test sample is the luminescence of cells treated with the test samples and stimuli, L.sub.maximum is the luminescence of cells treated with stimuli only, and L.sub.minimum is the luminescence of cells treated without test samples and stimuli. IC.sub.50 of each test sample was calculated by “XLfit”software. The final result was expressed as relative potency by comparing Example 1 with Standard1. The relative potency was calculated as follows:
(228)
(229) Similarly, other Andrographis paniculata extracts (“Example 2-6”) were tested. The results showed that Examples 1-6 were much more potent than Standard 1 with the relative potency of 418.5% (Mean) (n=6). The results were shown in Table 3.
(230) TABLE-US-00004 TABLE 3 Inhibitory potency on NF-κB activation NF-κB activation IC.sub.50 relative potency % based Example # (μg/mL) on Standard 1 1 18.5 284.4% 2 15.4 270.5% 3 14.8 452.2% 4 14.6 561.7% 5 16.4 408.2% 6 12.5 533.9%
Assay 3: Effects on Pro-Inflammatory Gene Regulation
(231) Cytokines have a crucial role in the pathogenesis of IBD, where they control multiple aspects of the inflammatory response. In particular, the imbalance between pro-inflammatory and anti-inflammatory cytokines in IBD impedes the resolution of inflammation and resulted in disease perpetuation and tissue destruction. Pro-inflammatory cytokines, such as TNF-α, IL-1β, IL-6 and IL-12p40, have demonstrated fundamental roles in controlling mucosal inflammation in the disease. For instance, TNF-α, through activation of NF-κB, receptor-interacting protein kinases and caspase 3 pathways, exerts various pleiotropic pro-inflammatory effects in IBD, including augmented angiogenesis, the induction of Paneth cell death via necroptosis, the production of matrix metalloproteinases by myofibroblasts, and activation of macrophages and effector T cells, and direct damage of intestinal epithelial cells via myosin light chain kinase activation. Members of IL-12 family are produced by antigen presentation cells during intestinal inflammation, perpetuating local Th17 cell responses and suppressing regulatory T cell activity. Therapies based on anti-pro-inflammatory cytokines have been very successful in treatment of various autoimmune diseases, including IBD. For example, infliximab, an anti-TNF-α antibody, has demonstrated great clinical improvement and mucosal healing in moderate to severe IBD patients [Darcy M., et al, Ulcerative Colitis. 2015 Decision resources Group]. In addition, Ustekinumab, a specific antibody for common p40 subunit of IL-12 and IL-23, demonstrated increased clinical response in patients with active CD, particularly for those who fail to respond to anti-TNF therapy [Yu Q H., et al. Crohn's Disease. 2015 Decision Resources Group].
(232) Inhibition of pro-inflammatory cytokine production by Example 1 has been evaluated in LPS-stimulated human PBMCs in vitro. As a control, 5-aminosalicylic acid (5-ASA) has also been evaluated.
(233) Human peripheral blood mononuclear cells (hPBMCs) were isolated from the blood of healthy humans by Ficoll density gradient separation and stored in the liquid nitrogen. For the assay, the cells were thawed from liquid nitrogen and centrifuged. Then the cells were suspended in fresh culture medium (RPMI-1640 with 10% heat-inactivated FBS) and cultured overnight. The cell density was determined and adjusted to 1×10.sup.6 cells/mL. The cells were then seeded into a 96-well plate and incubated at 37° C. with 5% CO.sub.2.
(234) The two Andrographis paniculata extracts, Standard 1 and Example 1 were serially diluted in DMSO and further diluted in medium. Diluted solution was added into wells. The plate was incubated at 37° C. with 5% CO.sub.2 for 30 minutes until stimuli treatment. LPS or a combination of anti-CD3 monoclonal antibody (mAb) and anti-CD28 mAb was added into the wells. The final concentrations of stimuli were: 1 μg/mL LPS or 1 μg/mL antiCD3 plus 0.5 μg/mL antiCD28 mAb. The plate was incubated at 37° C. under 5% CO.sub.2 for about 5 hours. The cells were collected and supernatants were removed. 150 μL RLT buffer was added into each well. The plate was stored at −80° C. until RNA extraction.
