RNA MEDIATED GENE REGULATING METHODS

Abstract

The invention provides methods for the assembly of repeated sequences that are useful in constructing nucleic acids for the simultaneous regulation and editing of multiple genes, and for DNA/RNA origami.

Claims

1. A method for producing an RNA mediated gene regulating or editing nucleic acid construct that comprises at least two sequences that are transcribed into nucleic acid polymers that each separately direct RNA mediated gene regulation or editing wherein the at least two nucleic acid sequences are transcribed into a single transcript from a single promoter, wherein the method comprises: a) amplifying a cassette from a gene regulating RNA generating (GRRG) vector using at least two GRRG primer pairs, each GRRG primer pair comprising a forward and a reverse primer, wherein the GRRG vector comprises a selectable marker nucleic acid sequence and a nucleic acid sequence that when in RNA form comprises a cleavage site wherein the forward and reverse GRRG primers comprise nucleic acid sequences that are complementary to sequences of the GRRG and allow hybridisation of the primers to the GRRG vector at either side of the selectable marker sequence such that upon hybridisation the primers are directed away from the selectable marker nucleic acid sequence, wherein the reverse GRRG primer hybridises to a common portion of the sequence that when in RNA form comprises a cleavage site, wherein the forward GRRG primer of each primer pair further comprises a sequence that encodes an RNA polymer that directs RNA mediated gene regulation or editing, which is not complementary to the vector nucleic acid sequence and which is located 5′ of the forward primer sequence that is complementary to the GRRG wherein amplification using each of the forward and reverse GRRG primer pairs results in the production of a linear cassette that comprises the following components in the following order 5′ to 3′: i) the sequence that encodes an RNA polymer that directs RNA mediated gene regulation or editing ii) the forward primer hybridisation sequence iii) the nucleic acid sequence that when in RNA form comprises a cleavage site but which does not comprise the marker nucleic acid sequence; and b) separately circularising each of the linear cassettes produced in step (a) to produce a circular nucleic acid polymer such that the sequence that encodes an RNA polymer that directs RNA mediated gene regulation or editing, is located between the forward primer hybridisation sequence and the nucleic acid sequence that when in RNA form comprises a cleavage site; and c) providing at least two linking primer pairs, each primer pair comprising a forward linking primer and a reverse linking primer, wherein the forward linking primer is capable of hybridising to the nucleic acid sequence that when in RNA form comprises a cleavage site and the reverse linking primer is capable of hybridising to the common forward primer hybridisation sequence of the GRRG vector, wherein each of the forward and reverse linking primers comprises a nucleic acid sequence capable of forming a single-stranded overhang; and d) amplifying each of the cassettes formed in step (b) with the appropriate pair of linking primers of (c); and e) treating the amplification products of (d) to generate a single-stranded overhang; and f) assembling the treated amplification products of (e) to one another to generate a single nucleic acid assembly comprising the assembled amplification products; and either g) ligating the single nucleic acid of (f) to a nucleic acid destination or expression vector: or (h) (i) ligating the single nucleic acid of (f) to an intermediate nucleic acid vector producing an intermediate vector comprising the single nucleic acid assembly of step (f); (ii) performing steps (a) to (f) and (h)(i) at least twice resulting in at least two different intermediate vectors each comprising a different single nucleic acid assembly of step (f); (iii) digesting the respective at least two intermediate vectors to produce at least two cleavage fragments comprising different nucleic acid assemblies; and/or amplifying the at least two different nucleic acid assemblies from the at least two intermediate vectors; (iv) ligating the at least two cleavage fragments or the at least two amplification products into a single destination or expression vector producing an array of nucleic acid assemblies of (f), wherein the destination or expression vector comprises a promoter and optionally a terminator, wherein the promoter is located 5′ to the array of nucleic acid assemblies of (f) and is capable of driving expression of a single transcript from the array, and the optional terminator is located 3′ to the array of nucleic acid assemblies of (f).

2. The method according to claim 1 wherein the cleavage site of the GRRG vector is selected from: i) an endoribonuclease cleavage site, for example a site-specific RNA endonuclease site, for example a Csy4 cleavage sequence or an artificial site-specific RNA endonucleases or ii) a tRNA sequence iii) a ribozyme sequence iv) an intron v) a target sequence for an RNA directed cleavage complex

3. The method according to any of claims 1 or 2 wherein the sequence of the reverse GRRG primer is the same for each reverse primer in each primer pair, and wherein the forward GRRG primer hybridises to a common forward primer hybridisation sequence of the GRRG vector.

4. The method according to any of claims 1-3 wherein the linear cassette of step (a) comprises intervening nucleic acid located between (ii) the forward primer hybridisation sequence and (ii) the nucleic acid sequence that when in RNA form comprises a cleavage site.

5. The method according to any of claims 1-4 wherein the circularising of step (b) comprises ligation of the two ends the linear cassette.

6. The method according to any of claims 1-5 wherein the sequence capable of forming a single-stranded overhang of the forward and reverse linking primers of step (c) is a Type II S restriction site or homing endonuclease site, wherein each pair of forward and reverse linking primers are designed so that following amplification the single-stranded overhang generated at one end of the amplification product generated by a first linking primer pair is able to hybridise with a compatible single-stranded overhang generated at one end of a second amplification product generated by a second linking primer pair.

7. The method according to any of claims 1-6 wherein said treating of step (e) involves digesting the amplification products with an appropriate Type II S restriction enzyme(s) or homing endonuclease(s).

