SYNTHESIS OF ISOPRENOIDS AND DERIVATIVES

20210371884 · 2021-12-02

    Inventors

    Cpc classification

    International classification

    Abstract

    This disclosure generally relates to the use of enzyme combinations or recombinant microbes comprising same to make isoprenoid precursors, isoprenoids and derivatives thereof including prenylated aromatic compounds. Novel metabolic pathways exploiting Claisen, aldol, and acyloin condensations are used instead of the natural mevalonate (MVA) pathway or 1-deoxy-d-xylulose 5-phosphate (DXP) pathways for generating isoprenoid precursors such as isopentenyl pyrophosphate (IPP), dimethylallyl pyrophosphate (DMAPP), and geranyl pyrophosphate (GPP). These pathways have the potential for better carbon and or energy efficiency than native pathways. Both decarboxylative and non-carboxylative condensations are utilized, enabling product synthesis from a number of different starting compounds. These condensation reactions serve as a platform for the synthesis of isoprenoid precursors when utilized in combination with a variety of metabolic pathways and enzymes for carbon rearrangement and the addition/removal of functional groups. Isoprenoid alcohols are key intermediary products for the production of isoprenoid precursors in these novel synthetic metabolic pathways. These precursors can be modified to various isoprenoid products through prenyl transferase, terpene synthase, or terpene cyclases. The production of prenylated aromatic compounds is achieved through prenyl transfer of the hydrocarbon units of isoprenoid precursors to polyketides.

    Claims

    1. A recombinant microorganism for the production of an isoprenoid(s) or an isoprenoid derivative(s), said microorganism comprising: a) one or more alcohol(s) selected from prenol, isoprenol, or both; b) enzymes catalyzing conversion of said alcohol(s) to dimethylallyl pyrophosphate (DMAPP) and isopentenyl pyrophosphate (IPP) comprising: a) an alcohol kinase (EC 2.7.1.-) plus a phosphate kinase (EC 2.7.4.-), orb) an alcohol diphosphokinase (EC 2.7.6.-), plus optionally c) an IPP isomerase (5.3.3.2); c) a GPP synthase catalyzing conversion of said DMAPP and IPP to geranyl diphosphate (GPP); and d) one or more enzyme(s) selected from a group comprising farnesyl diphosphate synthase, geranylgeranyl-diphosphate synthase, prenyl transferase, terpene synthase, terpene cyclase, tetrahydrocannabinolic acid synthase, cannabidiolic acid synthase, cannabichromenic acid synthase, tetrahydrocannabivarinic acid synthase, cannabidivarinic acid synthase, and cannabichrovarinic acid synthase catalyzing conversion of said GPP to an isoprenoid(s) or an isoprenoid derivative(s).

    2. The recombinant microorganism of claim 1, wherein said microorganism comprises an aromatic prenyltransferase or a 4-hydroxybenzoate geranyltransferase catalyzing a prenyl transfer from said GPP or said isoprenoid to an aromatic polyketide(s) forming a prenylated aromatic compound(s).

    3. The recombinant microorganism of claim 2, wherein said prenylated aromatic compound(s) is a cannabinoid(s).

    4. The recombinant microorganism of claim 1, wherein said recombinant organism is grown in a culture medium and said isoprenoid(s) or isoprenoid derivative(s) is isolated from said culture medium or said recombinant microorganism or both.

    5. The recombinant microorganism of claim 1, wherein said isoprenoid(s) is selected from hemiterpenoid(s), monoterpenoid(s), sesquiterpenoid(s), diterpenoid(s), sesterterpenoid(s), triterpenoid(s), tetraterpenoid(s), polyterpenoid(s), or a derivative(s) thereof.

    6. The recombinant microorganism of claim 1, that further comprises reduced expression of gene(s) encoding one or more fermentation enzymes leading to reduced production of one or more of lactate, acetate, ethanol or succinate.

    7. The recombinant microorganism of claim 1, that is a bacteria or yeast cell.

    8. The recombinant microorganism of claim 1, that is an Escherichia coli cell.

    9. A recombinant microorganism for the production of one or more cannabinoid(s), said microorganism comprising: a) one or more alcoholics(s) selected from prenol and isoprenol; b) enzymes catalyzing conversion of said alcohol(s) to DMAPP or IPP using one or more enzyme(s) selected from i) an alcohol kinase (EC 2.7.1.-) plus a phosphate kinase (EC 2.7.4.-), or ii) an alcohol diphosphokinase (EC 2.7.6.-); c) an aromatic prenyltransferase or a 4-hydroxybenzoate geranyltransferase catalyzing a prenyl transfer from said DMAPP or IPP to an aromatic polyketide to form one or more cannabinoid(s); d) optionally one or more enzymes selected from the group comprising tetrahydrocannabinolic acid synthase, cannabidiolic acid synthase, cannabichromenic acid synthase, tetrahydrocannabivarinic acid synthase, cannabidivarinic acid synthase, and cannabichrovarinic acid synthase catalyzing conversion of said cannabinoid(s) to another cannabinoid(s).

    10. A recombinant microorganism for the production of a cannabinoid, said microorganism comprising: a) an alcohol selected from prenol, isoprenol, or both; b) enzymes catalyzing conversion of said alcohol to DMAPP and IPP comprising a) an alcohol kinase (EC 2.7.1.-) plus a phosphate kinase (EC 2.7.4.-), or b) an alcohol diphosphokinase (EC 2.7.6.-), plus optionally c) an 1PP isomerase (5.3.3.2); c) a GPP synthase catalyzing conversion of said DMAPP and IPP to GPP; d) an aromatic prenyltransferase or a 4-hydroxybenzoate geranyltransferase catalyzing a prenyl transfer from said GPP to an aromatic polyketide to form a cannabinoid; e) optionally one or more enzymes selected from the group comprising tetrahydrocannabinolic acid synthase, cannabidiolic acid synthase, cannabichromenic acid synthase, tetrahydrocannabivarinic acid synthase, cannabidivarinic acid synthase, and cannabichrovarinic acid synthase catalyzing conversion of said cannabinoid to another cannabinoid.

    11. The recombinant microorganism of claim 9 or 10. wherein said aromatic polyketide is selected from olivetolic acid, olivetol, divarinolic acid or divarinol.

    12. The recombinant microorganism of claim 9 or 10, that is a bacteria or yeast cell.

    13. The recombinant microorganism of claim 9 or 10, that is an Escherichia coli cell.

    14. The recombinant microorganism of claim 9 or 10, that further comprises reduced expression of gene(s) encoding one or more fermentation enzymes leading to reduced production of one or more of lactate, acetate, ethanol or succinate.

    15. The recombinant microorganism of claim 9 or 10, wherein said recombinant organism is grown in a culture medium and said cannabinoid(s) is isolated from said culture medium or said recombinant microorganism or both.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0074] FIG. 1A-B: Synthesis of isoprenoid precursors, isoprenoids and derivatives thereof, and prenylated aromatic compounds using Claisen, aldol, or acyloin condensation reactions. Thiolases catalyze the non-decarboxylative condensation between an acyl-CoA, serving as the primer, and another acyl-CoA, serving as the extender unit, forming beta-keto acyl-CoA. Ketoacyl-CoA synthases catalyze the decarboxylative condensation between acyl-CoA and a beta-carboxylic acyl-CoA to form a beta-ketoacyl-CoA foiming a beta-keto acyl-CoA. Aldolases or 2-hydroxyacyl-CoA lyases catalyze the aldol condensation of an aldehyde and a ketone, or an aldehyde and a second aldehyde, or an aldehyde and a carboxylic acid to form an aldol. Acyloin synthases or acetolactate synthase catalyze the non-decarboxylative acyloin condensation of a ketone and an aldehyde, or an aldehyde and a second aldehyde, or the decarboxylative acyloin condensation of a ketone and an alpha-keto acid, an aldehyde and an alpha keto acid, or an alpha-keto acid and a second alpha-keto acid to form an acyloin. Following condensation of starting compounds to initiate a given pathway, a variety of metabolic pathways and enzymes (dotted lines or multiple arrows) for carbon rearrangement and the addition/removal of functional groups can be utilized for the synthesis of key isoprenoid intermediates including isoprenoid acyl-CoAs, such as 3-methyl-but-2-enoyl-CoA and 3-methyl-but-3-enoyl-CoA, and isoprenoid alcohols, such as prenol and isoprenol. Isoprenoid alcohols are then converted to isoprenoid precursors such as DMAPP. IPP, and GPP. Prenylated aromatic compounds are formed from the prenyl transfer of the hydrocarbon units of isoprenoid precursors to aromatic polyketides. Isoprenoids and derivatives thereof can be formed from the isoprenoid precursors via prenyl transferase, terpene synthase, or terpene cyclases.

    [0075] FIG. 2A-B: Generation of isoprenoid precursor GPP through non-decarboxylative condensations, beta-reductions, acyl-CoA mutases, and termination pathways starting with acetyl-CoA as the primer and propionyl-CoA as the extender unit.

    [0076] FIG. 3A-B: Generation of isoprenoid precursors IPP, DMAPP, and GPP through non-decarboxylative condensation, beta-reductions, and termination pathways starting with glycolyl-CoA as the primer and propionyl-CoA as the extender unit.

    [0077] FIG. 4A-B: Generation of isoprenoid precursors IPP, DMAPP and GPP through non-decarboxylative condensation, beta-reductions, acyl-CoA mutase, and termination pathways starting with propionyl-CoA as the primer and glycolyl-CoA as the extender unit.

    [0078] FIG. 5A-B: Generation of isoprenoid precursors IPP, DMAPP and GPP through non-decarboxylative condensations, beta-reductions, acyl-CoA mutase, and termination pathways starting with propionyl-CoA as the primer and acetyl-CoA as the extender unit.

    [0079] FIG. 6A-B: Generation of isoprenoid precursors IPP, DMAPP and GPP through non-decarboxylative condensation, beta-reductions, acyl-CoA mutase, and termination pathways starting with acetyl-CoA as the primer and propionyl-CoA as the extender unit.

    [0080] FIG. 7A-B: Pathways for the synthesis of isoprenoid precursors IPP, DMAPP and GPP from the central carbon intermediate acetyl-CoA through decarboxylative or non-decarboxylative Claisen condensation. Conversion of 2 acetyl-CoA or an acetyl-CoA and a malonyl-CoA to acetoacetyl-CoA initiates the pathway, which then procceds through 3-hydroxy-3-methylglutaryl-CoA as an intermediate. Exemplary enzymes for each step shown in Table C.

    [0081] FIG. 8A-B: Pathways for the synthesis of isoprenoid precursors IPP, DMAPP and GPP from the central carbon intermediate acetyl-CoA CoA through decarboxylative or non-decarboxylative Claisen condensation. Conversion of 2 acetyl-CoA or an acetyl-CoA and a malonyl-CoA to acetoacetyl-CoA initiates the pathway, which proceeds through 3-hydroxy-3-methylbutyryl-CoA as an intermediate. Exemplary enzymes for each step shown in Table D.

    [0082] FIG. 9A-B: Pathways for the synthesis of isoprenoid precursors IPP, DMAPP and GPP from the acyloin condensation of the central carbon intermediate pyruvate. Conversion of 2 pyruvate to acetolactate initiates the pathway, which proceeds through 2-hydroxyisovalerate as an intermediate. Exemplary enzymes for each step shown in Table E.

    [0083] FIG. 10A-B: Pathways for the synthesis of isoprenoid precursors IPP, DMAPP and GPP from the acyloin condensation of the central carbon intermediate pyruvate. Conversion of 2 pyruvate to acetolactate initiates the pathway, which proceeds through 2-isopropylmalate as an intermediate. Exemplary enzymes for each step shown in Table F.

    [0084] FIG. 11A-C: Pathways for the synthesis of isoprenoid precursors IPP, DMAPP and GPP from the non-decarboxylative acyloin condensation of isobutanol and formyl-CoA. Exemplary enzymes for each step shown in Table G.

    [0085] FIG. 12A-B: Pathways for the synthesis of isoprenoid precursors IPP, DMAPP and GPP from the aldol condensation of acetaldehyde and pyruvate. Condensation to 4-hydroxy-2-oxopentanote initiates the pathway, which proceeds through 2-hydroxyisovalerate as an intermediate. Exemplary enzymes for each step shown in Table H.

    [0086] FIG. 13A-B: Pathways for the synthesis of isoprenoid precursors IPP, DMAPP and GPP from the aldol condensation of acetaldehyde and pyruvate. Condensation to 4-hydroxy-2-oxopentanote initiates the pathway, which proceeds through 2-isopropylmalate as an intermediate. Exemplary enzymes for each step shown in Table I.

    [0087] FIG. 14A-B: Pathways for the synthesis of isoprenoid precursors IPP, DMAPP and GPP from the aldol condensation of acetaldehyde and 2-oxobutanoate. Examplary enzymes for each step shown in Table J.

    [0088] FIG. 15: Pathways for the synthesis of isoprenoids from isoprenoid precursors such as DMAPP, IPP, GPP, and FPP. Generation of isoprenoid precursors through described routes can be combined with various isoprenoid forming enzymes such as prenyl transferases, terpene synthases, or terpene cyclases to synthesize isoprenoids and derivatives thereof. Examplary enzymes for each step shown in Table K.

    [0089] FIG. 16A-B: Pathways for the synthesis of polyketides, olivetolic acid and olivetol, through thiolases-catalyzed non-decarboxylative condensations, beta-reductions, and termination pathways.

    [0090] FIG. 17: Synthesis of prenylated aromatic compound cannabigerolic acid through olivetolic acid prenylation with the hydrocarbon unit of geranyl pyrophosphate. Geranyl pyrophosphate generated through various example routes as shown in FIG. 2-14, or through native pathways such as MVA or DXP pathway or commercial sources. Olivetolic acid generated through thiolases-catalyzed non-decarboxylative condensations, beta-reductions, and termination pathways, with examples shown in FIG. 16 or through alternative pathways or from commercial sources. Exemplary enzymes prenyl transfer step shown in Table L.

    [0091] FIG. 18: Titers of tiglic acid of IST06(DE3) strain overexpressing thiolase FadAx, hydroxyacyl-CoA dehydrogenase FadB2x and enoyl-CoA hydratase FadB1x along with acyl-CoA transferase Pct with or without thioesterase Ydil in shake flasks or bioreactor.

    [0092] FIG. 19: Total ion GC-MS chromatogram showing peak of synthesized 2,3-dihydroxybutyric acid synthesized by MG1655 (DE3) ΔgleD pET-P1-bktB-phaB1-P2-phaJ pCDF-P1-pct-P2-tdter.

    [0093] FIG. 20: Results of in vitro enzymatic assays of acyl-CoA transferases Pct and Pct540 on different substrates.

    [0094] FIG. 21: 2-hydroxyisovaleric acid titer of JST06(DE3) expressing alsS, ilvD and panE when grown on various carbon sources.

    [0095] FIG. 22: Absorbance at 340 nm of in vitro assay samples and controls on dehydration of ethylene glycol to acetaldehyde by PddABC, coupled with actaldehyde oxidization to acetyl-CoA by Lmo1179. Red: control without B12 coenzyme; Blue: control without cell lysates; Green: reaction sample with lysate and B12 coenzyme.

    [0096] FIG. 23: Butyric acid production of JC01 strain overexpressing AtoB, FadB and EgTer in combination with overexpression of different thioesterase through pZS vector.

    [0097] FIG. 24A-D: in vitro characterization of HACL1. FIG. 24A, the result of assay on degradation of 2-hydroxyhexadecaonyl-CoA to formyl-CoA and pentadecanal; FIG. 24B, the result of assay on acyloin condensation of pentadecanal and formyl-CoA to 2-hydroxyhexadecanoyl-CoA, which is hydrolyzed to 2-hydroxyhexadecanoic acid; FIG. 24C: the result of assay on acyloin condensation between formyl-CoA and acetaldehyde to lactyl CoA, which is hydrolyzed to lactate; FIG. 24D, the result of assay on acyloin condensation between formaldehyde and foimyl-CoA to glycolyl-CoA, which is hydrolyzed to glycolate.

    [0098] FIG. 25: NADH oxidization of samples and controls of in vitro formate activation assay by E. coli acyl-CoA synthase ACS (EcAcs) coupled by Listeria monocytogenes acyl-CoA reductase Lmo1179 (LmACR).

    [0099] FIG. 26: Prenol production in E. colt through the pathway via. HMG-CoA with usage of different acyl-CoA reductases and alcohol dehydrogenase and different number of vectors.

    [0100] FIG. 27: Geraniol production of E. coli strains harboring novel GPP synthesis pathway via HMG-CoA and prenol with usage of acyl-CoA reductases AdhE2 or CbjALD and alcohol dehydrogenase YahK.

    [0101] FIG. 28: GC MS spectra of olivetolic produced in vivo in comparison to olivetolic acid standard.

    [0102] FIG. 29: GC-MS spectra of cannabigerolic acid (CBGA) produced in vivo in comparison to CBGA standard.

    [0103] FIGS. 30A-1 to 30A-3, 30B-1 to 30B-11, 30C-1 to 30C-26: Embodiments of the invention.

    DETAILED DESCRIPTION

    [0104] This disclosure generally relates to the use of enzyme combinations or recombinant microbes comprising the same to make isoprenoid precursors, isoprenoids and derivatives thereof including prenylated aromatic compounds through novel synthetic metabolic pathways. As described herein, the novel pathways for the synthesis of these products exploit enzymes catalyzing Claisen, aldol, or acyloin condensation reactions for the generation of longer chain length intermediates from central carbon metabolites (FIG. 1). Both decarboxylative and non-carboxylative condensations are utilized, enabling product synthesis from a number of different starting compounds. These condensation reactions serve as a platform for the synthesis of isoprenoid precursors, isoprenoids and derivatives thereof, polyketides, and prenylated aromatic compounds when utilized in combination with a variety of metabolic pathways and enzymes for carbon rearrangement and the addition/ removal of functional groups (FIG. 1). Isoprenoid alcohols are key intermediary products for the production of isoprenoid precursors in these novel synthetic metabolic pathways.

    [0105] One such pathway employs native or engineered thiolases that catalyze the condensation between an acyl-CoA, serving as the primer, and another acyl-CoA, serving as the extender unit, enabling the formation of beta-keto acyl-CoA intermediate (FIG. 1). Primers and extender units can be omega-functionalized to add required functionalities to the carbon chain, which can be further modified to form isoprenoid intermediates. The beta-keto group of the beta-keto acyl-CoA formed via condensation can be reduced and modified step-wise by one or more of the beta-reduction enzymes—dehydrogenase, dehydratase, and/or reductase reactions. Furthermore, various carbon re-arrangement enzymes, such as acyl-CoA mutases, can be employed to modify the carbon structure and branching of the acyl-CoAs. These CoA intermedites can then serve as the primer for the next round of condensation with the extender unit or as direct precursors to IPP, DMAPP, or other isoprenoid intermediates. After the termination by spontaneous or enzyme-catalyzed CoA removal, reduction, and/or phosphorylation, and subsequent structure re-arrangement, isoprenoids precursors (e.g. IPP and DMAPP), isoprenoids and derivatives thereof are produced. Many examples of thiolase enzymes which can potentially catalyze the condensation of an acyl-CoA primer and acyl-CoA extender unit are provided herein and the following Table A provides several additional examples which can also serve as templates for engineered variants. In another embodiment, ketoacyl-CoA syntheases can be employed in place of thiolases, catalyzing decarboxylative Claisen condensations.

    [0106] By employing these thiolase- or ketoacyl-CoA synthase catalyzed condensations with unsubstituted or functionalized acyl-CoAs serving as the primer and the extender unit, various beta-keto acyl-CoAs can be generated that through additional beta-reduction and carbon rearrangement modifications serve as direct precursors to the C5 isoprenoid intermediates IPP or DMAPP. For example, FIGS. 2-6 depict various primer/extender unit combinations that through condensation and beta-reduction/carbon rearrangement reaction form CoAs that can be converted to IPP and DMAPP through various termination pathways. These building blocks can then be converted to longer chain length isoprenoid intermediates and products through, for example, known geranyl-, farnesyl- or, geranylgeranyl-diphosphate synthases, such as the formation of the Cio intermediate geranyl pyrophosphate (GPP) from IPP and DMAPP by GPP synthase.

    [0107] In addition to serving as precursors to IPP and DMAPP, the above described acyl-CoA intermediates can also serve as a primer for the next round of condensation with an extender unit enabling the synthesis of longer chain beta-keto acyl-CoAs. Additional rounds of elongation/beta-reduction/carbon rearrangement result in CoA intermediates that can be converted to longer chain length (e.g. C.sub.10, C.sub.15, etc.) isoprenoid intermediates. For example, FIG. 2 depicts the direct synthesis of GPP through condensation and beta-reduction/carbon rearrangement formation of an isoprenoid acyl-CoA that can be converted to GPP. This type of strategy can be utilized to target not only Cio isoprenoid intermediates, but also longer chain length compounds as well. Following either route to isoprenoid precursors various prenyl transferases, terpene synthases, or terpene cyclases can be used to convert the isoprenoid precursors into desired isoprenoid products and derivatives thereof. Exemplary materials that can be used with the invention include those in Tables A and B.

    [0108] In another embodiment, the formation of isoprenoid precursors, isoprenoids and derivatives thereof including prenylated aromatic compounds proceeds from acetoacetyl-CoA formed as an intermediate through the non-decarboxylative condensation of 2 acetyl-CoA molecules catalyzed by thiolase(s) or decarboxylative condensation of acetyl-CoA and malonyl-CoA catalyzed by keto-acyl-CoA synthase(s). In one such pathway, acetoacetyl-CoA is first converted to 3-hydroxy-3-methylglutaryl-CoA by hydroxymethylglutaryl-CoA synthase (FIG. 7). 3-hydroxy-3-methylglutaryl-CoA is then dehydrated and decarboxylated through the action of an enoyl-CoA hydratase and glutaconyl-CoA decarboxylase, respectively, to form 3-methyl-2-butenoyl-CoA (FIG. 7). From 3-methyl-2-butenoyl-CoA, a number of routes are available leading to the formation of dimethylallyl phosphate. The formation of the isoprenoid precursors IPP and DMAPP then proceeds as described. These pathways are depicted in FIG. 7 and Table C provides examples of enzymes that can be used.

    [0109] In another pathway from acetoacetyl-CoA, acetone generated from the decarboxylation of acetoacetic acid is converted to 3-methyl-3-hydroxy-butyryl-CoA through a condensation (FIG. 8). Dehydration of 3-methyl-3-hydroxy-butyryl-CoA through the action of an enoyl-CoA hydratase then forms 3-methyl-2-butenoyl-CoA. From 3-methyl-2-butenoyl-CoA, a number of routes are available leading to the formation of dimethylallyl phosphate, and then to IPP and DMAPP as described. These pathways are depicted in FIG. 8 and Table D provides examples of enzymes that can be used.

    [0110] This disclosure also relates to the use of enzyme combinations or recombinant microbes to make isoprenoid precursors, isoprenoids and derivatives thereof including prenylated aromatic compounds through acyloin condensation reactions (FIG. 1). In one embodiment, the pathway begins from the central carbon intermediate pyruvate, with a decarboxylative acyloin condensation of 2 molecules of pyruvate forming acetolactate. Subsequent isomeroreduction and dehydration convert acetolactate to 3-methyl-2-oxobutanoate (FIG. 9 and FIG. 10). These first 3 reactions are catalyzed by acetalactate synthase, acetohydroxyacid isomeroreductase, and dihydroxyacid dehydratase, respectively.

    [0111] Following the formation of 3 -methyl-2-oxobutanoate, several potential pathways can be exploited for the conversion of 3-methyl-2-oxobutanoate to isoprenoid precursors. One such pathway to isoprenoid precursors involves a keto-reduction to 3-methyl-2-hydroxybutanoate, catalyzed by 2-hydroxyacid dehydrogenase. A series of different reactions can then be employed to convert 3-methyl-2-hydroxybutanoate into prenol (FIG. 9). In general, these steps involve the dehydration and phosphorylation of either the acid intermediate (3-methyl-2-hydroxybutanoate) or its CoA derivative to into prenol. Conversion of the acid intermediate requires a 2-hydroxyacid dehydratase for the foiniation of an alpha-beta-double bond, and the subsequent conversion to 3-methyl-2-butenoyl-CoA through the action of any of an acyl-CoA synthetase, an acyl-CoA transferase, or the combination of a carboxylate kinase and phosphotransacylase (FIG. 9). From 3-methyl-2-butenoyl-CoA, a number of routes are available leading to the formation of prenol. The formation of the isoprenoid precursors IPP and DMAPP then proceeds from prenol through an alcohol kinase and phosphate kinase or an alcohol diphosphokinase to form DMAPP, with isopentenyl diphosphate isomerase able to interconvert DMAPP and IPP. These pathways are also depicted in FIG. 9 and Table E.

    [0112] Alternatively, 3-methyl-2-hydroxybutanoate can be converted into its CoA derivative (3-methyl-2-hydroxybutanoyl-CoA) before the dehydration reaction. This can be accomplished through any of an acyl-CoA synthetase, an acyl-CoA transferase, or the combination of a carboxylate kinase and phosphotransacylase. Following activation to 3-methyl-2-hydroxybutanoyl-CoA, the dehydration reaction forms 3-methyl-2-butenoyl-CoA, which is catalyzed by a 2-hydroxyacyl-CoA dehydratase, for which a number of candidate enzymes are available (Table E). From 3-methyl-2-butenoyl-CoA, a number of routes are available leading to the formation of prenol. The formation of the isoprenoid precursors IPP and DMAPP proceeds as described. These pathways are also depicted in FIG. 9 and Table E.

    [0113] An alternative route from 3-methyl-2-oxobutanoate involves the addition of 2 carbons (with acetyl-CoA as the donor) through the action of isopropylmalate synthases to form (2S)-isopropylmalate (FIG. 10). Isopropylmalate isomerase and isopropylmalate dehydrogenase then convert (2S)-isopropylmalate to 4-methyl-2-oxopentanoate, which is subsequently converted to 3-methyl-2-butenoyl-CoA through a branched chain alpha-keto acid dehydrogenase and an acyl-CoA dehydrogenase (FIG. 10). From 3-methyl-2-butenoyl-CoA, a number of routes are available leading to the formation of prenol. The formation of the isoprenoid precursors IPP and DMAPP is as described above. These pathways are depicted in FIG. 10 and Table F provides examples of enzymes that can be used.