(235) Total RNA was extracted using RNeasy 96 kit (QIAGEN) and cDNA was synthesized from the RNA template using High Capacity cDNA RT kit (Applied Biosystems). Quantitative real-time PCR detection of gene expression was effected using SYBR Premix Ex Taq TM II (TakaRa). GAPDH was used as a reference gene (Primer sequences were shown in Table 4). Expression of genes analyzed by q-PCR was normalized to GAPDH using the fold change (2.sup.−ΔΔCT) method. The formula used in calculation was shown as follows:
Fold=2.sup.−ΔΔCT=2.sup.−[(CT.sup.
where CT.sub.test sample is the CT value of target gene in cells treated with the test samples and stimuli; CT.sub.test sample-GAPDH is the CT value of GAPDH gene in cells treated with the test samples and stimuli; CT.sub.minimum is the CT value of target gene in cells treated without test samples and stimuli, and CT.sub.minimum-GAPDH is the CT value of GAPDH gene in cells treated without test samples and stimuli; The inhibition ratio was calculated as follows:
(236)
where Fold.sub.test sample is the fold value of cells treated with the test samples and stimuli, Fold.sub.maximum is the fold value of cells treated with stimuli only, and Fold.sub.minimum is the fold of cells treated without test samples and stimuli.
(237) The results indicated that Example 1 significantly suppressed LPS induced mRNA expression of TNFα, IL-1β, IL-6, IL-12p40, IL-18 and Cox2 in a dose-dependent manner in hPBMCs (
(238) Assay 4: Effects on Chemokine Gene Regulation
(239) Chemokines are a group of chemoattractant cytokines that exert double-edged effects on both host defense and inflammation. Pro-inflammatory chemokines released from a wide variety of cells in response to pro-inflammatory stimuli have been shown to play an essential role in the recruitment of leukocytes, such as neutrophils, monocytes and other effector cells from blood to sites of inflammation and tissue damage.
(240) The chemokine CCL-20 and its cognate receptor CCR6 are of particular interest, due to the overexpression of both in IBD patients [Skovdahl H K., et al. Expression of CCL-20 and its corresponding receptor CCR6 is enhanced in active inflammatory bowel disease, and TLR3 mediates CCL-20 expression in colonic epithelial cells. PLoS One. 2015 Nov. 4; 10(11):e0141710]. CCL-20, recently identified as a susceptibility gene for IBD, is expressed by many cell types when stimulated with pro-inflammatory cytokines. CCL-20 has been shown to direct CCR6-expressed effector cells, such as Treg, Th17, B cells and immature dendritic cells, to gut mucosa. Thus, blockade of CCL-20 may provide benefit for the treatment of IBD.
(241) Two adherent epithelial cell lines, HT29 and T84, were used in the assay. For sustaining cell culture, HT29 cells were incubated in cell culture dish with McCoy's 5a Medium containing 10% FBS, and T84 cells were incubated with DMEM/F-12 (1:1) medium containing 5% FBS. All cells were incubated at 37° C. with 5% CO2. Sub-culture was performed when cells reached 90% confluence. For the assay, the cells were trypsinized and suspended in culture medium. The cell density was determined and adjusted to 1×10.sup.6 cells/mL. The cells were then seeded into a 96-well plate and incubated at 37° C. with 5% CO.sub.2 overnight.
(242) The two Andrographis paniculata extracts, Standard 1 and Example 1, were serially diluted in DMSO and further diluted in medium. Diluted solution was added into wells. The final concentrations for Standard 1 were: 300, 100, 30 and 10 μg/mL. The final concentrations for Example 1 were: 100, 30, 10 and 1 μg/mL. The plate was incubated at 37° C. with 5% CO.sub.2 for 30 minutes until stimuli treatment. Stimuli rhTNFα was added into wells and its final concentration was 50 ng/mL. The plate was incubated at 37° C. with 5% CO.sub.2 for about 5 hours. The supernatants were removed, and 150 μL RLT buffer was added into each well. The plate was stored at −80° C. until RNA extraction.
(243) Total RNA was extracted using RNeasy 96 kit (QIAGEN), and cDNA was synthesized from RNA template using High Capacity cDNA RT kit (Applied Biosystems). Quantitative real-time PCR detection of gene expression was using SYBR Premix Ex Taq TM II (TakaRa). GAPDH was used as a reference gene (Primer sequences were shown in Table 4). Expression of genes analyzed by q-PCR was normalized to GAPDH using the fold change (2.sup.−ΔΔCT) method. The formula used in calculation was shown as follows:
Fold=2.sup.−ΔΔCT=2.sup.−[(CT.sup.
where CT.sub.test sample is the CT value of target gene in cells treated with the test samples and stimuli; CT.sub.test sample-GAPDH is the CT value of GAPDH gene in cells treated with the test samples and stimuli; CT.sub.minimum is the CT value of target gene in cells treated without test samples and stimuli, and CT.sub.minimum-GAPDH is the CT value of GAPDH gene in cells treated without test samples and stimuli; The inhibition ratio was calculated as follows:
(244)
where Fold.sub.test sample is the fold value of cells treated with the test samples and stimuli, Fold.sub.maximum is the fold value of cells treated with stimuli only, and Fold.sub.minimum is the fold of cells treated without test samples and stimuli.
