NANOLIPOSOME-MICROBUBBLE CONJUGATE HAVING COMPLEX OF CAS9 PROTEIN, GUIDE RNA INHIBITING SRD5A2 GENE EXPRESSION AND CATIONIC POLYMER ENCAPSULATED IN NANOLIPOSOME AND COMPOSITION FOR AMELIORATING OR TREATING HAIR LOSS CONTAINING THE SAME

20210369859 · 2021-12-02

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a nanoliposome-microbubble conjugate, in which a complex of a Cas9 protein, a guide RNA inhibiting SRD5A2 gene expression and a cationic polymer is encapsulated in a nanoliposome, and to a composition for the amelioration or treatment of hair loss containing the same. Currently, drugs used for the treatment of hair loss cause serious side effects such as loss of libido or erectile dysfunction, and hair loss progresses again when drug treatment is stopped. However, when the nanoliposome-microbubble conjugate of the present invention is used, the expression of SRD5A2 inducing hair loss can be fundamentally suppressed, and the treatment of male hair loss can be performed very effectively.

Claims

1. A nanoliposome-microbubble conjugate, in which a complex of a Cas9 protein, a guide RNA inhibiting SRD5A2 gene expression and a cationic polymer is encapsulated in a nanoliposome.

2. The nanoliposome-microbubble conjugate of claim 1, wherein the guide RNA inhibiting SRD5A2 gene expression comprises a base sequence of SEQ. ID. NO: 1, 2, 3, 4 or 5.

3. The nanoliposome-microbubble conjugate of claim 1, wherein the nanoliposome includes lecithin, cholesterol, a cationic phospholipid and a metal chelating lipid.

4. The nanoliposome-microbubble conjugate of claim 1, wherein the nanoliposome is configured to bind to a monoclonal or polyclonal antibody able to recognize at least one protein selected from the group consisting of endoglin, CD34, keratin 18 and IL-6 (interleukin 6), which are expressed in dermal papilla cells.

5. The nanoliposome-microbubble conjugate of claim 1, wherein the microbubble includes an amphoteric phospholipid, an anionic phospholipid, cholesterol, a cationic phospholipid and a disulfide-group-containing lipid.

6. A composition for ameliorating or treating hair loss, containing the nanoliposome-microbubble conjugate of claim 1.

7. A method of preparing the nanoliposome-microbubble conjugate of claim 1, the method comprising: forming a nanoliposome-microbubble conjugate by mixing a nanoliposome with a microbubble, the nanoliposome being prepared by: S1) preparing a complex of a Cas9 protein, a guide RNA inhibiting SRD5A2 gene expression and a cationic polymer and preparing a lipid film composition by mixing lecithin, cholesterol, a cationic phospholipid and a metal chelating lipid in chloroform; S2) adding the lipid film composition with the complex of the Cas9 protein, the guide RNA inhibiting SRD5A2 gene expression and the cationic polymer and performing sonication; S3) subjecting the sonicated lipid film composition to freezing-thawing and then sonication; S4) centrifuging the lipid film composition sonicated in S3 and recovering a nanoliposome that is precipitated; and S5) allowing an antibody to bind to the precipitated nanoliposome obtained in S4 using a crosslinking agent, and the microbubble being prepared by: A) preparing a lipid film composition by mixing an amphoteric phospholipid, cholesterol, an anionic lipid, an amine-group-containing lipid and a disulfide-group-containing lipid in chloroform; B) adding a glucose solution to step A and performing sonication; C) subjecting the lipid film composition sonicated in step B to freezing-thawing and then sonication; and D) preparing a microbubble by introducing a hydrophobic gas into the lipid film composition sonicated in step C.

Description

DESCRIPTION OF DRAWINGS

[0095] FIG. 1 schematically shows the process by which, when a nanoliposome-microbubble conjugate is delivered to dermal papilla cells (DPCs) and sonication is performed, the cell membrane is perforated and the microbubble collapses, whereby the nanoliposome enters the cells;

[0096] FIG. 2 shows the results of confirming whether the SRD5A2 gene is actually cleaved using a hybrid of in-vitro-transcribed sgRNA and purified Cas9 protein prepared through binding in a laboratory (Cas9/sgRNA hybrid, Cas9-RNP);

[0097] FIG. 3 shows the results of evaluation of size and dispersivity of the nanoliposome of Comparative Example 1, the microbubble of Comparative Example 2 and the nanoliposome-microbubble conjugate of Example 2 through dynamic light scattering (DLS);

[0098] FIG. 4 shows confocal laser scanning microscopy images of the nanoliposome-microbubble conjugate by introducing RITC to the nanoliposome and FITC to the microbubble in order to confirm the conjugation of the nanoliposome and the microbubble in Example 2;

[0099] FIG. 5 shows the results of echogenicity in order to confirm whether the hydrophobic gas is maintained in the nanoliposome of Comparative Example 1, the microbubble of Comparative Example 2 and the nanoliposome-microbubble conjugate of Example 2;

[0100] FIG. 6 shows the results of measurement of efficiency of the single-stranded guide RNA according to the present invention (sgRNA 1˜5, SEQ. ID. NOS: 1˜5 in order) through introduction thereof into the plasmid system and then mRNA expression of SRD5A2 in dermal papilla cells;

[0101] FIG. 7 shows confocal laser scanning microscopy images after treatment of dermal papilla cells with the nanoliposome-microbubble conjugate and then immunostaining with an antibody to Cas9 in order to confirm whether the nanoliposome-microbubble conjugate of the present invention is introduced into dermal papilla cells;