    [0114] In another embodiment, the non-decarboxylative acyloin condensation of isobutanal and formyl-CoA to 3-methyl-2-hydroxybutanoyl-CoA catalyzed by 2-hydroxyacyl-CoA lyase is utilized (FIG. 11). Isobutanal is generated through the use of Claisen condensation and beta-reduction reactions, with carbon rearrangement and an aldehyde forming termination pathway. Formyl-CoA can be generated directly from formate or formaldehyde. Following acyloin condensation, 3-methyl-2-hydroxybutanoyl-CoA is converted to prenol through various pathways (FIG. 11). Prenol is subsequently converted into DMAPP and IPP. These pathways are depicted in FIG. 11 and Table G provides examples of enzymes that can be used.

    [0115] This disclosure also relates to the use of enzyme combinations or recombinant microbes to make isoprenoid precursors, isoprenoids and derivatives thereof including prenylated aromatic compounds through acyloin condensation reactions (FIG. 1). In one embodiment, the pathway begins from the central carbon intermediate pyruvate, which is condensed with acetealdeyhde in an aldol condensation to form 4-hydroxy-2-oxopentanoate (FIG. 12). Carbon rearrangement catalyzed by a mutase and reduction through the action of a 2-hydroxyacid dehydrogenase converts 4-hydroxy-2-oxopentanoate to 2,3-dihydroxy-3-methylbutanoate, an intermediate of the aformentoned valine biosythensis pathway. Following dehydration to 3-methyl-2-oxobutanoate, several metabolic routes to isoprenoid precursors can be exploited, including keto-reduction and combinations of dehydration and phosphorylation, either converting the free acid intermediate or its CoA derivative to prenol (FIG. 12). Prenol is subsequently converted into DMAPP and IPP. These pathways are depicted in FIG. 12 and Table H below provides examples of enzymes that can be used.

    [0116] Alternatively, the addition of 2-carbons to 3-methyl-2-oxobutanoate, followed by subsequent isomerization, and decarboxylation results in the generation of isovaleryl-CoA, which can then be converted to prenol through a series of reactions (FIG. 13). Prenol is then converted to DMAPP, which can be isomerized into IPP generating the two C5 isoprenoid precursors. These pathways are depicted in FIG. 13 and Table I below provides examples of enzymes that can be used.

    [0117] In another embodiment, an aldolase catalyzes the aldol condensation of 2-oxobutanoate and acetaldehyde forming 4-hydroxy-2-oxo-3-methylpentanoate (FIG. 14). Conversion of this intermediate to 4-methyl-2-oxopent-4-enoate, through the action of a mutase and a dehydratase, enables the use of a number of pathways to generate isoprenol from 4-methyl-2-oxopent-4-enoate. This 5-carbon isoprenoid alcohol is then converted to IPP through a two-step phosphorylation with IP as an intermediate, or a one step diphosphorylation catalyzed by an alcohol diphosphokinase. IPP can be isomerized into DMAPP generating the two Cs isoprenoid precursors. These pathways are depicted in FIG. 14 and Table J below provides examples of enzymes that can be used.

    [0118] The synthesis of IPP, DMAPP, GPP, FPP or other isoprenoid precursors can then be combined with the rearrangement of these intermediates into the desired isoprenoid product. The 5-carbon isomers IPP and DMAPP are the fundamental building blocks of isoprenoid products. From these Cs units, an immense number of products can be synthesized through the action of for example prenyl transferases, terpene synthases, or terpene cyclases, which involves the prenyl transfer, head-to-tail condensation, head-to-head condensation, tail-to-tail condensation, or cyclization, among other biochemical reactions, of IPP, DMAPP, and other longer chain isoprenoid precursors synthesized from the Cs building blocks. As such, the generation of these intermediates can enable the synthesis of for example a variety of monoterpenes (C.sub.10), sesquiterpenes (C.sub.15), diterpenes (C.sub.20), sesterterpenes (C.sub.25), triterpenes (C.sub.30), sesquarterpenes (C.sub.35), and tetraterpenes (C.sub.40), among other isoprenoid compounds and derivatives thereof (FIG. 15). Table K below provides examples of enzymes that can be used.

    [0119] The isoprenoid precursors synthesized through these routes can also be exploited for the synthesis of hybrid products, which contain as an example, the Cs (dimethylallyl), C.sub.10 (geranyl), or C.sub.15 (farnesyl) isoprenoid attached to an aromatic core structure. The prenylation of these aromatic compounds with the isoprenoid units offers another route to diverse products. One route to polyketides involves native or engineered thiolases catalyzing the condensation in an iterative manner (i.e. one or multiple rounds) between two either unsubstituted or functionalized acyl-CoAs each serving as the primer and the extender unit to generate and elongate polyketide CoAs. Before an optional next round of thiolase reaction, the beta-keto group of the polyketide chain can be reduced and modified step-wise by the beta-reduction reactions. Spontaneous or enzymatically catalyzed termination reaction terminates the elongation of the polyketide chain at any point through CoA removal and reactions rearranging the structure, generating the final functional polyketide products. Examples of enzymes that can be used for these key reactions are shown in Tables A and B. This approach is the subject of patent application WO2017020043, BIOSYNTHESIS OF POLYKETIDES, filed Aug. 1, 2016, and 62/198,764, filed Jul. 30, 2015.

    [0120] The polyketides synthesized through this route or other routes such as polyketide synthases can be combined with isoprenoid precursors for the formation of prenylated aromatic compounds. For example, FIG. 16 demonstrates olivetolic acid generation through condensation and beta-reduction reactions and generation of isoprenoid precursor geranyl pyrophosphate, which when combined through the action of an aromatic prenyltransferase or 4-hydroxybenzoate grenyltransferase, enables the synthesis of the cannabinoid cannabigerolic acid (FIG. 17). Cannabigerolic acid can then be converted into a number of other cannabinoids, including Δ.sup.9-tetrahydrocannabinolic acid, cannabidiolic acid, and cannabichromenic acid. Examples of enzymes that can be used for these key reactions are shown in Table L.

    [0121] As such, through the use of these novel pathways based on Claisen, aldol, or acyloin condensation, this platform can be exploited to make not only isoprenoids precursors, isoprenoids and derivatives thereof, but also diverse hybrid products with wide ranging applications.

    (Prophetic) GPP Biosynthesis Through Utilization of Beta-Oxidation Reversal and Methyl Group Transferring Mutase

    [0122] The purpose of this example is to demonstrate the biosynthesis of GPP through a novel pathway that recniits condensation and beta-reduction reactions as well as a mutase that moves the methyl group by one carbon. E. coli serves as the host organism. This pathway starts from non-decarboxylative Claisen condensation between acetyl-CoA, which serves as the primer, and propionyl-CoA, which serves as the extender unit, by thiolase FadAx (AAKI8171.1) from P. putida. In the pathway, propionyl-CoA is activated from propionic acid, which is either supplemented or synthesized through overexpressed native pathway of conversion of succinate to propionic acid, catalyzed by M. elsdenii acyl-CoA transferase Pct (BAU59368.1). After two beta-reduction steps catalyzed by hydroxyacyl-CoA dehydrogenase FadB2x (AAK18170.1) and enoyl-CoA hydratase FadBlx (AAK18173.1), both from P. putida, 2-methylcrotonyl-CoA (tiglyl-CoA) is generated. Then, mutase moves the methyl group from alpha-site to beta-site on tiglyl-CoA, generating 3-methyl-2-butenoyl-CoA (3-methylcrotonyl-CoA). 3-methylcrotonyl-CoA is converted to prenol by alcohol-forming acyl-CoA reductase or aldehyde forming acyl-CoA reductase and alcohol dehydrogenase or carboxylate reductase and the hydrolysis enzyme selected from the group consisting thioesterase, acyl-CoA synthase, acyl-CoA transferase and carboxylate kinase plus phosphotransacylase. Alcohol-forming acyl-CoA reductase is selected from the group consisting C. acetobutylicum AdhE2 (YP_009076789.1) and M. aquaeolei VT8 Maqu_2507 (YP_959769.1). CbjALD from C. beijerinckii aldehyde forming acyl-CoA reductase (AAT66436.1) is selected for conversion of 3-methylcrotonyl-CoA to prenol. Alcohol dehydrogenase is selected from the group consisting E. coli YahK (NP_414859.1), E. coli YjgB (NP_418690.4) and Acinetobacter sp. SE19 ChnD (BAC80217.1).

    [0123] Prenol is then converted to DMAPP by one or two steps of phosphorylation. If phosphorylated by two steps, the first step is catalyzed by E. coli alcohol kinase YchB (NP_415726.1) or Thermoplasma acidophilum phosphate kinase ThaIPK (WP_010900530.1, V731, Y141V and K204G mutations to increase specificity on prenol. Liu et al. 2016) and the second is by M. thermautotrophicus phosphate kinase MtIPK (AAB84554.1). The one step phosphorylation is catalyzed by alcohol diphosphokinase. E. coli isopentenyl pyrophosphate isomerase Idi (NP_417365.1) converts DMAPP to IPP. Then, DMAPP and IPP are condensed to GPP catalyzed by E. coli. GPP synthase IspA (NP_414955.1, with S8OF mutation to make the enzyme exclusive active on GPP synthesis, Reiling et al. 2004) or Abies grandis GPP synthase GPPS2 (AAN01134.1, N-terminal 84 aa truncation to improve the activity). 3-methylcrotonyl-CoA can also serve as the primer for the next iteration composed of reactions by thiolase, hydroxyacyl-CoA dehydrogenase, enoyl-CoA hydratase and enoyl-CoA reductase, with acetyl-CoA as the extender unit, generating 5-methyl-4-hexenoyl-CoA. 5-methyl-4-hexenoyl-CoA, serving as the primer, is condensed with extender unit propionyl-CoA through condensation by P. putida thiolase FadAx. After two beta-reduction steps catalyzed by P. putida hydroxyacyl-CoA dehydrogenase FadB2x and enoyl-CoA hydratase FadBlx, 2,7-dimethyl-2,6-octadienoyl-CoA is formed. Then, mutase moves the methyl group from alpha-site to beta-site, converting 2,7-dimethyl-2,6-octadienoyl-CoA to 3,7-dimethyl-2,6-octadienoyl-CoA, namely geranyl-CoA. Geranyl-CoA is converted to geraniol by alcohol-forming acyl-CoA reductase or aldehyde forming acyl-CoA reductase and alcohol dehydrogenase. Geraniol is then converted to GPP by one or two steps of phosphorylation. If phosphorylated through two steps, the first step is catalyzed by Arabidopsis thaliana alcohol kinase AT5G58560 (NP_200664.1) and the second step is catalyzed by Thermoplasma acidophilum phosphate kinase ThaIPK (WP_010900530.1, Y70A, V130A and I130A mutations to increase specificity on geranyl phosphate over isopentenyl phosphate, Mabanglo et al. 2012). The one-step phosphorylation is catalyzed by alcohol diphosphokinase. Ocimum basilicum geraniol synthase GES (AR11765.1, with N-terminal 65 aa truncated to improve the activity, lijima et al. 2004) converts GPP to geraniol, which serves as the proxy product of GPP to demonstrate the synthesis pathway.

    [0124] JST06(DE3) serves as the E. coli host strain for demonstration of this novel pathway. JST06(DE3) (MG1655(DE3) ΔldhA ΔpoxB Δpta ΔadhE ΔfrdA ΔyciA ΔybgC ΔydiI ΔtesA ΔfadM ΔtesB) (Cheong et al. 2016) is an E. coli strain deficient in mixed-acid fermentation pathways due to deletions of genes ldhA, poxB, pta, adhE and frdA, which maximize the supply of acetyl-CoA, and deletions of genes encoding major thioesterases (yciA, ybgC, ydiI, tesA, fadM and tesB), which minimize the hydrolysis of CoA intermediates.

    [0125] The genes for overexpression are either cloned into appropriate vectors or inserted into chromosome with strong synthetic constitutive promoter, such as M1-93. When cloned into vectors, these genes are amplified through PCR using appropriate primers to append homology on each end for recombination into the vector backbone with e.g., Phusion polymerase (Thermo Scientific, Waltham, MA) to serve as the gene insert. Plasmids are linearized by the appropriate restriction enzymes (New England Biolabs, Ipswich, MA, USA) and recombined with the gene inserts using the In-Fusion HD Eco-Dry Cloning system. The mixture is subsequently transformed into Stellar competent cells. Transformants that grow on solid media (LB±Agar) supplemented with the appropriate antibiotic are isolated and screened for the gene insert by PCR. Plasmids from verified transformants are isolated and the sequence of the gene insert is further confirmed by DNA sequencing. The sequence confirmed plasmids are then introduced to host strain through electroporation.

    [0126] When inserted into chromosome, CRISPR is used and genetic sites of tesB, adhE and IdhA are suitable loci, although others could be used. CRISPR method is based on the method developed by Jiang et al. (Jiang et al. 2015). First, the host strain is transformed with plasmid pCas, the vector for expression of Cas9 and λ-red recombinase. The resulting strain is grown under 30° C. with L-arabinose for induction of λ-red recombinase expression, and when OD reaches ˜0.6, competent cells are prepared and transformed with pTargetF (AddGene 62226) expressing sgRNA and N20 spacer targeting the locus and template of insertion of target gene. The template is the inserted gene plus M1-93 promoter with ˜500 bp sequences homologous with upstream and downstream of the insertion locus, constructed through overlap PCR with usage of Phusion polymerase or synthesized by GenScript (Piscataway, NJ) or GeneArt® (Life Technologies, Carlsbad, Calif.). The way to switch N20 spacer of pTargetF plasmid is inverse PCR with the modified N20 sequence hanging at the 5′ end of primers with usage of Phusion polymerase and followed by self-ligation with usage of T4 DNA ligase and T4 polynucleotide kinase (New England Biolabs, Ipswich, Mass., USA). Transformants that grow under 30° C. on solid media (LB+Agar) supplemented with spectinomycin and kanamycin (or other suitable antibiotic) are isolated and screened for the chromosomal gene insert by PCR. The sequence of the gene insert, which is amplified from genomic DNA through PCR using Phusion polymerase, is further confirmed by DNA sequencing. The pTargetF can then be cured through IPTG induction, and pCas can be cured through growth under higher temperature like 37-42° C.

    [0127] All molecular biology techniques are performed with standard methods (Miller, 1972; Sambrook et al., 2001) or by manufacturer protocol. Strains are stored in glycerol stocks at -80° C. Plates are prepared using LB medium containing 1.5% agar, and appropriate antibiotics are included at the following concentrations: ampicillin (100 μg/mL), kanamycin (50 μg/mL), spectinomycin (50 g/mL) and chloramphenicol (12.5 g/mL).

    [0128] MOPS minimal medium (Neidhardt et al., 1974) with 125 mM MOPS and Na.sub.2HPO.sub.4 in place of K.sub.2HPO.sub.4 (2.8 μM), supplemented with 20 g/L glycerol or 40 g/L glucose, 10 g/L tryptone, 5 g/L yeast extract, 100 μM FeSO.sub.4, 5 mM calcium pantothenate, 5 mM (NH4)2504, and 30 mM NH4Cl is used for fermentations. If required, 55 g/L of CaCO.sub.3 is also supplemented as pH buffer. 20 mM propionic acid is supplemented, if it is not synthesized intracellularly and needed for the experiment. Antibiotics (50 μg/mL carbenicillin, 50 μg/mL spectinomycin and 50 μg/mL kanamycin) are included when appropriate. All chemicals are obtained from Fisher Scientific Co. (Pittsburg, Pa.) and Sigma-Aldrich Co. (St. Louis, Mo.).

    [0129] Fermentations are performed in 25 mL Pyrex Erlenmeyer flasks (narrow mouth/heavy duty rim, Corning Inc., Corning, NY) filled with appropriate volume of fermentation medium and sealed with foam plugs filling the necks. A single colony of the desired strain is cultivated overnight (14-16 hrs) in LB medium with appropriate antibiotics and used as the inoculum with initial OD.sub.550 as ˜0.05. After inoculation, flasks are incubated in a NBS 124 Benchtop Incubator Shaker (New Brunswick Scientific Co., Inc., Edison, NJ) at 200 rpm and 37° C. or 30° C. When optical density (550 nm, OD55o) reached ˜0.3-0.5, appropriate concentration of isopropyl beta-D-1-thiogalactopyranoside (IPTG) (or other suitable inducer) is added for plasmid gene induction. Additional fermentations are conducted in a SixFors multi-fermentation system (Infors HT, Bottmingen, Switzerland) with an air flowrate of 2 N L/hr, independent control of temperature (37° C.), pH (controlled at 7.0 with NaOH and H.sub.2SO.sub.4), and appropriate stirrer speed. Pre-cultures are grown in 25 mL Pyrex Erlenmeyer flasks as described above and incubated for 4 hours post-induction. An appropriate amount of this pre-culture is centrifuged, washed twice with fresh media, and used for inoculation (400 mL initial volume). The fermentations in bioreactor use described fermentation media with 30 g/L glycerol or 40 g/L glucose, with the optional inclusion of 5 μM sodium selenite to promote FHL activity, and appropriate IPTG and antibiotics. If required, propionic acid (20 mM) is added at 0, 24, and 48 hours.

    [0130] After the fermentation, the supernatant obtained through 5000 g, 5 min centrifuge in an Optima L-80XP Ultracentrifuge (Beckman-Coulter, Schaumburg, IL) of 2 mL culture is prepared for GC-FID/GC-MS analysis of geraniol. The supernatant aliquots of 2 mL are transferred to 5 mL glass vials (Fisher Scientific Co., Pittsburgh, PA). Then, organic solvent (typically hexane) is added at a 1:1 ratio to a fermentation broth sample (e.g. 2 mL for a 2 mL aqueous solution) for extraction. Following an appropriate extraction (vortex samples for 15 seconds, spin on a rotator at 60 rpm for 2 hours, and vortex again for 15 seconds), 1 mL of the organic phase is removed. 50 μL pyridine and 50 uL BSTFA are then added to the 1 mL organic phase for derivatization, with the reaction allowed to proceed at 70° C. for 30 minutes. After cooling to room temperature, this mixture is used for GC analysis.

    [0131] GC analysis is conducted on an Agilent 7890B Series Custom Gas Chromatography system equipped with a 5977B Inert Plus Mass Selective Detector Turbo EI Bundle (for identification) or a Flame Ionization Detector (for quantification) and an Agilent HP-5 capillary column (0.25 mm internal diameter, 0.25 μn film thickness, 30 m length). The following temperature profile is used with helium as the carrier gas at a flowrate of 1.5 mL/min Initial 50° C. (hold 3 min); ramp at 20° C/min to 270° C. (hold 6 min). The injector and detector temperature are 250° C. and 350° C., respectively. 1 uL of sample is injected with a 4:1 split ratio.

    [0132] Among above enzymes, the activities of thiolase FadAx, hydroxyacyl-CoA dehydrogenase FadB2x and enoyl-CoA hydratase FadBlx, required for the above described GPP synthesizing reverse beta-oxidation pathways, have already been demonstrated in vivo. JST06(DE3) overexpressing these enzymes along with E. coli thioesterase YdiI (NP_416201.1) and Pct have been grown in shake flasks with 20 g/L glycerol and 20 mM propionic acid for 48 hours at 20 mL volume and in a controlled bioreactor for 72 hours with 30 g/L glycerol and supplementation of 20 mM propionic acid every 24 hours, both induced by induced by 5 μM IPTG at 37° C., leading to production of 1.39 g/L of 2-methyl-2-butenoic acid or tiglic acid in shake flasks, and 3.79 g/L of tiglic acid in bioreactors (FIG. 18). If YdiI is not overexpressed, no tiglic acid production was detected, indicating that YdiI is able to hydrolyze 2-methyl-2-butenoyl-CoA (tiglyl-CoA), generated through FadAx condensation between primer acetyl-CoA and extender unit propionyl-CoA and subsequent beta-reduction steps by FadB2x and FadBlx, to tiglic acid.

    [0133] In the above demonstration, the genes encoding FadAx and Pct were expressed from pCDF-P1-pct-fadAx and the genes encoding FadB1x, FadB2x and YdiI were expressed from pET-P1-fadB2x-fadBlx-P2-ydiI. The primers used in constructions of these plasmids are listed in Table M. For the construction of pCDF-P1-pct-fadAx, the pct gene insert was first PCR amplified with pct-f1/pct-r1 primers and inserted into vector pCDFDuet-1 (Novagen, Darmstadt, Germany) cleaved by NcoI and EcoRI through In-Fusion HD Eco-Dry Cloning system (Clontech Lab., CA) to construct pCDF-P1-pct. Then, the fadAx gene insert was PCR amplified with fadAx-f1/fadAx-r1 and inserted into vector pCDF-P1-pct cleaved by EcoRI through In-Fusion cloning, generating pCDF-P1-pct-fadAx. For the construction of pET-P1-fadB2x-fadB1x-P2-ydiI, the fadB2x gene insert was first PCR amplified with fadB2x-f1/fadB2x-r1 primers and inserted into vector pETDuet-1 (Novagen, Darmstadt, Germany) cleaved by NcoI and EcoRI through In-Fusion cloning, generating pET-P1-fadB2x. Then, the fildB1x gene insert was PCR amplified with fadB1x-f1/fadB1x-r1 primers and inserted into pET-P1-fadB2x cleaved by EcoRI through In-Fusion cloning, generating pET-P1-fadB2x-fadB1x. Finally, the vdiI gene insert was PCR amplified with ydiI-f1/primers and inserted into pET-P1-fadB2x-fadBlx cleaved by NdeI (New England Biolabs, Ipswich, Mass., USA) through In-Fusion cloning, generating pET-P2-fadB2x-fadBlx-P2-ydiI. Before the introduction to host strain, the sequences of constructed plasmids were confirmed by DNA sequencing.

    [0134] Two plasmids for expressing the pathway that converts prenol to GPP and geraniol (or “Lower alcohol pathway” as shown in FIG. 1) and can be used in above pathway have been constructed and are listed in Table N. To construct pET-P1-idi-trGPPS2-P2-ges-ychB-mtipk and pET-P1-idi-trGPPS2-P2-ges-thaipk-mtipk, the gene inserts encoding Idi and trGPPS2 (“tr” means “truncated” as first 84 aa of GPPS2 was truncated to improve the activity) were PCR amplified with idi-f1/idi-r1 and trgpps2-f1/trgpps2-r1 respectively and inserted together into pETDuet-1 cleaved by NcoI through In-Fusion HD Eco-Dry Cloning system to generate pET-P1-idi-trGPPS2. Then, the gene insert encoding GES was PCR amplified with ges-f1/ges-r1 primers and inserted into vector pET-P1-idi-trGPPS2 cleaved by NdeI and KpnI through In-Fusion HD Eco-Dry Cloning system to generate pET-P1-idi-trGPPS2-P2-ges. When constructing pET-P1-idi-trGPPS2-P2-ges-ychB-mtipk, the gene inserts encoding YchB and MtIPK were PCR amplified with ychB-fychB-r1 and mtipk-f1/mtipk-r1 respectively and inserted together into pET-P1-idi-trGPPS2-P2-ges cleaved by XhoI through In-Fusion HD Eco-Dry Cloning system to generate pET-P1-idi-trGPPS2-P2-ges-ychB-mtipk. When constructing pET-P1-idi-trGPPS2-P2-ges-thaipk-mtipk, the gene insert encoding ThaIPK (with V73I, Y141V and K204G mutations) was PCR amplified with thaipk-f1/thaipk-r1 and inserted into pET-P1-idi-trGPPS2-P2-ges cleaved by XhoI through In-Fusion HD Eco-Dry Cloning system to generate pET-P1-idi-trGPPS2-P2-ges-thaipk, and then the gene encoding MtIPK was PCR amplified with mtipk-f2/mtipk-r1 and inserted into pET-P1-idi-trGPPS2-P2-ges-thaipk cleaved by XhoI through In-Fusion HD Eco-Dry Cloning system to generate pET-P1-idi-trGPPS2-P2-ges-thaipk-mtipk. The sequences of required primers can be seen in Table N. The sequences of constructed plasmids were further confirmed by DNA sequencing. Then, the sequence confirmed plasmids were introduced to competent cells of the host strain.

    [0135] Among above enzymes, in vitro activities of acyl-CoA reductases CbjALD and Maqu 2507 on reduction of 3-methylcrotonyl-CoA and the in vitro activities of alcohol dehydrogenases ChnD, YjgB and YahK on oxidization of prenol have been proven through enzymatic spectrophotometric assay. E. coli alcohol dehydrogenases FucO (NP_417279.2), YqhD (NP_417484.1), YiaY (YP_026233.1) were also assayed on prenol, but as mentioned below, they did not show the activity on prenol oxidization.

    [0136] For the tested enzymes, E. coli enzymes were expressed in pCA24N- gene (-gfp) plasmids from the ASKA collection (Kitagawa et al., 2005). Gene encoding Maqu_2507 and ChnD were codon optimized and synthesized by either GeneArt or GenScript. The gene encoding CbjALD was amplified from the genomic DNA of C. beiferinckii. The primers required for cloning of these genes are listed in Table O. The cbjALD gene insert was PCR amplified from the genomic DNA of C. beijerinckii. with cbjALD-f1 and cbjALD-r1 primers and inserted into vector pCDFDuet-1 cleaved by EcoRI through In-Fusion HD Eco-Dry Cloning system to construct pCDF-ntH6-cbjALD. The sequence of the cbjALD gene insert was further confirmed by DNA sequencing. The protein was expressed with an n-terminal 6 His-tag.

    [0137] The codon-optimized inaqu 2507 gene insert was PCR amplified with maqu 250741 and maqu_250741 primers and inserted into vector pCDFDuet-1 (Novagen, Darmstadt, Germany) cleaved by EcoRI through In-Fusion HD Eco-Dry Cloning system to construct pCDF-ntH6-maqu_2507. The sequence of the inaqu 2507 gene insert was further confirmed by DNA sequencing. The protein was expressed with an n-terminal 6 His-tag.

    [0138] The codon-optimized chnD gene insert was PCR amplified with chnD-f1 and chnD-r1 primers and inserted into vector pCDFDuet-1 (Novagen, Darmstadt, Germany) cleaved by EcoRI through In-Fusion HD Eco-Dry Cloning system to construct pCDF-ntH6-chnD. The sequence of the chnD gene insert was further confirmed by DNA sequencing. The protein was expressed with an n-terminal 6 His-tag.

    [0139] For expression of enzymes, cultures were grown in 25 mL of LB media in 125 mL flasks (Wheaton Industries, Inc., Millville, N.J.) at 37° C. A single colony of the desired strain was cultivated overnight (14-16 hrs) in 10 mL of LB medium in baffled flasks (Wheaton Industries, Inc., Millville, NJ) with appropriate antibiotics and used as the inoculum (3%). The cells were induced with 0.1 mM IPTG at an OD550˜0.6.

