Multiplex pyrophosphorolysis activated polymerization to amplify multiple almost-sequence-identical templates in a single reaction
11193167 · 2021-12-07
Inventors
- Shaofeng Ding (Santa Fe Springs, CA, US)
- Tony Zhou Lee (San Diego, CA, US)
- Qiang Liu (Rancho Cucamonga, CA, US)
Cpc classification
C12Q1/6848
CHEMISTRY; METALLURGY
C12Q2537/143
CHEMISTRY; METALLURGY
International classification
C12Q1/6848
CHEMISTRY; METALLURGY
Abstract
Multiplex pyrophosphorolysis activated polymerization uses multiple pairs of blocked primers to amplify multiple potential templates in a single reaction, including those almost-sequence-identical templates located in one locus. To identify and differentiate the multiple amplified products, individual molecules are sequenced in parallel. Thus multiplex PAP amplification is combined with parallel sequencing for ultrahigh-sensitive, ultrahigh-selective and ultrahigh-throughput detection of early cancer.
Claims
1. A method for multiplex pyrophosphorolysis activated polymerization (PAP), comprising: a) providing a plurality of pairs of forward and reverse blocked primers to amplify a plurality of potential templates in one reaction, wherein the blocked primers, with non-extendable, blocked nucleotides at their 3′ ends, are activated by pyrophosphorolysis to produce a 3′ unblocked primers and then extended by polymerization, which reactions are catalyzed by a polymerase, and wherein the templates are located at one locus consisting of 40 base pairs and have at least one nucleotide variance from each other, comprising: i. a first pair of forward and reverse primers to amplify a first template, wherein the first forward primer or reverse primer has one or two one artificial mutations introduced into its 5′ region forming one or two artificial mismatch between the 5′ region and its template, and ii. a second pair of forward and reverse primers to amplify a second template which is located at the same locus as the first template but contains at least one nucleotide variance from the first template, wherein the second forward or reverse primer in the same direction as the above 5′ mutated primer in the first pair has one or two one artificial mutations introduced into its 5′ region forming one or two artificial mismatch between the 5′ region and its template, wherein, the artificial mutations of the 5′ mutated primers in the first pair and in the second pair are located at different nucleotides at the locus of the genome and have different mismatches between the two pairs of primers, each of which amplify a different template, and b) amplifying the templates in one reaction.
2. The method for multiplex PAP of claim 1, further comprising a step c) sequencing individual molecules of the multiple amplified products in parallel.
3. The method for multiplex PAP of claim 1, wherein the plurality of pairs of forward and reverse blocked primers further comprise a third pair of forward and reverse primers to amplify a third template which is located at the same locus as the first and second templates but contains at least one nucleotide variance from each of the first and second templates, wherein the third forward or reverse primer in the same direction as the above 5′ mutated primer in the first and second pairs has at least one artificial mutation introduced into its 5′ region, wherein, the artificial mutations of the 5′ mutated primers in the first pair, the second pair and the third pair are located at different nucleotides at the locus of the genome.
4. The method for multiplex PAP of claim 1, wherein the plurality of pairs of forward and reverse blocked primers comprise: i.the first pair of forward and reverse primers, wherein the other primer in the first pair comprises at least one artificial mutation in the 5′ region in addition to the primer which already contains the artificial mutation, and ii.the second pair of forward and reverse primers, wherein the other primer in the second pair comprises at least one artificial mutation in the 5′ region in addition to the primer which already contains the artificial mutation, wherein the artificial mutations of the 5′ mutated primers in the first pair and the second pair are located at different nucleotides at the locus of the genome.
5. The method for multiplex PAP of claim 1, wherein the 3′ regions of the first pair of primers match the first template but mismatch the second template, and the 3′ regions of the second pair of primers match the second template but mismatch the first template, and wherein the first and second templates are located at the same locus but contain at least one nucleotide variance from each other.
6. The method for multiplex PAP of claim 1, wherein the artificial mutation of the 5′ mutated primer in each of the first and second pairs is selected from the group consisting of six types of A to C, C to A, T to G, G to T, A to T, and T to A mutations.
7. The method for multiplex PAP of claim 1, wherein the artificial mutation of the 5′ mutated primer in each of the first and second pairs result in one of the four types of mismatches of G-A, C-T, A-A, and T-T between the 5′ region of the 5′ mutated primer and the complementary strand of the template.
8. The method for multiplex PAP of claim 1, wherein the artificial mutation of the 5′ mutated primer in any of the first and second pairs is selected from the group consisting of four types of A to C, C to A, T to G, and G to T mutations.
9. The method for multiplex PAP of claim 1, wherein the artificial mutation of the 5′ mutated primer in any of the first and second pairs is selected from the group consisting of two types of A to T and T to A mutations.
10. The method for multiplex PAP of claim 1, wherein the 5′ regions of the 5′ mutated primers in the first and second pairs range from the first to the twelfth nucleotide from the 5′ ends, including the nucleotides at the 5′ ends assigned as the first nucleotides from the 5′ ends.
11. The method for multiplex PAP of claim 1, wherein the first and second templates are completely or partially overlapped in the locus.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
DETAILED DESCRIPTION OF THE INVENTION
Terminology
(7) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.
(8) PCR refers to polymerase chain reaction.
(9) Pyrophosphorolysis is the reverse reaction of deoxyribonucleic acid polymerization. In the presence of pyrophosphate, the 3′ nucleotide is removed by a polymerase from duplex DNA to generate a triphosphate nucleotide and a 3′ unblocked duplex DNA: [dNMP].sub.n+PPi.fwdarw.[dNMP].sub.n-1+dNTP (Deutscher and Kornberg, 1969).
(10) Polymerase or nucleic acid polymerase refers to a polymerase characterized as polymerization or extension of deoxyribonucleic acids.
(11) 3′ blocked primer refers to an oligonucleotide with a 3′ non-extendable nucleotide (3′ blocker), such as a dideoxynucleotide or an acycolonucleotide. The 3′ nucleotide could not be directly extended, but it can be removed by pyrophosphorolysis and then the unblocked primer can be extended by polymerase.
(12) PAP refers to pyrophosphorolysis activated polymerization.
(13) Bidirectional-PAP (Bi-PAP) is a form of PAP that uses a pair of opposing blocked primers that overlap by one nucleotide at their 30 termini.
(14) Exponential-PAP is a form of PAP that uses a pair of two opposing forward and reverse primers for exponential product accumulation with cycles. At least one primer is blocked primer.
(15) Sensitivity or detection limit is defined as the smallest copy number of a template that generates a detectable product when the blocked primers match the template at the targeted nucleotide, such as the 3′ end.
(16) Specificity is defined as the largest copy number of a template that generates an undetectable product when the blocked primers mismatch the template at the targeted nucleotide, such as the 3′ end.
(17) Selectivity, the ratio of sensitivity to specificity, is defined as the ability to detect a small number of copies of the matched template in the presence of a large number of copies of mismatched templates without causing false positives.
(18) Thermostable enzyme refers to an enzyme that is heat stable or heat resistant.
(19) TaqFS is a genetic engineered form of Taq polymerase containing G46E and F667Y amino acid changes compared with wild type sequence.
(20) A locus is defined as a short region of nucleotide sequence, such as 40 bp, in genome.
(21) Multiple templates or alleles at one locus mean that at least two templates are located at a short region of nucleotide sequence. The sequence differences among the templates, may be as little as one base substitution, a few base deletion or insertion, and may be located as near as at the same nucleotide. In addition, the alleles may be completely or partially overlapped within the region.
(22) Multiple almost-sequence-identical templates or alleles mean at least two templates, typically located at one locus in genome, among which the sequence differences may be as little as one base substitution, a few base deletion or insertion.
(23) A pair of primers means two opposing forward and reverse primers.
(24) Singleplex-PAP means that one pair of primers amplify one template in a reaction.
(25) Multiplex-PAP means that ≥2 pairs of primers amplify ≥2 potential templates in a reaction.