[0102] FIG. 8A schematically shows the cleavage of one base sequence after the PAM structure in the SRD5A2 gene through treatment of dermal papilla cells with the nanoliposome-microbubble of Example 2 according to the present invention, and FIG. 8B shows the results of evaluating the effect of inhibiting SRD5A2 mRNA expression after treatment of cells with the nanoliposome-microbubble of Example 2 and then sonication;

[0103] FIG. 9 shows the results of evaluation of the extent of SRD5A2 protein expression after treatment of dermal papilla cells with the nanoliposome-microbubble conjugate of Example 2 according to the present invention;

[0104] FIG. 10 shows confocal laser scanning microscopy images of the state of survival of dermal papilla cells when dermal papilla cells are pretreated with the nanoliposome-microbubble conjugate of Example 2 according to the present invention and then treated with testosterone;

[0105] FIG. 11 shows the results of WST-1 assay of the cell survival and proliferation when dermal papilla cells are pretreated with the nanoliposome-microbubble conjugate of Example 2 according to the present invention and then treated with testosterone;

[0106] FIG. 12 shows the results of western blotting of the extent of conversion into dihydrotestosterone upon treatment of dermal papilla cells with testosterone after pretreatment with the nanoliposome-microbubble conjugate of Example 2 according to the present invention;

[0107] FIG. 13 shows the results of measurement of caspase-3 activity in order to evaluate apoptosis upon treatment of dermal papilla cells with testosterone after pretreatment with the nanoliposome-microbubble conjugate of Example 2;

[0108] FIG. 14 shows the results of measurement of the activity of a hybrid of a Cas9 protein and a guide RNA by mixing DNA extracted from mouse dermal tissue with a Cas9 protein and a single-stranded mouse guide RNA (sgRNA m1˜5: SEQ. ID. NOS: 36˜40 in order);

[0109] FIG. 15 shows images confirming whether a hair growth effect appears after repeated treatment of hair-loss-induced mice with the nanoliposome-microbubble conjugate of Example 2 according to the present invention once (test group 1), three times (test group 2) and five times (test group 3); and

[0110] FIG. 16 shows the results of evaluation of the extent of SRD5A2 mRNA expression in mouse dermal tissue after treatment of a mouse with the nanoliposome-microbubble of Example 2 according to the present invention.

[0111] FIG. 17 shows the structure of a plasmid Cas guide vector;

[0112] FIG. 18 shows the structure of a pET28a/Cas9-Cys plasmid (Addgene plasmid #53261); and

[0113] FIG. 19 schematically shows a process of preparing a half-antibody obtained from [Wu S et al].

BEST MODE

[0114] A better understanding of the present invention will be given through the following examples. However, the present invention is not limited to the examples described herein but may be embodied in other forms. Furthermore, the examples are set forth to provide those skilled in the art with an understanding of the spirit of the present invention so that the teachings herein are thorough and complete.

Example 1. Preparation of Guide RNA and Purification of Cas9 Protein

Example 1-1. Preparation of Guide RNA Targeting SRD5A2 Gene

[0115] A guide RNA targeting a KRAS gene was prepared through an in-vitro transcription process using T7 RNA polymerase (NEB). To this end, a 140 b.p. DNA template was prepared through a PCR process using, as shown in Table 4 below, a ‘69-mer forward primer’ comprising the T7 promoter sequence and SEQ. ID. NO: 6: GTGTACTCACTGCTCAATCG, SEQ. ID. NO: 7: AGGGGCCGAACGCTTGTAAT, SEQ. ID. NO: 8: ACTATATATTGCGCCAGCTC, SEQ. ID. NO: 9: CACAGACATACGGTTTAGCT, SEQ. ID. NO: 10: TCCATTCAATGATCTCACCG, SEQ. ID. NO: 21: ACAGACATGCGGTTTAGCGT, SEQ. ID. NO: 22: CGCGCAATAAACCAGGTAAT, SEQ. ID. NO: 23: TCCATTCAATAATCTCGCCC, SEQ. ID. NO: 24: TCCTGGGCGAGATTATTGAA, SEQ. ID. NO: 25: AGCCCGGAGAGGTCATCTAC, corresponding to the 20 b.p. sequence of the SRD5A2 gene, a ‘20-mer reverse primer’ comprising the scaffold sequence to bind to the guide RNA, and a plasmid Cas guide vector (OriGene). This DNA template, an rNTP mixture, a T7 RNA polymerase, and an RNAase inhibitor were subjected to transcription at 37° C. for 2 hr, thus producing a guide RNA, followed by RNA purification, thereby increasing RNA purity. [0116] The T7 promoter sequence corresponds to the underlined portion of Table 4 below. [0117] The bold-type sequence of Table 1 is a site that recognizes the SRD5A2 gene, in which the guide RNA is synthesized by recognizing the template (plasmid Cas guide vector) of the scaffold sequence, and the base sequence thereof and the sequence of the final guide RNA are the same (in which T is substituted to U). [0118] GTTTTAGAGCTAGAAATAGCA after the F primer is a portion of the scaffold sequence. [0119] The plasmid Cas guide vector includes the template of the scaffold sequence. [0120] The structure of the plasmid Cas guide vector used in this test is as shown in FIG. 17. Source: http://www.origene.com/CRISPR-CAS9/Detail.aspx?sku=GE100001