    [0140] After post-induction growth for 4 h for ASKA strains, or 16 for other strains, the cells were collected and washed twice by 9 g/L sodium chloride solution. Cells were then re-suspended in lysis buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 10 mM imidazole, pH 8.0) to an OD ˜40. After re-suspension, the cells were disrupted using glass beads and then centrifuged at 4° C., 13000 g, 10 mM in an Optima L-8OXP Ultracentrifuge (Beckman-Coulter, Schaumburg, Ill.). The resultant supernatant is the crude enzyme extract. The His-tagged enzymes were then purified from crude extract by using Ni-NTA spin kit (Qiagen, Valencia, Calif.). The crude extracts are centrifuged (270 g, 5 min) in spin columns that were equilibrated with lysis buffer and then washed twice by wash buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 20 mM imidazole, pH 8.0). After washing, the enzyme was eluted twice in elution buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 500 mM imidazole, pH 8.0). Both washing and elution steps are centrifuged at 890 g for 2 min. The purified enzyme extracts were then further concentrated and dialyzed through Amicon® Ultra 10K Device (Millipore, Billerica, Mass.). The enzymes were first filtered by centrifugation at 4° C., 14000 g, 10 mM, and then washed with 100 mM potassium phosphate, pH 7 buffer under the same centrifugation conditions. Finally, the concentrated and dialyzed enzymes were recovered through 4° C., 1000 g. 2 mM centrifugation. The protein concentration was established using the Bradford Reagent (Thermo Scientific, Waltham, Mass.) using BSA as the protein standard. SDS-PAGE monitor of purified proteins was performed through XCell SureLock' Mini-cell system (Invitrogen, Carlsbad, Calif.) with gels (12% acrylamide resolving gel and 4% acrylamide stacking gel) prepared through SureLock' Mini-cell system (Invitrogen, Carlsbad, Calif.). The composition of the running buffer for SDS-PAGE was 3 g/L tris base, 14.4 g/L glycine and 1 g/L SDS in water.

    [0141] Enzymatic reactions were monitored on either a Synergy HT plate reader (BioTek Instruments, Inc., Winooski, Vt.) or a Biomate 5 Spectrophotometer (Thermo Scientific, Waltham, Mass.) according to established protocols. Measurement of 3-methylcrotonyl-CoA reduction by acyl-CoA reductases was measured by following the decrease (oxidation of NAD(P)H) in absorbance at 340 nm from a reaction mixture containing 100 mM Tris-HCI (pH 7.5), 5 mM DTT, 0.3 mM NAD(P)H, and 1 or 5 mM 3-methylcrotonyl-CoA. Measurement of alcohol dehydrogenase activity on prenol was measured by following the increase (reduction of NAD(P).sup.+) in absorbance at 340 nm from a reaction mixture containing 100 mM Tris-HCl (pH 8.0), 1 mM NAD(P).sup.+, and 1 mM prenol.

    [0142] For assays of acyl-CoA reductases, the crude extract of CbjALD did not show the detectable reduction activity on 1 mM 3-methylcrotonyl-CoA, but the activity was detected (0.008 μmol/mg/min) when the enzyme was purified and the concentration of 3-methylcrotonyl-CoA was 5 mM. The crude extract of Maqu_2507 showed 0.08+0.01 μmol/mg/min towards 1 mM 3-methylcrotonyl-CoA. These results indicate that CbjALD and Maqu_2507 are suitable for reduction of 3-methylcrotonyl-CoA to prenol. CbjALD uses NADH as cofactor, while Maqu_2507 uses NADPH as cofactor.

    [0143] Among the assayed alcohol dehydrogenases, YahK, YjgB and ChnD showed the activity on oxidization of prenol to 3-methyl-1-butenal. They should be suitable for catalyzing the required reverse reduction reaction of 3-methyl-1 -butenal, which is converted from 3-methylcrotonyl-CoA by CbjALD, to prenol. The results are shown in Table P.

    [0144] 3-methylcrotonyl-CoA, which is then converted to GPP via prenol through the pathway described above, can also be supplied through two different versions of reverse beta-oxidation pathways incorporated with methyl-group transferring mutase. The first pathway starts from non-decarboxylative Claisen condensation between propionyl-CoA, which serves as the primer, and glycolyl-CoA, which serves as the extender unit, catalyzd by thiolase. In this pathway, propionyl-CoA is activated from propionic acid, which is either supplemented or synthesized through overexpressed native pathway of conversion of succinate to propionic acid, while glycolyl-CoA is activated from glycolic acid, which is either supplemented or synthesized through overexpressed native pathway of conversion of glyoxylate, the intermediate of glyoxylate shunt, to glycolic acid. The activations of both propionic acid and glycolic acid are catalyzed by Pct. After three beta-reduction steps catalyzed by hyclroxyacyl-CoA dehydrogenase, enoyl-CoA hydratase and enoyl-CoA reductases, 2-hydroxypentanoyl-CoA is generated. Then, mutase moves the methyl group from y-site to beta-site on 2-hydroxypentanoyl-CoA, generating 2-hydroxy-3-methylbutanoyl-CoA, and 2-hydroxyacyl-CoA dehydratase converts 2-hydroxy-3-methylbutanoyl-CoA to 3-methylcrotonyl-CoA. The second pathway starts from non-decarboxylative Claisen condensation between propionyl-CoA, which serves as the primer, and acetyl-CoA, which serves as the extender unit, catalyzd by thiolase. In the pathway, propionyl-CoA is activated from propionic acid, which is either supplemented or synthesized through overexpressed native pathway of conversion of succinate to propionic acid, catalyzed by Pct. After two beta-reduction steps catalyzed by hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase, 3-hydroxypentanoyl-CoA is generated. Then, mutase moves the methyl group from -site to beta-site on 3-hydroxypentanoyl-CoA, generating 3-hydroxy-3-methylbutanoyl-CoA, and enoyl-CoA hydratase converts 3-hydroxy-3-methylbutanoyl-CoA to 3-methylcrotonyl-CoA.

    [0145] The non-decarboxylative Claisen condensation between primer acetyl-CoA, similar to propionyl-CoA required in the above described pathway, and extender unit glycolyl-CoA, and the subsequent beta-reduction by hydroxyacyl-CoA dehydrogenase have been in vivo demonstrated in E. coli. MG1655(DE3) ΔglcD (glcD gene encoding a subunit of glycolate oxidase was deleted to block degradation of glycolic acid) strain overexpressing thiolase BktB (AAC38322.1) from Ralstonia eutropha, hydroxyacyl-CoA dehydrogenase PhaB1 (P14697.1) from R. eutropha, enoyl-CoA hydratase PhaJ (032472.1) from Aeromonas caviae and enoyl-CoA reductase TdTer (4GGO_A) from Treponeina denticola along with activation enzyme Pct, which was supposed to produce 4-hydroxybutyric acid through reverse beta-oxidation pathway starting from non-decarboxylative Claisen condensation between primer glycolyl-CoA and extender unit acetyl-CoA, was also found to produce 2,3-dihydroxybutyric acid detected by GC-MS, after 96 h growth under 30° C. in LB supplemented with glucose and glycolic acid. The GC-MS chromatogram showing the peak of 2,3-dihydroxybutyric acid is shown in FIG. 19. This result indicates that thiolase BktB can accept glycolyl-CoA as extender unit and acetyl-CoA as primer in the condensation, generating 2-hydroxy-3-oxobutanoyl-CoA, and PhaB 1 can reduce 2-hydroxy-3-oxobutanoyl-CoA to 2,3-dihydroxybutanoyl-CoA, which is hydrolyzed to 2,3-dihydroxybutyric acid by native E. coli enzymes.

    [0146] In the strain producing 2,3-dihydroxybutyric acid, genes encoding BktB, PhaB1 and PhaJ were overexpressed from pET-P1-bktB-phaB1-P2-phaJ and genes encoding Pct and TdTer were over expressed from pCDF-P1-pct-P2-tdter, as shown in Table Q, along with primer sequences required for construction of these plasmids. The genes used for 2,3-dihydroxybutyric acid production were were codon optimized and synthesized by either GeneArt or GenScript, except bk and phaB1, which were amplified from the genomic DNA of R. eutropha, and pet, which was amplified from the genomic DNA of M. elsdenii. To construct pET-P1-bktB-phaB1-P2-phaJ, the gene insert encoding phaJ was amplified with phaJ-f1/phaJ-r1 and inserted into pETDuet-1 cleaved by NdeI through In-Fusion HD Eco-Dry Cloning system to generate pET-P2-phaJ. Then, the gene insert encoding BktB was PCR amplified with bktB-f1/bktB-r1 and inserted into pET-P2-phaJ cleaved by NcoI and EcoRI through In-Fusion HD Eco-Dry Cloning system to generate pET-P1-bktB-P2-phaJ. Then, the gene insert encoding PhaB1 was PCR amplified with phaB1-f1phaB 1-r1 primers and inserted into vector pET-P1-bktB-P2-phaJ cleaved by EcoRI through In-Fusion HD Eco-Dry Cloning system to generate pET-P1-bktB-phaB1-P2-phaJ. To construct pCDF-P1-pct-P2-tdter, the gene encoding TdTer was was amplified with tdter-f1/tdter-r1 and inserted into pCDFDuet-1 cleaved by NdeI through In-Fusion HD Eco-Dry Cloning system to generate pCDF-P2-tdter. Then, the gene insert encoding pct was PCR amplified with pct-f1/pct-r1 primers and inserted into vector pCDF-P2-tdter cleaved by NcoI and EcoRI through In-Fusion HD Eco-Dry Cloning system to generate pCDF-P1-pct-P2-tdter. The sequences of required primers can be seen in Table Q. The sequences of constructed plasmids were further confirmed by DNA sequencing. Then, the sequence confirmed plasmids were introduced to competent cells of the host strain.

    [0147] Fermentations for 2,3-dihydroxybutric acid production were conducted in 250 mL Erlenmeyer Flasks filled with 50 mL LB media supplemented with 10 g/L glucose and appropriate antibiotics. A single colony of the desired strain was cultivated overnight (14-16 h) in LB medium with appropriate antibiotics and used as the inoculum (2%). After inoculation, cells were cultivated at 30° C. and 250 rpm in a NBS 124 Benchtop Incubator Shaker (New Brunswick Scientific Co., Inc., Edison, N.J.) until an optical density of ˜0.8 was reached, at which point IPTG (0.1 mM) and neutralized glycolic acid (40 mM) were added. Flasks were then incubated under the same conditions for 96 hours.

    [0148] Besides above pathways, there is also a novel pathway of GPP synthesis employing beta-oxidation reversal without usage of methyl-group transferring muase and via 3-methyl-3-butenol (isoprenol) instead of prenol. This pathway starts from non-decarboxylative Claisen condensation between glycolyl-CoA, which serves as the primer, and propionyl-CoA, which serves as the extender unit, catalyzd by thiolase. In this pathway, propionyl-CoA is activated from propionic acid, which is either supplemented or synthesized through overexpressed native pathway of conversion of succinate to propionic acid, while glycolyl-CoA is activated from glycolic acid, which is either supplemented or synthesized through overexpressed native pathway of conversion of glyoxylate, the intermediate of glyoxylate shunt, to glycolic acid. The activations of both propionic acid and glycolic acid are catalyzed by Pct. After three beta-reduction steps catalyzed by hydroxyacyl-CoA dehydrogenase, enoyl-CoA hydratase and enoyl-CoA reductases, 4-hydroxy-2-methylbutanoyl-CoA is generated. 4-hydroxy-2-methylbutanoyl-CoA is converted to 2-methyl-1,4-butanediol by alcohol-forming acyl-CoA reductase or aldehyde forming acyl-CoA reductase and alcohol dehydrogenase or carboxylate reductase and the hydrolysis enzyme selected from the group consisting thioesterase, acyl-CoA synthase, acyl-CoA transferase and carboxylate kinase plus phosphotransacylase. Then, an alcohol dehydratase converts 2-methyl-1,4-butanediol to 3-methyl-3-butenol (isoprenol). Isorenol is then converted to IPP by one or two steps of phosphorylation. If phosphorylated by two steps, the first step is catalyzed by E. coli alcohol kinase YchB (NP_415726.1) and the second step is catalyzed by M. thermautotrophicus phosphate kinase MtIPK (AAB84554.1) or Thermoplasma acidopilum phosphate kinase ThaIPK (WP_010900530.1) or Methanocaldocldococcus jannaschii phosphate kinase MjIPK (3K4Y_A). The one step phosphorylation is catalyzed by alcohol diphosphokinase. E. coli isopentenyl pyrophosphate isomerase Idi (NP_417365.1) converts DMAPP to IPP. DMAPP and IPP are condensed to GPP catalyzed by E. coli GPP synthase IspA (NP_414955.1, S80F) or A. grand's GPP synthase GPPS2 (AAN01134.1, N-terminal 84 aa truncation). Ocimum basilicum geraniol stynthase GES (AR11765.1, N-terminal 65 aa truncation) converts GPP to geraniol, the proxy product for the synthesis pathway. For this pathway, JST06(DE3) serves as the E. coli host strain for demonstration. Vector creation, strain creation, growth and analysis of supernatant are conducted as described above.

    (Prophetic) GPP Biosynthesis Via 2-hydroxyisovaleric Acid and Prenol Starting from Decarboxylative Acyloin Condensation Between Two Pyruvates

    [0149] The purpose of this example is to demonstrate the biosynthesis of GPP through a novel pathway that starts from decarboxylative acyloin condensation between two pyruvates 2-hydroxyisovaleric acid and prenol, using E. coli as the host organism. This pathway starts from decarboxylative acyloin condensation of two pyruvates to (S)-2-acetolactone by B. subtilis acetolactate synthase AlsS (NP_391482.2). E. coli acetohydroxy acid isomeroreductase IlvC (NP_418222.1) converts (S)-2-acetolactone to (2R)-2,3-dihydroxy-3-methylbutyric acid. E. coli dihydroxy acid dehydratase IIvD (YP_026248.1) dehydrates (2R)-2,3-dihydroxy-3-methylbutanoate to 3-methyl-2-oxobutyric acid (2-oxoisovaleric acid). Then, L. lactis 2-hydroxyacid dehydrogenase PanE (AIS03659.1) reduces 2-oxoisovaleric acid to (2R)-3-methyl-2-hydroxybutyric acid (2-hydroxyisovaeleric acid). 2-hydroxyisovaleric acid is then activated to (2R)-3-methyl-2-hydroxybutanoyl-CoA (2-hydroxyisovaleryl-CoA) by acyl-CoA transferase selected from the group consisting M. elsdenii Pct (BAU59368.1) and C. propionicum Pct540 (CAB77207.1, with V193A mutation to enhance the expression in E. coli, Choi et al. 2016). 2-hydroxyisovaleryl-CoA can be directly dehydrated to 3-methyl-2-butenoyl-CoA (3-methylcrotonyl-CoA) by C. difficile 2-hydroxyacyl-CoA dehydratase HadBCI (AJP10092.1, AJP10093.1, AJP10091.1 or C. propionicum 2-hydroxyacyl-CoA dehydratase LcdABC (G3KIM4.1, G3KIM3.1, G3KIM5.1. HadBCI is originally a 2-hydroxyisocaproyl-CoA dehydratase. Kim et al. 2005). LcdABC is originally a lactonyl-CoA dehydratase. (Hofmeister et al. 1992).

    [0150] 2-hydroxyisovaleryl-CoA can also be converted to 3-methylcrotonyl-CoA by a multi-step pathway. In that pathway, 2-hydroxyisovaleryl-CoA is first reduced to (2R)-3-methyl-1,2-butanediol catalyzed by alcohol-forming acyl-CoA reductase or aldehyde forming acyl-CoA reductase and alcohol dehydrogenase or carboxylate reductase and the hydrolysis enzyme selected from the group consisting thioesterase, acyl-CoA synthase, acyl-CoA transferase and carboxylate kinase plus phosphotransacylase. (2R)-3-methyl-1.2-butanediol is dehydrated to 3-methylbutanal by diol dehydratase which is then converted to isovaleryl-CoA by aldehyde-forming acyl-CoA reductase. Isovaleryl-CoA is converted to 3-methylcrotonyl-CoA by P. aeruginosa acyl-CoA dehydrogenase acyl-CoA dehydrogenase LMA (APJ52511.1).

    [0151] 3-methylcrotonyl-CoA is converted to prenol by alcohol-forming acyl-CoA reductase or aldehyde forming acyl-CoA reductase and alcohol dehydrogenase or carboxylate reductase and the hydrolysis enzyme selected from the group consisting thioesterase, acyl-CoA synthase, acyl-CoA transferase and carboxylate kinase plus phosphotransacylase. Alcohol-forming acyl-CoA reductase is selected from the group consisting C. acetobutylicum AdhE2 (YP_009076789.1) and M. aquaeolei VT8 Maqu_2507 (YP_959769.1). CbjALD from C. beijerinckii aldehyde forming acyl-CoA reductase (AAT66436.1) is selected for conversion of 3-methylcrotonyl-CoA to prenol. Alcohol dehydrogenase is selected from the group consisting E. coli YahK (NP_414859.1), E. coli YjgB (NP_418690.4) and Acinetobacter sp. ChnD (BAC80217.1).

    [0152] In another route, 2-hydroxyisovaleric acid is dehydrated to 3-methylcrotonic acid by 2-hydroxyacid dehydratase. 3-methylcrotonic acid is either activated to 3-methylcrotonyl-CoA, which is then converted to prenol by alcohol-forming acyl-CoA reductase or aldehyde forming acyl-CoA reductase and alcohol dehydrogenase, or directly converted to prenol by two step reductions by carboxylate reductase and alcohol dehydrogenase. Prenol is then converted to DMAPP by one or two steps of phosphorylation. If phosphorylated by two steps, the first step is catalyzed by E. coli alcohol kinase YchB (NP_415726.1) or Thermoplasma acidophilum phosphate kinase ThaIPK (WP_010900530.1, V73I, Y141V and K204G mutations to increase specificity on prenol. Liu et al. 2016) and the second is by M. thermautorophicus phosphate kinase MtIPK (AAB84554.1). The one step phosphorylation is catalyzed by alcohol diphosphokinase. E. coli isopentenyl pyrophosphate isomerase Idi (NP_417365.1) converts DMAPP to IPP. DMAPP and IPP are condensed to GPP catalyzed by E. coli GPP synthase IspA (NP_414955.1, S80F) or A. grandis GPP synthase GPPS2 (AAN01134.1, N-terminal 84 aa truncation). Ocimum basilicum geraniol stynthase GES (AR11765.1, N-terminal 65 aa truncation) converts GPP to geraniol, the proxy product for the synthesis pathway. Because 2-hydroxyacyl-CoA dehydratase is oxygen-sensitive, the strain harboring this pathway is grown under microaerobic or anoxic or anaerobic conditions.

    [0153] As above, JST06(DE3) serves as the E. coli host strain for demonstration of novel pathway. The genes for overexpression are either cloned into appropriate vectors or inserted into chromosome with strong synthetic constitutive promoter M1-93, as described in the previous example. Transformed cells are grown, and supernatant analyzed, also as described in the previous example.

    [0154] Among above enzymes, as mentioned in the previous example, the in vitro activities of acyl-CoA reductases CbjALD and Maqu_2507 on reduction of 3-methylcrotonyl-CoA and the in vitro activities of alcohol dehydrogenases ChnD, YjgB and YahK on oxidization of prenol have been proven through enzymatic spectrophotometric assay. E. coli alcohol dehydrogenases FucO (NP_417279.2), YqhD (NP_417484.1), YiaY (YP_026233.1) were also assayed on prenol, but as mentioned above, they did not show the activity on prenol oxidization. The results of assays on alcohol dehydrogenases can be seen in Table P, and the results of assays on acyl-CoA reductases and relevant enzyme preparation and assay methods are described in the previous example.

    [0155] The in vitro activities of acyl-CoA transferases Pct and Pct540 on activation of 2-hydroxyisovaleric acid to 2-hydroxyisovaleryl-CoA have also been proven through enzymatic spectrophotometric assay.

    [0156] Genes encoding Pct540 was codon optimized and synthesized by GeneArt. The gene encoding Pct was PCR amplified from the genomic DNA of M. elsdenii. The primers required for cloning of these genes are listed in Table R. The pet gene insert was PCR amplified from the genomic DNA of Megasphaera elsdenii with pct-f2 and pct-r2 primers and inserted into vector pUCBB-ctH6-eGFP (Vick et al. 2011) cleaved by BglII and XhoI through In-Fusion HD Eco-Dry Cloning system to construct pUCBB-ctH6-pct. The sequence of the pct gene insert was further confirmed by DNA sequencing. The protein was expressed with a c-terminal 6 His-tag.

    [0157] The codon-optimized pct540 gene insert was PCR amplified with pct540-f1 and pct540-r1 primers and inserted into vector pTrcHis2A (Invitrogen, Carlsbad, Calif.) cleaved by NcoI and SalI through In-Fusion HD Eco-Dry Cloning system to construct pTH-ctH6-pct540. The sequence of the pc1540 gene insert was further confirmed by DNA sequencing. The protein was expressed with a c-terminal 6 His-tag. The sequence-confirmed plasmids were introduced into BL21(DE3) (Studier et al. 1986).

    [0158] For expression of enzymes, cultures were grown in 25 mL of LB media in 125 mL flasks (Wheaton Industries, Inc., Millville, N.J.) at 37° C. A single colony of the desired strain was cultivated overnight (14-16 hrs) in 10 mL, of LB medium in baffled flasks (Wheaton Industries, Inc., Millville, N.J.) with appropriate antibiotics and used as the inoculum (3%). Except for the expression of pct, the cells were induced with 0.1 mM IPTG at an OD550˜0.6, while pct was expressed constitutively.

    [0159] After post-induction growth for 16 hours, the cells were collected and washed twice by 9 g/L sodium chloride solution. Cells were then re-suspended in lysis buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 10 mM imidazole, pH 8.0) to an OD ˜40. After re-suspension, the cells were disrupted using glass beads and then centrifuged at 4° C., 13000 g, 10 min in an Optima L-80XP Ultracentrifuge (Beckman-Coulter, Schaumburg, Ill.). The resultant supernatant is the crude enzyme extract. The His-tagged enzymes were then purified from crude extract by using Ni-NTA spin kit (Qiagen, Valencia, Calif.). The crude extracts are centrifuged (270 g, 5 mM) in spin columns that were equilibrated with lysis buffer and then washed twice by wash buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 20 mM imidazole, pH 8.0). After washing, the enzyme was eluted twice in elution buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 500 mM imidazole, pH 8.0). Both washing and elution steps are centrifuged at 890 g for 2 min. The purified enzyme extracts were then further concentrated and dialyzed through Amicon® Ultra 10K Device (Millipore, Billerica, Mass.). The enzymes were first filtered by centrifugation at 4° C., 14000 g, 10 min, and then washed with 100 mM potassium phosphate, pH 7 buffer under the same centrifugation conditions. Finally, the concentrated and dialyzed enzymes were recovered through 4° C., 1000 g, 2 min centrifugation. The protein concentration was established using the Bradford Reagent (Thermo Scientific, Waltham, Mass.) using BSA as the protein standard. SDS-PAGE monitor of purified proteins was performed through XCell SureLock' Mini-cell system (Invitrogen, Carlsbad, Calif.) with gels (12% acrylamide resolving gel and 4% acrylamide stacking gel) prepared through SureLock™ Mini-cell system (Invitrogen, Carlsbad, Calif.). The composition of the running buffer for SDS-PAGE was 3 g/L tris base, 14.4 g/L glycine and 1 g/L SDS in water.

    [0160] Enzymatic reactions were monitored on either a Synergy HT plate reader (BioTek Instruments, Inc., Winooski, Vt.) or a Biomate 5 Spectrophotometer (Thermo Scientific, Waltham, Mass.) according to established protocols.

    [0161] Measurement of acyl-CoA transferase activity was conducted in a two-step reaction in which the residual amount of acetyl-CoA after incubation of the enzyme with the substrate of interest was measured. Each assay was carried out in 100 mM Tris-HCL (pH 7.4). First, 0.1 mM acetyl-CoA and 1 or 10 mM of the substrate was incubated with purified enzyme for 15 min at 30° C. After denaturation of the enzyme (90 s at 95° C.), 0.1 mM oxaloacetate, 5 μg citrate synthase and 0.5 mM DTNB were added, and the reaction was further incubated for 15 min at 30° C. The amount of generated CoASH was determined by measuring the absorbance at 412 nm.

    [0162] Pct and Pct540 were assayed on CoA transfer from acetyl-CoA to three different substrates: original substrate propionic acid, 2-hydroxyisovaleric acid and 3-methylcrotonic acid, which are required for this novel GPP synthesis pathway. The results of activation of different substrates by Pct and Pct540 are shown in FIG. 20. Pct and Pct540 were shown to have slight activity towards 3-methylcrotonic acid. These enzymes have higher activity towards 2-hydroxyisovaleric acid, and the activity of Pet is higher than that of Pct540, though their activities on 2-hydroxyisovaleric acid are lower than those on original substrate propionic acid. Thus, Pct and Pct540 are suitable acyl-CoA transferases for activation of 2-hydroxyisovaleric acid.