(26) Multiplex-PAP at multiple loci is a form of multiplex PAP that ≥2 pairs of primers amplify ≥2 potential templates at ≥2 loci in a reaction.
(27) One-Locus-Multiplex-PAP is a form of multiplex PAP that ≥2 pairs of primers amplify ≥2 potential templates at one locus in a reaction.
(28) One-Locus-Duplex-PAP means that 2 pairs of primers amplify 2 potential templates at one locus in a reaction.
(29) One-Locus-Triplex-PAP means that 3 pairs of primers amplify 3 potential templates at one locus in a reaction.
(30) The 5′ region of a primer is the 5′ part of the primer sequence, such as the ten successive nucleotides from the 5′ end.
(31) The 3′ region of a primer is the 3′ part of the primer sequence, such as the ten successive nucleotides from the 3′ end.
(32) Central region of a primer is the middle part of the primer sequence between the 5′ region and the 3′ region.
(33) 5′-perfect-match primer: the 5′ region has no artificial mutations and perfectly matches the starting template.
(34) 5′-artificial-mismatch primer: artificial mutations are introduced into the 5′ region, resulting to mismatch to the starting template.
(35) 5′ mutated primer: i.e., 5′-artificial-mismatch primer, artificial mutations are introduced into the 5′ region.
(36) Artificial mutation means the mutation that is artificially introduced into primer sequences for substitution, typically in the 5′ region.
(37) Artificial mismatch is formed between the artificial mutation in the 5′ region of 5′-artificial-mismatch primer and the template.
(38) Starting template is the original template before amplification starts, such as that from genomic or plasmid DNA template.
(39) Duplicated template is duplicated from the starting template in amplification and can also be taken as template in later cycles.
(40) Terminology of Real-Time Fluorescence Detection
(41) Baseline is the level of fluorescence signal during initial cycles. The low level can be considered as background or “noise” of the reaction.
(42) Threshold is defined as the level of fluorescence signal that is a significant higher than baseline signal and can distinguish amplification signal from the background.
(43) Ct (threshold cycle) is the cycle number at which the fluorescence signal crosses the threshold.
(44) Amplification efficiency is defined as the percent of template that is amplified by the end of a cycle.
(45) Principle of 5′-Artificial-Mismatch Primers for One-Locus-Multiplex-PAP
(46) In order for multiple pairs of blocked primers to amplify multiple almost-sequence-identical templates or alleles at one locus without inhibitory interaction, a novel design of 5′-artificial-mismatch primers was developed that contain artificial mutations in the 5′ regions, as in Examples 2-4.
(47) a) Four Types of Artificial Mismatches Preferred
(48) Mismatches in short DNA duplexes significantly reduce their thermal stabilities, the levels depending on the type of mismatches. The order of thermal stabilities of a total of eight possible mismatches are approximately: G-T>G-G>G-A>C-T>A-A=T-T>A-C=C-C (mismatch G-T=T-G, G-A=A-G, C-T=T-C, and A-C=C-A) (Modrich, 1987) (Aboul-ela, et al., 1985) (Ikuta, et al., 1987).
(49) We prefer four types of mismatches of G-A, C-T, A-A and T-T because 1) their thermal stabilities are medium in the order: they can disrupt the structures of short DNA duplexes, the levels being not too little and not too much, and 2) their thermal stabilities are within a successive range in the order.
(50) b) The Four Types of Mismatches Caused by Six Types of Artificial Mutations
(51) Considering a One-Locus-Multiplex-PAP, at least two pairs of primers are applied to at least two potential templates. We chose six types of artificial mutations of A to C and C to A, T to G and G to T, A to T and T to A in primers, which always lead to the four types of artificial mismatches between the primers and the complementary strands of the starting or duplicated templates. The other six possible types of artificial mutations of A to G and G to A, T to C and C to T, G to C and C to G are not used at all in the design.
(52) The A to C or C to A artificial mutations cause two types of mismatches of C-T and A-G (mismatch C-T=T-C, and A-G=G-A) between the primers and the complementary strands of the starting or duplicated templates. The T to G and G to T artificial mutations cause the same two types of mismatches of G-A and T-C (mismatch G-A=A-G, and T-C=C-T) between the primers and the complementary strands of the starting or duplicated templates. The A to T and T to A artificial mutations cause other two types of mismatches of T-T and A-A between the primers and the complementary strands of the starting or duplicated templates. Thus, a total of four types of mismatches are counted in One-Locus-Multiplex-PAP.
(53) c) The Number of Artificial Mismatches Caused by Artificial Mutations
(54) When artificial mutations of the forward or reverse primers are designed at different nucleotides in the templates, the number of mismatches between the 5′ region of a primer and the complementary strand of a starting or duplicated template depends on the number of artificial mutations of the primer and on the template. In any case, the minimum number of mismatches between the 5′ region of a primer and the complementary strand of a duplicated template is zero, such as in Examples 2-4.
(55) d) Locations of Artificial Mismatches Preferred to Localize in the 5′ Region of Primers
(56) We prefer to localize artificial mismatches in the 5′ regions of primers because 1) besides the types, the locations of mismatches also affect thermal stability of short DNA duplexes (Modrich, 1987) (Piao, et al., 2008), and 2) We found that 28-30mer blocked primers commonly had >90% efficiency of pyrophosphorolysis and extension when mismatches vary from the 1.sup.st to 12.sup.th nucleotides from the 5′ ends, i.e., the 5′ regions. However, they had very low efficiency of pyrophosphorolysis and extension when mismatches are located in the 3′ regions, particularly at the 3′ ends.
(57) Thus, artificial mutations are preferred to localize in the 5′ regions, ranging from the 1.sup.st to the 12.sup.th nucleotide from the 5′ ends, better ranging from the 3.sup.rd to 9.sup.th nucleotide from the 5′ ends.
(58) e) Mechanism by Different Numbers of Mismatches Between Different Primers and Different Templates in One-Locus-Multiplex-PAP
(59) In a One-Locus-Multiplex-PAP, ≥2 pairs of primers amplify ≥2 potential templates at one locus in a reaction. For a 5′-artificial-mismatch primer, such as each of the forward primers of the first pair, the second pair and the third pair, an artificial mutation is designed into the 5′ region. The number of mismatches between the 5′ regions and the complementary strands of the starting or duplicated templates varies, such as from zero to 4, depending on annealing of a specific primer to a specific template. Thus, the different numbers of mismatches between different primers and different templates provide the mechanism to reduce inhibitory interaction: 1) the 5′ region of a 5′-atifitial-mismatch primer matches its corresponding templates more than its competing templates, and 2) a template matches the 5′ region of its corresponding 5′-atifitial-mismatch primer more than its competing 5′-atifitial-mismatch primers, as in Examples 2-4.
Example 1
(60) Materials and Methods
(61) Preparation of Primers
(62) 3′ ddCMP blocked primers were chemically synthesized in 3′-5′ direction and purified by HPLC by Integrated DNA Technologies.
(63) 3′ ddAMP, ddTMP and ddGMP blocked primers were synthesized enzymatically by adding ddATP, ddTTP and ddGTP to the 3′ ends of oligodeoxynucleotides by terminal transferase (Liu and Sommer, 2000; Liu and Sommer, 2002). Then they were purified by 7M urea/16% polyacrylamide gel electrophoresis. The amount of each recovered primer was determined by UV absorbance at 260 nm.
(64) Preparation of Templates
(65) Genomic DNA was extracted from blood white cells using QIAamp Blood Mini Kit according to Qiagen's protocol. Recombinant plasmid DNA was constructed by inserting into pUC57 vector a 100-400 bp target DNA segment which was chemically synthesized or PCR amplified. After transformed into E. coli, the recombinant plasmid DNA was extracted using QIAamp Plasmid Mini Kit according to Qiagen's protocol. The eluted DNA was dissolved in TE buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH8.0) and its amount was determined by UV absorbance at 260 nm.