TABLE-US-00004 TABLE 4 Human sgHNA1 GCGGCCTCTAATACGACTCACTATAGGGGTGTAC SRD5A2 TCACTGCTCAATCGGTTTTAGAGCTAGAAATAGC forward A primer sgRNA2 GCGGCCTCTAATACGACTCACTATAGGGAGGGGC CAGACGCTTGTAATGTTTTAGAGCTAGAAATAGC A sgRNA3 GCGGCCTCTAATACGACTCACTATAGGGACTATA TTATGCGCCAGCTCGTTTTAGAGCTAGAAATAGC A sgRNA4 GCGGCCTCTAATACGACTCACTATAGGGCACAGA CATACGGTTTAGCTGTTTTAGAGCTAGAAATAGC A sgRNA5 GCGGCCTCTAATACGACTCACTATAGGGTCCATT CTAAGATCTCACCGGTTTTAGAGCTAGAAATAGC A Mouse sgRNAm1 GCGGCCTCTAATACGACTCACTATAGGGACAGAC SRD5A2 ATGCGGTTTAGCGTGTTTTAGAGCTAGAAATAGC forward A primer sgRNAm2 GCGGCCTCTAATACGACTCACTATAGGGCGCGCA ATAAACCAGGTAATGTTTTAGAGCTAGAAATAGC A sgRNAm3 GCGGCCTCTAATACGACTCACTATAGGGCGCGCA ATAAACCAGGTAATGTTTTAGAGCTAGAAATAGC A sgRNAm4 GCGGCCTCTAATACGACTCACTATAGGGTCCTGG GCGAGATTATTGAAGTTTTAGAGCTAGAAATAGC A sgRNAm5 GCGGCCTCTAATACGACTCACTATAGGGAGCCCG GAGAGGTCATCTACGTTTTAGAGCTAGAAATAGC A Reverse primer AAAAGCACCGACTCGGTGCCA

[0121] Through the above experiment, the guide RNA having the base sequence of Table 5 below was prepared.

TABLE-US-00005 TABLE 5 SEQ. ID. NO: 31 GUGUACUCACUGCUCAAUCGUUUUAGAGCUAGAA (SRD5A2 target) AUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA CUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU U SEQ. ID. NO: 32 AGGGGCCGAACGCUUGUAAUGUUUUAGAGCUAGA (SRD5A2 target) AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA ACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU UU SEQ. ID. NO: 33 ACUAUAUAUUGCGCCAGCUCGUUUUAGAGCUAGA (SRD5A2 target) AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA ACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU UU SEQ. ID. NO: 34 CACAGACAUACGGUUUAGCUGUUUUAGAGCUAGA (SRD5A2 target) AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA ACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU UU SEQ. ID. NO: 35 UCCAUUCAAUGAUCUCACCGGUUUUAGAGCUAGA (SRD5A2 target) AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA ACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU UU SEQ. ID. NO: 36 ACAGACAUGCGGUUUAGCGUGUUUUAGAGCUAGA (SRD5A2 target) AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA ACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU UU SEQ. ID. NO: 37 CGCGCAAUAAACCAGGUAAUGUUUUAGAGCUAGA (SRD5A2 target) AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA ACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU UU SEQ. ID. NO: 38 UCCAUUCAAVAAUCUCGCCCGUUUUAGAGCUAGA (SRD5A2 target) AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA ACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU UU SEQ. ID. NO: 39 UCCUGGGCGAGAUUAUUGAAGUUUUAGAGCUAGA (SRD5A2 target) AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA ACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU UU SEQ. ID. NO: 40 AGCCCGGAGAGGUCAUCUACGUUUUAGAGCUAGA (SRD5A2 target) AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA ACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU UU

[0122] The final guide RNA recognizes the base sequences of SEQ. ID. NOS: 11 to 15 of the human SRD5A2 gene as targets, and recognizes the base sequences of SEQ. ID. NOS: 26 to 30 of the mouse SRD5A2 gene as targets.

Example 1-2. Purification of Cas9 Protein

[0123] A pET28a/Cas9-Cys plasmid (Addgene plasmid #53261) was transformed into Escherichia coli (DH5α) and a Cas9 protein was overexpressed in 0.5 mM IPTG (isopropyl β-D-1-thiogalactopyranoside) at 28° C., and the Cas9-protein-overexpressed Escherichia coli was sonicated in a lysis buffer (20 mM Tris-Cl at pH 8.0, 300 mM NaCl, 20 mM imidazole, 1× protease inhibitor cocktail, 1 mg/mL lysozyme). The lysate obtained after sonication was centrifuged to afford a liquid containing the protein. The Cas9 protein was separated from the liquid using a Ni-NTA agarose bead extraction process (elution buffer: 20 mM Tris-Cl at pH 8.0, 300 mM NaCl, 300 mM imidazole, 1×protease inhibitor cocktail). The protein thus separated was dialyzed in a storage buffer (50 mM Tris-HCl at pH 8.0, 200 mM KCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, 20% glycerol) (cutoff 10K), thereby removing imidazole, after which the protein concentration was quantified (using a BCA process). [0124] The structure of pET28a/Cas9-Cys plasmid (Addgene plasmid #53261): FIG. 18, Source: Addgene (http://www.addgene.org/)

Example 2. Production of Nanoliposome-Microbubble Conjugate

Example 2-1. Production of Nanoliposome

[0125] A complex was prepared by mixing the Cas9 protein prepared in Example 1, guide RNA, and polyethyleneimine at a molar ratio of 1:2:50. Here, as the guide RNA, human SEQ. ID. NO: 31, 32, 33, 34 or 35 including the scaffold sequence (SEQ. ID. NO: 1, 2, 3, 4 or 5 included therein) and mouse SEQ. ID. NO: 36, 37, 38, 39 or 40 (SEQ. ID. NO: 16, 17, 18, 19 or 20 included therein) were used.

