DETECTION OF DNA HYDROXYMETHYLATION
20210371910 · 2021-12-02
Inventors
Cpc classification
International classification
Abstract
Reagents and methods for analysis of DNA hydroxymethylation are provided. Methods comprise modification of hydroxymethylated cytosine residues with a bulky moiety to protect hydroxymethylated positions from cleavage with a DNA endonuclease. For example, methods may comprise contacting DNA with a glucosyltransferase to glucosylate hydroxymethylated DNA positions and digesting the DNA with a DNA endonuclease to cleave DNA in positions lacking hydroxymethylation. Reagents and kits for hydroxymethylated DNA analysis are also provided.
Claims
1-48. (canceled)
49. A method for detecting sequence-specific DNA hydroxymethylation in a DNA sample comprising: (i) contacting the DNA sample with a glucosyltransferase, thereby glucosylating hydroxymethylcytosines present in the DNA sample; (ii) contacting the glucosylated DNA sample with at least one DNA endonuclease that is able to cleave at sequences comprising an unmodified cytosine, 5-methylcytosine, or 5-hydroxymethylcytosine, but cannot cleave at sequences comprising glucosyl-5-hydroxymethylcytosine, thereby generating DNA fragments comprising glucosylated hydroxymethylcytosines; and (iii) performing PCR to amplify the sequence-specific DNA, where amplification indicates the presence of sequence-specific DNA hydroxymethylation.
50. The method of claim 49, further comprising step, between steps (i) and (ii), of contacting the glucosylated DNA sample with a DNA methyltransferase, thereby methylating unmodified cytosines present in the DNA sample.
51. The method of claim 50, wherein the DNA methyltransferase is M.SssI or M.CviPI.
52. The method of claim 50, wherein step (ii) comprises contacting the glucosylated DNA sample with at least one DNA endonuclease that is able to cleave at sequences comprising a 5-methylcytosine, but cannot cleave at sequences comprising glucosyl-5-hydroxymethylcytosine.
53. The method of claim 49, wherein the PCR is qPCR.
54. The method of claim 53, further comprising contacting a non-glucosylated DNA sample with at least one DNA endonuclease that is able to cleave at sequences comprising an unmodified cytosine, 5-methylcytosine, or 5-hydroxymethylcytosine, but cannot cleave at sequences comprising glucosyl-5-hydroxymethylcytosine; performing qPCR to amplify the sequence-specific DNA; and comparing the Ct of the glucosylated DNA sample with the Ct of the non-glucosylated DNA sample, wherein a lower Ct in the glucosylated DNA sample indicates the presence of sequence-specific DNA hydroxymethylation.
55. The method of claim 49, further comprising ligating the DNA fragments of step (ii) to an oligonucleotide tag before step (iii), wherein the oligonucleotide tag comprises a sequence for PCR primer binding.
56. The method of claim 49, wherein the DNA endonuclease is Mspl, Bisl, Glal, Taqαl, or McrBC.
57. The method of claim 49, wherein the glucosyltransferase is recombinant, is from a T-even bacteriophage, or is a β-glucosyltransferase.
58. A method for detecting sequence-specific DNA hydroxymethylation in a DNA sample comprising: (i) contacting the DNA sample with a glucosyltransferase, thereby glucosylating hydroxymethylcytosines present in the DNA sample; (ii) contacting the glucosylated DNA sample with at least one DNA endonuclease that is able to cleave at sequences comprising an unmodified cytosine, 5-methylcytosine, or 5-hydroxymethylcytosine, but cannot cleave at sequences comprising glucosyl-5-hydroxymethylcytosine, thereby generating DNA fragments comprising glucosylated hydroxymethylcytosines; and (iii) determining the sequence of DNA fragments.
59. The method of claim 58, further comprising ligating the DNA fragments of step (ii) to an oligonucleotide tag before step (iii), wherein the oligonucleotide tag comprises a sequence the which a sequencing primer binds.
60. The method of claim 59, wherein step (iii) comprising sequencing the DNA fragments using a primer that hybridizes to the oligonucleotide tag.
61. The method of claim 58, further comprising step, between steps (i) and (ii), of contacting the glucosylated DNA sample with a DNA methyltransferase, thereby methylating unmodified cytosines present in the DNA sample.
62. The method of claim 61, wherein the DNA methyltransferase is M.SssI or M.CviPI.
63. The method of claim 61, wherein step (ii) comprises contacting the glucosylated DNA sample with at least one DNA endonuclease that is able to cleave at sequences comprising a 5-methylcytosine, but cannot cleave at sequences comprising glucosyl-5-hydroxymethylcytosine.