(245) The results indicated that Example 1 significantly inhibited expression of CCL-20, CXCL-9, CXCL-10, CXCL-11 in T84 cells (
(246) Assay 5: Effects on Growth Factor Gene Regulation
(247) Mucosal healing has emerged as a key treatment goal in IBD that predicts sustained clinical remission of patients. The structural basis of mucosal healing is an intact barrier function of the gut epithelium that prevents translocation of commensal bacteria into the mucosa and submucosa with subsequent immune cell activation. Thus, mucosal healing should be considered as an initial event in the suppression of inflammation of deeper layers of the bowel wall, rather than as a sign of complete healing of gut inflammation.
(248) Mucosal healing relies on coordinated events consisting of intestinal epithelial cell restitution, proliferation and differentiation, where epidermal growth factor (EGF) plays important roles. Significantly lower levels of serum EGF are observed in IBD patients compared to healthy controls. Interestingly, a short-term treatment using topical recombinant EGF has achieved clinical remission in a clinical trial of UC, suggesting that EGF plays a beneficial role in the treatment of the disease [Huynh E., et al. EGF and EGFR: promising targets for modulating inflammation and mucosal healing therapy in IBD. Inflamm Cell Signal. 2015; 2(3): e840]. In a case report of EGF treatment for IBD-associated pyoderma gangrenosum, daily topical EGF led to significant wound healing within 2 weeks and complete wound closure at 5 months despite rapid tapering of steroids. These investigations suggest that although EGF may not be a mainstay for UC, it may still play a beneficial role in patients with UC [Krishnan K., et al. Intestinal growth factors: potential use in the treatment of inflammatory bowel disease and their role in mucosal healing. Inflammatory Bowel Diseases. 2011; 17(1):410-22].
(249) The fibroblast growth factor family is comprised of at least 18 heparin-binding peptides (FGF1 through FGF18) and oncogenes. FGF1 and FGF2 are commonly referred to as acidic FGF (aFGF) and basic FGF (bFGF) respectively. Members of the FGF family generally act to enhance cell proliferation, modulate cell differentiation, and accelerate cell migration, angiogenesis, and extracellular matrix remodeling. FGF1 is one of the most promising cytokines for treating impaired wound healing. Previous studies have demonstrated that several growth factors including FGF-2 are overexpressed in IBD and their roles in epithelial repair have been postulated. Furthermore, it has been reported that an elevated FGF-2 level in serum of active IBD patients might promote mucosal healing and/or intestinal fibrinogenesis.
(250) Enhancement of EGF and FGF expression were investigated in a human HT-29 and T84 cell lines.
(251) Two adherent epithelial cell lines, HT29 and T84, were used in the assay. For sustaining cell culture, HT29 cells were incubated in cell culture dish with McCoy's 5a Medium containing 10% FBS, and T84 cells were incubated with DMEM/F-12 (1:1) medium containing 5% FBS. All cells were incubated at 37° C. with 5% CO.sub.2. Sub-culture was performed when cells reached 90% confluence.
(252) For the assay, the cells were trypsinized and suspended in culture medium. The cell density was determined and adjusted to 1×10.sup.6 cells/mL. Then, the cells were seeded into a 96-well plate and incubated at 37° C. with 5% CO.sub.2 overnight.
(253) The two Andrographis paniculata extracts, Standard 1 and Example 1, were serially diluted in DMSO and further diluted in medium. Diluted solution was added into wells. The final concentrations for Standard 1 were: 300, 100, 30 and 10 μg/mL. The final concentrations for Example 1 were: 100, 30, 10 and 1 μg/mL. The plate was incubated at 37° C. with 5% CO.sub.2 for about 24 hours. The supernatants were removed and 150 μL RLT buffer was added into each well. The plate was stored at −80° C. until RNA extraction.