[0126] Next, lecithin (Sigma Aldrich), DOGS-NTA-Ni lipid (Avanti polar lipids), cholesterol (Sigma Aldrich) and DPPE (Sigma Aldrich) were mixed at a molar ratio of 2:1:0.1:0.05 in chloroform and then made into a lipid film using a rotary evaporator.

[0127] The lipid film was added with the Cas9 protein/guide RNA/polyethyleneimine complex and mixed through sonication. A freezing-thawing cycle using liquid nitrogen was repeated five times, and then sonication (probe mode) was performed, thus preparing a uniform nanoliposome composition having a smaller size.

[0128] Thereafter, the nanoliposome composition (total amount of lipid: 20.43 mg, and total amount of Cas9 and gRNA: 0.1 mg) precipitated through centrifugation was recovered and mixed with 2.5 mg of sulfo-SMCC (ProteoChem), serving as a linker for antibody binding, at room temperature, that is, 25° C., for 2 hr in PBS.

[0129] Next, a purified antibody was provided to bind to the nanoliposome, and the antibody for binding to the nanoliposome was a monoclonal or polyclonal antibody able to recognize endoglin, CD34, keratin 18 and IL-6, which are known to be overexpressed in dermal papilla cells. In particular, an endoglin antibody (Anti-endoglin) was selected, mixed with 2-mercaptoethylamine (Thermo) in 10 mM EDTA at 37° C. for 2 hr, and then purified with a PD-10 desalting column (GE Healthcare) (mixing of endoglin antibody and 2-mercaptoethylamine at a ratio of 1 mg:0.6 mg). As such, the antibody purification process is described through the drawing of FIG. 19 (the antibody comprising the same two Y-shaped chains was added with 2-mercaptoethylamine to afford a half-antibody, which was then purified and bound to the nanoliposome). * The source of FIG. 19: Wu S et al., Highly sensitive nanomechanical immunosensor using half antibody fragments, Anal. Chem., 2014, 86(9), 4271-4277.

[0130] As seen in FIG. 19, when the half-antibody is made, —SH is produced. Since —NH2 is present in the DPPE lipid of the nanoliposome, it reacts with sulfo-SMCC (linker), and thus the sulfo-SMCC of the nanoliposome and the —SH of the half-antibody bind to each other. In this way, the ability of the nanoliposome to recognize dermal papilla cells can be doubled through the preparation of the half-antibody.

[0131] 1 mg of the antibody (anti-endoglin) thus purified was mixed with the linker-bound nanoliposome composition at 4° C. for 12 hr, after which the precipitate resulting from centrifugation was recovered, thereby obtaining an antibody-bound nanoliposome able to selectively recognize dermal papilla cells.

[0132] In order to conjugate the nanoliposome to the microbubble by introducing a thiol group to DPPE (cationic phospholipid) of the lipid structure of the nanoliposome having the purified antibody bound thereto by the linker, 2-iminothiolane hydrochloride (pH 8.2) (powder phase, added in an amount of 0.5 mg relative to 20.53 mg/mL of nanoliposome) was added, mixed at 25° C. for 2 hr, and centrifuged, and thus the resulting precipitate was recovered and dispersed in a 5% (w/v) glucose aqueous solution.

Example 2-2. Production of Microbubble

[0133] 15.4 mg of DPPC (1,2-dipalmitoyl-sn-glyerto-3-phosphocholine, Sigma Aldrich), 3.48 mg of cholesterol (Sigma Aldrich), 1 mg of DCP (dicetyl phosphate, Sigma-Aldrich), 1.2 mg of DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine, Sigma Aldrich), and 5 mg of DSPE-PEG-sPDP (1,2-distearoyl-sn-phosphoethanolamine-N-[PDP(polyethylene glycol)], Avanti polar) were mixed in 1 mL of chloroform and then made into a lipid film for microbubble synthesis using a rotary evaporator.

[0134] Thereafter, 1 mL of a 5% (w/v) glucose aqueous solution was added thereto and mixed together through sonication. A freezing-thawing cycle using liquid nitrogen was repeated three times, sonication (probe mode) and then filling with an SF.sub.6 gas were conducted, thereby preparing a microbubble composition in a dispersed phase.

Example 2-3. Formation of Nanoliposome-Microbubble

[0135] 1 mL of the nanoliposome (20.53 mg/mL) prepared in Example 2-1 and 0.5 mL of the microbubble (26.08 mg/mL) of Example 2-2 were mixed (at a volume ratio of 2:1), whereby the nanoliposome and the microbubble were dispersed in the glucose aqueous solution.

[0136] Thereafter, strong vibration [Mixing frequency: 4500 tr/mn (cpm: m.sup.3 per min)] was applied for 15 sec using a machine (Tianjin Iris), thus forming a nanoliposome-microbubble conjugate, which was then refrigerated in the state of being dispersed in a 5% glucose aqueous solution.

[0137] The nanoliposome-microbubble conjugate thus obtained is referred to as a ‘nanoliposome-microbubble conjugate of Example 2’.

Comparative Example 1. Antibody-Bound Nanoliposome

[0138] A nanoliposome (not conjugated with a microbubble) was prepared in the same manner as in Example 2-1, with the exception that only the procedures up to antibody binding were performed and introduction of a thiol group was not carried out, and such a nanoliposome was used as the composition of Comparative Example 1.