(66) PAP Reaction
(67) Unless stated otherwise, the PAP reaction mixture of 20 μl contained 88 mM Tris-HCl (pH 8.0 at 25° C.), 10 mM (NH.sub.4).sub.2SO.sub.4, 1.2-2.5 mM MgCl.sub.2, 25 μM each dNTPs (dATP, dTTP, dGTP and dCTP), 0.1 μM each primers, 90 μM Na.sub.4PP.sub.1, 0.1× SybrGreen I dye, 1-2 units of polymerase, and starting DNA template.
(68) Thermocycling
(69) A Bio-Rad CFX96 real-time PCR detection system was used for quantification of the amplified product. Analysis mode: SybrGreen fluorophore, Baseline setting: baseline subtracted curve fit, Threshold cycle (Ct) determination: single threshold, Baseline method: SYBR auto calculated, Threshold setting: auto calculated.
(70) A cycling entailed 96° C. for 12 seconds, 60° C. for 30 seconds, 64° C. for 30 seconds, and 68° C. for 30 seconds for a total of 40 cycles; or another cycling entailed 96° C. for 12 seconds, 64° C. for 45 seconds, and 68° C. for 45 seconds for a total of 40 cycles. A denaturing step of 96° C. for 2 min was added before the first cycle.
(71) To confirm the amplified product, melting curving analysis was followed from 68° C. to 95° C. with increment 0.5° C. and holding 5 seconds to confirm the specific amplified product.
(72) Serial Dilution Experiment to Determine Amplification Efficiency
(73) In order to determine the amplification efficiency, the template of plasmid or genomic DNA was 10-fold serially diluted from 10.sup.6 to 10 copies per 20 ul of reaction. In real-time PAP, Ct value was measured for each reaction which is proportional to the amount of amplified product in the early exponential phase of amplification. In addition, melting temperature was measured to confirm the specific amplified product.
(74) Then Ct values are plotted with log DNA copies so that the equation of linear regression, coefficient of determination (R.sup.2), and slop can be calculated. The slope is converted into the amplification efficiency by a formula: Efficiency=10.sup.(−1/slope)−1.
Example 2
(75) One-Locus-Duplex-PAP in Exon 19 of the EGFR Gene
(76) In a One-Locus-Duplex-PAP, two pairs of 5′-artificial-mismatch blocked primers COSM6255 and COSM12369 (SEQ ID 15 and 16, 19 and 16) were developed to detect two deletions of del2239_2256, an 18 base deletion COSM6255 (SEQ ID 13), and del2240_2254, a 15 base deletion COSM12369 (SEQ ID 17) in exon 19 of the EGFR gene (Table 2).
(77) For the forward primer (SEQ ID 15) of the first pair COSM6255, two artificial mutations were introduced into the 5′ region, i.e., a T to G at the 4.sup.th nucleotide and an A to C at the 7.sup.th nucleotide from the 5′ end. The 3′ end has two nucleotides, CddC, that are specific to the templates COSM6255 (SEQ ID 13 and 14), but mismatch the wildtype and other templates, providing high discrimination. For the reverse primer (SEQ ID 16) of the first pair, it is shared by the second pair of primers and no artificial mutations were introduced (Table 2).
(78) For the forward primer (SEQ ID 19) of the second pair COSM12369, two artificial mutations were introduced into the 5′ region, i.e., a T to G at 3.sup.rd nucleotide, an A to C at 6.sup.th nucleotide from the 5′ end. The 3′ end has two nucleotides, CddT, that are specific to the templates COSM12369 (SEQ ID 17 and 18), but mismatch the wildtype and other templates (Table 2).
(79)
(80) Table 3 describes a more complex situation. Rather than amplify one template in
(81) The One-Locus-Duplex-PAP used the two pairs of primers COSM6255 and COSM12369 (SEQ ID No 15 and 16, 19 and 16) to amplify the potential templates COSM6255 and COSM12369 (SEQ ID 13 and 14, 17 and 18), individually or together (
(82) To determine the amplification efficiencies, the starting templates were 10-fold serially diluted from 10.sup.6 to 10 copies per 20 ul of reaction (
Example 3
(83) One-Locus-Triplex-PAP in Exon 18 of the EGFR Gene
(84) In a One-Locus-Triplex-PAP, three pairs of 5′-artificial-mismatch blocked primers COSM6252, COSM6253 and COSM6239 (SEQ ID 22 and 23, 26 and 27, 30 and 31) were developed in exon 18 of the EGFR gene (Table 4).
(85) For each primer, an artificial mutation was introduced into the 5′ region (Table 4). For example, for the forward primer (SEQ ID 22) of the first pair COSM6252, an A to C artificial mutation was introduced at the 5.sup.th nucleotide from the 5′ end. For the forward primer (SEQ ID 26) of the second pair COSM6253, a T to G was introduced at 7.sup.th nucleotide from the 5′ end. For the forward primer (SEQ ID 30) of the third pair COSM6239, a T to G was introduced at 7.sup.th nucleotide from the 5′ end.
(86)
(87) In addition, for the first pair of primers COSM6252 (SEQ ID 22 and 23), the 3′ ends are specific to the templates COSM6252 (SEQ ID 20 and 21) that contain c.2155G>A substitution in exon 18 of the EGFR gene, but mismatch the wildtype and other templates, providing high discrimination. For the second pair of primers COSM6253 (SEQ ID 26 and 27), the 3′ ends are specific to the templates COSM6253 (SEQ ID 24 and 25) that contain c.2155G>T substitution, but mismatch the wildtype and other templates. For the third pair of primers COSM6239 (SEQ ID 30 and 31), the 3′ ends are specific to the templates COSM6239 (SEQ ID 28 and 29) that contain c.2156G>C substitution, but mismatch the wildtype and other templates.
(88) The One-Locus-Triplex-PAP used the three pairs of primers COSM6252, COSM6253 and COSM6239 (SEQ ID 22 and 23, 26 and 27, 30 and 31) to amplify the potential templates COSM6252 (SEQ ID 20 and 21), COSM6253 (SEQ ID 24 and 25) and COSM6239 (SEQ ID 28 and 29), individually or together (
(89) Through 10-fold serial dilution of the starting templates, amplification efficiencies of the Singleplex-PAP and One-Locus-Duplex-PAP were determined (
Example 4
(90) One-Locus-Triplex-PAP in Exon 2 of the KRAS Gene
(91) In a One-Locus-Triplex-PAP, three pairs of 5′-artificial-mismatch blocked primers COSM518, COSM516 and COSM517 (SEQ ID 34 and 35, 38 and 39, 42 and 43) were developed in exon 2 of the KRAS gene (Table 6).
(92) For each primer, an artificial mutation was introduced into the 5′ region (Table 6). For example, for the forward primer (SEQ ID 34) of the first pair COSM518, an A to C artificial mutation was introduced at the 5.sup.th nucleotide from the 5′ end. For the forward primer (SEQ ID 38) of the second pair COSM516, an A to C was introduced at 7.sup.th nucleotide from the 5′ end. For the forward primer (SEQ ID 42) of the third pair COSM517, an A to C was introduced at 9.sup.th nucleotide from the 5′ end.
(93)
(94) For the first pair of primers COSM518 (SEQ ID 34 and 35), the 3′ ends are specific to the templates COSM518 (SEQ ID 32 and 33) that contain c.34G>C substitution in exon 2 of the KRAS gene, but mismatch the wildtype and other templates, providing the high discrimination. For the second pair of primers COSM516 (SEQ ID 38 and 39), the 3′ ends are specific to the templates COSM516 (SEQ ID 36 and 37) that contain c.34G>T substitution, but mismatch the wildtype and other templates. For the third pair of primers COSM517 (SEQ ID 42 and 43), the 3′ ends are specific to the templates COSM517 (SEQ ID 40 and 41) that contain c.34G>A substitution, but mismatch the wildtype and other templates.