64. The method of claim 58, wherein the DNA endonuclease is Mspl, Bisl, Glal, Taqαl, or McrBC.
65. The method of claim 58, wherein the glucosyltransferase is recombinant.
66. The method of claim 58, wherein the glucosyltransferase is from a T-even bacteriophage.
67. The method of claim 58, wherein the glucosyltransferase is a β-glucosyltransferase.
Description
BRIEF DESCRIPTION OF THE DRAWING
[0021] The following drawings are part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to the drawings in combination with the detailed description of specific embodiments presented herein.
[0022]
[0023]
[0024]
[0025] CCGG at the internal C (indicated by underlining) were digested as indicated and analyzed by agarose gel electrophoresis. “Untreated template” is the hemi-hydroxymethylcytosine DNA template undigested. “+ Glucosylation” is a DNA template in vitro glucosylated with β-glucosyltransferase. “− Control” is mock glucosylated in a reaction treated without a β-glucosyltransferase enzyme.
[0026]
[0027]
[0028]
[0029] M.SssI “mC”; or in vitro methylated, hydroxymethylated with Tett and glucosylated with β-glucosyltransferase “GluhmC”. qRT-PCR was performed on the sample in duplicate. The resulting amplification curves are shown in graphical format.
[0030]
[0031]
DETAILED DESCRIPTION OF THE INVENTION
[0032] Genomic DNA methylation and hydroxymethylation are emerging as key epigenetic regulators of gene expression, especially in higher organisms such as humans. However, analysis of these modifications and their role in gene regulation has been hampered the inability of standard DNA analysis techniques to distinguish between DNA positions comprising these modifications. In particular, available techniques for analysis of methylated DNA, such as bisulfate sequencing and use of methylation sensitive endonucleases, are unable to distinguish between methylated and hydroxymethylated cytosines (see, e.g., Nestor et al., 2010 and Huang et al., 2010;
[0033] Techniques and regents detailed in the instant application allow efficient analysis of epigenetic modification to DNA and are able to distinguish between methylated and hydroxymethylated cytosine position. For example, reagents detailed here are able to mediate highly efficient glucosylation of DNA at 5′hmC positions (
[0034] A variety of methods can be used to analyze DNA molecules comprising a protected 5′Glu-hmC position. For example, glucosylated DNA can be hybridized to an array to determine the sequences of hydroxymethylated positions in DNA samples. DNA molecules comprising a 5′Glu-hmC were also found to serve a suitable template for DNA polymerase (See e.g., Example 6). Accordingly, protected DNA molecules can also by analyzed by PCR-based techniques or by direct DNA sequencing. Furthermore, modified 5′Glu-hmC may provide antibody-binding target and 5′Glu-hmC-binding antibodies may exhibit enhanced specificity and binding affinity relative to antibodies that bind to 5′hmC. Accordingly, 5′Glu-hmC-binding antibodies can be used in improved methods DNA hydroxymethylation analysis.
[0035] The following is a detailed description of the invention provided to aid those skilled in the art in practicing the present invention. Those of ordinary skill in the art may make modifications and variations in the embodiments described herein without departing from the spirit or scope of the present invention.
I. GENERAL PROTOCOL
[0036] An illustrative and non-limiting protocol for hydroxymethylation analysis according to the invention is exemplified below.
[0037] 1. Modifying hydroxymethylcytosine positions in a DNA sample. A DNA sample used for analysis may be chemically modified or treated with and enzyme to modify any hydroxymethylcytosine positions that are present in the sample. For example, efficient glucosylation of hydroxymethylcytosine can be achieved by incubating a sample DNA with a glucosyltransferase enzyme, such as a glucosyltransferase from a T2, T4 or T6 bacteriophage. In certain aspects a sample may be split and one portion of the sample treated with a glucosyltransferase (a test sample) while another portion is mock treated (a control sample).
[0038] Optionally, a DNA sample may be treated with a DNA methyltransferase prior to step 1, thereby methylating essentially all potential sites of methylation.
[0039] 2. Contact the DNA sample with a DNA endonuclease. Once the hydroxymethylated DNA positions have been protected from enzyme cleavage by modification (e.g., by glucosylation). DNA is contact with one or more DNA endonuclease enzyme(s). The enzyme(s) cleave at their corresponding recognition sites if no blocking moiety is present, while recognition sites with a 5′hmC are protected from cleavage by their previous modification. For example, in the case of glucosylation of 5′hmC, an endonuclease for use according to the invention displays differential sensitivity when glucosyl-5-hydroxymethylcytosine is present within its recognition sequence, versus unmodified cytosine, 5-methylcytosine, or 5-hydroxymethylcytosine. An example is an endonuclease that will be able to cleave at sequences comprising an unmodified cytosine, 5-methylcytosine, or 5-hydroxymethylcytosine but cannot digest glucosyl-5-hydroxymethylcytosine. Some non-limiting examples of such DNA endonuclease enzymes include MspI, GlaI, Csp6I, HaeIII, TagαI, MboI, McrBC, Hpy188I and HpyCH4III.