    [0163] Also, JST06(DE3) strain overexpressing B. militias acetolactate synthase AlsS, E. coli acetohydroxy acid isomeroreductase IlvC, E. coli dihydroxy acid dehydratase IlvD and Lactococcus locus 2-hydroxyacid dehydrogenase PanE—the enzymes of first four steps of the pathway—have been grown in shake flasks with 20 mL LB-like MOPS supplemented with 20 g/L glycerol or 32 g/L glucose (55 g/L CaCO.sub.3 was also added when glucose was used) for 48 hours under 37° C. with 5 μM IPTG induction. The genes encoding AlsS, IlvC, IlvD and PanE were expressed from the plasmid pET-P1-ilvC-ilvD-P2-aisS-panE. The genes encoding AlsS and PanE were codon optimized and synthesized by either GeneArt or GenScript, while the genes encoding IlvC and IlvD were amplified from genomic DNA of wild type E. coli MG1655 strain. The plasmids used for the construction of plasmid are listed in Table R. The codon-optimized alsS and panE gene inserts were PCR amplified with alsS-f1/alsS-r1 and panE-f1/panE-r1 primers respectively, and inserted together into vector pETDuet-1 cleaved by NdeI through In-Fusion HD Eco-Dry Cloning system, resulting in pET-P2-alsS-panE plasmid. The ilvC and ilvD gene inserts were PCR amplified from the genomic DNA of E. coli with ilvC-f1/ilvC-r1 and ilvD-f1/ilv-r1 primers respectively, and inserted together into vector pET-P2-alsS-panE cleaved by NcoI and EcoRl through In-Fusion HD Eco-Dry Cloning system, generating pET-P1-ilvC-ilvD-P2-alsS-panE. The sequences of constructed plasmids are further confirmed by DNA sequencing. The quantification of 2-hydroxyisovaleric acid was performed via ion-exclusion HPLC using a Shimadzu Prominence SIL 20 system (Shimadzu Scientific Instruments, Inc., Columbia, MD) equipped with an HPX-87H organic acid column (Bio-Rad, Hercules, CA) with operating conditions to optimize peak separation (0.3 mL/min flow rate, 30 mM H2504 mobile phase, column temperature 42° C.). Concentration of 2-hydroxyisovaleric acid in fermentation samples was determined through calibration to known 2-hydroxyisovaleric acid standards (5, 1, 0.5, 0.2 and 0.1 g/L).

    [0164] As shown in FIG. 21, this strain shows high production of 2-hydroxyisovaleric acid, especially when glucose was used as carbon source, in which the titer was 8.27 g/L. This indicates that AIsS, IlvC, IlvD and PanE can supply 2-hydroxyisovaleric acid with high flux, providing sufficient intermediates supply for the subsequent conversion into prenol and GPP.

    [0165] Plasmids containing the codon optimized gene encoding 6× HIS-tagged Lmo1179 and PddABC were constructed. The resulting construct was transformed into E. coli BL21(DE3) for expression. The resulting strain was cultured in 50 mL of TB media containing appropriate antibiotics in a 250 mL flask. When the culture reached an 0D550 of approximately 0.6, expression was induced by the addition of 0.1 mM IPTG, and the cells were harvested by centrifugation after overnight incubation at room temperature.

    [0166] The HIS-tagged Lmo1179 protein was purified from the cell extract using Talon Metal Affinity Resin (Clontech lab., Calif.). In short, a 250 μL resin bed was equilibrated twice using 2.5 mL of a buffer containing 50 mM sodium phosphate, 300 mM NaCl, and 10 mM imidazole at pH 7.5 (NPI-10). The cell extract was added to the resin and the mixture shaken gently for 20 minutes on ice. The resin was then washed twice with 2.5 mL buffer NPI-20 (same as NPI-10 but with 20 mM imidazole), shaking gently on ice for 15 minutes each wash. The resin was then transferred to a gravity column and washed once with 1.25 mL NPI-20. Finally, the desired protein was eluted using 1.25 mL of buffer NPI-250 (same as buffer NPI-10 but with 250 mM imidazole), and the eluate collected in 500 μL fractions.

    [0167] Clarified cell lysates of BL21(DE3) strain overexpressing His-tagged PddABC was prepared by resuspending a saved pellet in 50 mM potassium phosphate buffer pH 7.5 containing 0.2 M ethylene glycol. The resuspened cells were broken by glass beads and supernatant was reserved after centrifugation. Assays were performed by coupling the dehydration of ethylene glycol to acetaldehyde to acyl-CoA reductase Lmo1179 to give acetyl-CoA with the reduction of NAD.sup.+ to NADH, which was monitored at 340 nm. The final assay mixture was 250 μL and contained 50 mM potassium phosphate buffer pH 7.5, 5 mM CoASH. 0.5 mM NAD.sup.+, 0.2 M ethylene glycol, 7 μL purified Lmo1179, 50 μL cell lysate, and 15 μM coenzyme B12 (the cofactor of PddABC). The relevant controls included were no cell lysates (replaced with 50 μL of buffer) and no coenzyme B12.

    [0168] The in vitro activity of dehydration of ethylene glycol to acetaldehyde by diol dehydratae PddABC (AFJ04717.1, AFJ04718.1, AFJ04719.1) from Klebsiella oxytoca has been proven, as shown in FIG. 22. This assay was coupled with oxidization of resultant acetaldehyde to acetyl-CoA by Listeria monocytogenes acyl-CoA reductase (ACR) Lino1179 (CAC99257.1) and the activity was measured through observation of increased NADH absorbance. Based on these results, PddABC should be a good candidate of diol dehydratase for dehydration of (2R)-3-methyl-1,2-butanediol required for GPP synthesis pathway.

    (Prophetic) GPP Biosynthesis Via 2-hydroxyisovaleric Acid and Prenol Starting from Aldol Condensation Between Acetaldehyde and Pyruvate

    [0169] The purpose of this experiment is to demonstrate the biosynthesis of GPP through a novel pathway that starts from aldol condensation between pyruvate and acetaldehyde via 2-hydroxyisovaleric acid and prenol, using E. coli as the host organism. This pathway starts from aldol condensation between pyruvate and acetaldehyde to (S)-4-hydroxy-2-oxopentaonoic acid by E. coli aldolase MhpE (NP_414886.1). Acetaldehyde is supplied either through decarboxylation of pyruvate by Saccharomyces cerevisiae alpha-keto acid decarboxylase PDC1 (CAA97573.1) or through reduction of acetyl-CoA by E. coli aldehyde forming acyl-CoA reductase MhpF (NP_414885.1). Then, a mutase moves the—(C═O)COOH group of (S)-4-hydroxy-2-oxopentaonic acid from C-3 site to C-4 site, forming 3-hydroxy-2-oxo-3-methylbutyric acid. 2-hydroxyacid dehydrogenase converts 3-hydroxy-2-oxo-3-methylbutyric acid to (2R)-2,3-dihydroxy-3-methylbutyric acid. E. coli dihydroxy acid dehydratase IlvD (YP_026248.1) dehydrates (2R)-2,3-dihydroxy-3-methylbutanoate to 3-methyl-2-oxobutyric acid (2-oxoisovaleric acid). Then, L. lactis 2-hydroxyacid dehydrogenase PanE (AIS03659.1) reduces 2-oxoisovaleric acid to (2R)-3-methyl-2-hydroxybutyric acid (2-hydroxyisovaeleric acid). 2-hydroxyisovaleric acid is then activated to (2R)-3-methyl-2-hydroxybutanoyl-CoA (2-hydroxyisovaleryl-CoA) by acyl-CoA transferase selected from the group consisting M elsdenii Pct (BAU59368.1) and C. propionicwn Pct540 (CAB77207.1, with V193A mutation to enhance the expression in E. coil, Choi et al. 2016). 2-hydroxyisovaleryl-CoA can be directly dehydrated to 3-methyl-2-butenoyl-CoA (3-methylcrotonyl-CoA) by C. difficile 2-hydroxyacyl-CoA dehydratase HadBCI (AJP10092.1, AJP10093.1, AJP10091.1. HadBCI is originally a 2-hydroxyisocaproyl-CoA dehydratase. Kim et al. 2005) or C. propionicum 2-hydroxyacyl-CoA dehydratase LcdABC (G3KIM4.1, G3KIM3.1, G3KIM5.1. LcdABC is originally a lactonyl-CoA dehydratase, Hofmeister et al. 1992). 2-hydroxyisovaleryl-CoA can also be converted to 3-methylcrotonyl-CoA by a multi-step pathway.

    [0170] In that pathway, 2-hydroxyisovaleryl-CoA is first reduced to (2R)-3-methyl-1,2-butanediol catalyzed by alcohol-forming acyl-CoA reductase or aldehyde forming acyl-CoA reductase and alcohol dehydrogenase or carboxylate reductase and the hydrolysis enzyme selected from the group consisting thioesterase, acyl-CoA synthase, acyl-CoA transferase and carboxylate kinase plus phosphotransacylase. (2R)-3-methyl-1,2-butanediol is dehydrated to 3-methylbutanal by diol dehydratase which is then converted to isovaleryl-CoA by aldehyde-forming acyl-CoA reductase. Isovaleryl-CoA is converted to 3-methylcrotonyl-CoA by P. aeruginosa acyl-CoA dehydrogenase acyl-CoA dehydrogenase LiuA (APJ52511.1). 3-methylcrotonyl-CoA is converted to prenol by an alcohol-forming acyl-CoA reductase or aldehyde forming acyl-CoA reductase and alcohol dehydrogenase or carboxylate reductase and the hydrolysis enzyme selected from the group consisting thioesterase, acyl-CoA synthase, acyl-CoA transferase and carboxylate kinase plus phosphotransacylase. Alcohol-forming acyl-CoA reductase is selected from the group consisting C. acetobutylicum AdhE2 (YP_009076789.1) and M. aquaeolei VT8 Maqu_2507 (YP_959769.1). CbjALD from C. beijerinckii aldehyde forming acyl-CoA reductase (AAT66436.1) is selected for conversion of 3-methylcrotonyl-CoA to prenol. Alcohol dehydrogenase is selected from the group consisting E. coli YahK (NP_414859.1), E. coli YjgB (NP_418690.4) and Acinetobacter sp. ChnD (BAC80217.1).

    [0171] In another route, 2-hydroxyisovaleric acid is dehydrated to 3-methylcrotonic acid by 2-hydroxyacid dehydratase. 3-methylcrotonic acid is either activated to 3-methylcrotonyl-CoA, which is then converted to prenol by alcohol-forming acyl-CoA reductase or aldehyde forming acyl-CoA reductase and alcohol dehydrogenase, or directly converted to prenol by two step reductions by carboxylate reductase and alcohol dehydrogenase. Prenol is then converted to DMAPP by one or two steps of phosphorylation. If phosphorylated by two steps, the first step is catalyzed by E. coli alcohol kinase YchB (NP_415726.1) or Thermoplasma acidophilum phosphate kinase ThaIPK (WP_010900530.1, V73I, Y141V and K204G mutations to increase specificity on prenol. Liu et al. 2016) and the second is by M. thermautotrophicus phosphate kinase MtIPK (AAB84554.1). The one step phosphorylation is catalyzed by alcohol diphosphokinase. E. coli isopentenyl pyrophosphate isomerase Idi (NP_417365.1) converts DMAPP to IPP. DMAPP and IPP are condensed to GPP catalyzed by E. coli GPP synthase IspA (NP_414955.1, S80F) or A. grandis GPP synthase GPPS2 (AAN01134.1, N-terminal 84 aa truncation). Ocimum basilicum geraniol stynthase GES (AR11765.1, N-terminal 65 aa truncation) converts GPP to geraniol, the proxy product for the synthesis pathway. Because 2-hydroxyacyl-CoA dehydratase is oxygen-sensitive, the strain harboring this pathway is grown under microaerobic or anoxic or anaerobic conditions.

    [0172] JST06(DE3) serves as the E. coli host strain for demonstration of this novel pathway. Vector creation, strain creation, growth and analysis of supernatant are as described above in previous examples.

    [0173] Among above enzymes, as mentioned in the previous example, The in vitro activities of acyl-CoA transferases Pct and Pct540 on activation of 2-hydroxyisovaleric acid to 2-hydroxyisovaleryl-CoA, the in vitro activities of acyl-CoA reductases CbjALD and Maqu 2507 on reduction of 3-methylcrotonyl-CoA and the in vitro activities of alcohol dehydrogenases ChnD, YjgB and YahK on oxidization of prenol have been proven through enzymatic spectrophotometric assay. E. coli alcohol dehydrogenases FucO (NP_417279.2), YqhD (NP_417484.1), YiaY (YP_026233.1) were also assayed on prenol, but as mentioned above, they did not show the activity on prenol oxidization. The results of assays on alcohol dehydrogenases and acyl-CoA transferases can be seen in Table R and FIG. 20 respectively, and the results of assays on acyl-CoA reductases and relevant enzyme preparation and assay methods are described in the previous example.

    [0174] The in vitro activity of dehydration of ethylene glycol to acetaldehyde by diol dehydratae PddABC (AFJ04717.1, AFJ04718.1, AFJ04719.1) from Klebsiella oxytoca has been proven, as shown in FIG. 22. The assay method is described in the previous examples.

    (Prophetic) GPP Biosynthesis Via 2-hydroxyisovaleryl-COA and Prenol Starting from Non-decarboxylative Acyloin Condensation between Isobutanal and Formyl-COA

    [0175] The purpose of this experiment is to demonstrate the biosynthesis of GPP through a novel pathway that starts from non-decarboxylative acyloin condensation between formyl-CoA and isobutanal via 2-hydroxyisovaleryl-CoA and prenol, using E. coli as the host organism. This pathway starts from non-decarboxylative acyloin condensation between isobutanal and formyl-CoA to (2R)-3-methyl-2-hydroxybutanoyl-CoA (2-hydroxyisovaleryl-CoA) by Homo sapiens 2-hydroxyacyl-CoA lyase HACL1 (NP_036392.2). Formyl-CoA is activated from formate, which is a byproduct of conversion of pyruvate to acetyl-CoA by E. coli pyruvate-formate lyase P11B (NP_415423.1), catalyzed by activation enzymes selected from the group consisting acyl-CoA synthase, acyl-CoA transferase, carboxylate kinase plus phosphotransacylase. Isobutanal is reduced from isobutyryl-CoA by aldehyde forming acyl-CoA reductase. Isobutyryl-CoA is converted from butyryl-CoA by mutase. Butyryl-CoA can be supplied from butyric acid, either supplemented or intracellularly synthesized through beta-oxidation reversal starting from two acetyl-COAs composed of ketoacyl-CoA thiolase BktB (AAC38322.1) from R. eutropha or thiolase AtoB (NP_416728.1) from E. coli, hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase multifunctional enzyme FadB from E. coli (NP_418288.1) and enoyl-CoA reductase EgTer from E. gracilis (Q5EU90.1) or fatty acid biosynthesis pathway starting from acetyl-CoA and malonyl-CoA composed of beta-ketoacyl-ACP synthase FabH (NP_415609.1), beta-ketoacyl-ACP reductase FabG (NP_415611.1), 3-hydroxyacyl-ACP dehydratase FabZ (NP_414722.1) and enoyl-ACP reductase FabI (NP_415804.1), all from E. coli, with termination by E. coli thioesterase TesA (NP_415027.1, with truncation of 26 aa leader sequence) and activation by E. coli acyl-CoA synthetase FadD (NP_416319.1), or directly synthesized through overexpressed beta-oxidation reversal pathway without termination. If malonyl-CoA is used to enhance its supply, E. coli acetyl-CoA carboxylase AccABCD (NP_414727.1, NP_417721.1, NP_417722.1, NP_416819.1) is overexpressed.

    [0176] 2-hydroxyisovaleryl-CoA can be directly dehydrated to 3-methyl-2-butenoyl-CoA (3-methylcrotonyl-CoA) by C. difficile 2-hydroxyacyl-CoA dehydratase HadBCI (AJP10092.1, AJP10093.1, AJP10091.1. HadBCI is originally a 2-hydroxyisocaproyl-CoA dehydratase. Kim et al. 2005) or C. propionicum 2-hydroxyacyl-CoA dehydratase LcdABC (G3KIM4.1, G3KIM3.1, G3KIM5.1. LcdABC is originally a lactonyl-CoA dehydratase. Hofmeister et al. 1992). 2-hydroxyisovaleryl-CoA can also be converted to 3-methylcrotonyl-CoA by a multi-step pathway. In that pathway, 2-hydroxyisovaleryl-CoA is first reduced to (2R)-3-methyl-1,2-butanediol catalyzed by alcohol-forming acyl-CoA reductase or aldehyde forming acyl-CoA reductase and alcohol dehydrogenase or carboxylate reductase and the hydrolysis enzyme selected from the group consisting thioesterase, acyl-CoA synthase, acyl-CoA transferase and carboxylate kinase plus phosphotransacylase. (2R)-3-methyl-1,2-butanedial is dehydrated to 3-methylbutanal by diol dehydratase which is then converted to isovaleryl-CoA by aldehyde-forming acyl-CoA reductase. Isovaleryl-CoA is converted to 3-methylcrotonyl-CoA by P. aeruginosa acyl-CoA dehydrogenase acyl-CoA dehydrogenase LiuA (APJ52511.1). 3-methylcrotonyl-CoA is converted to prenol byalcohol-forming acyl-CoA reductase or aldehyde forming acyl-CoA reductase and alcohol dehydrogenase or carboxylate reductase and the hydrolysis enzyme selected from the group consisting thioesterase, acyl-CoA synthase, acyl-CoA transferase and carboxylate kinase plus phosphotransacylase. Alcohol-forming acyl-CoA reductase is selected from the group consisting C. acetobutylicum AdhE2 (YP_009076789.1) and M. aquaeolei VT8 Maqu_2507 (YP 959769.1). CbjALD from C. beijerinckii aldehyde forming acyl-CoA reductase (AAT66436.1) is selected for conversion of 3-methylcrotonyl-CoA to prenol. Alcohol dehydrogenase is selected from the group consisting E. coli YahK (NP_414859.1), E. coli YjgB (NP_418690.4) and Acinetobacter sp. ChnD (BAC80217.1).

    [0177] Prenol is then converted to DMAPP by one or two steps of phosphorylation. If phosphorylated by two steps, the first step is catalyzed by E. coli alcohol kinase YchB (NP_415726.1) or Thermoplasma acidophilum phosphate kinase ThaIPK (WP_010900530.1, V73I, Y141V and K204G mutations to increase specificity on prenol. Liu et al. 2016) and the second is by M. thermautotrophicus phosphate kinase MtIPK (AAB84554.1). The one step phosphorylation is catalyzed by alcohol diphosphokinase. E. coli isopentenyl pyrophosphate isomerase Idi (NP_417365.1) converts DMAPP to IPP. DMAPP and IPP are condensed to GPP catalyzed by E. coli GPP synthase IspA (NP_414955.1, S80F) or A. grand's GPP synthase GPPS2 (AAN01134.1, N-terminal 84 aa truncation). Ocimum basilicum geraniol stynthase GES (AR11765.1, N-terminal 65 aa truncation) converts GPP to geraniol, the proxy product for the synthesis pathway. Because diol dehydratase is oxygen-sensitive, the strain harboring this pathway is grown under microaerobic or anoxic or anaerobic conditions.

    [0178] JST06(DE3) serves as the E. coli host strain for demonstration of this novel pathway. Vector creation, strain creation, growth and analysis of supernatant are as described above in previous examples.

    [0179] The in vivo butyryl-CoA and butyric acid synthesis through beta-oxidation reversal composed of AtoB, FadB and EgTer has been demonstrated in E. coli. JC01 (MG1655 ΔldhA ΔpoxB Δpta ΔadhE ΔfrdA, an E. coli strain with removal of mixed-acid fermentation for improved supply of acetyl-CoA), overexpressing AtoB, FadB and EgTer produced 3.3 g/L of butyric acid when grown in LB-like MOPS media with glycerol as carbon source for 48 hours, indicating that beta-oxidation reversal composed of AtoB, FadB and EgTer is functional of supplying butyric acid with acetyl-CoA as primer and extender unit, and native endogenous thioesterases are able to hydrolyze butyryl-CoA to butyric acid. Overexpression of different E. coli thoesterases FadM (NP_414977.1), TesA (NP_415027.1), TesB (NP_414986.1), YciA (NP_415769.1), Ydil (NP_416201.1) and YbgC (NP_415264.1) was added, but as seen in FIG. 23, it did not greatly improve butyric acid production. The detailed methods of fermentation conditions and HPLC analysis for butyric acid are described in previous examples.

    [0180] The vectors and primers used in overexpression of AtoB, FadB, EgTer and thioesterases are listed in Table S. The E. coli genes were PCR amplified from genomic DNA of wild type E. coli strain, while the gene encoding EgTer was codon-optimized and synthesized by GenScript. For the construction of pTH-atoB-fadB-egter, the atoB gene insert was first PCR amplified with atoB-f1/atoB-r1 primers and inserted into vector pTrcHis2A (Invitrogen, Carlsbad, Calif.) cleaved by NcoI and EcoRI through In-Fusion HD Eco-Dry Cloning system to construct pTH-atoB. Then, the fadB gene insert was PCR amplified with fadB-f1/fadB-r1 primers and inserted into vector pTH-atoB cleaved by HindIII through In-Fusion HD Eco-Dry Cloning system to generate pTH-atoB-fadB. Finally, the egter gene insert was PCR amplified with egter-f1/egter-r1 primers and inserted into vector pTH-atoB-fadB cleaved by HindIII through In-Fusion HD Eco-Dry Cloning system to generate pTH-atoB-fadB-egter. The thioesterases were overexpressed from pZS vector backbone (Invitrogen, Carlsbad, Calif.). The genes encoding thioesterases were PCR amplified with relevant primers (fadM-f1/fadM-r1, tesA-f1/tesB-r1, tesA-f1/tesA-r1, ydiI-f1/ydiI-r1, ybgC-f1/ybgC-r1, yciA-f1/yciA-r1) and inserted into pZS cleaved by KpnI and MluI through In-Fusion HD Eco-Dry Cloning system.

    [0181] The condensations between formyl-CoA and different kinds of aldehyde (pentadecanal, acetaldehyde, formaldehyde) by 2-hydroxyacyl-CoA lyase HACL 1 have been proven in vitro, as shown in FIG. 24A-D. HACL1 is a good candidate to also accept required isobutanal as the substrate for acyloin condensation.

    [0182] 2-hydroxyhexadecanoyl-CoA was prepared by the n-hydroxysuccinimide method (Blecher, 1981). In summary, the n-hydroxysuccinimide ester of 2-hydroxyhexadecanoic acid is prepared by reacting n-hydroxysuccinimide with the acid in the presence of dicyclohexylcarbodiimide. The product is filtered and purified by recrystallization from methanol to give pure n-hydroxysuccinimide ester of 2-hydroxyhexadecanoic acid. The ester is reacted with CoA-SH in presence of thioglycolic acid to give 2-hydroxyhexadecanoyl-CoA. The 2-hydroxyhexadecanoyl-CoA is purified precipitation using perchloric acid, filtration, and washing the filtrate with perchloric acid, diethyl ether, and acetone.

    [0183] Formyl-CoA was prepared by first forming formic ethylcarbonic anhydride as previously described (Parasaran & Tarbell, 1964). Briefly, formic acid (0.4 mmol) and ethyl chloroformate (0.4 mmol) were combined in 4 mL anhydrous diethyl ether and cooled to −20° C. 0.4 mmol triethylamine was added to the mixture and the reaction was allowed to proceed at −20° C. for 30 minutes. The reaction mixture was filtered over glass wool to give a solution containing formic ethylcarbonic anhydride in diethyl ether. To obtain formyl-CoA, 7 μmol CoASH was dissolved in 5 mL 3:2 water:tetrahydrofuran, to which 10 mg of sodium bicarbonate were added. The solution of formic ethylcarbonic anhydride was added dropwise to the CoASH solution with vigorous agitation, after which the organic phase was evaporated under a stream of nitrogen. The mixture was kept at 4° C. for two hours, after which any remaining diethyl ether was evaporated under nitrogen. Solid phase extraction using a C18 column was used to purify formyl-CoA from the reaction mixture. Formyl-CoA was eluted from the C18 column in methanol and stored in 2:1 methanol:ammonium acetate pH 5.5.

    [0184] The resulting cell pellet was resuspended in Bacterial Protein Extraction Reagent (B-PER) (THERMO SCIE., Mass.) to an OD550 of approximately 40, to which approximately 5000 U of lysozyme and approximately 250 U of Benzonase nuclease (Sigma-Aldrich CO., MO) were added. The cell mixture was left at room temperature until completely clarified to give the cell extract. 1 M stock solution of imidazole was added to provide a final concentration of 10 mM imidazole in the cell extract.

    [0185] A plasmid containing the codon optimized gene encoding human HIS-tagged HACLI was constructed as described. The resulting construct, was transformed into S. cerevisiae InvSC1 (Life Technologies, Carlsbad, Calif.). The resulting strain was cultured in 50 mL of SC-URA media containing 2% glucose at 30° C. for 24 hours. The cells were pelleted and the required amount of cells were used to inoculate a 250 mL culture volume of SC-URA media containing 0.2% galactose, 1 mM MgCl.sub.2, and 0.1 mM thiamine to 0.4 OD600. After 20 hours of incubation with shaking at 30° C., the cells were pelleted and saved.

    [0186] When needed, the cell pellets were resuspended to an OD600 of approximately 100 in a buffer containing 50 mM potassium phosphate pH 7.4, 0.1 mM thiamine pyrophosphate, 1 mM MgCl.sub.2, 0.5 mM AEBSF, 10 mM imidazole, and 250 units of Benzonase nuclease. To the cell suspension, approximately equal volumes of 425-600 glass beads were added. Cells were broken in four cycles of 30 seconds of vortexing at 3000 rpm followed by 30 seconds on ice. The glass beads and cell debris were pelleted by centrifugation and supernatant containing the cell extract was collected. The HIS-tagged HACL1 was purified from the cell extract using Talon Metal Affinity Resin as described above, with the only modification being the resin bed volume and all subsequent washes were halved. The eluate was collected in two 500 μL fractions.

    [0187] Human HACL1 was cloned, expressed, and purified in S. cerevisiae as described above. Purified HACL1 was tested for its native catabolic activity by assessing its ability to cleave 2-hydroxyhexadecanoyl-CoA to pentadecanal and formyl-CoA. Enzyme assays were performed in 50 mM tris-HCl pH 7.5, 0.8 mM MgCl.sub.2, 0.02 mM TPP, 6.6 μM BSA, and 0.3 mM 2-hydroxyhexadecanoyl-CoA. The assay mixtures were incubated for one hour at 37° C., after which the presence of pentadecanal was assessed by extraction with hexane and analysis by GC-FID. As shown in FIG. 24A-D, pentadecanal was produced in the sample containing HACL1, but not in the control sample, which did not contain HACL1, indicating that the protein was expressed and purified in an active form.

    [0188] The ability of purified HACL1 to run in the anabolic direction (reverse from the physiological direction) was also determined. An aldehyde and formyl-CoA were tested for ligation in a buffer comprised of 60 mM potassium phosphate pH 5.4, 2.5 mM MgCl.sub.2, 0.1 mM TPP, 6.6 μM BSA, 5 mM aldehyde, 20% DMSO, approximately 1 mM freshly prepared formyl-CoA, and approximately 0.5 mg/mL purified HACL1. The reaction was allowed to take place at room temperature for 16 hours, after which acyl-CoAs were hydrolyzed to their corresponding acids by adjusting to pH>12.0. For situations in which a short carbon chain product was expected, for example lactate production from acetaldehyde, samples were analyzed by HPLC. In the case of longer products, for example the production of 2-hydroxyhexadecanoic acid from pentadecanal, samples were acidified with HCl and extracted with diethyl ether. The extracted diethyl ether was evaporated to dryness under a stream of nitrogen and derivatized by the addition of 1:1 BSTFA: pyridine. After incubation at 70° C. for 30 min, these samples were analyzed by GC-FID.