(95) The One-Locus-Triplex-PAP used the three pairs of primers COSM518, COSM516 and COSM517 (SEQ ID 34 and 35, 38 and 39, 42 and 43) to amplify the potential templates COSM518 (SEQ ID 32 and 33), COSM516 (SEQ ID 36 and 37) and COSM517 (SEQ ID 40 and 41), individually or together (
(96) Through 10-fold serial dilution of the starting templates, amplification efficiencies of the Singleplex-PAP and One-Locus-Duplex-PAP were determined (
Example 5
(97) Multiplex PAP and Parallel Sequencing of Individual Molecules of the Amplified Products
(98) A Multiplex PAP System was developed to amplify multiple potential cancer-specific somatic mutations in the KRAS, EGFR, NRAS and BRAF genes in non-small cell lung cancer (NSCLC) in a single reaction.
(99) Specifically, a total of 33 pairs of blocked primers were used in a reaction to amplify 40 potential mutant templates, including those of One-Locus-Multiplex-PAP to amplify almost-sequence-identical mutant templates in the same locus in which at least a blocked primer of a pair has one or two artificial mutations introduced into its 5′ region (Table 8).
(100) Typically, only a few of such potential mutants that are actually present in the sample can be amplified in the reaction. To identify and differentiate the amplified products, individual molecules were sequenced in parallel with their frequencies scored.
(101) One-Locus-Multiplex-PAP to Amplify Multiple Templates Including Almost-Sequence-Identical Templates in a Single Reaction
(102) In order for this Multiplex PAP System to amplify not only efficiently but also evenly the multiple potential almost-sequence-identical templates, One-Locus-Multiplex-PAP was developed.
(103) For the design, the multiple potential almost-sequence-identical templates, which are located at one locus in a genome and have at least one nucleotide variance from each other, are amplified by the multiple pairs of blocked primers. A least a primer of a pair has one or two artificial mutations introduced into its 5′ region. In addition, the artificial mutations in the 5′ regions of the multiple pairs of primers are located at different nucleotides at the locus of the genome.
(104) KRAS Mutations
(105) This Multiplex PAP System includes a component of One-Locus-Multiplex-PAP in the KRAS gene. Seven pairs of blocked primers were developed for seven mutations in exon 2 (Table 8, Table 9 and B).
(106) EGFR Mutations
(107) This Multiplex PAP System includes three components of One-Locus-Multiplex-PAP and Regular-Multiplex-PAP in the EGFR gene. Twelve pairs of blocked primers were developed for eighteen mutations (Table 8, Table 10 A and B).
(108) A first component of Regular-Multiplex-PAP has three pair of blocked primer for three mutations scattered in exons 20 and 21, in which each primer of a pair has no artificial mutation introduced into its 5′ region. A second component of One-Locus-Multiplex-PAP has three pairs of blocked primers for three G719X mutations in exon 18. A third component of One-Locus-Multiplex-PAP has six pairs of blocked primers for twelve deletions in exon 19.
(109) NRAS Mutations
(110) This Multiplex PAP System assay includes two components of One-Locus-Multiplex-PAP in the NRAS gene. Thirteen pairs of blocked primers were developed for thirteen mutations (Table 8, Table 11 A and B).
(111) A first component of One-Locus-Multiplex-PAP has seven pairs of blocked primers for seven mutations in exon 2. A second component of One-Locus-Multiplex-PAP has six pairs of blocked primers for six mutations in exon 3.
(112) BRAF Mutations
(113) This Multiplex PAP System includes a component of PAP. One pair of blocked primers was a developed for two mutations in the BRAF gene (Table 8, Table 12A and B).
(114) Multiplex PAP Amplification
(115) The Multiplexed PAP System used all the above 33 pairs of blocked primers (each at 0.05 μM), including those for One-Locus-Multiplex-PAP, to amplify 40 potential templates in a reaction.
(116) To simulate conditions in cancer genome, four recombinant plasmid DNA templates (each with 1000 copies) of EGFR C2369T (T790M, COSM 6240), EGFR T2573G (L858R, COSM 6224), EGFR Del2235_2249 (delE746-A750, COSM 6223) and KRAS G34C (G12R, COSM518) mutations were added for this amplification. After performing the thermocycling procedure for 30 cycles, the amplified products were collected for parallel sequencing.
(117) Parallel Sequencing of Individual Molecules of the Amplified Products
(118) Previously, a real time PCR machine needs two fluorescence signals to identify and differentiate two amplified products, greatly limiting the number of the multiple amplified products.
(119) To resolve this problem, parallel sequencing was used to sequence individual molecules to identify and differentiate the multiple amplified products. Illumina next generation sequencer was exampled, and others like Thermo Fisher Ion Torrent, Oxford Nanopore and Pacific Biosciences SMRT sequencers can also be used. Through procedure of library preparation, cluster amplification, sequencing, and alignment and data analysis, individual molecules of the above four multiple amplified products were sequenced in parallel by an Illumina HiSeq Series sequencer.
(120) Qualified reads originated from individual molecules were called with their numbers counted (Table 13). With high frequencies, most of the reads were aligned to either target of EGFR C2369T (T790M, COSM 6240), EGFR T2573G (L858R, COSM 6224), EGFR Del2235_2249 (delE746-A750, COSM 6223) and KRAS G34C (G12R, COSM518) mutations. Thus, the four amplified products were identified and differentiated, demonstrating the feasibility of sequencing individual molecules of the multiple amplified products in parallel. With low frequencies, the remaining reads could not be aligned to the four targets or any other human genome, constituting a background of unknown origin (Table 13).
(121) The method of parallel sequencing has two advantages: 1) unlimited capacity to differentiate a large number of amplified products, and 2) additional resolution to recognize false amplified products.
(122) Thus, we combine mmultiplex PAP amplification with parallel sequencing for ultrahigh-sensitive, ultrahigh-selective and ultrahigh-throughput detection of early cancer
REFERENCE
(123) Aboul-ela F, Koh D, Tinoco I, Jr., Martin F H. 1985. Base-base mismatches. Thermodynamics of double helix formation for dCA3XA3G+dCT3YT3G (X, Y=A, C, G, T). Nucleic Acids Res 13(13):4811-24.
(124) Deutscher M P, Kornberg A. 1969. Enzymatic synthesis of deoxyribonucleic acid. 28. The pyrophosphate exchange and pyrophosphorolysis reactions of deoxyribonucleic acid polymerase. J Biol Chem 244(11):3019-28.
(125) Ikuta S, Takagi K, Wallace R B, Itakura K. 1987. Dissociation kinetics of 19 base paired oligonucleotide-DNA duplexes containing different single mismatched base pairs. Nucleic Acids Res 15(2):797-811.
(126) Liu Q, Nguyen V Q, Li X, Sommer S S. 2006. Multiplex dosage pyrophosphorolysis-activated polymerization: application to the detection of heterozygous deletions. Biotechniques 40(5):661-8.
(127) Liu Q, Sommer SS. 2000. Pyrophosphorolysis-activated polymerization (PAP): application to allele-specific amplification. Biotechniques 29(5):1072-1080.
(128) Liu Q, Sommer SS. 2002. Pyrophosphorolysis-activatable oligonucleotides may facilitate detection of rare alleles, mutation scanning and analysis of chromatin structures. Nucleic Acids Res 30(2):598-604.
(129) Liu Q, Sommer SS. 2004a. Detection of extremely rare alleles by bidirectional pyrophosphorolysis-activated polymerization allele-specific amplification (Bi-PAP-A): measurement of mutation load in mammalian tissues. Biotechniques 36(1):156-66.
(130) Liu Q, Sommer SS. 2004b. PAP: detection of ultra rare mutations depends on P* oligonucleotides: “sleeping beauties” awakened by the kiss of pyrophosphorolysis. Hum Mutat 23(5):426-36.
(131) Liu Q, Sommer SS. 2004c. Pyrophosphorolysis by Type II DNA polymerases: implications for pyrophosphorolysis-activated polymerization. Anal Biochem 324(1):22-8. Modrich P. 1987. DNA mismatch correction. Annu Rev Biochem 56:435-66.
(132) Piao X, Sun L, Zhang T, Gan Y, Guan Y. 2008. Effects of mismatches and insertions on discrimination accuracy of nucleic acid probes. Acta Biochim Pol 55(4):713-20.