Comparative Example 2. Microbubble

[0139] A microbubble was prepared in the same manner as in Example 2-2 and was used as the composition (not conjugated with a nanoliposome) of Comparative Example 2.

Comparative Example 3. Nanoliposome

[0140] A nanoliposome was prepared in the same manner as in Example 2-1, with the exception that an antibody was not bound thereto, and such a nanoliposome was used as the composition of Comparative Example 3 (antibody-unbound nanoliposome).

Comparative Example 4. Conjugate of Antibody-Bound Nanoliposome Including Scramble Guide RNA and Microbubble

[0141] A nanoliposome comprising the scramble guide RNA sequence (SEQ. ID. NO: 41: GCACUACCAGAGCUAACUCA) as guide RNA was prepared using the nanoliposome preparation method according to the present invention. The scramble guide RNA sequence, which is a sequence that does not bind to any site of the DNA, was prepared for use as a comparative example. The nanoliposome including the scramble guide RNA was introduced with a thiol group (Example 2-2) and conjugated to the microbubble (Example 2-3), thereby preparing a conjugate of the antibody-bound nanoliposome including the scramble guide RNA and the microbubble.

[0142] Meanwhile, the nanoliposome-microbubble conjugate of Example 2 having no antibody is considered to be remarkably decreased in targeting effectiveness, and thus was not provided as a comparative example in the present invention.

Test Example 1. Evaluation of Activity and Function of Guide RNA During Preparation of Nanoliposome-Microbubble Conjugate

Test Example 1-1. Evaluation of Activity of Guide RNA and Cas9 Protein

[0143] Dermal papilla cells (DPCs) used for this test are Human Follicle Dermal Papilla Cells (HFDPC), and were purchased from Promocell. These cells were cultured in a 5% CO.sub.2 incubator at 37° C. for 24 hr or more in a culture medium obtained by mixing Follicle Dermal Papilla Cell Growth Medium and Follicle Dermal Papilla Cell Growth Medium SupplementMix products of Promocell and were then used for testing.

[0144] In order to evaluate the preparation of guide RNA and the purification of Cas9 protein, dermal papilla cells (DPC) were collected, DNA was extracted therefrom, and a template fragment (500 bp) was made through a PCR process using a forward primer: TTGCCCTCCCCACTTTCTGC and a reverse primer: TCCCACCTTCCGGGTATTGC. Then, the fragment was introduced with the purified Cas9 protein alone or with a combination of purified Cas9 protein and sgRNA3 (SEQ. ID. NO: 33, FIG. 2).

[0145] With reference to FIG. 2, in the test group using the purified Cas9 protein alone, the fragment was not cleaved with the Cas9 protein due to the absence of guide RNA, and in the test group using the combination of purified Cas9 protein and sgRNA3 (SEQ. ID. NO: 33), the fragment was cleaved with the Cas9 protein.

Test Example 1-2. Evaluation of Size of Nanoliposome-Microbubble Conjugate

[0146] The sizes and surface charges of the nanoliposome, microbubble and nanoliposome-microbubble conjugate prepared in the present invention were measured through dynamic light scattering (DLS). The results based on the inclusion of the guide RNA of SEQ. ID. NO: 33 are shown in Table 6 below and in FIG. 3.

TABLE-US-00006 TABLE 6 Average Surface nanoparticle Classification charge (mV) size (nm) Example 2 +2.13 955 Comparative Example 1 +1.78 78 Comparative Example 2 −0.89 1106

[0147] In order to deliver the nanoliposome including the guide RNA into dermal papilla cells, a negative (−) surface charge value has to be changed to a positive charge. With reference to Table 6 and FIG. 3, the nanoliposome of Example 2 has a positive surface charge value. Also, the nanoliposome of Comparative Example 1 and the microbubble of Comparative Example 2 were not greatly changed in size and surface charge compared to the nanoliposome-microbubble conjugate of Example 2.

[0148] Meanwhile, in order to evaluate whether the composition of Example 2 was provided in the form of a nanoliposome-microbubble conjugate, the state of conjugation of which was maintained, rather than a mixture of a nanoliposome and a microbubble, imaging was performed using confocal laser scanning microscopy. To this end, a RITC (red) fluorescent dye was added upon the preparation of the nanoliposome of Example 2-1 and a FITC (green) fluorescent dye was added upon the synthesis of the microbubble of Example 2-2. Thereby, the nanoliposome-microbubble conjugate of Example 2, ultimately prepared as the nanoliposome-microbubble conjugate in Example 2-3, was analyzed through electron microscopy and fluorescence imaging. The results are shown in FIG. 4, from which the nanoliposome was confirmed to be efficiently conjugated to the microbubble.

Test Example 1-3. Evaluation of Echogenicity of Nanoliposome-Microbubble Conjugate

[0149] In order to evaluate whether the gas in the microbubble is maintained even after conjugation of the nanoliposome and the microbubble, the echogenicity of the nanoliposome-microbubble conjugate of Example 2 was measured using a clinical sonicator (Philips). Echogenicity is the phenomenon in which an ultrasound image appears white or black depending on the degree of transmission of the ultrasound. Since the nanoliposome contains no gas therein, echogenicity does not occur upon sonication, but the echogenicity of the microbubble containing the gas therein is confirmed. This experiment is based on the efficiency of propagation of ultrasound through the hydrophobic gas in the microbubble because ultrasound radiation travels poorly through the air but is easily transmitted through a liquid or solid. Accordingly, a probe was brought into contact with a test specimen, the ultrasound was generated, and the reflected ultrasound was received to confirm the image.