    [0189] When the purified enzyme was supplied with pentadecanal and formyl-CoA, as in FIG. 24A-D, HACL1 was shown to catalyze the ligation of these molecules to 2-hydroxyhexadecanoyl-CoA as hypothesized. After hydrolysis of acyl-CoAs, the chromatogram of the sample containing enzyme shows similar peaks to the 2-hydroxyhexadecanoyl-CoA spiked standard, which are absent from the sample containing no enzyme.

    [0190] The purified HACL1 was further tested for activity on shorter aldehydes, such as the ligation of acetaldehyde or formaldehyde with formyl-CoA to produce lactoyl-CoA or glycolyl-CoA, respectively. After hydrolysis of acyl-COAs to their acid forms, these samples were analyzed by HPLC. The presence of lactate from elogation of acetaldehyde and formyl-CoA was identified in the sample containing HACL I, but not in the no enzyme control as shown in FIG. 24A-D. Similar results were observed for glycolate from formaldehyde and formyl-CoA as shown in FIG. 24A-D. The presence of lactate in the relevant samples was confirmed by NMR. This demonstrates that HACL1 is capable of catalyzing the ligation of aldehydes with chain lengths ranging at least from C1-C15 with formyl-CoA, making it suitable for acyloin condensation between C5 aldehyde isobutanal with formyl-CoA, required for the GPP synthesis pathway.

    [0191] Also, the required activity of activation of formate to formyl-CoA by E. coli acyl-CoA synthase ACS (NP_418493.1) was also proven in vitro as shown in FIG. 25. This assay was coupled with reduction of resultant formyl-CoA to formaldehyde by Listeria monocytogenes acyl-CoA reductase (ACR) Lmo1179 (CAC99257.1) and the activity was measured through observation of NADH oxidization.

    [0192] A plasmid containing the codon optimized gene encoding 6× HIS-tagged Lmo1179 from Lysteria monocytogenes was constructed. The resulting construct was transformed into E. coli BL21(DE3) for expression. The resulting strain was cultured in 50 mL of TB media containing appropriate antibiotics in a 250 mL flask. When the culture reached an OD550 of approximately 0.6, expression was induced by the addition of 0.1 mM IPTG, and the cells were harvested by centrifugation after overnight incubation at room temperature.

    [0193] The HIS-tagged Lmo1179 protein was purified from the cell extract using Talon Metal Affinity Resin (Clontech lab., Calif.). In short, a 250 μL resin bed was equilibrated twice using 2.5 mL of a buffer containing 50 mM sodium phosphate, 300 mM NaCl, and 10 mM imidazole at pH 7.5 (NPI-10). The cell extract was added to the resin and the mixture shaken gently for 20 minutes on ice. The resin was then washed twice with 2.5 mL buffer NPI-20 (same as NPI-10 but with 20 mM imidazole), shaking gently on ice for 15 minutes each wash. The resin was then transferred to a gravity column and washed once with 1.25 mL NPI-20. Finally, the desired protein was eluted using 1.25 mL of buffer NPI-250 (same as buffer NPI-10 but with 250 mM imidazole), and the eluate collected in 500 μL fractions.

    [0194] E. coli ACS was cloned, expressed, and purified in E. coli as described above. The purified enzyme was evaluated for its ability to convert formate into the extender unit formate. Enzyme assays were performed in 23 mM potassium phosphate buffer pH 7.0, 1 mM CoASH, 0.5 mM NADH, 5 mM ATP, 2.5 mM MgCl.sub.2, 50 mM formate. E. coli ACS was added along with Lysteria monocytogenes Lmo1179, and the reduction of resulting formyl-CoA was monitored by measuring absorbance of NADH at 340 nm. The sample containing ACS resulted in an increased rate of NADH oxidation, indicating that formyl-CoA was produced by ACS.

    [0195] Among above enzymes, as mentioned in the previous example, the in vitro activities of acyl-CoA reductases CNALD and Maqu_2507 on reduction of 3-methylcrotonyl-CoA and the in vitro activities of alcohol dehydrogenases ChnD, YjgB and YahK on oxidization of prenol have been proven through enzymatic spectrophotometric assay. E. coli alcohol dehydrogenases FucO (NP_417279.2), YqhD (NP_417484.1), YiaY (YP_026233.1) were also assayed on prenol, but as mentioned above, they did not show the activity on prenol oxidization. The results of assays on alcohol dehydrogenases can be seen in Table P, and the results of assays on acyl-CoA reductases and relevant enzyme preparation and assay methods are described in the previous example.

    [0196] The in vitro activity of dehydration of ethylene glycol to acetaldehyde by dial dehydratae PddABC (AFJ04717.1, AFJ04718.1, AFJ04719.1) from Klebsiella oxytoca has been proven, as shown in FIG. 22. The assay method is described in the previous examples.

    (Prophetic) GPP Biosynthesis Via 4-methyl-2-OXO-4-pentenoic Acid and Isoprenol Starting Aldol Condensation Between Acetaldehyde and 2-oxobutyric Acid

    [0197] The purpose of this experiment is to demonstrate the biosynthesis of GPP through a novel pathway that starts from aldol condensation between 2-oxobutyric acid and acetaldehyde via 4-methyl-2-oxo-4-pentenoic acid and isoprenol, using E. coli as the host organism. This pathway starts from aldol condensation between pyruvate and acetaldehyde to 4-hydroxy-2-oxo-3-methylpentaonoic acid by E. coli aldolase MhpE (NP_414886.1). Acetaldehyde is supplied either through decarboxylation of pyruvate by Saccharomyces cerevisiae alpha-keto acid decarboxylase PDC1(CAA97573.1) or through reduction of acetyl-CoA by E. coli aldehyde forming acyl-CoA reductase MhpF (NP_414885.1). 2-oxobutyric acid is elongated from pyruvate through alpha-keto acid pathway composed of: citramalate synthase CimA from Methanocaldococcus jannaschii (WP_010870909.1) or Leptospira interrogans serovar Lai str. 56601 (NP_712531.1); citramalate isomerase LeuCD from E. coli (NP_414614.1, NP_414613.1) or Methanocaldococcus jannaschii (AAB98487.1, AAB99283.1) or Leptospira interrogans serovar Lai str. 56601 (NP_712276.1, NP_712277.1); Methanocaldococcus jannaschii 3-methylmalate dehydrogenase MJ0720 (WP_010870225.1) or Leptospira interrogans serovar Lai str. 56601 3-methylmalate dehydrogenase LeuB (NP_712333.1).

    [0198] After the aldol condensation, a mutase transfers the methyl group of 4-hydroxy-2-oxo-3-methylpentaonoic acid from C-3 to C-4 site, generating 4-hydroxy-2-oxo-4-methylpentaonoic acid. Then, E. cob 2-oxopent-4-enoate dehydratase MhpD (NP_414884.2) dehydrates 4-hydroxy-2-oxo-4-methylpentaonoic acid into 4-methyl-2-oxo-4-pentenoic acid. 4-methyl-2-oxo-4-pentenoic acid can be converted to 3-methyl-3-butenoyl-CoA by alpha-keto acid dehydrogenase and 3-methyl-3-butenoyl-CoA is converted to isoprenol by alcohol-forming acyl-CoA reductase or aldehyde forming acyl-CoA reductase and alcohol dehydrogenase or carboxylate reductase and the hydrolysis enzyme selected from the group consisting thioesterase, acyl-CoA synthase, acyl-CoA transferase and carboxylate kinase plus phosphotransacylase. 4-methyl-2-oxo-4-pentenoic acid can also be converted to isoprenol by two steps of reactions catalyzed by alpha-keto acid decarboxylase and alcohol dehydrogenase. Alcohol-foiniing acyl-CoA reductase is selected from the group consisting C. acetobutylicum AdhE2 (YP_009076789.1) and M. aquaeolei VT8 Maqu_2507 (YP_959769.1). CbjALD from C. beijerinckii aldehyde forming acyl-CoA reductase (AAT66436.1) is selected for conversion of 3-methyl-3-butenoyl-CoA to isoprenol. Alcohol dehydrogenase is selected from the group consisting E. coli YahK (NP_414859.1), E. coli YjgB (NP_418690.4) and Acinetobacter sp. SE19 ChnD (BAC_80217.1).

    [0199] Isorenol is then converted to IPP by one or two steps of phosphorylation. If phosphorylated by two steps, the first step is catalyzed by E. coli alcohol kinase YchB (NP_415726.1) and the second is catalyzed by M. thermautotrophicus phosphate kinase MtIPK (AAB84554.1) or Thermoplasma acidophilum phosphate kinase ThaIPK (WP_010900530.1) or Methanocaldococcus jannaschii phosphate kinase MjIPK (3K4Y_A). The one step phosphorylation is catalyzed by alcohol diphosphokinase. E. coli isopentenyl pyrophosphate isomerase Idi (NP_417365.1) converts DMAPP to IPP. DMAPP and IPP are condensed to GPP catalyzed by E. coli GPP synthase IspA (NP_414955.1, S80F) or A. grandis GPP synthase GPPS2 (AAN01134.1, N-terminal 84 aa truncation). Ocimum basilicum geraniol stynthase GES (AR11765.1, N-terminal 65 aa truncation) converts GPP to geraniol, the proxy product for the synthesis pathway.

    [0200] JST06(DE3) serves as the E. coli host strain for demonstration of this novel pathway. Vector creation, strain creation, growth and analysis of supernatant are as described above in previous examples.

    (Prophetic) GPP Biosynthesis Via 2-oxoisovaleric Acid, 2-oxoisocaproic Acid and Prenol Starting from Decarboxylative Acyloin Condensation Between Two Pyruvates

    [0201] The purpose of this example is to demonstrate the biosynthesis of GPP through a novel pathway via 2-oxoisovaleric acid, 2-oxoisocaproic acid and prenol. E. coil serves as the host organism. This pathway starts from decarboxylative acyloin condensation of two pyruvates to (S)-2-acetolactone by B. subtilis acetolactate synthase AIsS (NP_391482.2). E. coli acetohydroxy acid isomeroreductase IlvC (NP_418222.1) converts (S)-2-acetolactone to (2R)-2,3-dihydroxy-3-methylbutyric acid. E. coli dihydroxy acid dehydratase IlvD (YP_026248.1) dehydrates (2R)-2,3-dihydroxy-3-methylbutanoate to 3-methyl-2-oxobutyric acid (2-oxoisovaleric acid). Then, 2-oxoisovaleric acid is elongated into 2-oxoisocaproic acid through alpha-keto acid pathway composed of: E. coli isopropylmalate synthase LeuA (NP_414616.1, with a G462D mutation to maximize 2-oxoisocaprate production and minimize 2-oxoisovalerate, Connor et al. 2008) which condenses 2-oxoisovaleric acid and acetyl-CoA to (2S)-2-isopropylmalate; E. coli isopropyl isomerase LeuCD (NP_414614.1, NP_414613.1) which converts (2S)-2-isopropylmalate to (2R, 3S)-3-isopropylmalate; E. coli isopropylmalate dehydrogenase LeuB (NP_414615.4) which oxidizes and decarboxylates (2R, 3S)-3-isopropylmalate, generating 4-methyl-2-oxopentanoic acid (2-oxoisocaproic acid). Then, S. avermitilis alpha-keto acid dehydrogenase complex BkdFGH-LpdA1 (BAC72088.1, BAC72089.1, BAC72090.1, KUN54417.1) converts 2-oxoisocaproic acid into isovaleryl-CoA. Overexpression of heterologous branched alpha-keto acid dehydrogenase complex requires improved lipoylation, which can be realized though supplementation of lipoic acid accompanied with overexpression of E. coli lipoate-protein ligase LplA (NP_418803.1), or overexpression of E. coli endogenous lipoylation pathway consisting lipolate synthase LipA (NP_415161.1) and lipoyl(octanoyl) transferase LipB (NP_415163.2). P. aeruginosa acyl-CoA dehydrogenase LiuA (APJ52511.1) converts isovaleryl-CoA to 3-methylcrotonyl-CoA. 3-methylcrotonyl-CoA is converted to prenol by alcohol-forming acyl-CoA reductase or aldehyde forming acyl-CoA reductase and alcohol dehydrogenase or carboxylate reductase and the hydrolysis enzyme selected from the group consisting thioesterase, acyl-CoA synthase, acyl-CoA transferase and carboxylate kinase plus phosphotransacylase. Alcohol-forming acyl-CoA reductase is selected from the group consisting C. acetobutylicum AdhE2 (YP_009076789.1) and M. aquaeolei VT8 Maqu_2507 (YP_959769.1). CbjALD from C. beijerinckii aldehyde forming acyl-CoA reductase (AAT66436.1) is selected for conversion of 3-methylcrotonyl-CoA to prenol. Alcohol dehydrogenase is selected from the group consisting E. coli YahK (NP_414859.1), E. coli YjgB (NP_418690.4) and Acinetobacter sp. SE19 ChnD (BAC80217.1). Prenol is then converted to DMAPP by one or two steps of phosphorylation. If phosphorylated by two steps, the first step is catalyzed by E. coli alcohol kinase YchB (NP_415726.1) or Thermoplasma acidophilum phosphate kinase ThaIPK (WP_010900530.1, V73I, Y141V and K204G mutations to increase specificity on prenol. Liu et al. 2016) and the second is by M. thertnautotrophicus phosphate kinase MtIPK (AAB84554.1). The one step phosphorylation is catalyzed by alcohol diphosphokinase. E. coli isopentenyl pyrophosphate isomerase Idi (NP_417365.1) converts DMAPP to IPP. Then, DMAPP and IPP are condensed to GPP catalyzed by E. coli GPP synthase IspA (NP_414955.1, S80F) or A. grandis GPP synthase GPPS2 (AAN01134.1, N-terminal 84 aa truncation). Ocimim basilicum geraniol stynthase GES (AR11765.1, with N-terminal 65 aa truncation) converts GPP to geraniol, which serves as a proxy to demonstrate a functioning pathway.

    [0202] JST06(DE3) serves as the E. coli host strain for demonstration of this novel pathway. Vector creation, strain creation, growth and analysis of supernatant is conducted as described in previous examples.

    [0203] The required plasmids and primers for this example are listed in Table T. The genes encoding E. coli enzymes are PCR amplified from the genomic DNA of wild type strain, while genes encoding other enzymes are codon optimized and synthesized by either GeneArt or GenScript. For construction of pET-P1-ilvC-ilvD-P2-a1sS-liuA, the codon-optimized alsS and liuA gene inserts were first PCR amplified with alsS-f1/alsS-r2 and liuA-f1/liuA-r1 primers respectively, and inserted together into vector pETDuet-1 cleaved by NdeI and KpnI through In-Fusion HD Eco-Dry Cloning system, resulting in pET-P2-aisS-panE plasmid. The ilvC and ilvD gene inserts were then PCR amplified from the genomic DNA of E. coli with ilvC-f1/ilvC-r1 and ilvD-f1/ilvD-r1 primers respectively, and inserted together into vector pET-P2-alsS-liuA cleaved by NcoI and EcoRI through In-Fusion HD Eco-Dry Cloning system, generating pET-P1-ilvC-ilvD-P2-alsS-liuA. For construction of pCDF-P1-bkdF-bkdG-bkdH-P2-lplA-lpdA1, the lplA1 and lpdA1 gene inserts were first PCR amplified with lplA-f1/lplA-r1 and lpdA1-f1/lpdA1-r1 primers respectively, and inserted together into vector pCDFDuet-1 cleaved by NdeI and KpnI through In-Fusion HD Eco-Dry Cloning system, resulting in pCDF-P2-lplA-lpcLA1. The codon-optimized hkdF, NOG and hkdH gene inserts were then PCR amplified with bkdF-f1/bkdF-r1, bkdG-f1/bkdG-r1, bkdH-f1/bkdH-r1 respectively and inserted together into pCDF-P2-lplA-IpdA1 cleaved by NcoI and EcoRI through In-Fusion HD Eco-Dry Cloning system, generating pCDF-P1-bkdF-bkdG-bkdH-P2-lplA-IpdA1. For construction of pRSF-P1-leuA(G462D)-leuB-P2-leuC-leuD, the leuA and leuB genes were PCR amplified together into two pieces from the genomic DNA of E. coli with leuA(G462D)B-f11/leuA(G462D)B-r11 and leuA(G462D)B-f12/leuA(G462D)B-r12 respectively, and attached together through overlap PCR with leuA(G462D)B-f2/leuA(G462D)B-r2 to generate G462D mutation. The overlap PCR product was inserted into pRSFDuet-1 cleaved by NcoI and EcoRI through In-Fusion HD Eco-Dry Cloning system, generating pRSF-P1-leuA(G462D)-leuB. Then leuC and leuD genes were amplified together from from the genomic DNA of E. coli with leuCD-f1/leuCD-r1 and the resulting gene insert was inserted into pRSF-P 1 -leuA(G462D)-leuB cleaved by Kpn1, generating pRSF-P1-leuA(G462D)-leuB-P2-leuC-leuD. Before the introduction to host strain, the sequences of constructed plasmids were confirmed by DNA sequencing.

    [0204] Among above enzymes, as mentioned in the previous example, the in vitro activities of acyl-CoA reductases CbjALD and Maqu_2507 on reduction of 3-methylcrotonyl-CoA and the in vitro activities of alcohol dehydrogenases ChnD, YjgB and YahK on oxidization of prenol have been proven through enzymatic spectrophotometric assay. E. coli alcohol dehydrogenases FucO (NP_417279.2), YqhD (NP_417484.1), YiaY (YP_026233.1) were also assayed on prenol, but as mentioned above, they did not show the activity on prenol oxidization. The results of assays on alcohol dehydrogenases can be seen in Table P, and the results of assays on acyl-CoA reductases and relevant enzyme preparation and assay methods are described in the previous example.

    (Prophetic) GPP Biosynthesis Via 2-oxoisovaleric Acid, 2-ox Oisocaproic Acid and Prenol Starting from Aldol Condensation Between Pyruvate and Acetaldehyde

    [0205] The purpose of this experiment is to demonstrate the biosynthesis of GPP through a novel pathway that starts from aldol condensation between pyruvate and acetaldehyde via 2-oxoisovaleric acid, 2-oxoisocaproic acid and prenol, using E. coli as the host organism. This pathway starts from aldol condensation between pyruvate and acetaldehyde to (S)-4-hydroxy-2-oxopentaonoic acid by E. coli aldolase MhpE (NP_414886.1). Acetaldehyde is supplied either through decarboxylation of pyruvate by Saccharomyces cerevisiae alpha-keto acid decarboxylase PDC1(CAA97573.1) or through reduction of acetyl-CoA by E. coli aldehyde forming acyl-CoA reductase MhpF (NP_414885.1). Then, a mutase moves the —(C═O)COOH group of (S)-4-hydroxy-2-oxopentaonic acid from C-3 site to C-4 site, forming 3-hydroxy-2-oxo-3-methylbutyric acid. 2-hydroxyacid dehydrogenase converts 3-hydroxy-2-oxo-3-methylbutyric acid to (2R)-2,3-dihydroxy-3-methylbutyric acid. E. coli dihydroxy acid dehydratase IlvD (YP_026248.1) dehydrates (2R)-2,3-dihydroxy-3-methylbutanoate to 3-methyl-2-oxobutyric acid (2-oxoisovaleric acid). Then, 2-oxoisovaleric acid is elongated into 2-oxoisocaproic acid through alpha-keto acid pathway composed of: E. coli isopropylmalate synthase LeuA (NP_414616.1, with a G462D mutation to maximize 2-oxoisocaprate production and minimize 2-oxoisovalerate, Connor et al. 2008) which condenses 2-oxoisovaleric acid and acetyl-CoA to (2S)-2-isopropylmalate; E. coli isopropyl isomerase LeuCD (NP_414614.1, NP_414613.1) which converts (2S)-2-isopropylmalate to (2R, 3S)-3-isopropylmalate; E. coli isopropylmalate dehydrogenase LeuB (NP_414615.4) which oxidizes and decarboxylates (2R, 3S)-3-isopropylmalate, generating 4-methyl-2-oxopentanoic acid (2-oxoisocaproic acid). Then, S. avermitilis alpha-keto acid dehydrogenase complex BkdFGH-LpdA1 (BAC72088.1, BAC72089.1, BAC72090.1, KUN54417.1) converts 2-oxoisocaproic acid into isovaleryl-CoA.

    [0206] Overexpression of heterologous branched alpha-keto acid dehydrogenase complex requires improved lipoylation, which can be realized though supplementation of lipoic acid accompanied with overexpression of E. coli lipoate-protein ligase LplA (NP_418803.1), or overexpression of E. coli endogenous lipoylation pathway consisting lipolate synthase LipA (NP_415161.1) and lipoyl(octanoyl) transferase LipB (NP_415163.2). P. aeruginosa acyl-CoA dehydrogenase LiuA (APJ52511.1) converts isovaleryl-CoA to 3-methylcrotonyl-CoA. 3-methylcrotonyl-CoA is converted to prenol by alcohol-forming acyl-CoA reductase or aldehyde forming acyl-CoA reductase and alcohol dehydrogenase or carboxylate reductase and the hydrolysis enzyme selected from the group consisting thioesterase, acyl-CoA synthase, acyl-CoA transferase and carboxylate kinase plus phosphotransacylase. Alcohol-forming acyl-CoA reductase is selected from the group consisting C. acetobutylicum AdhE2 (YP_009076789.1) and M. aquaeolei VT8 Maqu_2507 (YP_959769.1). CbjALD from C. beijerinckii aldehyde forming acyl-CoA reductase (AAT66436.1) is selected for conversion of 3-methylcrotonyl-CoA to prenol. Alcohol dehydrogenase is selected from the group consisting E. coli YahK (NP_414859.1), E. coil YjgB (NP_418690.4) and Acinetobacter sp. SE19 ChnD (BAC80217.1). Prenol is then convened to DMAPP by one or two steps of phosphorylation. If phosphorylated by two steps, the first step is catalyzed by E. coli alcohol kinase YchB (NP_415726.1) or Thermoplasma acidophilum phosphate kinase ThaIPK (WP_010900530.1, V73I, Y141V and K204G mutations to increase specificity on prenol. Liu et al. 2016) and the second is by M. thermautotrophicus phosphate kinase MtIPK (AAB84554.1). The one step phosphorylation is catalyzed by alcohol diphosphokinase. E. coli isopentenyl pyrophosphate isomerase Idi (NP_417365.1) converts DMAPP to IPP. Then, DMAPP and 1PP are condensed to GPP catalyzed by E. coli GPP synthase IspA (NP_414955.1, S80F) or A. grandis GPP synthase GPPS2 (AAN01134.1, N-terminal 84 aa truncation). Ocimum basilicum geraniol stynthase GES (AR11765.1, with N-terminal 65 aa truncation) converts GPP to geraniol, which serves as a proxy to demonstrate a functioning pathway.

    [0207] JST06(DE3) serves as the E. coli host strain for demonstration of this novel pathway. Vector creation, strain creation, growth and analysis of supernatant are largely as described in previous examples.

    [0208] The plasmids listed in Table T can be used for required gene expression. The primers required for construction of these plasmids are also listed in Table T and their construction process is described in previous examples.

    [0209] Among above enzymes, as mentioned in the previous example, the in vitro activities of acyl-CoA reductases CbjALD and Maqu_2507 on reduction of 3-methylcrotonyl-CoA and the in vitro activities of alcohol dehydrogenases ChnD, YjgB and YahK on oxidization of prenol have been proven through enzymatic spectrophotometric assay. E. coli alcohol dehydrogenases FucO (NP_417279.2), YqhD (NP_417484.1), YiaY (YP_026233.1) were also assayed on prenol, but as mentioned above, they did not show the activity on prenol oxidization. The results of assays on alcohol dehydrogenases can be seen in Table P, and the results of assays on acyl-CoA reductases and relevant enzyme preparation and assay methods are described in the previous example.

    GPP Biosynthesis Via 3-hydroxy-3-methylglutaryl-COA (HMG-COA) and Prenol starting from Non-decarboxylative Claisen Condensation Between Two Acetyl-cors or Decarboxylative Claisen Condensation Between Acetyl-COA and Malonyl-COA

    [0210] The purpose of this example is to demonstrate the biosynthesis of GPP through a novel pathway via HMG-CoA and prenol. E. coli serves as the host organism. This pathway starts from non-decarboxylative Claisen condensation between two acetyl-CoAs to acetoacetyl-CoA catalyzed by E. coli thiolase AtoB (NP_416728.1) or decarboxylative Claisen condensation between acetyl-CoA and malonyl-CoA by ketoacyl-CoA synthase. Malonyl-CoA is supplied from acetyl-CoA by E. coli acetyl-CoA carboxylase AccABCD (NP_414727.1, NP_417721.1, NP_417722.1, NP_416819.1). Then, S. aureus 3-hydroxy-3-methylglutaryl-CoA synthase HMGS (BAU36102.1) condenses acetoacetyl-CoA with another acetyl-CoA to generate 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA). HMG-CoA is dehydrated to 3-methylglutaconyl-CoA by M. xanthus enoyl-CoA hydratase LiuC (WP_011553770.1). M. xanthus glutaconyl-CoA decarboxylase AibAB (WP_011554267.1, WP_011554268.1) decarboxylates 3-methylglutaconyl-CoA to 3-methylcrotonyl-CoA. 3-methylcrotonyl-CoA is converted to prenol by alcohol-forming acyl-CoA reductase or aldehyde forming acyl-CoA reductase and alcohol dehydrogenase or carboxylate reductase and the hydrolysis enzyme selected from the group consisting thioesterase, acyl-CoA synthase, acyl-CoA transferase and carboxylate kinase plus phosphotransacylase. Alcohol-forming acyl-CoA reductase is selected from the group consisting C. acetobutylicum AdhE2 (YP_009076789.1) and M. aquacolet VT8 Maqu_2507 (YP 959769.1). CbjALD from C. beijerinckii aldehyde forming acyl-CoA reductase (AAT66436.1) is selected for conversion of 3-methylcrotonyl-CoA to prenol. Alcohol dehydrogenase is selected from the group consisting E. coli YahK (NP_414859.1), E. coli YjgB (NP_418690.4) and Acinetobacter sp. SE19 ChnD (BAC80217.1). Prenol is then converted to DMAPP by one or two steps of phosphorylation. If phosphorylated by two steps, the first step is catalyzed by E. coli alcohol kinase YchB (NP_415726.1) or Thermoplasma acidophilum phosphate kinase ThaIPK (WP_010900530.1, V73I, Y141V and K204G mutations to increase specificity on prenol. Liu et al. 2016) and the second is by M. thermautotrophicus phosphate kinase MtIPK (AAB84554.1). The one step phosphorylation is catalyzed by alcohol diphosphokinase. E. coli isopentenyl pyrophosphate isomerase Idi (NP_417365.1) converts DMAPP to IPP. Then, DMAPP and IPP are condensed to GPP catalyzed by E. coli GPP synthase IspA (NP_414955.1, S80F) or A. grandis GPP synthase GPPS2 (AAN01134.1, N-terminal 84 aa is truncated). Ocimum basilicum geraniol stynthase GES (AR11765.1, N-terminal 65 aa truncation) converts GPP to geraniol, which serves as the proxy for pathway function.