(254) Total RNA was extracted using RNeasy 96 kit (QIAGEN) and cDNA was synthesized from RNA template using High Capacity cDNA RT kit (Applied Biosystems). Quantitative real-time PCR detection of gene expression was using SYBR Premix Ex Taq TM II (TakaRa). GAPDH was used as a reference gene (Primer sequences were shown in Table 4). Expression of genes analyzed by q-PCR was normalized to GAPDH using the fold change (2.sup.−ΔΔCT) method. The formula used in the calculation is shown as follows:
Fold=2.sup.−ΔΔCT=2.sup.−[(CT.sup.
where CT.sub.test sample is the CT value of target gene in cells treated with the test samples; CT.sub.test sample-GAPDH is the CT value of GAPDH gene in cells treated with the test samples; CT.sub.minimum is the CT value of target gene in cells treated without test samples, and CT.sub.minimum-GAPDH is the CT value of GAPDH gene in cells treated without test samples.
(255) The results indicated that both Example 1 and AND increased mRNA expression of EGF in HT29 cells and T84 cells (
(256) Similarly, enhancement effects of Example 10 on EGF and FGF1 and FGF2 mRNA expressions in epithelial cell lines HT29 and T84 were tested according to the procedure as described above. The results are shown in
(257) TABLE-US-00005 TABLE 4 Primer sequences Target gene Primer (Forward) Primer (Reverse) human IL-6 GCCAGAGCTGTGCAGATGAG TCAGCAGGCTGGCATTTG (SEQ ID NO: 1) (SEQ ID NO: 17) human TNF-a TGCTTGTTCCTCAGCCTCTT CAGAGGGCTGATTAGAGAGAGGT (SEQ ID NO: 2) (SEQ ID NO: 18) human COX-2 CCCTTCTGCCTGACACCTTT GTATTTCATCTGCCTGCTCTGGT (SEQ ID NO: 3) (SEQ ID NO: 19) human IL-12p40 CTATGGTGAGCCGTGATTGTG CTGTGTCATCCTCCTGTGTCTTTT (SEQ ID NO: 4) (SEQ ID NO: 20) human IL-18 CTTCCAGATCGCTTCCTCTC TCAAATAGAGGCCGATTTCC (SEQ ID NO: 5) (SEQ ID NO: 21) human IFN-γ AACTTTAAAGATGACCAGAGCATCC TGCGTTGGACATTCAAGTCAG (SEQ ID NO: 6) (SEQ ID NO: 22) human IL-1β TTCGACACATGGGATAACGAGG TTTTTGCTGTGAGTCCCGGAG (SEQ ID NO: 7) (SEQ ID NO: 23) human CCL20 TGCTGTACCAAGAGTTTGCTC CGCACACAGACAACTTTTTCTTT (SEQ ID NO: 8) (SEQ ID NO: 24) human CXCL9 GCATCATCTTGCTGGTTCTGATTGG GCGACCCTTTCTCACTACTGGGGT (SEQ ID NO: 9) (SEQ ID NO: 25) human CXCL10 CCAATTTTGTCCACGTGTTG TTCTTGATGGCCTTCGATTC (SEQ ID NO: 10) (SEQ ID NO: 26) human CXCL11 AGAGGACGCTGTCTTTGCAT TGGGATTTAGGCATCGTTGT (SEQ ID NO: 11) (SEQ ID NO: 27) human CXCL16 ACTACACGAGGTTCCAGCTCC CTTTGTCCGAGGACAGTGATC (SEQ ID NO: 12) (SEQ ID NO: 28) human EGF TGGATGTGCTTGATAAGCGG ACCATGTCCTTTCCAGTGTGT (SEQ ID NO: 13) (SEQ ID NO: 29) human FGF1 GATGGCACAGTGGATGGGAC AAGCCCGTCGGTGTCCATGG (SEQ ID NO: 14) (SEQ ID NO: 30) human FGF2 GCTCTTAGCAGACATTGGAAG GTGTGTGCTAACCGTTACCT (SEQ ID NO: 15) (SEQ ID NO: 31) human GAPDH TCGACAGTCAGCCGCATCTTCTTT ACCAAATCCGTTGACTCCGACCTT (SEQ ID NO: 16) (SEQ ID NO: 32)
Assay 6: Effects on Growth Factor Gene Regulation
(258) Enhancement of FGF1 expression of Example 7 and the four ingredients AND, NAND, DAND, and DDAND was investigated in human T84 cell line.