[0040] 3. Determine hydroxymethyalted DNA positions in the DNA sample. Cleaved DNA is analyzed, for example to identify sequences that were not cleaved but have a recognition site for a methylation dependent DNA endonuclease used in the cleavage reaction. The presence of an intact site is indicative a site that was hydroxymethylated in the DNA sample.
[0041] A wide range of analysis techniques may be used to determine hydroxymethylation in a sample. For example, methods for analysis include:
[0042] Ligating the cleaved DNA to an oligonucleotide tag comprising a detectable label and hybridizing the tagged DNA(s) to an array of known sequences to identify positions of hydroxymethylation.
[0043] Ligating the cleaved DNA oligonucleotide tags having known sequences. The tagged DNAs can then be amplified by PCR (e.g., for sequencing or cloning) or directly sequenced.
[0044] Hybridizing the cleaved DNA to one or more labeled probe wherein hybridization is indicative of positions with hydroxymethylation.
[0045] The hydroxymethylation status of a specific sequence of set of sequences need to be determined the cleaved DNA can subjected to PCR where amplification of a product comprising a potential site of hydroxymethylation is indicative of the presence of hydroxymethylation. In certain aspects quantitative PCR may be used to quantify the level or proportion of DNA in a sample that comprises hydroxymethylation at a given position.
II. GENOMIC DNA AND SAMPLES
[0046] Exemplary DNA samples that can be used in a method of the invention include, without limitation, mammal DNA such as a rodent, mouse, rat, rabbit, guinea pig, ungulate, horse, sheep, pig, goat, cow, cat, dog, primate, human or non-human primate. Plant DNA may also be analyzed according to the invention. For example, DNA from Arabidopsis thaliana, maize, sorghum, oat, wheat, rice, canola, or soybean may be analyzed. It is further contemplated that genomic DNA from other organisms such as algae, a nematodes, insects (e.g., Drosophila melanogaster, mosquito, fruit fly, honey bee or spider), fish, reptiles, amphibians and yeast may be analyzed.
[0047] As indicated above, DNA such as genomic DNA can be isolated from one or more cells, bodily fluids or tissues. An array of methods can be used to isolate DNA from samples such as blood, sweat, tears, lymph, urine, saliva, semen, cerebrospinal fluid, feces or amniotic fluid. DNA can also be obtained from one or more cell or tissue in primary culture, in a propagated cell line, a fixed archival sample, forensic sample or archeological sample. Methods for isolating genomic DNA from a cell, fluid or tissue are well known in the art (see, e.g., Sambrook et al., 2001).
[0048] Exemplary cell types from which DNA can be obtained in a method of the invention include, a blood cell such as a B lymphocyte, T lymphocyte, leukocyte, erythrocyte, macrophage, or neutrophil; a muscle cell such as a skeletal cell, smooth muscle cell or cardiac muscle cell; germ cell such as a sperm or egg; epithelial cell; connective tissue cell such as an adipocyte, fibroblast or osteoblast; neuron; astrocyte; stromal cell; kidney cell; pancreatic cell; liver cell; or keratinocyte. A cell from which genomic DNA is obtained can be at a particular developmental level including, for example, a hematopoietic stem cell or a cell that arises from a hematopoietic stem cell such as a red blood cell, B lymphocyte, T lymphocyte, natural killer cell, neutrophil, basophil, eosinophil, monocyte, macrophage, or platelet. Other cells include a bone marrow stromal cell (mesenchymal stem cell) or a cell that develops therefrom such as a bone cell (osteocyte), cartilage cells (chondrocyte), fat cell (adipocyte), or other kinds of connective tissue cells such as one found in tendons; neural stem cell or a cell it gives rise to including, for example, a nerve cells (neuron), astrocyte or oligodendrocyte; epithelial stem cell or a cell that arises from an epithelial stem cell such as an absorptive cell, goblet cell, Paneth cell, or enteroendocrine cell; skin stem cell; epidermal stem cell; or follicular stem cell. Generally any type of stem cell can be used including, without limitation, an embryonic stem cell, adult stem cell, totipotent stem cell or pluripotent stem cell.
[0049] A cell from which a genomic DNA sample is obtained for use in the invention can be a normal cell or a cell displaying one or more symptom of a particular disease or condition. Thus, a genomic DNA used in a method of the invention can be obtained from a cancer cell, neoplastic cell, apoptotic cell, senescent cell, necrotic cell, an autoimmune cell, a cell comprising a heritable genetic disease or the like.