(133) TABLE-US-00001 TABLE 1 Inhibition in One-Locus-Duplex-PAP using 5′-perfect-match primers Bi-allelic template # Locus.sup.a Chromosome.sup.a and primer Sequence (5′ to 3′) (SEQ ID NO) 1 Rs4261 7q A allele A-allelic 5′ggctaaaattatccctgggctctcagtaaAgccaatt template.sup.b gatgtcatcacttggacagtgt3′ (1) A-Forward 5′GGCTAAAATTATCCCTGGGCTCTCAGTAAddA (2) primer.sup.c A-Reverse 5′ACACTGTCCAAGTGATGACATCAATTGGCddT (3) primer T allele T-allelic 5′ggctaaaattatccctgggctctcagtaaTgccaatt template gatgtcatcacttggacagtgt3′ (4) T-Forward 5′GGCTAAAATTATCCCTGGGCTCTCAGTAAddT (5) primer T-Reverse 5′ACACTGTCCAAGTGATGACATCAATTGGCddA (6) primer 2 Rs31224 5q A allele A-allelic 5′ctgctcactgctaatggggttatgeggttAcaaggg template cgtgcatcatttcgcacacccag3′ (7) Forward 5′CTGCTCACTGCTAATGGGGTTATGCGGTTddA (8) primer Reverse 5′CTGGGTGTGCGAAATGATGCACGCCCTTGddT (9) primer T allele T-allelic 5′ctgctcactgctaatggggttatgeggttTcaaggg template cgtgcatcatttcgcacacccag3′ (10) Forward 5′CTGCTCACTGCTAATGGGGTTATGCGGTTddT (11) primer Reverse 5′CTGGGTGTGCGAAATGATGCACGCCCTTGddA (12) primer Footnotes of Table 1. .sup.aFrom www.ncbi.nlm.nih.gov/snp/, Rs4261 is a A/T biallelic polymorphism and Rs31224 is another A/T biallelic polymorphism. .sup.bThe downstream strand is shown for the template Rs4261. The upper and bold case is the biallelic nucleotide. .sup.cddA, underlined, is a dideoxynucleotide located at the 3′ end as a blocker. It matches the A allele-specific template Rs4261, but mismatched to the T allele-specific-template Rs4261 at the 3′ end.
(134) TABLE-US-00002 TABLE 2 5′-artificial-mismatch primers for One-Locus-Duplex-PAP in exon 19 of the EGFR gene Template Artificial mutation.sup.f COSMIC and nt from # ID.sup.ab Target.sup.b primer Sequence (5′ to 3′) (SEQ ID NO) Type the 5′ end 1 COSM6255 del2239_2256 Starting 5′agttaaaattcccgtcgctatcaaggaaccgaa Template.sup.c agccaacaaggaaatcctcgatgtgagtttc3′ (13) Duplicated 5′agtGaaCattcccgtcgctatcaaggaaccg template.sup.c aaagccaacaaggaaatcctcgatgtgagtttc3, (14) Forward 5′AGTGAACATTCCCGTCGCTA T to G, A 4, 7 primer.sup.d TCAAGGAACddC (15) to C Reverse 5′GAAACTCACATCGAGGATTT primer.sup.c CCTTGTTGGddC (16) 2 COSM12369 de12240-2254 Starting 5′agttaaaattcccgtcgctatcaaggaatctcc Template gaaagccaacaaggaaatcctcgatgtgagtttc 3′(17) Duplicated 5′agGtaCaattcccgtcgctatcaaggaatct template ccgaaagccaacaaggaaatcctcgatgtgagt ttc3′ (18) Forward 5′AGGTACAATTCCCGTCGCTA T to G, A 3, 6 primer TCAAGGAATCddT (19) to C Reverse 5′GAAACTCACATCGAGGATTT primer.sup.c CCTTGTTGGddC (16) Amplification Template efficiency Inhibition and Singleplex- Duplex- in Duplex- # COSMIC ID.sup.ab Target.sup.b primer PAP.sup.g PAP.sup.h PAP.sup.i 1 COSM6255 del2239_2256 Starting 99.4% 99.6% 0.2%.sup.i, No Template.sup.c Duplicated template.sup.c Forward primer.sup.d Reverse primer.sup.c 2 COSM12369 de12240-2254 Starting 96.7% 95.2% 1.5%, No Template Duplicated template Forward primer Reverse primer.sup.c Footnotes of Table 2. .sup.aFrom www.sanger.ac.uk/genetics/CGP/cosmic/ .sup.bCOSM6255 contains del2239_2256 deletion, and COSM 12369 contains del2240_2254 deletion in exon 19 of the EGFR gene. .sup.cOnly the downstream strand of the template is shown. For the duplicated template, the two upper, bold and underlined cases are corresponding artificial mutations duplicated from the 5′-artificial-mismatch primer, and can be taken as template in later cycles. .sup.dForward primer is a 5′-artificial-mismatch primer in which two artificial mutations G and C are indicated as bold and underlined cases. In addition, the underlined CddC are two nucleotides at the 3′ end that are specific to COSM6255 template, but mismatch the wildtype sequence. .sup.eReverse primer is used for both pairs of primers, and no artificial mutations are introduced for this primer. .sup.fArtificial mutation is indicated with the type and location from the 5′ end of a primer. .sup.gIn the Singleplex-PAP, the first pair of primers amplified the first template in a first reaction, and the second pair of primers amplified the second template in a second reaction to determine their amplification efficiencies. .sup.hIn the One-Locus-Duplex-PAP, the two pairs of primers amplified the first template in a first reaction and the second template in a second reaction, respectively. .sup.iInhibition is called Yes if the efficiency difference between the Singleplex-PAP and One-locus-Duplex-PAP is ≥5% to amplify the same template, or No if it is <5%. 0.2% is the efficiency difference between the Singleplex-PAP and One-locus-Duplex-PAP.
(135) TABLE-US-00003 TABLE 3 The number and type of mismatches between the 5′ regions of 5′-artificial-mismatch primers and the templates in exon 19 of the EGFR gene by One-Locus-Duplex-PAP Artificial mutation in the 5′ region of the forward primer.sup.a COSM6255 COSM12369 Complementary strand T to G at 4.sup.th nt, T to G at 3.sup.rd nt, # of the template A to C at 7.sup.th nt.sup.b A to C at 6.sup.th nt 1 COSM Starting.sup.a 2, G-A, C-T.sup.c 2, G-A, C-T 6255 Duplicated.sup.a 0 4, G-A, T-C, C-T, A-G 2 COSM Starting 2, G-A, C-T 2, G-A, C-T 12369 Duplicated 4, T-C, G-A, A-G, 0 C-T Footnotes of Table 3. .sup.aOnly the 5′ regions of the forward 5′-artificial-mismatch primers and the complementary strands of the starting and duplicated templates are considered in the One-Locus-Duplex-PAP. .sup.bT to G at 4.sup.th nt, A to C at 7.sup.th nt means that two artificial mutations of a T to G artificial mutation at the 4.sup.th nucleotide from the 5′ end, and an A to C artificial mutation at the 7.sup.th nucleotide from the 5′ end are contained in the 5′ region of the forward 5′-artificial-mismatch primer COSM6255. .sup.c2 means two artificial mismatches. For example, a G-A mismatch is formed between the 5′ region of the forward 5′-artificial-mismatch primer COSM6255 and the complementary strand of the starting template COSM6255. The artificial mismatch is the 4.sup.th nucleotide calculated from the 5′ end of the primer.