    [0211] JST06(DE3) atoB.sup.CT5 ΔfadB serves as the E. coli host strain for demonstration of novel pathway. The genotype atoB.sup.CT5 refers to chromosomal atoB gene, encoding the thiolase that condenses acetyl-CoA to acetoacetyl-CoA, under the p.sup.CT5 promoter for controlled induction by cumate. To enable the cumate-inducible chromosomal expression of atoB gene in JST06(DE3), E. coli atoB gene was first PCR amplified from genomic DNA extracted through Genomic DNA Purification kit (Promega, Fitchburg, Wis., USA), digested with BglII and NotI, and ligated by T4 ligase (Invitrogen, Carlsbad, Calif.) into pUCBB- ntH6-eGFP (Vick et al. 2011) that was previously digested with BglII and Notl to produce pUCBB-P.sup.CT5-atoB. The resulting ligation products were used to transform E. coli DH5alpha (Invitrogen, Carlsbad, Calif.), and positive clones identified by PCR were confirmed by DNA sequencing. To integrate the cumate-controlled atoB construct into the chromosome of JST06(DE3), first the cumate repressor (cytnR), promoter/operator regions (1.sup.3′.sup.5), and respective ORFs were PCR amplified, as was the kanamycin drug construct via pKD4 (Datsenko and Wanner, 2000). These respective products were linked together via overlap extension PCR to create a final chromosomal targeting construct. Integration of the cumate-controlled constructs was achieved via standard recombineering protocols by using strain HME45 and selection on LB drug plates (Thomason et al. 2001). The primers used in the construction of JST06(DE3) atoBcT.sup.5 are listed in Table U.

    [0212] The gene fadB, encoding hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase is deleted to minimize the flux of acetoacetyl-CoA entering the competing beta-oxidation reversal pathway. The gene deletion is performed using P1 phage transduction (Yazdani et al. 2008) with single gene knockout mutants from the National BioResource Project (NIG, Japan, Baba et al. 2006) as the specific deletion donor.

    [0213] The other genes for overexpression are made, put into cells and tested as described above. The quantification of intermediate prenol is also performed via ion-exclusion HPLC using a Shimadzu Prominence SIL 20 system equipped with an HPX-87H organic acid column (Bio-Rad, Hercules, CA) with operating conditions to optimize peak separation (0.3 mL/min flow rate, 30 mM H.sub.2SO.sub.4 mobile phase, column temperature 42° C.). Concentration of 2-oxoisovaleric acid in fermentation samples is determined through calibration to known prenol standards (5, 1, 0.5, 0.2 and 0.1 g/L).

    [0214] The first part of pathway to prenol has demonstrated been in vivo. The plasmids used for demonstration of in vivo prenol production are listed in Table V and the primers required for constructions of these plasmids are listed in Table W. First, the pathway to prenol was expressed in two vectors: the genes encoding acyl-CoA reductases were inserted into pETDuet-1 vector, while other genes were expressed from plasmid pCDF-P 1-HMGS-aibA-aibB-P2-liuC. When using CbjALD, endogenous alcohol dehyrogenases without overexpression was used. Except for genes encoding E. coli enzymes YjgB and YahK, which were PCR amplified from the genomic DNA of wild type E. coli MG1655 strain, and the gene encoding CbjALD, which was PCR amplified from the genomic DNA of C. beijerinckii, the genes were codon optimized and synthesized by either GeneArt or GenScript. The adhE2, cbjALD and magu_2507 gene inserts were PCR amplified with adhE2-f1/adhE2-r1, cbjALD-f2/cbjALD-r2 and maqu_250742/maqu_2507-r2 primers respectively and inserted into vector pETDuet-1 cleaved by NdeI through In-Fusion HD Eco-Dry Cloning system to construct pET-P2-adhE2, pET-P2-cbjALD, pET-P2-maqu_2507 respectively. For construction of pCDF-P1-HMGS-aibA-aibB-P2-liuC, the codon-optimized liuC gene insert was first PCR amplified with liuC-f1/liuC-r1 primers and inserted into vector pCDFDuet-1, cleaved by NdeI through In-Fusion HD Eco-Dry Cloning system to generate pCDF-P2-liuC. Then, the codon-optimized limp gene insert was PCR amplified with lungs-f1/hmgs-r1 primers and inserted into vector pCDF-P2-liuC cleaved with NcoI and EcoRI through In-Fusion HD Eco-Dry Cloning system to generate pCDF-P1-HMGS-P2-liuC. Finally, the codon optimized aibA and aibB gene inserts were PCR amplified with aibA-f1/aibA-r1 and aibB-f1/aibB-r1 primers respectively and inserted into vector pCDF-P2-liuC cleaved with EcoRI and San through In-Fusion HD Eco-Dry Cloning system to generate pCDF-P1-HMGS-aibAB-P2-liuC. The sequences of constructed plasmids were further confirmed by DNA sequencing. Then, the sequence confirmed plasmids were introduced to competent cells of host strain JST06(DE3) atoB.sup.CT5 ΔfadB.

    [0215] As shown in FIG. 26, under the two-vector system, the strain expressing AdhE2 showed 190 mg/L of prenol production when grown under 37° C. for 48 hours in shake flasks with 20 mL LB-like MOPS media supplemented with 20 g/L glycerol, induced under 10 μM IPTG and 100 μM cumate, while prenol production was not detected when expressing CbjALD and Maqu_2507. To test whether the burden caused by multiple vector system led to undetected prenol production when using CbjALD and Maqu_2507, the cbALD and map 2507 gene inserts were PCR amplified with cbjALD-f2icbjALD-r3 and maqu 2507-f2/maqu_2507-r3 primers respectively and inserted into vector pCDF-P2-HMGS-aibAB-P2-liuC cleaved by NdeI through In-Fusion HD Eco-Dry Cloning system to generate pCDF-P2-HMGS-aibAB-P2-cbjALD-liuC and pCDF-P2-HMGS-aibAB-P2-maqu_2507-liuC respectively, so that whole prenol supplying pathway is expressed through single vector. As a result, while the strain JST06(DE3) atoB.sup.CTS AfadB pCDF-P2-HMGS-aibAB-P2-maqu_2507-liuC still did not produce detectable prenol, JST06(DE3) atoB.sup.CT5 ΔfadB pCDF-P2-HMGS-aibAB-P2-cbjALD-liuC produced 475 mg/L of prenol production, higher than the strain with two-vector system using AdhE2, when grown under same conditions as above, possibly due to the added metabolic burden of maintaining two plasmids in the cell.

    [0216] To test whether co-expression of alcohol dehydrogenases YahK, YjgB and ChnD, which had been proven to be active on oxidizing prenol to 3-methyl-1-butenal through in vitro assay according to the second experiment, can improve prenol production with usage of CbjALD, the chnD, yjgB, yahK gene inserts were PCR amplified with chnD-f2/chnD-r2, yjgB-f1/yjgB-r1 and yahK-f1/yahK-r1 primers respectively and inserted into vector pCDF-P2-HMGS-aibAB-P2-cbjALD-liuC cleaved by BglII and XhoI through In-Fusion HD Eco-Dry Cloning system to generate pCDF-P2-HMGS-aibAB-P2-cbjALD-liuC-chnD, pCDF-P2-HMGS-aibAB-P2-cbjALD-liuC-yjgB and pCDF-P2-HMGS-aibAB-P2-cbjALD-liuC-yahK respectively, and the resultant plasmids were introduced into JST06(DE3) aoB.sup.CT5 ΔfadB. As a result, the strain overexpressing ChnD and YjgB did not show the detectable prenol production, while the strain overexpressing YahK produced 535 mg/L of prenol, higher than that of JST06(DE3) atoB.sup.CT5 ΔfadB pCDF-P2-HMGS-aibAB-P2-cbjALD-liuC, which uses endogenous alcohol dehydrogenase without overexpression, when grown under same conditions as above. To summarize, the pathway to prenol is effective in vivo when using acyl-CoA reductases CbjALD and AdhE2, and co-expression of YahK can further improve prenol production when using CbjALD.

    [0217] After demonstrating the in vivo prenol production, the rest of the pathway, which converts prenol to geraniol, was added. A three-vector system was first used as shown in Table V. The pathway to 3-methylcrotonyl-CoA was expressed through pCDF-P1-HMGS-aibA-aibB-P2-liuC; acyl-CoA reductases AdhE2 or CbjALD were expressed through pRSF-P2-adhE2 or pRSF-P2-cbjALD; the rest of the pathway converting prenol to geraniol was expressed through pET-P1-idi-trGPPS2-P2-ges-ychB-mtipk. For construction of other plasmids, the E. coli genes encoding Idi and YchB were PCR amplified from the genomic DNA of wild type E. coli MG1655 strain, while the other genes were codon optimized and synthesized by either GeneArt or GenScript. The adhE2 and cNALD gene inserts were PCR amplified with were PCR amplified with adhE2-f1/adhE2-r1 and cbjALD-f2/cbjALD-r2 primers respectively and inserted into vector pRSFDuet-1 cleaved by NdeI through In-Fusion HD Eco-Dry Cloning system to construct pRSF-P2-adhE2 and pRSF-P2-cbjALD respectively. To construct pET-P1-idi-trGPPS2-P2-ges-ychB-mtipk, the gene inserts encoding Idi and trGPPS2 (“tr” means “truncated” as first 84 aa of GPPS2 was truncated to improve the activity) were PCR amplified with idi-f1/idi-r1 and trgpps2-f1/trgpps2-r1 respectively and inserted together into pETDuet-1 cleaved by NcoI through In-Fusion HD Eco-Dry Cloning system to generate pET-P1-idi-trGPPS2. Then, the gene insert encoding GES was PCR amplified with ges-f1/ges-r1 primers and inserted into vector pET-P1-idi-trGPPS2 cleaved by NdeI and KpnI through In-Fusion HD Eco-Dry Cloning system to generate pET-P1-idi-trGPPS2-P2-ges. Finally, the gene inserts encoding YchB and MtIPK were PCR amplified with ychB-f1/ychB-r1 and mtipk-f1/mtipk-r1 respectively and inserted together into pET-P1-idi-trGPPS2-P2-ges cleaved by XhoI through In-Fusion HD Eco-Dry Cloning system to generate pET-P1-idi-trGPPS2-P2-ges-ychB-mtipk. The sequences of required primers can be seen in Table W. The sequences of constructed plasmids were further confirmed by DNA sequencing. Then, the sequence confirmed plasmids were introduced to competent cells of host strain JST06(DE3) atoB.sup.CT5 ΔfadB.

    [0218] As shown in FIG. 27, the resultant strain using AdhE2 did not show detectable geraniol production, while the strain using CbjALD and endogenous alcohol dehydrogenases without overexpression had 0.54 mg/L of geraniol production when grown under 30° C. for 48 hours in shake flasks with 20 mL LB-like MOPS media supplemented with 20 g/L glycerol, induced under 10 μM IPTG and 100 μM climate. Though the titer was small and further improvement measures, like decreasing the vector number and optimizing fermentation conditions, were required, this result indicates that the claimed novel GPP synthesis pathway via HMG-CoA and prenol is effective in vivo when using acyl-CoA reductase CbjALD.

    [0219] A two-vector system was also tested for geraniol production with usage of acyl-CoA reductase CbjALD with or without alcohol dehydrogenase YahK. One plasmid was pCDF-P2-HMGS-aibAB-P2-cbjALD-liuC or pCDF-P2-HMGS-aibAB-P2-cbjALD-liuC-yahK that expresses the pathway from acetoacetyl-CoA to prenol (or most of “upper alcohol pathway”, as shown in FIG. 1), and the other plasmid was pET-P 1-idi-trGPPS2-P2-ges-ychB-mtipk that expresses the pathway converting from prenol to geraniol (or “lower alcohol pathway”, as shown in FIG. 1). As shown in FIG. 27, the resultant strain using two-vector system and CbjALD and endogenous alcohol dehydrogenases without overexpression had 3.7 mg/L of geraniol production when grown under 30° C. for 48 hours in shake flasks with 20 mL LB-like MOPS media supplemented with 20 g/L glycerol, induced under 50 μM IPTG and 100 μM cumate, indicating that reduction of expression vector can improve the geraniol production. The addition of YahK overexpression further improved the titer to 7.0 mg/L. When YahK was overexpressed, the strain was grown under 30° C. for 48 hours in shake flasks with 15 mL LB-like MOPS media supplemented with 20 g/L glycerol, induced under 10 μM IPTG and 100 μM cumate.

    (Prophetic) GPP Biosynthesis Via 3-methyl-3-hydroxybutyryl-COA and Prenol Starting from Non-decarboxylative Claisen Condensation Between Two Acetyl-coas or Decarboxylative Claisen Condensation Between Acetyl-COA and Malonyl-COA

    [0220] The purpose of this example is to demonstrate the biosynthesis of GPP through a novel pathway via 3-methyl-3-hydroxybutyryl-CoA and prenol. E. coli serves as the host organism. This pathway starts from non-decarboxylative Claisen condensation between two acetyl-CoAs to acetoacetyl-CoA catalyzed by E. colt thiolase AtoB (NP_416728.1) or decarboxylative Claisen condensation between acetyl-CoA and malonyl-CoA by ketoacyl-CoA synthase. Malonyl-CoA is supplied from acetyl-CoA by E. coli acetyl-CoA carboxylase AccABCD (NP_414727.1, NP_417721.1, NP_417722.1, NP_416819.1). Then, acetoacetyl-CoA is hydrolyzed to acetoacetic acid by enzymes selected from the group consisting thioesterase, acyl-CoA transferase and phosphotransacylase plus carboxylate kinase. Acetoacetate decarboxylase removes the carboxyl group of acetoacetic acid, generating acetone. 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase then performs a condensation between acetone and another acetyl-CoA, generating 3-methyl-3-hydroxybutyryl-CoA. Enoyl-CoA hydratase dehydrates 3-methyl-3-hydroxybutyryl-CoA to 3-methylcrotonyl-CoA. 3-methylcrotonyl-CoA is converted to prenol by alcohol-forming acyl-CoA reductase or aldehyde forming acyl-CoA reductase and alcohol dehydrogenase or carboxylate reductase and the hydrolysis enzyme selected from the group consisting thioesterase, acyl-CoA synthase, acyl-CoA transferase and carboxylate kinase plus phosphotransacylase. Alcohol-forming acyl-CoA reductase is selected from the group consisting C. acetobutylicum AdhE2 (YP_009076789.1) and M. aquacolei VT8 Maqu_2507 (YP_959769.1). CbjALD from C. beijerinckii aldehyde forming acyl-CoA reductase (AAT66436.1) is selected for conversion of 3-methylcrotonyl-CoA to prenol. Alcohol dehydrogenase is selected from the group consisting E. coli YahK (NP_414859.1), E. coli YjgB (NP_418690.4) and Acinetobacter sp. SE19 ChnD (BAC80217.1). Prenol is then converted to DMAPP by one or two steps of phosphorylation. If phosphorylated by two steps, the first step is catalyzed by E. coli alcohol kinase YchB (NP_415726.1) or Thermoplasma acidophilum phosphate kinase ThaIPK (WP_010900530.1, V73I, Y141V and K204G mutations to increase specificity on prenol. Liu et al. 2016) and the second is by M. thermautorrophicus phosphate kinase MtIPK (AAB84554.1). The one step phosphorylation is catalyzed by alcohol diphosphokinase. E. coli isopentenyl pyrophosphate isomerase Idi (NP_417365.1) converts DMAPP to IPP, which is condensed with DMAPP to form GPP catalyzed by E. coli GPP synthase IspA (NP_414955.1, 580F) or A. grandis GPP synthase GPPS2 (AAN01134.1, N-terminal 84 aa truncation). Ocimum basilicum geraniol stynthase GES (AR11765.1, N-terminal 65 aa truncation) converts GPP to geraniol, which serves as the proxy product.

    [0221] JST06(DE3) atoB.sup.CT5 ΔfadB serves as the E. coli host strain for demonstration of novel pathway. The genes for overexpression are made and put into cells, which are gown and the supernatants analyzed as described above.

    [0222] The quantifications of intermediates prenol and acetone are also performed via ion-exclusion HPLC using a Shimadzu Prominence SIL 20 system equipped with an HPX-87H organic acid column with operating conditions to optimize peak separation (0.3 mL/min flow rate, 30 mM H.sub.2SO.sub.4 mobile phase, column temperature 42° C.). Concentration of 2-oxoisovaleric acid in fermentation samples is determined through calibration to known acetone and prenol standards (5, 1, 0.5, 0.2 and 0.1 g/L).

    [0223] The in vivo production of acetone has been demonstrated in E. coli. The JC01 (MG1655 ΔldhA ΔpoxB Δpia ΔadhE ΔfrdA, an E. coli strain with removal of mixed-acid fermentation for improved supply of acetyl-CoA) strain overexpressing thiolase AtoB and thioesterase YbgC showed 53 mg/L of acetone production when grown in LB-like MOPS media with glycerol under 37° C. for 48 hours. This result indicates that YbgC can hydrolyze acetoaceetyl-CoA, the product of non-decarboxylative Claisen condensation between two acetyl-CoAs by AtoB, to acetoacetic acid, and aetoacetic acid can be decarboxylated to acetone spontaneously or by endogenous E. coli enzymes. These enzymes can be used in this GPP synthesis pathway. The media, fermentation conditions and method of HPLC analysis on acetone are described in previous example. In this fermentation, the atoB gene was expressed from pTH-atoB, while the ybgC gene was expressed from pZS-ybgC. The primers required for construction of these plasmids can be seen in Table S, and the process of construction of these plasmids is described in the previous example.

    [0224] Among above enzymes, as mentioned in the previous example, the in vitro activities of acyl-CoA reductases CbjALD and Maqu_2507 on reduction of 3-methylcrotonyl-CoA and the in vitro activities of alcohol dehydrogenases ChnD, YjgB and YahK on oxidization of prenol have been proven through enzymatic spectrophotometric assay. E. coli alcohol dehydrogenases FucO (NP_417279.2), YqhD (NP_417484.1), YiaY (YP_026233.1) were also assayed on prenol, but as mentioned above, they did not show the activity on prenol oxidization. The results of assays on alcohol dehydrogenases can be seen in Table P, and the results of assays on acyl-CoA reductases and relevant enzyme preparation and assay methods are described in the previous example.

    (Prophetic) Synthesis of Isoprenoids

    [0225] The purpose of this example is to demonstrate the biosynthesis of isoprenoids other than geraniol from isoprenoid precursor GPP or others, which are supplied from claimed novel pathways. E. coli serves as the host strain. The possible isoprenoid products are monoterpenes like limonene and pinene, which are derived from GPP, and sesquiterpenes like beta-caryophyllene, valencene, vetispiradiene, amorphadiene and farnesene, which are derived from farnesyl diphosphate (FPP), as shown in FIG. 15. FPP is a isoprenoid precursor with five more carbons than GPP and supplied through condensation between GPP and IPP, which are supplied from above novel claimed pathways, by E. coli FPP synthase IspA (NP_414955.1). These mentioned isoprenoids are with great industrial importance and can be used as biofuels and solvents and be used in the fields of cosmetics, pharmaceutics and perfumery. The conversion of GPP to limonene is caalzyed by Mentha spicata limonene synthase LS (AGN90914.1). The conversion of GPP to pinene is catalyzed by Pinus taeda pinene synthase Pt30 (AA061228.1). The conversion of FPP to beta-caryophyllene is catalyzed by Artemisia annua beta-caryophyllene synthase QHS1 (AAL79181.1). The conversion of FPP to valencene is catalyzed by Callitropsis nootkatensis valenecene synthase VALC (AFN21429.1). The conversion of FPP to vetispiradiene is catalyzed by Hyoscyamus muticus vetispiradiene synthase VS1 (Q39978.2). The conversion of FPP to amorphadiene is catalyzed by Artemisia anima amorphadiene synthase ADS (AAF61439.1). The conversion of FPP to famesene is catalyzed by Callitropsis nootkatensis farnesene synthase FS (NP_001280822.1). The genes encoding enzymes for productions of above isoprenoids are separately cloned into pACYCDuet-1 vector (Novagen, Darmstadt, Germany), and the resultant plasmids can be directly used and introduced to GPP-synthsizing strains as described in previous examples to realized productions of isoprenoids. The resultant vectors are listed in Table X. Except ispA, which is PCR amplified from the genomic DNA of wild type E. coli, the genes encoding synthases of isoprenoids are codon-optimized and synthesized by GenScript (Piscataway, N.J.) or GeneArt® (Life Technologies, Carlsbad, Calif.).

    In Vivo Synthesis of Olivetolic Acid in E. coli

    [0226] The purpose of this example is to demonstrate in vivo synthesis of olivetolic acid with E. coli as host organism. Olivetolic acid is a suitable aromatic acceptor of geranyl group donated from GPP, which is synthesized by claimed novel pathways, MVA, MEP/DXP, or other pathways, the prenylation reaction generating the valuable cannabinoid, cannabigerolic acid (CBGA). Olivetolic acid is synthesized through multiple possible pathways. The first pathway starts from three series of decarboxylative Claisen condensation with hexanoyl-CoA as the initial primer and malonyl-CoA as the extender unit by e.g., C. saliva olivetol synthase OLS (BAG14339.1), generating 3,5,7-trioxododecanoyi-CoA. Then, C. saliva olivetolic acid cyclase OAC (AFN42527.1, several non-conservative substitutions of residues are performed to improve the activity) cyclizes 3,5,7-trioxododecanoyl-CoA to olivetolic acid.

    [0227] The second pathway also starts from three series of decarboxylative Claisen condensation with hexanoyl-CoA as the initial primer and malonyl-CoA as the extender unit, but catalyzed by other polyketide synthases selected from e.g., H. macrophylla stilbenecarboxylate synthase STCS (AAN76183.1, with a subset of mutations of T135S, T198M and 1200C to accept hexanoyl-CoA as the active substrate), a type III polyketide synthase, and type I polyketide synthases AviM from Streptomyces viridochromogenes Tue57 (AAK83194.1), ArmB from Armillaria mellea (AFL91703.1) and Ca1O5 from Micromonospora echinospora ssp. Calichensis (AAM70355.1). These polyketide synthases directly perform the cyclization of 3,5,7-trioxododecanoyl-CoA to olivetolic acid.

    [0228] The third pathway starts from three series of condensations with hexanoyl-CoA as the initial primer and acetyl-CoA as the extender unit by polyketoacyl-CoA thiolase selected e.g., from the group consisting FadAx (AAK18171.1) and PcaF (AAA85138.1) from P. putida, DcaF (CAG68532.1) from Acinetobacter sp. ADP1, and ScFadA (AAL10298.1) from S. collinus, generating 3,5,7-trioxododecanoyl-CoA, which is then cyclized to olivetolic acid by OAC.

    [0229] Hexanoyl-CoA can be supplied from hexanoic acid, either supplemented or intracellularly synthesized through beta-oxidation reversal composed of ketoacyl-CoA thiolase BktB (AAC38322.1) from R. eutropha, 3-hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase multifunctional enzyme FadB from E. coli (NP_418288.1) and enoyl-CoA reductase EgTer from E. gracilis (Q5EU90.1) or fatty acid biosynthesis pathway composed of beta-ketoacyl-ACP synthases FabH (NP_415609.1) and FabB (NP_416826.1), acetoacetyl-ACP reductase FabG (NP_415611.1), 3-hydroxyacyl-ACP dehydratase FabZ (NP_414722.1) and enoyl-ACP reductase Fabl (NP_415804.1), all from E. coli, with termination by E. coli thioesterase TesA (NP_415027.1, with truncation of 26 aa leader sequence) and activation by E. coli acyl-CoA synthetase FadD (NP_416319.1), or directly synthesized through overexpressed beta-oxidation reversal pathway without termination.

    [0230] If malonyl-CoA is used as the extender unit, to enhance its supply, e.g., E. coli acetyl-CoA carboxylase AccABCD (NP_414727.1, NP_417721.1, NP_417722.1, NP_416819.1) is overexpressed. Also, to improve acetyl-CoA supply, e.g., E. coli pyruvate dehydrogenase complex AceEF-Lpd is overexpressed (e.g., NP_414658.1, NP_414656.1, NP_414657.1, A358V mutation in Lpd subunit to increase the activity of pyruvate dehydrogenase by reducing inhibition by NADH, Chen et al. 2014).

    [0231] JST06(DE3) ΔfadE bktB.sup.CT5 ΔatoB fadB.sup.CT5 ΔfadA egter.sup.CT5, which is able to intracellularly supply hexanoyl-CoA and hexanoic acid through beta-oxidation reversal, can serve as the host strain for the in vivo production of olivetolic acid. JST06(DE3) is described in previous examples and is selected to maximize the flux of beta-oxidation reversal for hexanoyl-CoA supply required for the synthesis of olivetolic acid via polyketoacyl-CoA thiolases. ΔatoB fadB.sup.CT5 are as described above. BktB, FadB and EgTer are chromosomally expressed under p.sup.CT5 promoter with control by cumate. To integrate the cumate-controlled bktB construct into the chromosome of the target strain, first the cumate repressor (cymR), promoter/operator regions (P.sup.CT5) and respective ORFs are PCR amplified using appropriate primers, as is chloramphenicol drug construct via pKD4 (Datsenko and Wanner, 2000). These respective products are linked together via overlap extension PCR to create a final chromosomal targeting construct. The fadA gene was separately deleted via recombineering in the HME45 derivative harboring the cumate-controlled fadBA construct by replacement of the fadA ORF with a zeocin resistance marker amplified from pKDzeo (Magner et al. 2007).