[0050] DNA for use according to the invention may be a standard or reference DNA sample. Such reference samples may comprise a known level of DNA hydroxymethylation. For example, reference DNA samples may be DNA extracted from cells that lack one of more
[0051] DNA methyltransferase enzyme and are essentially devoid of methylation and hydroxymethylation. In further aspects, a reference DNA sample may be treated with a DNA methyltransferase (e.g., M.Ssssl methyltransferase) and an enzyme to convert methylated cytosines into hydroxymethylcytosines (e.g., TET1, TET2 or TET3, see Tahiliani et al., 2009, incorporated herein by reference) and therefore comprise hydroxymethylation at most or essentially all potential methylation sites. For example, a standard DNA may be DNA isolated from the human cell line such as the HCT116 DKO cell line. In certain aspects, methods according to the invention involve the use of two for more standard DNA samples, such as DNA samples comprising essentially no methylation and essentially complete methylation.
III. METHODS FOR PRODUCING ANTIBODIES
[0052] As described above certain aspects of the invention involve antibodies and the use thereof. For example, in some aspects an antibody may be a 5′Glu-hmC-binding antibody that may be used to the presence of 5′Glu-hmC in DNA. Antibodies may be made by any of the methods that as well known to those of skill in the art. The following methods exemplify some of the most common antibody production methods. T he skilled artisan will recognize that the methods provided here may be used to generate antibody that binds 5′Glu-hmC while not binding to 5′mC.
A. POLYCLONAL ANTIBODIES
[0053] Polyclonal antibodies generally are raised in animals by multiple subcutaneous (sc) or intraperitoneal (ip) injections of the antigen. As used herein the term “antigen” refers to any molecule that will be used in the production of antibodies. For example in certain aspects of the invention it is preferred that antibodies recognize 5′Glu-hmC, which for the purposes of antibody production may be coupled to a carrier protein.
[0054] It may be useful to conjugate the 5′Glu-hmC antigen to a protein that is immunogenic in the species to be immunized, e.g., keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor using a bifunctional or derivatizing agent.
[0055] Animals are immunized against the immunogenic conjugates or derivatives by combining 1 mg to 1 μg of conjugate (for rabbits or mice, respectively) with 3 volumes of Freud's complete adjuvant and injecting the solution intradermally at multiple sites. One month later the animals are boosted with ⅕ to 1/10 the original amount of conjugate in Freud's complete adjuvant by subcutaneous injection at multiple sites. 7 to 14 days later the animals are bled and the serum is assayed for specific antibody titer Animals are boosted until the titer plateaus. Preferably, the animal boosted with the same antigen conjugate, but conjugated to a different protein and/or through a different cross-linking reagent. Conjugates also can be made in recombinant cell culture as protein fusions. Also, aggregating agents such as alum are used to enhance the immune response.
B. MONOCLONAL ANTIBODIES
[0056] In certain embodiments of the invention the 5′Glu-hmC-binding antibody is a monoclonal antibody. By using monoclonal a great specificity may be achieved. This may reduce the background in assays of the invention. Monoclonal antibodies are obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present in minor amounts. Thus, the modifier “monoclonal” indicates the character of the antibody as not being a mixture of discrete antibodies.
[0057] For example, monoclonal antibodies of the invention may be made using the hybridoma method first described by Kohler et al., 1975, or may be made by recombinant DNA methods (U.S. Pat. No. 4,816,567 to Cabilly et al.).
[0058] In the hybridoma method, a mouse or other appropriate host animal, such as hamster is immunized as hereinabove described to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the protein used for immunization. Alternatively, lymphocytes may be immunized in vitro. Lymphocytes then are fused with myeloma cells using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell (Goding, 1986).
[0059] The hybridoma cells thus prepared are seeded and grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells. For example, if the parental myeloma cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine (HAT medium), which substances prevent the growth of HGPRT-deficient cells.
[0060] Preferred myeloma cells are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. Among these, preferred myeloma cell lines are murine myeloma lines, such as those derived from MOPC-21 and MPC-11 mouse tumors available from the Salk Institute Cell Distribution Center, San Diego, Calif. USA, and SP-2 cells available from the American Type Culture Collection, Rockville, Md. USA.
[0061] Culture medium in which hybridoma cells are growing is assayed for production of monoclonal antibodies directed against the target antigen. Preferably, the binding specificity of monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA).
[0062] The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson et al., 1980.
[0063] After hybridoma cells are identified that produce antibodies of the desired specificity, affinity, and/or activity, the clones may be subcloned by limiting dilution procedures and grown by standard methods, Goding (1986). Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium or RPMI-1640 medium. In addition, the hybridoma cells may be grown in vivo as ascites tumors in an animal.
[0064] The monoclonal antibodies secreted by the subclones are suitably separated from the culture medium, ascites fluid, or serum by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.
[0065] DNA encoding the monoclonal antibodies of the invention is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). The hybridoma cells of the invention serve as a preferred source of such DNA.
[0066] Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences, Morrison et al. 1984, or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide. In that manner, “chimeric” or “hybrid” antibodies are prepared that have the binding specificity for any particular antigen described herein.