(136) TABLE-US-00004 TABLE 4 5′-artificial-mismatch primers for One-Locus-Triplex-PAP in exon 18 of the EGFR gene 5′ artificial mismatch COSMIC Template nt from # ID.sup.a Target.sup.a and primer Sequence (5′ to 3′) (SEQ ID NO) Type 5′end 1 COSM6252 c.2155G > A Starting 5′actgaattcaaaaagatcaaagtgctgAgctc Template cggtgcgtteggcacggtgtata3′ (20) Duplicated 5′actgCattcaaaaagatcaaagtgctgAgct template ccggtgcgttcggcacTgtgtata3′ (21) Forward 5′ACTGCATTCAAAAAGATCA A to C 5 Primer AAGTGCTGddA (22) Reverse 5′TATACACAGTGCCGAACGC C to A 8 primer ACCGGAGCddT (23) 2 COSM6253 c.2155G > T Starting 5′actgaattcaaaaagatcaaagtgctgTgctc Template cggtgcgtteggcacggtgtata3′ (24) Duplicated 5′actgaaGtcaaaaagatcaaagtgctgTgct template ccggtgcgtteggcaAggtgtata3′ (25) Forward 5′ACTGAAGTCAAAAAGATCA T to G 7 Primer AAGTGCTGddT (26) Reverse 5′TATACACCTTGCCGAACGCA G to T 9 primer CCGGAGCddA (27) 3 COSM6239 c.2156G > C Starting 5′ctgaattcaaaaagatcaaagtgctggCctcc Template ggtgcgtteggcacggtgtataa3′ (28) Duplicated 5′ctgaatGcaaaaagatcaaagtgctggCct template ccggtgcgtteggcacgAtgtataa3′ (29) Forward 5′CTGAATGCAAAAAGATCAA T to G 7 Primer AGTGCTGGddC (30) Reverse 5′TTATACAACGTGCCGAACGC C to A 8 primer ACCGGAGddG (31) Amplification Inhibition efficiency in COSMIC Template Singleplex- Triplex- Triplex- # ID.sup.a Target.sup.a and primer PAP.sup.b PAP.sup.c PAP 1 COSM6252 c.2155G > A Starting 99.9% 101.3% 0.4%, No Template Duplicated template Forward Primer Reverse primer 2 COSM6253 c.2155G > T Starting 98.1% 95.6% 2.5%, No Template Duplicated template Forward Primer Reverse primer 3 COSM6239 c.2156G > C Starting 97.3% 97.0% 0.3%, No Template Duplicated template Forward Primer Reverse primer Footnotes of Table 4. .sup.aCOSM6252 contains c.2155G > A substitution, COSM6253 contains c.2155G > T substitution, and COSM6239 contains c.2156G > C substitution in exon 18 of the EGFR gene. The three substitutions are located at two neighboring nucleotides in the sequences. .sup.bIn the Singleplex-PAP, the first pair of primers amplified the first template in a first reaction, the second pair of primers amplified the second template in a second reaction, and the third pair of primers amplified the third template in a third reaction to determine their amplification efficiencies. .sup.cIn the One-Locus-Triplex-PAP, the three pairs of primers amplified the first template in a first reaction, the second template in a second reaction, and the third template in a third reaction, respectively.
(137) TABLE-US-00005 TABLE 5 The number and type of mismatches between the 5′ regions of 5′-artificial-mismatch primers and the templates in exon 18 of the EGFR gene by One-Locus-Triplex-PAP.sup.a Artificial mutation in the 5′ region of the forward primer COSM6252 COSM6253 COSM6239 Complementary strand A to C at T to G at T to G at 7.sup.th # of the template 5.sup.th nt 7.sup.th nt.sup.b nt.sup.b 1 COSM6252 Starting 1, C-T 1, G-A 1, G-A Duplicated 0 2, A-G, G-A 2, A-G, G-A 2 COSM6253 Starting 1, C-T 1, G-A 1, G-A Duplicated 2, C-T, T-C 0 2, T-C, G-A 3 COSM6239 Starting 1, C-T 1, G-A 1, G-A Duplicated 2, C-T, T-C 2, G-A, T-C 0 Footnotes of Table 5. .sup.aThe One-Locus-Triplex-PAP used the three pairs of primers COSM6252, COSM6253 and COSM6239 (SEQ ID 22 and 23, 26 and 27, 30 and 31) to amplify the templates COSM6252 (SEQ ID 20 and 21), COSM6253 (SEQ ID 24 and 25) and COSM6239 (SEQ ID 28 and 29) in a reaction. .sup.bAlthough the two artificial mutations of the two forward primers are at the same location calculated from their 5′ ends, they are located at different nucleotides in the templates.
(138) TABLE-US-00006 TABLE 6 5′-artificial-mismatch primers for One-Locus-Triplex-PAP in exon 2 of the KRAS gene 5′ artificial Template mismatch COSMIC and nt from # ID.sup.a Target.sup.a primer Sequence (5′ to 3′) (SEQ ID NO) Type 5′ end 1 COSM518 c.34G > C Starting 5′ctgaatataaacttgtggtagttggagctCgtgg Template cgtaggcaagagtgccttgacgata3′ (32) Duplicated 5′ctgaCtataaacttgtggtagttggagctCgtg template gcgtaggcaagagtgcAttgacgata3′ (33) Forward 5′CTGACTATAAACTTGTGGTAG A to C 5 primer TTGGAGCTddC (34) Reverse 5′TATCGTCAATGCACTCTTGCC G to T 10 primer TACGCCACddG (35) 2 COSM516 c.34G > T Starting 5′ctgaatataaacttgtggtagttggagctTgtgg Template cgtaggcaagagtgccttgacgata3′ (36) Duplicated 5′ctgaatCtaaacttgtggtagttggagctTgtgg template cgtaggcaagagtgccttTacgata3′ (37) Forward 5′CTGAATCTAAACTTGTGGTAG A to C 7 primer TTGGAGCTddT (38) Reverse 5′TATCGTAAAGGCACTCTTGCC C to A 7 primer TACGCCACddA (39) 3 COSM517 c.34G > A Starting 5′ctgaatataaacttgtggtagttggagctAgtgg Template cgtaggcaagagtgccttgacgata3′ (40) Duplicated 5′ctgaatatCaacttgtggtagttggagctAgtg template gcgtaggcaagagtgccttgTcgata3′ (41) Forward 5′CTGAATATCAACTTGTGGTAG A to C 9 Primer TTGGAGCTddA (42) Reverse 5′TATCGACAAGGCACTCTTGCC T to A 6 primer TACGCCACddT (43) Amplification Inhibition Template efficiency in COSMIC and Singleplex- Triplex- Triplex- # ID.sup.a Target.sup.a primer PAP.sup.b PAP.sup.c PAP 1 COSM518 c.34G > C Starting 98.8% 97.8% 1.0%, No Template Duplicated template Forward primer Reverse primer 2 COSM516 c.34G > T Starting 97.5% 98.9% 1.4%, No Template Duplicated template Forward primer Reverse primer 3 COSM517 c.34G > A Starting 98.8% 100.1% 1.3%, No Template Duplicated template Forward Primer Reverse primer Footnotes of Table 6. .sup.aCOSM518 contains c.34G > C substitution, COSM516 contains c.34G > T substitution, COSM517 contains c.34G > A substitution in exon 2 of the KRAS gene. The three substitutions are located at two neighboring nucleotides in the sequences. .sup.bIn the Singleplex-PAP, the first pair of primers amplified the first template in a first reaction, the second pair of primers amplified the second template in a second reaction, and the third pair of primers amplified the third template in a third reaction to determine their amplification efficiencies. .sup.cIn the One-Locus-Triplex-PAP, the three pairs of primers amplified the first template in a first reaction, the second template in a second reaction, and the third template in a third reaction.
(139) TABLE-US-00007 TABLE 7 The number and type of mismatches between the 5′ regions of 5′-artificial-mismatch primers and the templates in exon 2 of the KRAS gene by One-Locus-Triplex-PAP.sup.a Artificial mutation in the 5′ region of the forward primer COSM518 COSM516 COSM517 Complementary strand A to C at A to C at A to C at # of the template 5.sup.th nt 7.sup.th nt 9.sup.th nt 1 COSM 518 Starting 1, C-T 1, C-T 1, C-T Duplicated 0 2, A-G, C-T 2, A-G, C-T 2 COSM 516 Starting 1, C-T 1, C-T 1, C-T Duplicated 2, C-T, A-G 0 2, A-G, C-T 3 COSM 517 Starting 1, C-T 1, C-T 1, C-T Duplicated 2, C-T, A-G 2, C-T, A-G 0 Footnotes of Table 7. .sup.aThe One-Locus-Triplex-PAP used the three pairs of primers COSM518, COSM516 and COSM517 (SEQ ID 34 and 35, 38 and 39, 42 and 43) to amplify the templates COSM518 (SEQ ID 32 and 33), COSM516 (SEQ ID 36 and 37) and COSM517 (SEQ ID 40 and 41) in a reaction.