    [0232] For the creation of the cumate-controlled egTER, the cat gene, cymR repressor gene, hybrid cumate-controlled phage T5 promoter, and egTER gene are PCR amplified from genomic DNA of a strain with egTER seamlessly replacing fadBA at the cumate controlled Jac/BA locus (See below for details). This product is recombineered into strain HME45 at the end of the fabI locus, selecting on chloramphenicol (12.5 μg/ml) LB plates. Integration is done in a manner to duplicate the last 22 bp of fabI (including stop codon) so as retain an overlapping promoter for the next native downstream gene.

    [0233] Construction of the strain serving as the PCR template for egTER described above was accomplished by first creating a kan-sacB fusion cassette via overlap extension PCR using pKD4 and genomic DNA, respectively. This kan-sacB cassette was integrated between fadB and fadA of the fadBA.sup.CT5 strain formerly constructed (Vick et al., 2015) through subsequent recombineering. Seamless replacement of the kan-sacB cassette to create the cat-cynR-P.sup.CT5egTER at the sadBA.sup.CT5 locus was done via recombineering and subsequent sucrose selection with codon optimized egter (Genscript) PCR product. The primers for construction of this strain are listed in Table Y.

    [0234] The gene fadE, encoding acyl-CoA dehydrogenase is deleted to block the degradation of hexanoyl-CoA through beta-oxidation. The gene deletion is performed using P1 phage transduction (Yazdani et al. 2008) with single gene knockout mutants from the National BioResource Project (NIG, Japan, Baba et al. 2006) as the specific deletion donor.

    [0235] The constructed vectors for expression of different routes of olivetolic acid synthesis pathways are listed in Table Z. To construct pET-P1-OLS-P2-OAC, the OLS gene insert was first PCR amplified with OLS-BamHI-F/OLS-EcoRI-R primers and inserted into vector pETDuet-1 cleaved by BamHI and EcoRI through Gibson Assembly cloning system, generating pET-P1-OLS. Then, the OAC gene insert was PCR amplified with OAC-NdeI-Up/OAC-XhoI-Dn primers and inserted into pET-P1-OLS cleaved by NdeI and XhoI through Gibson Assembly cloning system, generating pET-P1-OLS-P2-OAC.

    [0236] The in vivo synthesis of olivetolic acid in E. coli has been demonstrated by using C. saliva olivetol synthase OLS and olivetolic acid cyclase OAC. JST06(DE3) AWE bktB.sup.CT5 ΔatoB fadB.sup.CT5 ΔfadA egret.sup.CT5 @fabI served as the host strain containing plasmid pET-P1-OLS-P2-OAC. The genes encoding OLS and OAC were codon optimized and synthesized by either GeneArt or GenScript. The resultant strain for olivetolic acid production was grown in shake flasks with 15 mL LB-like MOPS media supplemented with 20 g/L glycerol and 55 g/L CaCO.sub.3 at 30° C. for 48 hours. Extracellular olivetolic acid was extracted and derivatized following the protocols described in previous examples and the resulting sample analyzed via GC-MS. FIG. 28 shows GC-MS identification of in vivo olivetolic acid synthesis through comparsion with an olivetolic acid standard. This result demonstrates that OLS and OAC are effective for in vivo biosynthesis of olivetolic acid which can be used as the acceptor group donated from GPP synthesized through claimed pathways for production of valued compound cannabigerolic acid (CBGA).

    (Prophetic) In Vivo Two Synthesis of Divarinolic Acid in E. coli

    [0237] The purpose of this example is to demonstrate in vivo synthesis of divarinolic acid with E. coli as host organism. Divarinolic acid is a suitable aromatic acceptor of geranyl group donated from GPP, which is synthesized by claimed novel pathways or the known MVA, MEP/DXP pathways, or otherwise, in the prenylation reaction generating cannabinoid cannabigerovarinic acid (CBGVA). Divarinolic acid is synthesized through multiple possible pathways. The first pathway starts from three series of condensation with butyryl-CoA as the initial primer and malonyl-CoA as the extender unit by e.g., C. saliva olivetol synthase OLS (BAG14339.1), generating 3,5,7-trioxodecanoyl-CoA. Then, C. saliva olivetolic acid cyclase OAC (e.g., AFN42527.1, several non-conservative substitutions of residues are performed to improve the activity) cyclizes 3,5,7-trioxodecanoyl-CoA to divarinolic acid.

    [0238] The second pathway also starts from three series of condensations with butyryl-CoA as the initial primer and malonyl-CoA as the extender unit, but catalyzed by catalyzed by other polyketide synthases selected from e.g., H. macrophylla stilbenecarboxylate synthase STCS (AAN76183.1, with a subset of mutations of T135S, T198M and I200C), a type III polyketide synthase, and type I polyketide synthases AviM from Streptomyces viridochromogenes Tue57 (AAK83194.1), ArmB from Armillaria mellea (AFL91703.1) and CalO5 from Micromonospora echinospora ssp. Calichensis (AAM70355.1). These polyketide synthases then directly perform the cyclization of 3,5,7-trioxodecanoyl-CoA to divarinolic acid.

    [0239] The third pathway starts from three series of condensations with butyryl-CoA as the initial primer and acetyl-CoA as the extender unit by polyketoacyl-CoA thiolase from e.g., FadAx (AAK18171.1) and PcaF (AAA85138.1) from P. putida, DcaF (CAG68532.1) from Acinetobacter sp. ADP1, and ScFadA (AAL10298.1) from S. collinus, generating 3,5,7-trioxodecanoyl-CoA, which is then cyclized to divarinolic acid by OAC.

    [0240] Butyryl-CoA can be supplied from butyric acid, either supplemented or intracellularly synthesized through beta-oxidation reversal composed of e.g., ketoacyl-CoA thiolase BktB (AAC38322.1) from R. eutropha or thiolase AtoB (NTP 416728.1) from E. coli, 3-hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase multifunctional enzyme FadB from E. coli (NP_418288.1) and enoyl-CoA reductase EgTer from E. gracilis (Q5EU90.1) or fatty acid biosynthesis pathway composed of beta-ketoacyl-ACP synthase FabH (NP_415609.1), beta-ketoacyl-ACP reductase FabG (NP_415611.1), 3-hydroxyacyl-ACP dehydratase FabZ (NP_414722.1) and enoyl-ACP reductase FabI (NP_415804.1), all from E. coli, with termination by e.g., E. coli thioesterase TesA (NP_415027.1, with truncation of 26 aa leader sequence) and activation by E. coli acyl-CoA synthetase FadD (NP_416319.1), or directly synthesized through overexpressed beta-oxidation reversal pathway without termination. If malonyl-CoA is used as the extender unit, to enhance its supply, e.g., E. coli acetyl-CoA carboxylase AccABCD is overexpressed. Also, to improve acetyl-CoA supply, e.g., E. coli pyruvate dehydrogenase complex AceEF-Lpd is overexpressed.

    [0241] JST06(DE3) ΔfadE bktB.sup.CT5 ΔatoB ΔfadA egter.sup.CT5 @fabI, which is able to intracellularly supply butyryl-CoA through beta-oxidation reversal, can serve as the host strain for the in vivo production of olivetolic acid. Its construction, growth and analysis of products are as described above in previous examples.

    [0242] The in vivo butyryl-CoA and butyric acid synthesis through beta-oxidation reversal composed of AtoB, FadB and EgTer has been demonstrated in E. coli. The results are shown in FIG. 23. Strain and vector constructions, fermentation conditions and analysis method are as decribed above in previous examples.

    (Prophetic) In Vivo Synthesis of Orsellinic Acid in E. coli

    [0243] The purpose of this example is to demonstrate in vivo synthesis of orsellinic acid with E. coli as host organism. Orsellinic acid is a suitable aromatic acceptor of geranyl group donated from GPP, which is synthesized by claimed novel pathways or other pathways, in the prenylation reaction. Orsellinic acid is synthesized through multiple possible pathways. The first pathway starts from three series of decarboxylative Claisen condensations with acetyl-CoA as the initial primer and malonyl-CoA as the extender unit by e.g., C. saliva olivetol synthase OLS (BAG14339.1), generating 3,5,7-trioxooctanoyl-CoA. Then, C. saliva olivetolic acid cyclase OAC (AFN42527.1) cyclizes 3,5,7-trioxooctanoyl-CoA to orsellinic acid.

    [0244] The second pathway also starts from three series of decarboxylative Claisen condensations with acetyl-CoA as the initial primer and malonyl-CoA as the extender unit, but catalyzed by other polyketide synthases selected from e.g., H. macrophylla stilbenecarboxylate synthase STCS (AAN76183.1, with a subset of mutations of T135S, T198M and I200C), a type III polyketide synthase, and type I polyketide synthases AviM from Streptomyces viridochromogenes Tue57 (AAK83194.1), ArmB from Armillaria mellea (AFL91703.1) and CalO5 from Micromonospora echinospora ssp. Calichensis (AAM70355.1). These polyketide synthases then directly performs the cyclization of 3,5,7-trioxooctanoyl-CoA to orsellinic acid.

    [0245] The third pathway starts from condensation between two acetyl-COAs to acetoacetyl-CoA catalyzed by E. coli thiolase AtoB (NP_416728.1). Then, two series of condensation reactions with acetoacetyl-CoA as the primer and acetyl-CoA as the extender unit by polyketoacyl-CoA thiolase selected from e.g., FadAx (AAK18171.1) and PcaF (AAA85138.1) from P. putida, DcaF (CAG68532.1) from Acinetobacter sp. ADP1, and ScFadA (AAL10298.1) from S. collinus, generates 3,5,7-trioxooctanoyl-CoA, which is then cyclized to orsellinic acid by OAC. If malonyl-CoA is used as the extender unit E. coli acetyl-CoA carboxylase AccABCD is preferably overexpressed. Also, to improve acetyl-CoA supply, E. coli pyruvate dehydrogenase complex AceEF-Lpd is overexpressed.

    [0246] JST06(DE3) atoB.sup.CT5 A/adB serves as the E. coli host strain for demonstration of the novel pathway. Vector and strain creation, growth and analysis are as described in previous examples.

    In Vivo Synthesis of Cbga in E. coli

    [0247] The purpose of this example is to demonstrate in vivo synthesis of cannabigerolic acid (CBGA) with E. coli as host organism. In this example, Streptomyces sp. strain CL190 prenyltransferase NphB (BAE00106.1), which is soluble and desirable for functional expression and operation in E. coli, was used to convert GPP, which was synthesized through mevalonate pathway and GPP synthase in this example, and extracellularly supplemented olivetolic acid, into CBGA. Besides NphB, Lithospermum erythrorhizon PGT-1(Q8W405), Lithospermum erythrorhizon PGT-2 (Q8W404), E. coli UbiA (P0AGK1), Arabidopsis thaliana PPTI (Q93YP7), Schizosaccharomyces pombe Coq2 (Q10252), Cannabis saliva CsPT1, Streptomyces coelicolor SC07190 (BAE00107.1), Streptomyces sp. CNQ-509 CnqPP3 (AM-184817.1) and Phleum pretense Phlp4 (ABB78007.1) can be another options of prenyltransferases for transfer of geranyl group from GPP to olivetolic acid forming CBGA.

    [0248] The mevalonate pathway used herein is composed of 3-hydroxy-3-methylglutaryl-CoA synthase HMGS (BAU36102.1) and 3-hydroxy-3-methylglutaryl-CoA reductase HMGR (OLN67110.1) from S. aureus, mevalonate kinase MK (NP_013935.1), phosphomevalonate kinase PMK (NP_013947.1) and phosphomevalonate decarboxylase PMD (NP_014441.1) from S. cerevisiae and E. coli isopentenyl pyrophosphate isomerase Idi (NP_417365.1). A. grandis GPP synthase TrGPPS2 (AAN01134.1, N-terminal 84 aa truncation) was selected for condensation of IPP and DMAPP to GPP.

    [0249] Except for the gene encoding Idi, which was amplified from the genomic DNA of E. coli wild type MG1655 strain, the required genes were codon optimized and synthesized by either GeneArt or GenScript. The genes encoding HMGS, HMGR, MK, PMK and PMD were expressed through pCDF-P1-MK-PMK-PMD-P2-HMGS-HMGR, while the genes encoding Idi, TrGPPS2 and NphB were expressed through pET-P1-idi-trGPPS2-CymR-CT5-NphB. The primers used for constructions of these plasmids are listed in Table AA.

    [0250] Primers NphB-IF-fwd and NphB-IF-rev were used to PCR amplify NphB gene from the synthesized DNA fragment with usage of Phusion polymerase, and the amplified DNA fragment was assembled with NdeI/KpnI digested pETDuet-1 vector by In-Fusion HD Eco-Dry Cloning system, resulting in plasmid pET-P2-NphB. Primers idi-GB-fwd, idi-GB-rev, trGPPS2-IF-fwd, and GPPS2-GB-rev were utilized to PCR amplify DNA fragments containing idi and trGPPS2 with usage of Phusion polymerase, respectively. These two amplified DNA fragments were assembled with NcoI digested pET-P2-NphB by Gibson assembly cloning system, resulting in plasmid pET-P 1-idi-trGPPS2-P2-NphB.

    [0251] Later, primers CymR-GB-fwd and CymR-GB-rev were used to amplify CymR with CT5 promoters, and NphB-cumate-GB-fwd and NphB-cumate-GB-rev were used to PCR amplify NphB fragment with usage of Phusion polymerase. Two amplified DNA fragments were assembled with NotI/XhoI digested pET-P1-idi-trGPPS2-P2-NphB by Gibson assembly, providing plasmid pET-P1-idi-trGPPS2-CymR-CT5-NphB.

    [0252] For cloning plasmid pCDF-P1-MK-PMK-PMD-P1-HMGS-HMGR, the synthesized DNA fragments containing HMGS genes and HMGR genes were assembled with NdeI digested pCDFDuet-1 vector by In-Fusion HD Eco-Dry Cloning system, resulting plasmid pCDF-P2-HMGS-HMGR. Primers MK-IF-fwd and MK-IF-rev were used to PCR amplify DNA containing MK gene with usage of Phusion polymerase, and the amplified DNA fragment was assembled with NcoI/EcoRI digested pCDF-P2-HMGS-HMGR by in-fusion cloning, producing plasmid pCDF-P1-MK-P2-HMGS-HMGR.

    [0253] Similarly, primer PMK-IF-fwd and PMK-IF-rev were used to PCR amplify PMK with usage of Phusion polymerase and the DNA fragment was assembled with EcoRI digested pCDF-P -MK-P2-HMGS-HMGR by In-fusion cloning, resulting in plasmid pCDF-P1-MK-PMK-P2-HMGS-HMGR.

    [0254] Finally, primers PMD-IF-fwd and PMD-IF-rev were utilized to PCR amplify PMD gene with usage of Phusion polymerase, and the amplified DNA fragments were assembled with EcorI digested pCDF-P1-MK-PMK-P2-HMGS-HMGR by In-fusion cloning, resulting in the plasmid pCDF-P1-MK-PMK-PMD-P2-HMGS-HMGR.

    [0255] Host strain JST06(DE3) atoB.sup.CT5 containing plasmid pCDF-P1-MK-PMK-PMD-P2-HMGS-HMGR and pET-P1-idi-trGPPS2-CymR-CT5-NphB was inoculated into 5 ml LB medium in 25 ml flask with antibiotic and shaking under 37° C. with 200 rpm in NBS 124 Benchtop Incubator Shaker for overnight. The overnight culture was used as the seed culture to start the subculture with appropriate volume of LB-like MOPS medium as described above supplied with 20 g/L glucose in 25 ml flask. After 3 hours shaking under 37° C. at 200 rpm, the culture OD550 reached about 0.5. 20 μM IPTG and 100 μM cumate, and 500 mg/L olivetolic acid were added into the culture to induce enzyme expression and supply the substrate. Then, the flasks were transferred into another same type of shaker to grow under 30° C. After growing for 48 hours, 2 mL of fermentation broths with or without cells were collected for GC-MS identification and GC-FID quantification of CBGA. If without cell, the 5000 g, 5 min centrifuge in an Optima L-80XP Ultracentrifuge (Beckman-Coulter, Schaumburg, Ill.) was performed to remove the cells.

    [0256] The fermentation broths of 2 mL were transferred to 5 mL glass vials (Fisher Scientific Co., Pittsburgh, PA). Then, organic solvent (typically hexane) was added at a 1:1 ratio to a fermentation broth sample (e.g. 2 mL for a 2 mL aqueous solution) for extraction. Before extraction, the samples were acidified with sulfuric acid (80 uL per 2 mL sample) and 30% (w/v) NaCl was added (340 uL per 2 mL). Following an appropriate extraction (vortex samples for 15 seconds, spin on a rotator at 60 rpm for 2 hours, and vortex again for 15 seconds), 1 mL of the organic phase was removed and evaporated to dryness under a gentle N.sub.2 stream. 100 μL pyridine and 100 μL BSTFA were then added for derivatization, with the reaction allowed to proceed at 70° C. for 60 minutes. After cooling to room temperature, this mixture was used for GC analysis.

    [0257] GC analysis was conducted on an Agilent 7890B Series Custom Gas Chromatography system equipped with a 5977B Inert Plus Mass Selective Detector Turbo EI Bundle (for identification) or a Flame Ionization Detector (for quantification) and an Agilent HP-5 capillary column (0.25 mm internal diameter, 0.25 μm film thickness, 30 m length). The following temperature profile was used with helium as the carrier gas at a flowrate of 1.2 mL/min: Initial 200° C. (hold 1 min); ramp at 30° C./min to 300° C. (hold 5 min). The injector and detector temperature were 290° C. and 350° C., respectively. 1 μL of sample was injected with a 4:1 split ratio.

    [0258] Cells grown with 10 mL medium in 25 ml flasks produced 0.2 mg/L CBGA after 48 hours of fermentation, and cells grown with 5 ml medium in 25 ml flasks produced 0.38 mg/L CBGA. FIG. 29 shows GC-MS identification of in vivo CBGA synthesis. This result indicates that prenyltransferase NphB is well expressed and functional on transferring geranyl group from GPP to olivetolic acid to synthesize CBGA in E. coli.

    [0259] Although GPP in this example was supplied through traditional mevalonate pathway, the GPP could also be generated through claimed novel pathways or MEP/DXP pathway or commercially supplied. Alternative to the extracellular supplementation in this example, olivetolic acid can also be intracellularly synthesized through the series of condensations priming from hexanoyl-CoA as described in a previous example. Alternative to NphB used in this example, prenyl transfer can be catalyzed by other suitable enzymes such as those examples listed in Table L. The vectors for expression of some of prenyltransferases have been constructed, which are shown in Table AB.

    [0260] The following are incorporated by reference herein in its entirety for all purposes:

    [0261] Atsumi, S. et al. Metabolic engineering of Escherichia coli for 1-butanol production. Metab. Eng. 10, 305-311 (2008).

    [0262] Baba, T. et al. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2 (2006).

    [0263] Blecher, M. (1981). Synthesis of long-chain fatty acyl-CoA thioesters using N-hydroxysuccinimide esters. Methods in Enzymology, 72: 404-408.

    [0264] Chen, J. et al. Activating C4-dicarboxylate transporters DcuB and DcuC for improving succinate production. Appl. Microbiol. Biotechnol. 98, 2197-2205 (2014).

    [0265] Cheong, S., et al. Energy- and carbon-efficient synthesis of functionalized small molecules in bacteria using non-decarboxylative Claisen condensation reactions. Nat Biotech 34, 556-561 (2016).

    [0266] Choi, S.Y. et al. One-step fermentative production of poly(lactate-co-glycolate) from carbohydrates in Escherichia coli. Nat Biotech 34, 435-440 (2016).

    [0267] Clomburg, J. M., et al., A Synthetic Biology Approach to Engineer a Functional Reversal of the beta-Oxidation Cycle. ACS Synthetic Biology 1, 541-554 (2012).

    [0268] Cracan. & Banerjee, R. Novel B12-dependent acyl-CoA mutases and their biotechnological potential. Biochemistry 51(31), 6039-6046 (2012),

    [0269] Dellomonaco, C., et al., Engineered reversal of the beta-oxidation cycle for the synthesis of fuels and chemicals. Nature 476, 355-359 (2011).

    [0270] Gao, Y. et al., et al., Terpenoid synthase structures: a so far incomplete view of complex catalysis. Natural product reports 29, 1153-4175 (2012).

    [0271] Haapalainen, A. M., et al., The thiolase superfamily: condensing enzymes with diverse reaction specificities. Trends in Biochemical Sciences 31, 64-71 (2006).

    [0272] Heath, R. J. & Rock, C. O. The Claisen condensation in biology. Nat. Prod. Rep. 19. 581-596 (2002).

    [0273] Iijima, Y., et al., Characterization of Geraniol Synthase from the Peltate Glands of Sweet Basil. Plant Physiol. 134, 370-379 (2004).

    [0274] Jiang, C., et al., Divergent evolution of the thiolase superfamily and chalcone synthase family. Molecular Phylogenetics and Evolution 49, 691-701 (2008).

    [0275] Jiang, Y. et al. Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System. Appl. Environ. Microbiol. 81, 2506-2514 (2015).

    [0276] Kim. J., et al., W. 2-Hydroxyisocaproyl-CoA dehydratase and its activator from Clostridium difficile. Febs J. 272, 550-561 (2005).

    [0277] Kitagawa, M. et al. Complete set of ORF clones of Escherichia coli ASKA library (A complete Set of E. coli K-12 ORF archive): Unique resources for biological research. DNA Res. 12, 291-299 (2005).

    [0278] Kuzuyama, T., et al., Structural basis for the promiscuous biosynthetic prenylation of aromatic natural products. Nature 435, 983-987 (2005).

    [0279] Liu, Y., Yan, Z., Lu, X., Xiao, D. & Jiang, H. Improving the catalytic activity of isopentenyl phosphate kinase through protein coevolution analysis. Scientific Reports 6, 24117 (2016).

    [0280] Mabanglo, M.F., et al., Mutagenesis of Isopentenyl Phosphate Kinase To Enhance Geranyl Phosphate Kinase Activity. ACS Chem. Biol. 7, 1241-1246 (2012).

    [0281] Magner, D. B. et al. RecQ Promotes Toxic Recombination in Cells Lacking Recombination Intermediate-Removal Proteins. Mol. Cell 26, 273-286 (2007).

    [0282] Miller, J. H. Experiments in molecular genetics. (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.; 1972).

    [0283] Neidhardt, F. C., Bloch, P. L. & Smith, D. F. Culture medium for enterobacteria J. Bacteriol. 119, 736-747 (1974).

    [0284] Parasaran, T., & Tarbell, D. S. (1964). Formic Ethylcarbonic Anhydride. The Journal of Organic Chemistry, 29(11): 3422-3423.

    [0285] Reiling, K. K. et al. Mono and diterpene production in Escherichia coli. Biotechnol Bioeng 87 (2004).

    [0286] Sambrook, J. & Russell, D.W. Molecular cloning: a laboratory manual Edn. 3rd. (Cold Spring Harbor Laboratory Press., Cold Spring Harbor, N.Y.; 2001).

    [0287] Schrader, J. & Bohlmann, J., eds. Biotechnology of Isoprenoids. Vol, 149. Springer, (2015).

    [0288] Studier, F.W. & Moffatt, B.A. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189, 113-130 (1986).

    [0289] Thomason, L. C., Sawitzke, J.A., Li, X., Costantino, N. & Court, D. L. in Current Protocols in Molecular Biology (John Wiley & Sons, Inc., 2001).

    [0290] Vick, J. E. et al. Escherichia coli enoyl-acyl carrier protein reductase (FabI) supports efficient operation of a functional reversal of the beta-oxidation cycle. Appl. Environ. Microbiol. 81, 1406-1416 (2015).

    [0291] Vick, J. E. et al. Optimized compatible set of BioBrick™ vectors for metabolic pathway engineering. Appl. Microbiol. Biotechnol. 92, 1275-1286 (2011).

    [0292] Yazdani, S. S. & Gonzalez, R. Engineering Escherichia coli for the efficient conversion of glycerol to ethanol and co-products. Metal,. Eng. 10, 340-351 (2008).