[0067] Typically such non-immunoglobulin polypeptides are substituted for the constant domains of an antibody of the invention, or they are substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody comprising one antigen-combining site having specificity for the target antigen and another antigen-combining site having specificity for a different antigen.
[0068] Chimeric or hybrid antibodies also may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example, immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate.
[0069] For diagnostic applications, the antibodies of the invention typically will be labeled with a detectable moiety. The detectable moiety can be any one which is capable of producing, either directly or indirectly, a detectable signal. For example, the detectable moiety may be a radioisotope, such as .sup.3H, .sup.14C, .sup.32P, .sup.35S, or .sup.125I, a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate, rhodamine, or luciferin; biotin; an enzyme, such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase.
[0070] Any method known in the art for separately conjugating the antibody to the detectable moiety may be employed, including those methods described by Hunter et al., 1962; David et al., 1974; Pain et al., 1981; and Nygren 1982.
[0071] The antibodies of the present invention may be employed in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays (Zola, 1987).
[0072] Competitive binding assays rely on the ability of a labeled standard (which may be a purified target antigen or an immunologically reactive portion thereof) to compete with the test sample analyte for binding with a limited amount of antibody. The amount of antigen in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies. To facilitate determining the amount of standard that becomes bound, the antibodies generally are insolubilized before or after the competition, so that the standard and analyte that are bound to the antibodies may conveniently be separated from the standard and analyte which remain unbound.
[0073] Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected (e.g., AP). In a sandwich assay, the test sample analyte is bound by a first antibody which is immobilized on a solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three part complex (see, U.S. Pat. No. 4,376,110). The second antibody may itself be labeled with a detectable moiety (direct sandwich assays) or may be measured using an anti-immunoglobulin antibody that is labeled with a detectable moiety (indirect sandwich assay). In aspects of the invention, such assays may be used to assess AP polypeptide cleavage. One type of sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme.
IV. REAGENTS AND KITS
[0074] The kits may comprise suitably aliquoted reagents of the present invention, such as a glucosyltransferase (e.g., a β-glucosyltransferase) and one ore more DNA endonucleases (e.g., MspI, TaqI (or TaqαI), or a methylation dependent endonuclease such as BisI, GlaI or McrBC). Additional components that may be included in a kit according to the invention include, but are not limited to, MSEs (e.g., AatII, AccIII, Acil, AfaI, Agel, AhaII, Alw26I, Alw44I, ApaLI, ApyI, Ascl, Asp718I, AvaI, AvaII, Bme216I, BsaAI, BsaHI, BscFI, BsiMI, BsmAI, BsiEI, BsiWI, BsoFI, Bsp105I, Bsp119I, BspDI, BspEI, BspHI, BspKT6I, BspMII, BspRI, BspT104I, BsrFI, BssHII, BstBI, BstEIII, BstUI, BsuFI, BsuRI, CacI, CboI, CbrI, CceI, Cfr10I, ClaI, Csp68KII, Csp45I, CtyI, CviAI, CviSIII, DpnII, EagI, Ec113611, Eco47I, Eco47III, EcoRII, EcoT22I, EheI, Esp3I, Fnu4HI, FseI, FspI, Fsp4HI, GsaI, HaeII, HaeIII, HgaI, HhaI, HinPlI, HpaII, HpyAIII, ItaI, KasI, Kpn2I, LlaAI, LlaKR2I, MboI, MflI, MluI, MmeII, MroI, MspI, MstII, MthTI, NaeI, NarI, NciAI, NdeII, NgoMIV, NgoPII, NgoS II, NlaIII, NlaIV, NotI, NruI, NspV PmeI, Pm1I, Psp1406I, PvuI, RalF40I, RsaI, RspXI, RsrII, SacII, Sall, Sau3AI, SexAI, SfoI, SfuI, SmaI, SnaBI, SolI, SpoI, SspRFI, Sth368I, TaiI, TaqI, TflI, TthHB8I, VpaK11BI, or XhoI), oligonucleotide primers, reference DNA samples (e.g., hydroxymethylated and non-hydroxymethylated reference samples), distilled water, probes, a glucosylation buffer, UDPG, a PCR buffer, dyes, sample vials, polymerase, ligase and instructions for performing methylation assays. In certain further aspects, reagents for DNA isolation, DNA purification and/or DNA clean-up may also be included in a kit.
[0075] The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit, the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a vial. The kits of the present invention also will typically include a means for containing reagent containers in close confinement for commercial sale.
[0076] Such containers may include cardboard containers or injection or blow-molded plastic containers into which the desired vials are retained.
[0077] When the components of the kit are provided in one or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being preferred.
[0078] However, the components of the kit may be provided as dried powder(s). When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means.