(259) The adherent epithelial cell line T84 was used in the assay. For sustaining cell culture, T84 cells were incubated with DMEM/F-12 (1:1) medium containing 5% FBS at 37° C. with 5% CO.sub.2. Sub-culture was performed when cells reached 90% confluence.
(260) For the assay, the cells were trypsinized and suspended in culture medium. The cell density was determined and adjusted to 1×10.sup.6 cells/mL. Then, the cells were seeded into a 96-well plate and incubated at 37° C. with 5% CO.sub.2 overnight.
(261) The two Andrographis paniculata extracts, Standard 1 and Example 7, and AND, NAND, DAND, DDAND, and the mixture of them (named as the mixture of 4 markers, wherein the amounts of AND, NAND, DAND, and DDAND were 69%, 11%, 5%, and 15%, respectively, by weight relative to the weight of the mixture) were serially diluted in DMSO and further diluted in medium. Diluted solution was added into wells. The final concentrations for Standard 1 were: 300 and 100 μg/mL. The final concentration for Example 7 was: 100 μg/mL. The final concentration for NAND, DAND and DDAND was 10 μg/mL and AND was 40 μg/mL. The final concentrations for mixture of 4 markers were: 100 and 30 μg/mL. The plate was incubated at 37° C. with 5% CO.sub.2 for about 24 hours. The supernatants were removed and 150 μL RLT buffer was added into each well. The plate was stored at −80° C. until RNA extraction.
(262) Total RNA was extracted using RNeasy 96 kit (QIAGEN) and cDNA was synthesized from RNA template using High Capacity cDNA RT kit (Applied Biosystems). Quantitative real-time PCR detection of gene expression was using SYBR Premix Ex Taq TM II (TakaRa). GAPDH was used as a reference gene (Primer sequences were shown in Table 5). Expression of genes analyzed by q-PCR was normalized to GAPDH using the fold change (2.sup.−ΔΔCT) method. The formula used in the calculation is shown as follows:
Fold=2.sup.−ΔΔCT=2.sup.−[(CT.sup.
where CT.sub.test sample is the CT value of target gene in cells treated with the test samples; CT.sub.test sample-GAPDH is the CT value of GAPDH gene in cells treated with the test samples; CT.sub.minimum is the CT value of target gene in cells treated without test samples, and CT.sub.minimum-GAPDH is the CT value of GAPDH gene in cells treated without test samples.
(263) The results are shown in
(264) TABLE-US-00006 TABLE 5 Primer sequences Target gene Primer (Forward) Primer (Reverse) human GATGGCACAGTGGATGGGAC AAGCCCGTCGGTGT FGF1 (SEQ ID NO: 33) CCATGG (SEQ ID NO: 35) human TCGACAGTCAGCCGCATCTTCTTT ACCAAATCCGTTGA GAPDH (SEQ ID NO: 34) CTCCGACCTT (SEQ ID NO: 36)
Assay 7: The In Vivo Efficacy of Andrographis Extract in a DNBS-Induced Rat Colitis Prophylactic Model
1. Materials
1.1. Test Compounds and Formulation Methods Test articles: Two Andrographis paniculata extracts, Example 10 used in Experiment 1 and Example 11 used in Experiment 2. Control drugs: Standard 1; and Sulfasalazine (SASP), Sigma-Aldrich, Cat S0883.
(265) Oral suspension of the test articles and Standard 1 were prepared as follows: the test articles and Standard 1 were respectively weighed and added into a 50 mL centrifuge tube. 0.5% sodium carboxymethylcellulose (0.5% CMC-Na) was added. Sonicate for 15 min to give suspensions with desired concentration. The fresh-made formulation was stored away from light, and homogenized thoroughly before use. The administration volume was 10 ml/kg.
(266) Oral suspension of SASP was prepared as follows: SASP was weighed and added into a 50 mL centrifuge tube. 0.5% CMC-Na was added. Sonicate for 15 min to give 30 mg/mL suspension. The fresh-made formulation was stored away from light, and homogenized thoroughly before use. The administration volume was 10 ml/kg.
(267) 1.2. Animals:
(268) Male Wistar rats, 110-130 g, were purchased from Shanghai SLAC Laboratory Animal Co. Ltd.
(269) 1.3. Reagents
(270) DNBS (2,4-dinitrobenzenesulfonate acid): Cat: D2275, Tokyo Kasei kogyo (Japan).
(271) Sodium Carboxymethylcellulose (CMC-Na): Cat: C9481, Sigma-Aldrich.
(272) Zoletil: Tiletamine-zolazepam; Virbac S.A., Garros, France.