[0150] The mechanical index (MI) of the clinical sonicator for measuring echogenicity was 0.07, and a 2% agarose gel able to contain the nanoliposome-microbubble conjugate was made and measured with a 5˜12 MHz rectangular ultrasonic probe.

[0151] The results thereof are shown in FIG. 5. When comparing the microbubble of Comparative Example 2 with the nanoliposome-microbubble conjugate of Example 2, there was no change in echogenicity, and thus it can be concluded that the nanoliposome-microbubble conjugate of Example 2 was configured such that the nanoliposome was efficiently conjugated to the microbubble containing therein SF.sub.6 gas in intact form.

Test Example 2. Measurement of SRD5A2 Expression and Activity

Test Example 2-1. Comparison of SRD5A2 Expression Efficiency of Guide RNA

[0152] In order to compare the efficiencies of sgRNA 1, 2, 3, 4 and 5 (SEQ. ID. NOS: 1, 2, 3, 4 and 5) in dermal papilla cells (DPCs), the pCas plasmid (the pCas-Guide plasmid of Example 1-1) was introduced with SEQ. ID. NOS: 6, 7, 8, 9 and 10, and the dermal papilla cells were treated therewith.

[0153] The treated cells were collected, total RNA was extracted therefrom using TRIzol (Invitrogen), and cDNA was synthesized using SuprimeScript RT premix 2× (GeNetBio).

[0154] Real-time PCR for measuring mRNA expression of SRD5A2 was measured using SYBR green 2× Premix (Applied Biosystems) and an AB Step One Plus real-time PCR system (Applied Biosystems). As such, the base sequences of primers used for the detection were as follows.

TABLE-US-00007 SRD5A2 sense: GGCCTCTTCTGCGTAGATTA SRD5A2 antisense: CACCCAAGCTAAACCGTATG GAPDH sense: GCACCGTCAAGGCTGAGAA GAPDH antisense: AGGGATCTCGCTCCTGGAA

[0155] The above results are shown in FIG. 6. Based on the results of comparison of efficiency of sgRNA in DPCs, sgRNA 3 (SEQ. ID. NO: 3) most efficiently reduced the SRD5A2 mRNA expression, and thus these including the guide RNA of SEQ. ID. NO: 3 were used in all subsequent tests.

Test Example 2-2. Evaluation of Introduction of Nanoliposome-Microbubble Conjugate into Dermal Papilla Cells

[0156] In order to evaluate whether the nanoliposome-microbubble conjugate of Example 2 was introduced into dermal papilla cells, DPCs were treated for 2 hr with the nanoliposome-microbubble conjugate of Example 2 at a concentration of Cas9:gRNA (24.7 μg:8.6 μg-24.7 μg of Cas9 and 8.6 μg of gRNA in total broth), followed by immunostaining with an antibody to Cas9. The confocal laser scanning microscopy images thereof are shown in FIG. 7. For immunostaining, the intracellular Cas9 protein was labeled using a Cas9 primary antibody (Rabbit) and then a secondary antibody CFL-488 and was then imaged by confocal laser scanning microscopy. The results based on the inclusion of the guide RNA of SEQ. ID. NO: 33 are shown in FIG. 7.

[0157] In FIG. 7, DAPI shows the DNA-stained image, Cas9 shows the CFL-4880-stained image of the Cas9 protein, and Merge shows the image of combination thereof. With reference to FIG. 6, the Cas9 protein can be seen to be efficiently injected into the nuclei of dermal papilla cells due to treatment with the nanoliposome-microbubble conjugate of Example 2.

[0158] Meanwhile, the position of the human genomic DNA recognized by the guide RNA of SEQ. ID. NO: 3 is shown in FIG. 8A (green underline). With reference thereto, by virtue of the nanoliposome-microbubble conjugate according to the present invention, 20 base sequences were recognized by the guide RNA, and the PAM (protospacer adjacent motif) (AGG sequence) site was cleaved with the Cas9 protein, whereby the cleavage of one DNA sequence during self-repair of the cleaved DNA was confirmed (the genomic DNA was directly extracted from the cells treated with the nanoliposome-microbubble of Example 2, and the position of the cleaved sequence shown in FIG. 8A was identified through a sequencing service provided by Bionia Inc.).

Test Example 2-3. Determination of SRD5A2 Expression—Measurement of mRNA Expression Level

[0159] The dermal papilla cells were treated for 2 hr with the nanoliposome-microbubble prepared in the present invention at a concentration of Cas9:gRNA (24.7 μg:8.6 μg), after which total RNA was extracted from the collected cells using TRIzol (Invitrogen), and cDNA was synthesized using SuprimeScript RT premix 2× (GeNetBio).

[0160] Real-time PCR for measuring mRNA expression of SRD5A2 was performed using SYBR green 2× Premix (Applied Biosystems) and an AB Step One Plus real-time PCR system (Applied Biosystems). The base sequences of primers used for the detection were as follows.

TABLE-US-00008 SRD5A2 sense: GGCCTCTTCTGCGTAGATTA SRD5A2 antisense: CACCCAAGCTAAACCGTATG GAPDH sense: GCACCGTCAAGGCTGAGAA GAPDH antisense: AGGGATCTCGCTCCTGGAA

[0161] The above results are shown in FIG. 8B, from which the mRNA expression of SRD5A2 can be confirmed to be remarkably decreased in dermal papilla cells due to the treatment with the nanoliposome-microbubble conjugate of Example 2.