V. EXAMPLES
[0079] The following examples are included to demonstrate certain embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
Example 1
Methylation Dependent Endonuclease Enzymes Cleave Both 5′mC and 5′hmC
[0080] In order to determine if methylation dependent DNA endonucleases could cut at positions comprising both a 5′mC and 5′hmC PCR products were amplified using primers: 5′ (AGA ATT GGT TAA TTG GTT GTA A; SEQ ID NO: 7) and 3′ (ATA TTT GAA TGT
[0081] ATT TAG AAA AAT AAA; SEQ ID NO: 8). Resulting PCR products have the same primary sequence (SEQ ID NO: 9) and differing only in the modification status of cytosines were digested with the Bisl and Glal endonucleases and analyzed by agarose gel electrophoresis (
Example 2
Glucosylation of 5′hmC prevents cleavage by methylation dependent endonuclease enzymes
[0082] In order to determine if the addition of a larger covalently linked moiety to 5′hmC could inhibit cleavage by a methylation dependent endonucleases, PCR products having the same primary sequence and differing only in the modification status of cytosines were digested with Mspl and analyzed by agarose gel electrophoresis (
Example 3
Hemi-Glu-5′hmC Prevents Cleavage by Methylation Dependent Endonuclease Enzymes
[0083] In order to determine whether glucosylation of 5′hmC both strands of DNA was required to inhibit cleavage, a DNA template with hemi-Glu-5′hmC (TAAAAGCTAACCGCATCTTTACCGACAAGGCATCCGGCAGTTCAACAGATCGGG AAGGGCTGGATTTGCTGAGGATGAAGGTGGA; SEQ ID NO: 10, underlined “C” was modified to Glu-5′hmC) was digested with Mspl and analyzed by agarose gel electrophoresis. The results shown in
Example 4
Glu-5′hmC Prevents Cleavage by TaqαI Digestion
[0084] In order to determine the ability of Glu-5′hmC to inhibit digestion with additional endonuclease enzymes DNA templates comprising Glu-5′hmC or 5′hmC were digest with TaqαI (recombinant TaqI). Results shown in
Example 5
Glu-5′hmC prevents cleavage by MspI after in vitro conversion of unmodified cytosines to Glu-5′hmC
[0085] A DNA template containing all unmodified cytosines was in vitro methylated at CpG sites with M.SssI. CpG methylated template was treated in vitro with Tet1 to create 5′-hydroxymethylcytosine on the premethylated (mCpG) sites. Then mC and mC+Tet1 (hmC) samples were glucosylated with β-glucosyltransferase and subsequently digested with Mspl. As shown in
Example 6
DNA Comprising Glu-5′hmC is a Suitable Substrate for PCR
[0086] To determine if DNA comprising Glu-5′hmC could be amplified by PCR sample template was amplified from pUC18 (using primers pUC 5′ (ttttaaattaaaaatgaagttttaaat; SEQ ID NO: 4) and pUC 3′ (aataatattgaaaaaggaagagtatgagtatt; SEQ ID NO: 5)). The resulting PCR product has the sequence of SEQ ID NO: 6. A portion of the PCR product was left untreated (C) and a portion was in vitro methylated with M.SssI to create sample “mC”. Part of sample “mC” was treated in vitro with Tett to create hydroxymethylcytosine on pre-methylated C′s. Then sample “mC” along with the Tett treated sample (containing hmC) were in vitro glucosylated with β-glucosyltransferase. Thus, the sample labeled “GluhmC” contains glucosyl-5′-hydroxymethylcytsoine because only the +Tet1 sample will accept glucosyl groups.
[0087] qRT-PCR was performed in duplicates with 4 pg of “C,” “mC” and “GluhmC” input DNA for each template. The results indicate shown in
TABLE-US-00001 TABLE 1 Quantification of the qRT-PCR amplification Sample Cp Avg. Cp C 31.57 31.62 C 31.66 mC 35.97 35.96 mC 35.94 GluhmC 34.5 34.55 GluhmC 34.6 No DNA — — No DNA —
Example 7
Glu-5′hmC can be used to Quantify Hydroxymethylation in a DNA Sequence
[0088] To test whether glucosylation of 5′-hydroxymethycytosine can be used to gauge for locus specific quantification of 5′-hydroxymethylcytosine, DNA “-Control DNA” from Example 5 (
[0089] Quantification of the results is shown in Table 2. The study demonstrates that glucosylated-5′-hydroxymethylcytosine DNA amplified ˜4.2 cycles before 5′-methylcytosine containing DNA, indicating a greater than 16-fold enrichment of glucosylated-5′-hydroxymethylcytosine DNA after Mspl digestion. These results show that glucosylation of DNA coupled to DNA endonuclease digestion and quantitated by qRT-PCR offers a reliable method for locus specific quantification of 5′ -hydroxymethylcytosine. Results also clearly demonstrate that DNA comprising Glucosylated-5′-hydroxymethylcytosine can be amplified by PCR and that PCR can detect hydroxymethylated DNA positions relative to methylated positions in a sample after enzyme digestion.