(273) Xylazine: Jilin Huamu Animal Health Product Co., Ltd. Veterinary drug production No. (2015) 070011777.
(274) 2. Methods
(275) 2.1. Grouping and Dosing Regimen
(276) TABLE-US-00007 TABLE 6 Treatment groups and dosing regimen of the extracts on DNBS induced rat colitis model Dose Groups N (mg/kg) Dosing regimen Route Vehicle Experiment 1 Naive (30% ethanol control) 8 — — — — Vehicle (DNBS control) 8 0 Animals were PO 0.5% CMC-Na DNBS + SASP 300 mg/kg 8 300 administered 2 h before PO 0.5% CMC-Na DNBS + “Example 10” 5 mg/kg 8 5 and 4 h after model PO 0.5% CMC-Na DNBS + “Example 10” 10 mg/kg 8 10 induction on the first PO 0.5% CMC-Na DNBS + “Example 10” 20 mg/kg 8 20 day and then PO 0.5% CMC-Na DNBS + “Example 10” 40 mg/kg 8 40 administered once daily PO 0.5% CMC-Na in the next 5 days. Experiment 2 Naive (30% ethanol control) 8 — — — — Vehicle (DNBS control) 8 0 Animals were PO 0.5% CMC-Na DNBS + “Example 11” 8 40 administered 2 h before PO 0.5% CMC-Na DNBS + Standard 1 8 130 and 4 h after model PO 0.5% CMC-Na induction on the first day and then administered once daily in the next 5 days. *SASP group: The animals in the SASP treated group were administered with vehicle 2 h before and with SASP 4 hours after the model induction on the first day and then administrated once daily in the next five days.
2.2. Model Induction
(277) Wistar rats were randomized assigned. The fasting rats were anesthetized with 25 mg/kg Zoletil and 0.5 mg/kg xylazine. And colitis was induced by intracolonic administration of 10 mg or 12 mg DNBS dissolved in 0.25 mL of 30% ethanol (v/v). The animals in naive control group were instilled with 30% ethanol only.
(278) 2.3. Assessment
(279) Body weight: Body weights of animals were checked daily on and after grouping. Diarrhea score: Stool consistency of the animals was monitored and scored daily from the 3.sup.rd day after the model induction. Evaluation criteria: 0=formed, 1=moist/sticky, 2=loose, 3=liquid. Colon weight and length measurement: Rats were sacrificed 4 h post the last dosing on the 6.sup.th day. The abdomen was opened by a midline incision. Adhesion degree of colon and other organs was observed. The colon (from cecum end to the anus) was emptied of its content, rinsed with saline. The weight and length of the colon were measured, and then the colon ratio (colon weight/colon length) was calculated. Histopathology analysis: Proximal colon with obvious ulcer was made into Swiss Rolls, fixed in 10% neutral formalin solution, dehydrated with xylene, embedded in paraffin, sectioned, and stained with hematoxylin and eosin (H&E). The criterion of histopathological assessment of the tissue section was made according to reference (David Prescott, BSc, et al. Loss of Phosphoinositide 3-Kinase p110γ is Protective in the Acute Phase but Detrimental in the Resolution Phase of Hapten-Induced Colitis, Inflamm Bowel Dis. Volume 19, Number 3, March 2013). The severity of lesion was graded based on a semi-quantitative scale using the sum of scores of the following 10 evaluation indicators (see table 7).
(280) TABLE-US-00008 TABLE 7 Scoring System for assessing pathologic changes of colon Evaluation indicators Score Assigned Total area affected None:0 25%: 1 25%-50%: 2 50%-75%: 3 75%: 4 Degree of erosion or ulcer None: 0 Mild: 1 Moderate: 2 Severe: 3 Severe destruction for erosion (%) None: 0 25%: 1 25%-50%: 2 50%-75%: 3 75%: 4 Degree of mucosa edema Normal: 0 Mild: 1 Moderate: 2 Extensive: 3 Degree of cellular infiltrate Normal: 0 Mild: 1 Moderate: 2 Severe/transmural: 3 Severely affected in infiltration (%) None: 0 25%: 1 25%-50%: 2 50%-75%: 3 75%: 4 Epithelium hyperplasia None: 0 5%: 1 5%-25%: 2 25%-50%: 3 50%: 4 Muscle thickening Normal: 0 Mild: 1 Moderate: 2 Extensive: 3 Crypt abscesses Absent: 0 Present: 1 Goblet cell depletion Absent: 0 Present: 1
2.4. Statistical Analysis
(281) All of the data were presented as mean±SD.