Test Example 2-4. Determination of SRD5A2 Expression—Measurement of Protein Expression Level

[0162] The nanoliposome-microbubble conjugate of Example 2 was treated under the same conditions as the mRNA expression test, with the exception that the number of times the treatment with the nanoliposome-microbubble conjugate was repeated was varied in the range from 1 to 5 per day. The dermal papilla cell (DPC) test groups were collected, and these cells were treated with a RIPA buffer (Sigma) and the protein was extracted therefrom, after which the expression of SRD5A2 protein was identified using an SRD5A2 ELISA kit (Antibodies-online). Here, the compositions of Comparative Examples 1 to 4 were subjected to the same test.

[0163] Consequently, as the number of times the process using the composition of Example 2 according to the present invention is repeated increases, the SRD5A2 protein expression level decreases, and this decrease is maintained for 5 days or more, unlike the group (control) not treated with the nanoliposome-microbubble conjugate, as is apparent from Table 7 below and FIG. 9.

TABLE-US-00009 TABLE 7 SRD5A2 protein expression (fold) on the Classification 5.sup.th day of cell treatment Non-treated group 1.00 Group treated 5 times of 0.43 Example 2 Group treated 5 times of 0.75 Comparative Example 1 Group treated 5 times of 0.99 Comparative Example 2 Group treated 5 times of 0.85 Comparative Example 3 Group treated 5 times of 0.98 Comparative Example 4

Test Example 3. Measurement of Cell Viability and Increment Rate

Test Example 3-1. Live/Dead Cells

[0164] The dermal papilla cells were repeatedly treated for 2 hr with the nanoliposome-microbubble conjugate finally obtained in Example 2 at a concentration of Cas9:gRNA (24.7 μg:8.6 μg-24.7 μg of Cas9 and 8.6 μg of gRNA in total broth) once a day for a total of five days (treatment standard once a day, the same conditions as in Test Example 2-4). Thereafter, in order to induce the apoptosis conditions of dermal papilla cells causing hair loss, the dermal papilla cells used for testing were treated with 2 μm Calcein AM (Calcein acetoxymethyl ester) and 4 μM EthD-1 (Ethidium homodimer-1) at 25° C. for 30 min using a new medium.

[0165] Cell survival and apoptosis were evaluated by subjecting the cells to fluorescence staining using a LIVE/DEAD Viability/Cytotoxicity kit (Thermo) and imaging using confocal laser scanning microscopy. The living cells show green fluorescence by recognizing the activity of esterase in the cells by Calcein AM, and EthD-1 (Ethidium homodimer-1) penetrates the damaged cell membrane of the dead cells and thus enters the cells and bind to the nucleic acid, thus showing red fluorescence.

[0166] The results are shown in FIG. 10, and cell viability can be seen to increase depending on the number of times the treatment with the nanoliposome-microbubble conjugate of Example 2 is repeated.

Test Example 3-2. Measurement of Cell Viability

[0167] Cell viability was measured through WST-1 assay (EZ-cytox Cell Viability Assay Kit). DPCs were cultured at a density of 1×10.sup.4/well in a 96-well plate for 24 hr, and were then treated with the nanoliposome-microbubble conjugate of each of Example 3 and Comparative Examples 3, 4, 5 and 6, after which the culture medium was replaced with a new medium containing testosterone at each of different concentrations (200 μM, 400 μM), and after 24 hr, a WST-1 reagent was added thereto. The WST-1 reagent was added in an amount of 10% of the culture broth, and after 1 hr, absorbance was measured at 460 nm and thus the cell survival and proliferation were compared with a control (non-treated group). Cell survivals were evaluated at an interval of 24 hr for 5 days after treatment with the nanoliposome.

[0168] Here, FIG. 11A shows the results of the cell test groups treated with the nanoliposome-microbubble conjugate alone, in which the cells were well grown without toxicity of the nanoliposome-microbubble conjugate, and FIGS. 11B and 11C show the results of the cell test groups after treatment with the nanoliposome-microbubble conjugate of Example 2 and then with 200˜300 μM testosterone, in which cell survival and proliferation were remarkably increased depending on the number of times the process using the nanoliposome-microbubble conjugate was repeated. These results indicate that the nanoliposome-microbubble conjugate of Example 2 of the present invention can effectively inhibit testosterone-mediated apoptosis in cells.

Test Example 4. Measurement of Amount of Testosterone Converted into Dihydrotestosterone

[0169] Whether testosterone was actually converted into dihydrotestosterone (DHT) was evaluated after editing of the SRD5A2 gene in the cells with the nanoliposome-microbubble conjugate of Example 2 of the present invention. The cells were treated with the nanoliposome-microbubble conjugate in the same manner as in Test Example 3-2, and were then treated for 24 hr using a new medium containing testosterone (0 to 400 μM).

[0170] The results are shown in FIG. 12, in which the expression level of dihydrotestosterone was increased in proportion to the treatment concentration of testosterone in a control (non-treated group), but in the group treated with the nanoliposome-microbubble conjugate of Example 2, even when the treatment concentration of testosterone was high, the expression of the dihydrotestosterone protein was not relatively increased. Accordingly, the composition of the present invention can be concluded to inhibit the progression of hair loss.