TABLE-US-00002 TABLE 2 Quantification of the qRT-PCR amplification Sample Cp Avg. Cp Tet1 (GluHMC) 28.73 28.66 Tet1 (GluHMC) 28.59 −Cont (5mC) 32.96 32.86 −Cont (5mC) 32.76 No DNA Input — —
Example 8
Cloning and Glucosylation with β-Glucosyltransferase
[0090] The coding region for T4 β-glucosyltransferase was amplified using oligonucleotide primers 5′ (atgaaaattgctataattaatatgg; SEQ ID NO: 1) and 3′ (ttataaatcaatagcttttttgaac; SEQ ID NO: 2) resulting in a coding region having the sequence of SEQ ID NO: 3. The coding sequence was subcloned into an expression vector; over expressed and purified using standard techniques (see, e.g., Tomaschewski et al., 1985).
[0091] In vitro glucosylation reactions were carried out in the presence of uridine diphosphate glucose (UDPG) in an appropriate buffer. For example, a lx reaction buffer may comprise 50 mM Tris (pH 7.5), 25 mM MgCl.sub.2 1mM DTT and 100 μM UDPG or may comprise 50 mM Potassium Phosphate buffer (pH 7.6), 25 mM MgC1.sub.2, 1 mM DTT and 100 μM UDPG. An example reaction mix is provided below.
TABLE-US-00003 DNA [100 ng/μl] 10 μl (1 μg) 10xBgt Rxn Bfr 5 μl [10 mM]100xUDPG 0.5 μl β-glucosyltransferase 1 μl ddH.sub.2O 33.5 μl.sup. Total Vol 50 μl
[0092] DNA was found to be effectively glucosylated after incubation for 1 hour at 30° C.
[0093] Another example of Glucosylation reaction is provided below:
TABLE-US-00004 DNA [10-100 ng/μl] 10 μl 10X 5hmC GT Reaction Buffer 5 μl 10X UDPG [1 mM] 5 μl 5hmC GT Enzyme (2 units/μl) 2 μl ddH2O 28 μl Total 50 μl
[0094] A standard reaction setup shown above would incubation at 30° C. for ≥2 hours.
[0095] To ensure glucosylation reaction is carried to completion excess enzyme unit:DNA ratio may be used. For example, if glucosylating 1 μg of DNA use 4 units of 5′hmC Glucosyltransferase. Likewise the reaction may be extended for an incubation at 30° C. for ≥2 hours.
[0096] Reactions such as those above may be used for global quantification of 5′hmC with use of Uridine Diphosphate Glucose [Glucose-.sup.14C(U)] PerkinElmer (Szwagierczak et al., 2010).
Example 9
Example Kit and Protocol for Detection of DNA Hydroxymethylation
[0097] A kit according to the invention uses a robust and highly specific 5-hmC Glucosyltransferase enzyme. 5-hydroxymethylcytosine in DNA is specifically tagged with a glucose moiety yielding a modified base, glucosyl-5-hydroxymethylcytosine (
[0098] After glucosylation of 5-hydroxymethylcytosine, digestion of DNA with “5-hydroxymethylcytosine sensitive” restriction endonucleases, or GSRE's (see, e.g., Table 3), allows for effective differentiation of 5-methylcytosine from 5-hydroxymethylcytosine. Identification of 5-hydroxymethylcytosine in a sequence specific context can then be deduced from the restriction endonuclease recognition sequence (Table 3).
[0099] Included in a kit is a GSRE such as GlaI (for others see Table 3). GlaI is also a methylation dependent restriction endonuclease that can digest DNA only when 5′-methylcytosine or 5′-hydroxymethylcytosine lies within its recognition sequence. However, when 5′-hydroxymethylcytosine is glucosylated (glucosyl-5-hydroxymethylcytosine), GlaI is no longer able to digest (
TABLE-US-00005 TABLE 3 Example GSREs. GSRE Recognition Sequence GlaI GCGC ACGC ACGT MspI CCGG Taq.sup.αI * TCGA * - TaqαI displays incomplete sensitivity to Glucosyl-5′hmC. Enzyme and incubation time titration may be needed for optimal results.
[0100] After processing of DNA with a 5′-hmC detection kit, detection of 5′hmC sites can be achieved by a variety of techniques such as: qPCR, ultra-deep sequencing, southern blot and microarray.
[0101] Eluted DNA containing 5-hydroxymethylcytosine residues will be fully glycosylated (glucosyl-5-hydroxymethylcytosine). Amplification of glucosyl-5-hydroxymethylcytosine containing DNA displays lower amplification efficiencies with some Taq DNA polymerases. However, PCR mixtures can be optimized specifically for efficient amplification of DNA templates containing glucosyl-5-hydroxymethylcytosine residues.