(282) Body weight data were analyzed with repeated-measures ANOVA analysis by GraphPad Prism 6.0 software. Fisher's Least Significant Difference (LSD) test was used to perform significance analysis. p value was calculated. *p<0.05 refers to significant difference between vehicle control group and each of the treated groups. **p<0.01 refers to extremely significant difference between vehicle control group and each of the treated groups.
(283) The colon ratio inhibition of each animal was calculated by the following formula, wherein CW refers to colon weight, CL refers to colon length:
(284)
(285) The statistical analysis of the data of colon length and colon ratio was performed by Graphpad Prism 6.0 software. Unpaired t test or Mann-Whitney test were applied to analyze the significance analysis between test article treated groups and vehicle treated group, based on the normality of the data.
(286) The difference of diarrhea score and histopathology score between vehicle control group and test article treated groups was analyzed with Mann-Whitney test by GraphPad Prism 6.0 software. *p<0.05 refers to statistically significant difference between vehicle control group and each of the treated groups. **p<0.01 refers to extremely statistically significant difference between vehicle control group and each of the treated groups.
(287) 3. Result and Discussion
(288) 3.1 The Efficacy of the Extracts on the Diarrhea Score and Body Weight in the DNBS Induced Colitis Rat
(289) Severe diarrhea was occurred on the 2.sup.nd day and lasted to the 4.sup.th day of the model induction and then was recovered gradually. Diarrhea score was measured on the 3.sup.rd day of model induction. The extracts treated groups at the dose of 40 mg/kg ameliorated the disease progression and alleviated the diarrhea score from the 3.sup.rd day to the 6.sup.th day, and even, relieved the diarrhea severity on the 3.sup.rd day and 4.sup.th day, the efficacy of which was superior to the efficacy of the positive control SASP treated group at 300 mg/kg/day and Standard 1 treated group at 130 mg/kg/day.
(290) Compared with the naive control group, the Wistar rats in the vehicle control group showed a significant decrease in the growth trend of body weight from the 2.sup.nd day of model induction. The extracts (5.sup.˜40 mg/kg/day) restored body weight to a certain extent. The efficacy of the extracts was comparable to positive drug SASP at 300 mg/kg/day and Standard 1 at 130 mg/kg/day.
(291) The oral administration of the extracts at 5.sup.˜40 mg/kg ameliorated the severity of DNBS-induced colitis model in a certain dose-dependent manner. The extracts at 40 mg/kg/day showed the most remarkable efficacy in the model.
(292) 3.2 The Efficacy of the Extracts on Colon Ratio in the DNBS Induced Colitis Rat
(293) The following data showed that the colon ratios in the extracts of the invention treated groups were significantly decreased at the end of the study (Table 8). The colon ratio in the extract treatment groups at 20 mg/kg/day and 40 mg/kg/day were reduced to about 40%, which is comparable with the efficacy of SASP at 300 mg/kg/day and Standard 1 at 130 mg/kg/day.
(294) TABLE-US-00009 TABLE 8 Colon length, colon weight and colon ratio in the DNBS induced colitis model Dose Colon ration Colon ratio Groups (mg/kg) n CW/CL (%) inhibition, % Experiment 1 Naive (ethanol control) — 8 0.0690 ± 0.0028*** — Vehicle (DNBS control) — 8 0.0972 ± 0.0114 — DNBS + SASP 300 8 0.0846 ± 0.0089* 44.5 DNBS + “Example 10” 5 8 0.0930 ± 0.0102 14.8 10 8 0.0892 ± 0.0067 28.3 20 8 0.0872 ± 0.0069* 35.2 40 8 0.0867 ± 0.0078* 37.1 Experiment 2 Naive (ethanol control) — 8 0.0741 ± 0.0068*** — Vehicle (DNBS control) — 8 0.1033 ± 0.0077 — DNBS + “Example 11” 40 8 0.0890 ± 0.0065** 48.9 DNBS + Standard 1 130 8 0.0929 ± 0.0083* 35.6 *p < 0.05 vs vehicle control, **p < 0.01 vs vehicle control, ***p < 0.001 vs vehicle control.