Test Example 5. Measurement of Caspase-3 Activity

[0171] Caspase-3 activity was measured using a caspase-3 assay kit (Cell Signaling). As in previous tests, dermal papilla cells were treated with the nanoliposome-microbubble conjugate of Example 2 for 1 to 5 days, and were then further treated for 24 hr using a new medium containing testosterone (200 μM, 400 μM). Thereafter, protein was extracted from the cells, and the extracted protein was mixed with 200 μL of a 1× assay buffer A and a substrate solution B and reacted at 37° C. for 30 min. After the reaction, fluorescence values were measured at an excitation wavelength of 380 nm and an emission wavelength of 440 nm to thus determine caspase-3 activity.

[0172] The above results are shown in FIG. 13, from which the caspase-3 activity can be concluded to be significantly decreased depending on the number of times the process using the nanoliposome-microbubble conjugate of Example 2 is repeated upon treatment with testosterone after editing of the SRD5A2 gene.

Test Example 6. Evaluation of Effect of Nanoliposome-Microbubble Conjugate on Inhibiting Hair Loss in Mouse Model

Test Example 6-1. Evaluation of Activity of Guide RNA in Mouse Dermal Tissue DNA

[0173] In order to compare the efficiencies of sgRNA m1, m2, m3, m4 and m5 (SEQ. ID. NOS: 16, 17, 18, 19 and 20) in cells of mouse dermal papilla tissue, mouse dermal tissue was obtained and DNA was extracted therefrom. The extracted DNA was subjected to a PCR process using a forward primer: CTCTTTGGACTATTTTGTGGCTT and a reverse primer: AAGACTGGGAACATTTGGTTTGT for sgRNA m1 and m2, a forward primer: GGCAGGAAGCCCCTCAGGGAGAT and a reverse primer: AATGTGACCGGCTGCTTCAAGTT for sgRNA m3 and m4, and a forward primer: AACCCAAAACCAAACACAAAACC and a reverse primer: GGGTCATAGACATGTGCACCATG for sgRNA 5 to afford each template fragment (500 bp). Then, the purified Cas9 protein was added thereto alone or in combination with sgRNA m1, m2, m3, m4 and m5 (SEQ. ID. NOS: 36, 37, 38, 39 and 40).

[0174] With reference to FIG. 14, in the test group using the purified Cas9 protein alone, the fragment was not cleaved with the Cas9 protein due to the absence of guide RNA, and in the test groups using the combinations of purified Cas9 protein and sgRNA m1, m2, m3, m4 and m5 (SEQ. ID. NOS: 36, 37, 38, 39 and 40), the fragment was cleaved with the Cas9 protein. In particular, the efficiency of sgRNA m1 (SEQ. ID. NO: 36) was evaluated to be the greatest, and thus those including the guide RNA of SEQ. ID. NO: 36 were used in all subsequent mouse tests.

Test Example 6-2. Evaluation of Efficiency as Therapeutic Agent for Ameliorating and Treating Hair Loss in Mouse

[0175] The hair of the back of each of 6-week-old mice (C57BL/6J) was epilated using an animal epilator (Philips) and hair removal cream (Veet), and in control 2 and test groups 1, 2 and 3, testosterone (30 μg/mL) dissolved in a mixed solution (3:7 (v:v)) of propylene glycol and ethanol was applied thereon every day and thus an environment similar to human hair loss was made. In control 1, no treatment was performed after epilation. In test groups 1, 2 and 3, the nanoliposome-microbubble conjugate (200 μL, nanoliposome-microbubble conjugated at a ratio of 2:1 and dispersed) of Example 2 of the present invention was applied in an amount of 200 μL each using a plastic spatula on the entire epilated back of each mouse, and after 3 min, sonication was performed using a medical sonicator. Treatment with the conjugate of Example 2 was performed once in test group 1, three times in test group 2, and five times in test group 3.

[0176] The above results are shown in FIG. 15. In control 2, hair was seldom grown after 21 days due to the effect of testosterone, whereas in test groups treated with the conjugate of Example 2 three times and five times (test groups 2 and 3), relatively large amounts of hair grew compared to control 2.

Test Example 6-3. SRD5A2 Expression in Mouse-Measurement of mRNA Expression Level

[0177] The mouse was treated with the nanoliposome-microbubble conjugate (Cas9:gRNA (74 μg:26 μg)) of Example 2 according to the present invention, and after 24 hr, the mouse skin was obtained, and total RNA was extracted therefrom using TRIzol (Invitrogen) and cDNA was synthesized using SuprimeScript RT premix 2× (GeNetBio).

[0178] Real-time PCR for measuring mRNA expression of SRD5A2 was measured using SYBR green 2× Premix (Applied Biosystems) and an AB Step One Plus real-time PCR system (Applied Biosystems). As such, the base sequences of primers used for the detection were as follows.

[0179] SRD5A2 sense: GGCCTCTTCTGCGTAGATTA

[0180] SRD5A2 antisense: CACCCAAGCTAAACCGTATG

[0181] GAPDH sense: GCACCGTCAAGGCTGAGAA

[0182] GAPDH antisense: AGGGATCTCGCTCCTGGAA

[0183] The above results are shown in FIG. 16, from which the mRNA expression of SRD5A2 can be concluded to be significantly reduced in dermal papilla cells due to treatment with the nanoliposome-microbubble conjugate of Example 2.

[0184] In conclusion, the nanoliposome-microbubble conjugate of the present invention is capable of fundamentally inhibiting the expression of SRD5A2 that induces hair loss, whereby the nanoliposome-microbubble conjugate is very effective at treating male hair loss.