(140) TABLE-US-00008 TABLE 8 Summary of components in the Multiplex PAP System.sup.a Number Number of In Type of Mutation of pairs of one Multiplex- Gene Exon type mutations primers locus PAP KRAS.sup.b 2 Single base 7 7 Yes One-Locus- EGFR 20, 21 Single base 3 3 No Regular- 18 Single base 3 3 Yes One-Locus- 19 Deletion 12 6 Yes One-Locus- NRAS 2 Single base 7 7 Yes One-Locus- 3 Single base 6 6 Yes One-Locus- BRAF Single base 2 1 No Regular- Total 40 33 Footnotes of Table 8 .sup.aThe Multiplex PAP System contains components of One-Locus-Multiplex-PAP and Regular-Multiplex-PAP, depending on whether or not the individual assays are located at the same locus. For One-Locus-Multiplex-PAP, at least a blocked primer of a pair has one or two artificial mutations introduced into its 5′ region (5′ mutated primer), while for Regular-Multiplex-PAP, each primer of a pair has no artificial mutation introduced into its 5′ region (5′ perfect match primer). .sup.bFor example, the KRAS gene has seven mutations in the same locus within exon 2, and thus seven pairs of blocked primers are used for a component of One-Locus-Multiplex-PAP.
(141) TABLE-US-00009 TABLE 9A List of seven KRAS mutations Mutation Relative #.sup.a Exon AA change (CDS) frequency (%) COSM ID 1 2 p.G12S c.34G > A 4.7 COSM517 2 2 p.G12R c.34G > C 3.3 COSM518 3 2 p.G12C c.34G > T 11.5 COSM516 4 2 p.G12D c.35G > A 34.8 COSM521 5 2 p.G12A c.35G > C 5.5 COSM522 6 2 p.G12V c.35G > T 23.7 COSM520 7 2 p.G13D c.38G > A 12.9 COSM532 Sum 96.3% Footnotes of Table 9A .sup.aThe mutations in the KRAS gene are numbered from 1 to 7. The seven mutant templates are located at one locus of exon 2 and have at least one nucleotide variance from each other.
(142) TABLE-US-00010 TABLE 9B Seven pairs of blocked primers for the seven KRAS mutations 5′ artificial mutation nt from #.sup.a Primer Sequence (5′ to 3′) (SEQ ID NO) Type 5′ end 1 Forward 5′CTGACTATAAACTTGTGGTAGTTGGAGCTddC A to C 5 primer (42).sup.b Reverse 5′TATCGTCAATGCACTCTTGCCTACGCCACddG G to T 10 primer (43) 2 Forward 5′CTGAATCTAAACTTGTGGTAGTTGGAGCTddT A to C 7 primer (34) Reverse 5′TATCGTAAAGGCACTCTTGCCTACGCCACddA C to A 7 primer (35) 3 Forward 5′CTGAATATCAACTTGTGGTAGTTGGAGCTddA A to C 9 primer (38) Reverse 5′TATCGACAAGGCACTCTTGCCTACGCCACddT T to A 6 primer (39) 4 Forward 5′TGAAGATAAACTTGTGGTAGTTGGAGCTGddA T to G 5 primer (44) Reverse 5′GTATCGTCATGGCACTCTTGCCTACGCCAddT A to T 10 primer (45) 5 Forward 5′TGAATAGAAACTTGTGGTAGTTGGAGCTGddC T to G 7 primer (46) Reverse 5′GTATCGACAAGGCACTCTTGCCTACGCCAddG T to A 7 primer (47) 6 Forward 5′TGAATATAGACTTGTGGTAGTTGGAGCTGddT T to G 9 primer (48) Reverse 5′GTATAGTCAAGGCACTCTTGCCTACGCCAddA C to A 5 primer (49) 7 Forward 5′ATATAACCTTGTGGTAGTTGGAGCTGGTGddA A to C 7 primer (50) Reverse 5′GCTGTAACGTCAAGGCACTCTTGCCTACGddT T to A 7 primer (51) Footnotes of Table 9B .sup.aThe seven pairs of primers for the KRAS mutations are also numbered from 1 to 7. They are covered by a component of One-Locus-Multiplex-PAP in which a blocked primer of a pair has an artificial mutation introduced into its 5′ region. In addition, the artificial mutations of the 5′ mutated primers of the seven pairs are located at different nucleotides in exon 2 of the KRAS gene. .sup.bThe primer has an artificial mutation indicated as a bold and underlined case, and the type and location from the 5′ end are also shown. In addition, the underlined ddC is a nucleotide at the 3′ end that is specific to its template, but mismatches the wildtype sequence.
(143) TABLE-US-00011 TABLE 10A List of eighteen EGFR mutations Relative #.sup.a Exon AA change Mutation frequency (%) COSM ID 1 21 L858R T2573G 40.1% COSM 6224 2 21 L861Q T2582A 1.6% COSM 6213 3 20 T790M C2369T 5.5% COSM 6240 4 18 G719A G2156C 1.0% COSM 6239 5 18 G719S G2155A 0.8% COSM 6252 6 18 G719C G2155T 0.6% COSM 6253 7 19 delE746-A750 del2235_2249 16.9% COSM 6223 19 del2236_2250 8 19 delE746-S752insV del2237_2255insT 1.1% COSM 12384 9 19 delE746-S752insV del2237_2256insTT 0.1% COSM 133194 10 19 delE746-T751insVP del2237_2253insTT 0.1% COSM 52935 CCT 11 19 delE746-A750 del2236_2250 7.9% COSM 6225 12 19 del747-P753insS del2240_2257 2.8% COSM 12370 13 19 del747-P753insS del2239_2257insT 0.1% COSM 133197 14 19 delL747-A750insP del2239_2248insC 1.7% COSM 12382 15 19 delL747-S752 del2239_2256 0.7% COSM 6255 16 19 delL747-A751insP del2239_2251insC 0.5% COSM 12383 17 19 delL747-T751 del2240_2254 1.4% COSM 12369 18 19 delL747-T751 del2238_2252 0.2% COSM 23571 Sum 82.8% Footnotes of Table 10A .sup.aThe eighteen mutations in the EGFR gene are numbered from 1 to 18.