3.3 The Efficacy of the Extracts on the Histopathology in the DNBS Induced Colitis Model
(295) All the samples in the naive control group showed focal inflammatory cell infiltration without mucosa erosion. In vehicle control group, seven samples showed pathological changes including severe mucosal erosion, severely damaged mucosa structure, inflammatory cell infiltration and even be seen throughout the whole intestinal wall, mucosa edema and muscle thickening. One sample showed very mild pathological changes with only focal inflammatory cell infiltration. In SASP (300 mg/kg/day) group, five samples showed severe mucosal erosion and inflammatory cell infiltration. Three samples showed only focal cell infiltration without obvious mucosa erosion. Mucosa edema was found in most samples in this group. In the extracts (10 mg/kg/day, 20 mg/kg/day and 40 mg/kg/day) treated groups, five samples in each group showed moderate to severe mucosal erosion, inflammatory cell infiltration, and mucosa edema. The other three samples in each group showed only inflammatory cell infiltration without obvious mucosa erosion. Mucosa edema was found in all samples.
(296) By histopathological score evaluation, significant decreased histological score was found in the extracts treated groups at 10 mg/kg/day, 20 mg/kg/day and 40 mg/kg/day compared with vehicle control group, wherein the histological score of the Example 10 treated group at 40 mg/kg/day is comparable with the score of SASP treated group at 300 mg/kg/day. Significant improvement in histological changes of DNBS induced colitis model were shown in the extract treated groups at 20 mg/kg/day and 40 mg/kg/day, mainly in reducing ulcer area and % Severe destruction, inflammatory cell infiltration, mucosa edema, and muscle thickening. (Table 9)
(297) TABLE-US-00010 TABLE 9 The efficacy of the extracts on the colon histopathology score in the DNBS induced rat colitis model The histopathological scoring results of colons Severe Severely Total area destruction Degree of Degree of affected in Dose affected Degree of for erosion mucosa cellular infiltration Group (mg/kg) n (%) erosion/ulcer (%) edema infiltrate (%) Experiment 1 Naive — 8 1.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.8 ± 0.5 1.8 ± 0.7 1.0 ± 0.0 (ethanol control) Vehicle — 8 2.5 ± 1.2 2.6 ± 1.1 1.3 ± 0.7 2.4 ± 1.1 2.5 ± 0.8 2.1 ± 0.6 (DNBS control) DNBS + SASP 300 8 1.6 ± 0.7 1.6 ± 1.4 0.8 ± 0.7 1.6 ± 0.9 2.1 ± 0.8 1.6 ± 0.7 DNBS + Example 10 5 8 2.1 ± 0.8 2.5 ± 1.1 1.0 ± 0.5 2.5 ± 0.8 2.5 ± 0.5 1.9 ± 0.6 10 8 1.6 ± 0.7 1.9 ± 1.6 0.6 ± 0.5 2.1 ± 1.0 2.3 ± 0.7 1.5 ± 0.8 20 8 1.9 ± 0.8 1.9 ± 1.6 0.6 ± 0.5 1.8 ± 0.7 2.1 ± 0.6 1.6 ± 0.9 40 8 1.5 ± 0.5 1.8 ± 1.5 0.6 ± 0.5 1.9 ± 1.0 2.4 ± 0.5 1.3 ± 0.5 The histopathological scoring results of colons Dose Epithelium Muscle Crypt Goblet cell The sum of Group (mg/kg) hyperplasia thickening abscesses depletion score Experiment 1 Naive — 0.8 ± 0.5 0.9 ± 0.4 0.0 ± 0.0 0.6 ± 0.5 6.8 ± 1.9** (ethanol control) Vehicle — 0.9 ± 0.4 1.8 ± 1.0 0.3 ± 0.5 0.9 ± 0.4 17.1 ± 6.3 (DNBS control) DNBS + SASP 300 0.8 ± 0.5 1.4 ± 0.9 0.1 ± 0.4 0.9 ± 0.4 12.5 ± 6.3* DNBS + Example 10 5 1.0 ± 0.0 2.3 ± 0.7 0.3 ± 0.5 1.0 ± 0.0 17.0 ± 3.7 10 0.9 ± 0.4 1.6 ± 1.1 0.1 ± 0.4 0.9 ± 0.4 13.5 ± 5.6* 20 0.9 ± 0.4 1.4 ± 0.5 0.1 ± 0.4 0.9 ± 0.4 13.1 ± 5.0* 40 1.0 ± 0.0 1.0 ± 0.5 0.1 ± 0.4 1.0 ± 0.0 12.5 ± 3.7** *p < 0.05 vs vehicle control, **p < 0.01 vs vehicle control.