[0102] The following two protocols describe a streamlined method for 5′hmC detection. DNA sample preparation entailing glucosylation of 5′hmC within DNA, methylation of DNA (used in the GlaI method), and subsequent digestion of DNA with GSRE's is carried out in a one tube format.
[0103] For use with Glal, a DNA methlytransferase cocktail must be used. GlaI is a methylation dependent restriction endonuclease, and can only digest DNA effectively when DNA is fully methylated. Conversely, for use with Mspl, no DNA methlytransferase cocktail is required. Methylation patterns induced by the DNA methlytransferase cocktail will inhibit cutting of some Mspl sites.
[0104] A DNA methyltransferase cocktail can be formulated as a mixture of CpG (M.SssI) and GpC (M.CviPI) DNA methyltransferases.
[0105] GlaI protocol:
[0106] Note: GlaI is a methylation dependent endonuclease, therefore use of DNA Methyltransferase Cocktail is necessary for complete GlaI digestion.
[0107] 1. Standard reaction setup shown below. Incubate at 30° C. for ˜2 hours.
TABLE-US-00006 DNA [10-100 ng/μl] 10 μl 10X 5-hmC GT Reaction Buffer 5 μl 10X UDPG [1 mM] 5 μl 5-hmC GT Enzyme (2 units/μl) 2 μl DNA Methyltransferase Cocktail (2 units/μl) 1.5 μl 20X SAM [12 mM] 2.5 μl ddH2O 24 μl Total 50 μl
[0108] 2. After ˜2 hour incubation in Step 1, add 1 μl (4 units) GlaI Restriction Enzyme directly to reaction. Incubate at 30° C. for 6-16 hours 3. Add a 5:1 ratio DNA Binding Buffer to the reaction (e.g., 250 μl DNA Binding Buffer to a 50 μl reaction volume)
[0109] 4. Proceed directly to Step 2 in the “Protocol” section of DNA Clean & Concentrator™ (or other DNA purification system).
[0110] Mspl protocol:
[0111] Note: Do not add DNA Methyltransferase Cocktail to reaction for MspI. DNA methylation profile induced by DNA Methyltransferase Cocktail may interfere with MspI digest.
[0112] 1. Standard reaction setup shown below. Incubate at 30° C. for ˜2 hours.
TABLE-US-00007 DNA [10-100 ng/μl] 10 μl 10X 5-hmC GT Reaction Buffer 5 μl 10X UDPG [1 mM] 5 μl 5-hmC GT Enzyme (2 units/μl) 2 μl ddH2O 28 μl Total 50 μl
[0113] 2. After ˜2 hour incubation in Step 1, add 10 units of MspI restriction enzyme (not included) directly to reaction. Incubate at 37° C. for ˜2 hours.
[0114] 3. Add a 5:1 ratio DNA Binding Buffer to the reaction (e.g., 250 μl DNA Binding Buffer to a 50 μl reaction volume)
[0115] 4. Proceed directly to Step 2 in the “Protocol” section of DNA Clean & Concentrator™ (or other DNA purification system).
REFERENCES
[0116] Each of the foregoing documents is hereby incorporated by reference in its entirety: [0117] U.S. Pat. Nos. 4,376,110; 4,816,567; 5,436, 134 and 5,658, 751. [0118] David et al., Biochemistry, 13:1014, 1974. [0119] Goding, In: Monoclonal Antibodies: Principles and Practice, 60-61, 71-74, 1986. [0120] Huang et al., PLoS ONE, 5(1):e8888, 2010. [0121] Hunter et al., Nature, 144:945, 1962. [0122] Jones et al., Nat. Genet., 21(2):163-7, 1999. [0123] Kohler et al., Nature, 256:495-497, 1975. [0124] Morrison et al., Proc. Natl. Acad. Sci. U.S.A., 81:6851, 1984. [0125] Munson et al., Anal. Biochem., 107:220, 1980. [0126] Nestor et al., BioTechniques, 48(4):317-319, 2010. [0127] Nygren, J. Histochem. Cytochem., 30(5):407-412, 1982. [0128] Oakes et al., Epigenetics, 1(3):146-152, 2009 [0129] Pain et al., J. Immunol. Meth., 40:219, 1981. [0130] PCT Pubin. WO/2010/114821 [0131] Sambrook et al., In: Molecular Cloning-A Laboratory Manual, 1989. [0132] Szwagierczak et al, Nucleic Acids Res., 1-5, 2010. [0133] Tahiliani et al., Science, 324:930-935, 2009. [0134] Tomaschewski et al., Nuc. Acids Res., 13(21):7551-7568, 1985. [0135] Zola, In: Monoclonal Antibodies. A Manual of Techniques, 147-158, 1987.