(144) TABLE-US-00012 TABLE 10B Twelve pairs of blocked primers for the eighteen EGFR mutations 5′ artificial mutation nt from #.sup.a Primer Sequence (5′ to 3′) (SEQ ID NO) Type 5′ end 1 Forward 5′GCAGCATGTCAAGATCACAGATTTTGGGCddG primer (52) Reverse 5′CTTTCTCTTCCGCACCCAGCAGTTTGGCCddC primer (53) 2 Forward 5′CAAGATCACAGATTTTGGGCTGGCCAAACddA primer (54) Reverse 5′CATGGTATTCTTTCTCTTCCGCACCCAGCddT primer (55) 3 Forward 5′CTGCCTCACCTCCACCGTGCAGCTCATCAddT primer (56) Reverse 5′CGGACATAGTCCAGGAGGCAGCCGAAGddG primer (57) 4 Forward 5′ACTGCATTCAAAAAGATCAAAGTGCTGddA A to C 5 primer (22) Reverse 5′TATACACAGTGCCGAACGCACCGGAGCddT C to A 8 primer (23) 5 Forward 5′ACTGAAGTCAAAAAGATCAAAGTGCTGddT T to G 7 primer (26) Reverse 5′TATACACCTTGCCGAACGCACCGGAGCddA G to T 9 primer (27) 6 Forward 5′CTGAATGCAAAAAGATCAAAGTGCTGGddC T to G 7 primer (30) Reverse 5′TTATACAACGTGCCGAACGCACCGGAGddG C to A 8 primer (31) 7 Forward 5′GAGACAGTTAAAATTCCCGTCGCTATCAAAAd A to C 5 primer dC (58) 8-10 Forward 5′AAGTTAAAAGTCCCGTCGCTATCAAGGTTddC T to G 10 primer (59) 11 Forward 5′GAAAGTTAAACTTCCCGTCGCTATCAAGAddC A to C 11 primer (60) 12 Forward 5′AGTTAAAATGCCCGTCGCTATCAAGGAATCdd T to G 10 primer G (61) 13-16 Forward 5′AGTGAACATTCCCGTCGCTATCAAGGAACddC T to G, 4, 7 primer.sup.b (15) A to C 17-18 Forward 5′AGGTACAATTCCCGTCGCTATCAAGGAATCdd T to G, 3, 6 primer.sup.b T (19) A to C 7-18 Reverse 5′GAAACTCACATCGAGGATTTCCTTGTTGGddC prime.sup.c (16) Footnotes of Table 10B .sup.aThe twelve pairs of primers are numbered for the eighteen EGFR mutations. The 1st-3rd pairs are in a first component of Regular-Multiplex-PAP that each primer of a pair has no artificial mutations introduced into its 5′ region. The 4th-6th pairs are in a second component of One-Locus-Multiplex-PAP. The 7th-18th pairs are in a third component of One-Locus-Multiplex-PAP. .sup.bThe forward primers has two artificial mutations introduced into its 5′ region. .sup.cIn the third component of One-Locus-Multiplex-PAP, the reverse primer has no artificial mutations introduced into its 5′ region and it pairs each of the six forward primers for deletions in exon 19.
(145) TABLE-US-00013 TABLE 11A List of thirteen NRAS mutations Mutation Relative #.sup.a Exon AA change (CDS) frequency (%) COSM ID 1 3 p.Q61R c.182A > G 26.4 COSM584 2 3 p.Q61K c.181C > A 16.0 COSM580 3 2 p.G12D c.35G > A 15.4 COSM564 4 2 p.G13D c.38G > A 8.3 COSM573 5 2 p.G12S c.34G > A 4.3 COSM563 6 3 p.Q61L c.182A > T 4.5 COSM583 7 2 p.G13V c.38G > T 0.9 COSM574 8 2 p.G13R c.37G > C 4.1 COSM569 9 3 p.Q61H c.183A > T 2.7 COSM585 10 2 p.G12C c.34G > T 2.9 COSM562 11 3 p.Q61H c.183A > C 2.2 COSM586 12 2 p.G13C c.37G > T 0.9 COSM570 13 3 p.Q61P c.182A > C 0.7 COSM582 Sum 89.3% Footnotes of Table 11A .sup.aThe thirteen mutations in the NRAS gene are numbered from 1 to 13.
(146) TABLE-US-00014 TABLE 11B Thirteen pairs of blocked primers for the thirteen NRAS mutations 5′ artificial mutation nt from #.sup.a Primer Sequence (5′ to 3′) (SEQ ID NO) Type 5′ end 1 Forward 5′TTTGTTTGACATACTGGATACAGCTGGACddG G to T 7 primer (62) Reverse 5′ATTGGTCACTCATGGCACTGTACTCTTCTddC T to A 8 primer (63) 2 Forward 5′GTTTGATGGACATACTGGATACAGCTGGAddA T to A 6 primer (64) Reverse 5′TTGGTCTCACATGGCACTGTACTCTTCTTddT T to A 9 primer (65) 3 Forward 5′AGTACAAACAGGTGGTGGTTGGAGCAGddA T to A 10 primer (66) Reverse 5′ATTGTCATTGCGCTTTTCCCAACACCAddT G to T 8 primer (67) 4 Forward 5′ACAAACTTGTGGTGGTTGGAGCAGGTGddA G to T 8 primer (68) Reverse 5′CTGGATTGACAGTGCGCTTTTCCCAACAddT T to A 9 primer (69) 5 Forward 5′GAGTACACACTGGTGGTGGTTGGAGCAddA A to C 8 primer (70) Reverse 5′TTGTCAGAGCGCTTTTCCCAACACCACddT T to A 8 primer (71) 6 Forward 5′TTTGTAGGACATACTGGATACAGCTGGACddT T to A 6 primer (72) Reverse 5′ATTGGTCTATCATGGCACTGTACTCTTCTddA T to A 9 primer (73) 7 Forward 5′ACAAACTGTTGGTGGTTGGAGCAGGTGddT G to T 9 primer (74) Reverse 5′TGGATGGTCAGTGCGCTTTTCCCAACAddA T to G 6 primer (75) 8 Forward 5′TACAAAATGGTGGTGGTTGGAGCAGGTddC C to A 7 primer (76) Reverse 5′GGATTGTCCGTGCGCTTTTCCCAACACddG A to C 9 primer (77) 9 Forward 5′TTGTTGGTCATACTGGATACAGCTGGACAddT A to T 8 primer (78) Reverse 5′TATTGGTATCTCATGGCACTGTACTCTTCddA C to A 8 primer (79) 10 Forward 5′GAGTACAATCTGGTGGTGGTTGGAGCAddT A to T 9 primer (80) Reverse 5′TTGTAAGTGCGCTTTTCCCAACACCACddA C to A 5 primer (81) 11 Forward 5′TTGTTGGAAATACTGGATACAGCTGGACAddC C to A 9 primer (82) Reverse 5′TATTGTTCTCTCATGGCACTGTACTCTTCddG G to T 6 primer (83) 12 Forward 5′TACAAACTGGAGGTGGTTGGAGCAGGTddT T to A 11 primer (84) Reverse 5′GGATTTTCAGTGCGCTTTTCCCAACACddA G to T 6 primer (85) 13 Forward 5′TTTGTTGTACATACTGGATACAGCTGGACddC G to T 8 primer (86) Reverse 5′ATTGGACTCTCATGGCACTGTACTCTTCTddG T to A 6 primer (87) Footnotes of Table 11B .sup.aThe thirteen pairs of primers for the thirteen NRAS mutations are also numbered from 1 to 18. They are covered by two components of One-Locus-Multiplex-PAP.
(147) TABLE-US-00015 TABLE 12A List of two BRAF mutations Relative AA frequency #.sup.a change Mutation (CDS) (%) COSM ID 1 V600E c.1799T > A 95 COSM476 2 V600K c.1798_1799GT > AA 2 COSM473 Sum 97% Footnotes of Table 12A .sup.aThe two mutations in the BRAF gene are numbered from 1 to 2.
(148) TABLE-US-00016 TABLE 12B One pair of blocked primers for the two BRAF mutations 5′ artificial mutation nt from #.sup.a Primer Sequence (5′ to 3′) (SEQ ID NO) Type 5′ end 1, 2 Forward 5′CAGTAAAAATAGGTGATTTTGGTCTAGCTAddC primer (88) Reverse 5′ACTGATGGGACCCACTCCATCGAGATTTCddT primer (89) Footnotes of Table 12B .sup.aThe pair of primers are used for the two BRAF mutations.
(149) TABLE-US-00017 TABLE 13 List of mutations identified by sequencing Number Relative of reads frequency # Read aligned.sup.a observed (%) COSM ID 1 EGFR T790M 6.3 × 10.sup.6 29.3% COSM 6240 2 EGFR L858R 4.5 × 10.sup.6 20.7% COSM 6224 3 EGFR E19 deletion 4.3 × 10.sup.6 19.9% COSM 6223 4 KRAS G12R 5.0 × 10.sup.6 23.0% COSM 518 5 Not aligned to human 1.6 × 10.sup.6 7.2% genome Sum 21.6 × 10.sup.6 100% Footnotes of Table 13 .sup.aRead originates from individual molecules of the amplified products, and it is aligned to either template or complementary strand.