    [0293] US20130316413 WO2012109176 61/440,192, Reverse Beta Oxidation Pathway

    [0294] US20140273110 WO2013036812 61/531/911 61/440,192, Functionalized Carboxylic Acids And Alcohols By Reverse Fatty Acid Oxidation

    [0295] WO2015191972 62/011,474, 62/012,113, 62/011,465, 61/531,911, WO2013036812, US20140273110 Omega-Carboxylated Carboxylic Acids And Derivitives

    [0296] WO2015191422 62/011,465, 62/012,113, 62/011,474, 61/531,911, WO2013036812, 14/199,528, Omega-Hydroxylated Carboxylic Acids

    [0297] WO2016007258 62/011,474, 62/012,113, 62/011,465, 61/531,911, WO2013036812, US20140273110, Omega-Aminated Carboxylic Acids

    [0298] WO2017020043, BIOSYNTHESIS OF POLYKETIDES, filed August 1, 2016, and 62/198,764, filed Jul. 30, 2015

    [0299] U.S. Ser. No. 62/308,937, filed Mar. 16, 2016

    [0300] U.S. Ser. No. 62/198,764, filed Jul. 30, 2015

    [0301] TABLES A-J TO BE INSERTED

    TABLE-US-00001 TABLE L Example reactions for the production of prenylated aromatic compounds and example enzymes Source organism Protein EC Enzyme and gene/enzyme Accession Reaction Illustration Numbers names name Numbers Olivetolic acid + GPP .fwdarw. canna- bigerolic acid [00017]embedded image 2.5.1.- geranylpyro- phosphate: olivetolate geranyltrans- ferase Lithospermum erythrorhizon PGT- 1 Q8W405 Lithospermum Q8W404 erythrorhizon PGT- 2 E. coli ubiA PDAGK1 Arabidopsis Q93YP7 thaliana PPT1 Schizosaccharomyces Q10252 pombe coq2 Cannabis sativa CsPT1 Streptomyces sp. BAE00106.1 strain CL190 nphB Streptomyces BAE00107.1 Coelicolor SCO7190 Streptomyces sp. AKH84817.1 CNQ-509 cnqp3 Phleum pretense ABB78007.1 phl p4

    TABLE-US-00002 TABLE M Plasmids and primers used for in vivo tiglic acid production Plasmids pCDF-P1-pct-fadAx pET-P1-fadB2x-fadB1x pET-P1-fadB2x-fadB1x-P2-ydil Primers SEQ ID Name NO: Sequence pct-f1 1 5′-AGGAGATATACCATGAGAAAAGTAGAAATCATTAC-3′ pct-r1 2 5′-CGCCGAGCTCGAATTCTTATTTTTTCAGTCCCATGGGAC-3′ fadAx-f1 3 5′-GAAAAAATAAGAATTTAAGGAGGAATAAACC ATGACCCTGGCAAATGATCC-3′ fadAx-r1 4 5′-CGCCGAGCTCGAATTCTTAATACAGACATTCAACTGCC-3′ fadB2x-f1 5 5′-AGGAGATATACCATGCATATCGCCAACAAACAC-3′ fadB2x-r1 6 5′-CGCCGAGCTCGAATTCTTATTTTGCTGCCATGCGCAG-3′ fadB1x-f1 7 5′-AGCAAAATAAGAATTTAAGGAGGAATAAACC ATGGCCTTTGAAACCATTCTG-3′ fadB1x-r1 8 5′-CGCCGAGCTCGAATTCTTAGCGATCTTTAAACTGTGC-3′ ydil-f1 9 5′-AAGGAGATATACATATGATATGGAAACGGAAAATCAC-3′ ydil-r1 10 5′-TTGAGATCTGCCATATGTCACAAAATGGCGGTCGTC-3′

    TABLE-US-00003 TABLE N plasmids and primers used for conversion of prenol to GPP and geraniol Plasmids pET-P1-idi-trGPPS2-P2-ges-ychB-mtipk pET-P1-idi-trGPPS2-P2-ges-thaipk-mtipk Primers SEQ ID Name NO: Sequence idi-f1 11 AGGAGATATACCATGCAAACGGAACACGTCATTT idi-r1 12 TGCGCTATATGCCATGGTTTATTCCTCCTTAAATTATTTAAGCTGGGTAAATGCAGATA trgpps2-f1 13 ATGGCATATAGCGCAATGGC trgpps2-r1 14 GTGATGGCTGCTGCCTTAGTTCTGACGAAATGCAACAT ges-f1 15 AAGGAGATATACATAATGGAAGAAAGCAGCAGCAAA gas-r1 16 TTACCAGACTCGAGGTTACTGGGTAAAAAACAGGGC ychB-f1 17 ACCCAGTAACCTCGAAAGGAGGAATAAGGC ATGCGGACACAGTGGCCCT ychB-r1 18 TTTCAGGATGATCATTTGTTATTCCTCCTTAAGGTCTTAAAGCATGGCTCTGTGCAA mtipk-f1 19 ATGATCATCCTGAAACTGGGT mtipk-f1 20 CTTTACCAGACTCGAGTTAGTGTTTACCTGTAATACGTG mtipk-f2 21 GATCCGCTAACTCGATAAGGAGGAATAACAA ATGATCATCCTGAAACTGGGT taipk-f1 22 ACCCAGTAACCTCGAAAGGAGGAATAAGGCATGATGATCCTGAAAATTGGTG taipk-r1 23 CTTTACCAGACTCGAGTTAGCGGATCACGGTGCCA

    TABLE-US-00004 TABLE O List of primers SEQ ID Name NO: Sequence Description maqu_2507- 24 GCCAGGATCCGAATTCGAACTACTTTCTGACCGGTGG maqu_2507 f1 forward maqu_2507- 25 CGCCGAGCTCGAATTCTTACCAGTAAATGCCACGCA maqu_2507 r1 reverse cbjALD-f1 26 GCCAGGATCCGAATTCGAATAAAGACACACTAATACCTAC cbjALD forward cbjALD-r1 27 CGCCGAGCTCGAATTCTTAGCCGGCAAGTACACATC cbjALD reverse chnD-f1 28 GCCAGGATCCGAATTCGCACTGCTATTGTGTTACCCAC chnD forward chnD-r1 29 CGCCGAGCTCGAATTCTCAATTTTCGTGCATCAGAAC chnD reverse

    TABLE-US-00005 TABLE P Measured activities of different alcohol dehydrogenases on oxidization of prenol. Specific activity Enzyme (cofactor) (μmol/mg/min) FucO (NAD.sup.+) N.D. YqhD (NADP.sup.+) N.D. YjgB (NADP.sup.+)  0.30 ± 0.03 YahK (NADP.sup.+) 0.167 ± 0.005 YiaY (NAD.sup.+) N.D. ChnD (NAD.sup.+) 0.123 ± 0.007

    TABLE-US-00006 TABLE Q plasmids and primers used for in vivo 2,3-dihydroxybutyric acid production Plasmids pET-P1-bktB-phaB1-P2-phaJ pCDF-P1-pct-P2-tdter Primers SEQ ID Name NO: Sequence tdTer-f1 30 5′-AAGGAGATATACATATGATTGTTAAGCCGATGGTCC-3′ tdTer-r1 31 5′-TTGAGATOTGCCATATGTTAGATGCGGTCAAAACGTTCA-3′ pct-f1 32 5′-AGGAGATATACCATGAGAAAAGTAGAAATCATTAC-3′ pct-rl 33 5′-CGCCGAGCTCGAATTCTTATTTTTTCAGTCCCATGGGAC-3′ bktB-f1 34 5′-AGGAGATATACCATGATGACGCGTGAAGTGGTAGT-3′ bktB-r1 35 5′-CGCCGAGCTCGAATTCTCAGATACGCTCGAAGATGG-3′ phaB1-f1 36 5′-GCGTATCTGAGAATTAGGAGGCTCTCTATGACTCAGCGCATTGCGTA phaB1-r1 37 5′-CGCCGAGCTCGAATTCTCAGCCCATGTGOAGGCC-3′ phaJ-f1 38 5′-AAGGAGATATACATATGTCGGCACAAAGCCTG-3′ phaJ-r1 39 5′-TTGAGATCTGCCATATGTTACGGCAGTTTCACCACC-3′

    TABLE-US-00007 TABLE R List of primers used in example of GPP BIOSYNTHESIS VIA 2-HYDROXYISOVALERIC ACID AND PRENOL STARTING FROM DECARBOXYLATIVE ACYLOIN CONDENSATION BETWEEN TWO PYRUVATES SEQ ID Name NO: Sequence Description pct540- 40 GAGGAATAAACCATGCGTAAAGTGCCGATTATTA pct540 f1 forward pct540- 41 GATGATGATGGTCGACGCTTTTCATTTCTTTCAGGCC pct540 r1 reverse pct-f2 42 TAGAAGGAGGAGATCTATGAGAAAAGTAGAAATCATTACAG pot forward pct-r2 43 GGGGGACCAGCTCGAGTTTTTTCAGTCCCATGGGACC pct reverse alsS-f1 44 AAGGAGATATACATATGACCAAAGCAACCMAGAA alsS forward alsS-r1 45 AATGGTAATACGCATGTTAATTTCCTCCTAGAATTACAGGGCTTTGGTTTTC alsS reverse AT panE-f1 46 ATGCGTATTACCATTGCCGG panE forward panE-r1 47 TTGAGATCTGCCATATTATTTGGCTTTCAGCAGTTCTT panE reverse ilvC-f1 48 AGGAGATATACCATGGCTAACTACTTCAATAC ilvC forward ilvC-r1 49 ACGGTACTTAGGCATGGTTTATTCCTCCTTAAACTCTTAACCCGCAACAGCA ilvC reverse ATAC ilvD-f1 50 ATGCCTAAGTACCGTTCCG ilvD forward ilvD-r1 51 CGCCGAGCTCGAATTCTTAACCCCCCAGTTTCGATTT ilvD reverse

    TABLE-US-00008 TABLE S plasmids and primers used for in vivo butyric acid production through beta-oxidation reversal Plasmids pTH-atoB-fadB-egter pZS-fadM pZS-tesA pZS-tesB pZS-yciA pZS-ybgC pZS-ydil pCDF-P1-pct-P2-tdter Primers SEQ ID Name NO: Sequence fadM-f1 129 5′-TTAAAGAGGAGAAAGGTACCATGCAAACACAAATCAAAGT-3′ fadM-r1 52 5′-TGCCTCTAGCACGCGTCGTTTACTTAACCATCTGCTCCA-3′ tesA-f1 53 5′-TTAAAGAGGAGAAAGGTACCATGATGAACTTCAACAATGTTTTC-3′ tesA-r1 54 5′-TGCCTCTAGCACGCGTTCCGTTGCTTTATGAGTCATG-3 tesB-f1 55 5′-TTAAAGAGGAGAAAGGTACCATGAGTCAGGCGCTAAAAAA-3′ tesB-r1 56 5′-TGCCTCTAGCACGCGTAACAGCCGGACGGTTTTC-3 ybgC-f1 57 5′-TTAAAGAGGAGAAAGGTACCGTGAATACAACGCTGTTTCGAT-3′ ybgC-r1 58 5′-TGCCTCTAGCACGCGTTCACTGCTTAAACTCCGCGA-3′ yciA-f1 59 5′-TTAAAGAGGAGAAAGGTACCATGTCTACAACACATAACGTCCC-3′ yciA-r1 60 5′-TGCCTCTAGCACGCGTTTCAGTAAGCAGAAAGTCAAAAGC-3′ ydil-f1 61 5′-TTAAAGAGGAGAAAGGTACCATGATATGGAAACGGAAAATCA-3′ ydil-r1 62 5′-TGCCTCTAGCACGCGTGGTGACAACGTCACAAAATGG-3′ atoB-f1 63 5′-GAGGAATAAACCATGAAAAATTGTGTCATCGTCA-3′ atoB-r1 64 5′-CCCAAGCTTCGAATTCTTAATTCAACCGTTCAATCAC-3′ fadB-f1 65 5′-TAAGAATTCGAAGCTGCGGATTCAGGAGACTGACA-3′ fadB-r1 66 5′-GTTCGGGCCCAAGCTTTAAGCCGTTTTCAGGTCGC-3′ egter-f1 67 5′-AAACGGCTTAAAGCTAATAAGGAGGAATAAACCATGGCAATGTTTACCACGAC-3′ egter-r1 68 5′-GTTCGGGCCCAAGCTTGCGGCCGCTTATTGCTGTGCTGCGGAC-3′

    TABLE-US-00009 TABLE T plasmids and primers required for GPP biosynthesis via 2-oxoisovaleric acid, 2-oxoisocaproic acid and prenol starting from decarboxylative acyloin condensation between two pyruvates Plasmids pET-P1-ilvC-ilvD-P2-alsS-liuA pCDF-P1-bkdF-bkdG-bkdH-P2-lplA-lpdA1 pRSF-P1-leuA(G462D)-leuB-P2-leuC-leuD Primers SEQ ID Name NO: Sequence alsS-f1 44 AAGGAGATATACATATGACCAAAGCAACCAAAGAA alsS-r2 69 GCTCGGATAGGICATGTGATATTCCTCCTAGCTATGTTACAGGGCTTTGGTTTTCA TC ilvC-f1 48 AGGAGATATACCATGGCTAACTACTTCAATAC ilvC-r1 49 ACGGTACTTAGGCATGGTTTATTCCTCCTTAAACTCTTAACCCGCAACAGCAATAC ilvD-fl 50 ATGCCTAAGTACCGTTCCG ilvD-r1 51 CGCCGAGCTCGAATTOTTAACCCCCCAGTTTCGATTT liuA-f1 70 ATGACCTATCCGAGCCTGAA liuA-r1 71 TTACCAGACTCGAGGGTACCTTAGCGGGTTTCATTAAACAGT bkdF-fl 72 AGGAGATATACCATGACCGTTGAAAGCACCGC bkdF-r1 73 CATTTTTTCTGCCATGAGTTATTCCTCCTACAACTCTTAATTACCACCTTGACCGG bkdG-fl 74 ATGGCAGAAAAAATGGCAATCG bkdG-r1 75 GCTTGCTTCGGTCATGCTTTATTCCTCCTTTAATTGTTAATATGCCAGGCTACGATC bkdH-fl 76 ATGACCGAAGCAAGCGTTCG bkdH-r1 77 TTACCAGACTCGAGGGTACCTTAGCGGGTTTCATTAAACAGT lpIA-f1 78 AAGGAGATATACATATGTCCACATTACGCCTGCT lp1A-r1 79 TGCATCATTTGCCATCCATTATTCCTCCTTGGGTAACTACCTTACAGCCC lpdA1-f1 80 ATGGCAAATGATGCAAGCAC lpdA1-r1 81 TTACCAGACTCGAGGGTACCTTAATCATGGCTATGCAGCGG leuA(G462D)B- 82 AGGAGATATACCatgAGCCAGCAAGTCAT f11 leuA(G462D)B- 83 CACCTGgtCaAGCGCATCTTTACCGTGGC r11 leuA(G462D)B- 84 AAGATGCGCT tGacCAGGTG GATATCGTCGCTAA f12 leuA(G462D)B- 85 CGCCGAGCTCGAATTCTTACACCCCTTCTGCTACATA r12 leuA(G462D)B- 86 AGGAGATATACCatgAGCCAG f2 leuA(G462D)B- 87 CGCCGAGCTCGAATTCTTAC r2 leuCD-f1 88 CGATCGCTGACGTCGatgGCTAAGACGTTATACGAAAA leuCD-r1 89 TTACCAGACTCGAGGGTACCttaATTCATAAACGCAGGTTGTT

    TABLE-US-00010 TABLE U List of primers used in the construction of strain JST06(DE3) atoB.sup.CT5 SEQ ID Name NO: Sequence kan-homatoE-L 90 TTGGTTTAACGCTGTTCTGACGGCACCCCTAC AAACAGAAGGAATATAAACATATGAATATCCT CCTTA kan-ovcymatoB- 91 TCTGAAATTCTGCCTCGTGAGTGTAGGCTGGA R GCTGCTTCG cym-pCTC- 92 CGAAGCAGCTCCAGCCTACACTCACGAGGCAG atoB-ovkan-L AATTTCAGA atoBintrecomb- 93 GCCAGCCCGCTTTTTAAC R

    TABLE-US-00011 TABLE V Strains and plasmids Host strain Plasmid 1 Plasmid 2 Plasmid 3 Product JST06(DE3) atoB.sup.CT5 pCDF-P1-HMGS- pET-P2-magu_2507 Prenol ΔfadB aibAB-P2-liuC JST06(DE3) atoB.sup.CT5 pCDF-P1-HMGS- pET-P2-adhE2 Prenol ΔfadB aibAB-P2-liuC JST06(DE3) atoB.sup.CT5 pCDF-P1-HMGS- pET-P2-cbjALD Prenol ΔfadB aibAB-P2-liuC JST06(DE3) atoB.sup.CT5 pCDF-P1-HMGS- Prenol ΔfadB aibAB-P2-cbjALD-liuC JST06(DE3) atoB.sup.CT5 pCDF-P1-HMGS- Prenol ΔfadB aibAB-P2- magu_2507-liuC JST06(DE3) atoB.sup.CT5 pCDF-P1-HMGS- Prenol ΔfadB aibAB-P2-cbjALD- liuC-chnD JST06(DE3) atoB.sup.CT5 pCDF-P1-HMGS- Prenol ΔfadB aibAB-P2-cbjALD- liuC-yjgB JST06(DE3) atoB.sup.CT5 pCDF-P1-HMGS- Prenol ΔfadB aibAB-P2-cbjALD- liuC-yahK JST06(DE3) atoB.sup.CT5 pCDF-P1-HMGS- pRSF-P2-adhE2 pET-P1-idi-trGPPS2- Geraniol ΔfadB aibAB-P2-liuC P2-ges-ychB-mtipk JST06(DE3) atoB.sup.CT5 pCDF-P1-HMGS- pRSF-P2-cbjALD pET-P1-idi-trGPPS2- Geraniol ΔfadB aibAB-P2-liuC P2-ges-ychB-mtipk JST06(DE3) atoB.sup.CT5 pCDF-P1-HMGS- pET-P1-idi-trGPPS2- Geraniol ΔfadB aibAB-P2-cbjALD-liuC P2-ges-ychB-mtipk JST06(DE3) atoB.sup.CT5 pCDF-P1-HMGS- pET-P1-idi-trGPPS2- Geraniol ΔfadB aibAB-P2-cbjALD- P2-ges-ychB-mtipk liuC-yahK

    TABLE-US-00012 TABLE W Primers used SEQ ID Name NO: Sequence Description maqu_2507- 94 AAGGAGATATACATATGAACTACTTTCTGACCGGT maqu_2507 f2 forward maqu_2507- 95 TTGAGATCTGCCATATGTTACCAGTAAATGCCACGCAT maqu_2507 r2 reverse maqu_2507- 96 TTAAATTCCGGCATAATTACTCCITCACTGCCATATTACCAGTAAATGCCA maqu_2507 r3 CGCAT reverse cbjALD-f2 97 AAGGAGATATACATATGAATAAAGACACACTAATACCTA cbjALD forward cbjALD-r2 98 TTGAGATCTGCCATATGTTAGCCGGCAAGTACACATC cbjALD reverse cbjALD-r3 99 TTAAATTCCGGCATAATTACTCCTTCACTGCCATATTAGCCGGCAAGTACA cbjALD reverse CATC adhE2-f1 100 AAGGAGATATACATATGAAAGTTACAAATCAAAAAGAAC adhE2 forward adhE2-r1 101 TTGAGATCTGCCATATGTTAAAATGATTTTATATAGATATCCTTAAG adhE2 reverse hmgs-f1 102 AGGAGATATACCATGACCATCGGCATCGATAAG hmgs forward hmgs-r1 103 CGCCGAGCTCGAATTCTTATTCCGGACGATGATATTCG hmgs reverse aibA-f1 104 TCCGGAATAAGAATTGTAGGAGGAATACTACATGAAAACCGCACGTTGGT aibA forward G aibA-r1 105 CAGGGTTGCGCTCATGGITTATTCCTCCTTAAAATCTTATGCTGCACGAC aibA reverse GGGTCA aibB-f1 106 ATGAGCGCAACCCTGGATAT aibB forward aibB-r1 107 CCTGCAGGCGCGCCGAGCTCTTATGCACCAACCAGTGCAT aibB reverse liuC-f1 108 AAGGAGATATACATATGCCGGAATTTAAAGTTGATG liuC forward liuC-r1 109 TTGAGATCTGCCATATTAACGACCTTTATAAACCGGT liuC reverse chnD-f2 110 TTAATATGGCAGATCAGGAGGAATAGCTGATGCACTGCTATTGTGTTACC chnD forward chnD-r2 111 CTTTACCAGACTCGAGTCAATTTTCGTGCATCAGAAC chnD reverse yjgB-f1 112 TTAATATGGCAGATCAGGAGGAATAGCTGATGTCGATGATAAAAAGCTAT yjgB forward G yjgB-r1 113 CTTTACCAGACTCGAGTCAAAAATCGGCTTTCAACAC yjgB reverse yahK-f1 114 TTAATATGGCAGATCAGGAGGAATAGCTGATGAAGATCAAAGCTGTTGGT yahK forward G yahK-r1 115 CTTTACCAGACTCGAGTCAGTCTGTTAGTGTGCGATT yahK reverse

    TABLE-US-00013 TABLE X Plasmids for the synthesis of isoprenoids Name pACYC-P1-is pACYC-P1-pt30 pACYC-P1-qhs1-P2-ispA pACYC-P1-valc-P2-ispA pACYC-P1-ys1-P2-ispA pACYC-P1-fs-P2-ispA

    TABLE-US-00014 TABLE Y List of primers used in the construction of strain JST06(DE3) ΔfadE bktB.sup.CT5 ΔatoB fadB.sup.CT5 ΔfadA egter.sup.CT5 SEQ Construct/ ID PCR Product NO: Sequences kan-cymR- 130, F- P.sup.CT5-atoB- 116 GATGTTCAAGAAAACACCCGATAACTTTCGCTATCGGGTGTTTTTATTGAATCAAA (cat-sacB) GGGAAAACTGTCCATAT cat-sacB R- cassette GCATTGGCGGCGGTCAGGGAATTGCGATGGTGATTGAACGGTTGAATTAAAAAA with atoB TGAGACGTTGATCGGC homology kan-cymR- 117, F- P.sup.CT5-bktB 118 CAACAAACAGACAATCTGGTCTGTTTGTATTATGAACGAAGGAGAGATCTATGAC ΔatoB GCGTGAAGTGGTAGT bktB for R- replacement GATGTTCAAGAAAACACCCGATAACTTTCGCTATCGGGTGTTTTTATTGATCAGAT of atoB-cat- ACGCTCGAAGATGG sacB cassette cat-cymR- 119, F- P.sup.CT5-egTER 120 TTGACGGCGGTTTCAGCATTGCTGCAATGAACGAACTCGAACTGAAATAAGTGTA @ fabl GGCTGGAGCTGCTTCG cat-cymR- R- PCT5- AACAGAGATAACGGGCGGCAGAACGCCGCCCATCTTTACCAACAGAACGATTAT egTER with TTCAGTTCGAGTTCGTTTTATTGCTGTGCTGCGGAC fabl homology cat-cymR- 121, F- P.sup.CT5-egTER 122 CAACAAACAGACAATCTGGTCTGTTTGTATTATGAACGAAGGAGAGATCTATGGC @ fadBA AATGTTTACCACGAC ΔfadBA R- egTER for TTAAACCCGCTCAAACACCGTCGCAATACCCTGACCCAGACCGATACACATTATT replacement GCTGTGCTGCGGAC of fadB- (kansacB)- fadA cassette cat-cymR- 123, F1- P.sup.CT5--fadB- 124, ATCCTCCGGTTGAGCCAGCCCGTCCGGTTGGCGACCTGAAAACGGCTTAAATGA (kan-sacB)- 125, TTGAACAAGATGGATTGC facA @ 126 R1- fadBA TAAGGGGTGACGCCAAAGTATCAGAAGAACTCGTCAAGAAGG Overlap F2- extension of CCTTCTTGACGAGTTCTTCTGATACTTTGGCGTCACCCCTTA kan and R2- sacB ATCGGGGTGCGAATTGCATCGACAATGACAACCTGTTCCATTGTGACTCCATCAA with fadBA AGGGAAAACTGTCCATAT junction homology fadA 127, F- deletion 128 TTGAGCCAGCCCGTCCGGTTGGCGACCTGAAAACGGCTTAAGGAGTCACAATGG CCAAGTTGACCAGTG R- TTAAACCCGCTCAAACACCGTCGCAATACCCTGACCCAGACCGATACACATCAGT CCTGCTCCTCTGC

    TABLE-US-00015 TABLE Z Plasmids for expression of olivetolic acid synthesis pathways Name Synthesis pathway pRSF-P1-OLS-P2-OAC Olivetol synthase with olivetolic acid cyclase pCDF-P1-OLS-P2-OAC Olivetol synthase with olivetolic acid cyclase pET-F1-OLS-P2-OAC Olivetol synthase with olivetolic acid cyclase PET-F1-OLS-P2-OAC(Y27F) Olivetol synthase with olivetolic acid cyclase pRSF-P1-STC Polyketide synthase without cyclase pET-P1-STCS Polyketide synthase without cyclase pET-F1-STCS (T135S) Polyketide synthase without cyclase pET-F1-STCS (T198M) Polyketide synthase without cyclase pET-F1-STCS (I200C) Polyketide synthase without cyclase pET-F1-STCS (T135S T198M) Polyketide synthase without cyclase pET-F1-STCS (T135S I200C) Polyketide synthase without cyclase PET-F1-STCS (T198M I200C) Polyketide synthase without cyclase PET-F1-STCS (T135S T198M I200C) Polyketide synthase without cyclase pET-F1-dcaF-P2-OAC Polyketoacyl-CoA thiolase with olivetol cyclase pET-F1-fadAx-P2-OAC Polyketoacyl-CoA thiolase with olivetol cyclase PET-F1-ScfadA-P2-OAC Polyketoacyl-CoA thiolase with olivetol cyclase pET-P1-dcaF-P2-OAC Polyketoacyl-CoA thiolase with olivetol cyclase pET-F1-bktB-P2-OAC Polyketoacyl-CoA thiolase with olivetol cyclase

    TABLE-US-00016 TABLE AA Primers for constructions of plasmids used for demonstration of in vivo production of CBGA in E. coli. SEQ Name ID NO: Sequence MK-IF-fwd 131 AGGAGATATACCATGAGCCTGCCGTTTCTG MK-IF-rev 132 CGCCGAGCTCGAATTCTTAGCTGGTCCACGGCAG PMK-IF-fwd 133 GACCAGCTAAGAATTTAGGAGGAATAACTCATGAGCG PMK-1F-rev 134 CGCCGAGCTCGAATTCATTCCTCCTTTAATTGTTATTTGTC PMD-IF-fwd 135 AAGGAGGAATGAATTATGACCGTTTATACCGCAAG PMD-IF-rev 136 CGCCGAGCTCGAATTCTTATTCTTTCGGCAGACC idi-GB-fwd 137 GITTAACTTTAAGAAGGAGATATACatgCAAACGGAACACGTC idi-GB-rev 138 ATGGTTTATTCCTCCTTAAAttaTTTAAGCTGGGTAAATGCAG trGPPS2-IF- 139 TTTAAGGAGGAATAAACCATGGTGGAATTTGACTTTAACAAATATAT fwd GPPS2-GB- 140 GTGATGGCTGCTGCCTTAGTTCTGACGAAATGCAAC rev CymR-GB- 141 CTGCAGGTCGACAAGCTTGCAGGCGTATCACGAGGCAG fwd CymR-GB- 142 CATCTGCTGCTTCGCTCATATGAGATCTCTCCTTCGTTCATAATACAAAC rev NphB- 143 TCTCATATGAGCGAAGCAGCAGATG cumate-GB- fwd NphB- 144 AGCAGCGGTTTCTTTACCAGACTCGAGGTCAATCTTCCAGGCTATCAA cumate-GB- rev NphB-IF-fwd 145 AAGGAGATATACATAATGAGCGAAGCAGCAGAT NphB-IF-rev 146 TTACCAGACTCGAGGTCAATCTTCCAGGCTATCAA

    TABLE-US-00017 TABLE AB   Plasmids for expression of prenyitransferase and CBGA in vivo synthesis in E. coli Name pET-P1-idi-trGPPS2-P2-NphB pET-P1-idi-trGPPS2-CT5-NphB pET-P1-idi-trGPPS2-CT5-CnqP3 pET-P1-idi-trGPPS2-CT5-CphB pET-P1-idi-trGPPS2-CT5-SCO7190 pET-P1-idi-trGPPS2-CT5-SCO7190(R65S) pET-P1-idi-trGPPS2-CT5-SCO7190(E278G)