8. The method according to any of claims 1-7 wherein the destination or expression vector of (g) or (h)(iv) comprises a promoter sequence, and optionally a terminator sequence.

9. The method according to any of claims 1-8 wherein the promoter and/or terminator sequence of the destination or expression vector has compatible overhangs to the ends of the single nucleic acid of (f), such that the promoter is located 5′ to the ligated amplification products of (f) and is capable of driving expression of a single transcript from the ligated amplification products and the optional terminator is located 3′ to the ligated amplification products of (f).

10. The method according to any of claims 1-9 wherein steps (f) and (g) or (f) and (h)(i) are performed simultaneously.

11. The method of any of claims 1-10 wherein the sequence of the portion of the GRRG forward primer that is complementary to a sequence of the GRRG and that allows hybridisation of the primer to the GRRG vector in step (a) is the same for each forward primer of each primer pair and/or wherein the sequence of the GRRG reverse primer that is complementary to a sequence of the GRRG and that allows hybridisation of the primer to the GRRG vector in step (a) is the same for each reverse primer of each primer pair.

12. The method of any of claims 1-11 wherein the ligating of step (g) results in the incorporation of the single nucleic acid of (f) that comprises the amplification products of (d) into the destination vector under the control of the promoter.

13. The method of any of claims 1-12 wherein at least two sequences that are transcribed into nucleic acid polymers that each separately direct RNA mediated gene regulation or editing are suitable for use in any one or more of CRISPR, sense Suppression/Cosuppression, antisense suppression, double-stranded RNA interference, hairpin RNA interference, intron-containing hairpin RNA interference, siRNA, micro RNA, piRNA and snoRNA.

14. The method of any of claims 1-13 wherein the nucleic acid construct comprises between 3 and 100 nucleic acid sequences that are transcribed into nucleic acid polymers that each separately direct RNA mediated gene regulation or editing, wherein the between 3 and 100 nucleic acid polymers are expressed as a single transcript from a single promoter.

15. The method of according to any of claims 1-14 wherein the nucleic acid construct comprises between 5 and 95, 10 and 90, 15 and 85, 20 and 80, 25 and 75, 30 and 70, 35 and 65, 40 and 60, 45 and 55 nucleic acid polymers that are transcribed into nucleic acid polymers that each separately direct RNA mediated gene regulation or editing; or at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or at least 20 nucleic acid sequences that are transcribed into nucleic acid polymers that each separately direct RNA mediated gene regulation or editing, optionally at least 11 or at least 12 nucleic acid sequences that are transcribed into nucleic acid polymers that each separately direct RNA mediated gene regulation or editing.

16. The method of any of claims 1-15 wherein the promoter of the destination or expression vector is: a) a Pol II promoter, optionally wherein the Pol II promoter is classed as a strong promoter; wherein the promoter is an inducible promoter; and/or wherein the promoter is selected from the group consisting of TDH3 promoter, TEF1 promoter, PGK1 promoter, pCCW12 promoter, pTEF2 promoter, pHHF1 promoter, pHHF2 promoter, pALD6 promoter, pGal1 promoter (galactose-inducible), pPGK1 promoter, pHTB2 promoter or pCUP1 promoter (induced by copper-sulfate), or a tetracycline-inducible promoter; or b) a Pol III promoter, optionally wherein the Pol III promoter is classed as a strong Po 111I promoter; wherein the Pol III promoter is an inducible promoter; and/or wherein the Pol III is selected from the group consisting of the tRNA Phe promoter with a 5′ HDV ribozyme, the U6 promoter or the H1 promoter.

17. The method of any of claims 1-16 wherein the sequence of the GRRG to which the forward GRRG primer hybridises does not form part of the nucleic acid that directs RNA mediated gene regulation or editing.

18. The method of any of claims 1-16 wherein the sequence of the GRRG to which the forward GRRG primer hybridises encodes part of the nucleic acid that directs RNA mediated gene regulation or editing.

19. The method of any of claims 1-18 wherein the GGRG vector comprises a scaffold sequence that when in RNA form allows association of the RNA with a polypeptide capable of regulating or editing a gene, optionally wherein the polypeptide is selected from the group consisting of: Cas9 or Cas9-like polypeptide, optionally wherein the Cas9 polypeptide is a Streptococcus pyogenes Cas9 polypeptide; Cas12a; Cas12b; Cas13a; Cas13b; LbCpf1 (Lachnospiraceae bacterium ND2006)—most commonly used; AsCpf1 (from Acidaminococcus); or FnCpf1 (Francisella novicida).

20. The method of claim 19 wherein the common forward primer hybridisation sequence of the GRRG vector sequence at least partly overlaps with the scaffold sequence.

21. The method of any of claims 1-20 wherein the sequence that encodes an RNA mediated gene regulation or editing directing sequence that is part of the forward primer comprises RNA for association with a Cas9 or Cas9-like protein, optionally Cas13a/C3c2 optionally comprises sgRNA sequence.

22. The method of any of claims 1-21 wherein the at least two nucleic acid sequences that encode an RNA mediated gene regulation or editing directing sequence(s) are directed towards different genes, optionally wherein each nucleic acid sequence that encodes an RNA mediated gene regulation or editing directing sequence is directed towards a different gene.

23. A single RNA molecule that comprises at least 2 nucleic acid sequences that are each separately capable of directing RNA mediated gene regulation or editing, wherein between each nucleic acid sequence that directs RNA mediated gene regulation or editing is a sequence that is a cleavage site.

24. The single RNA molecule according to claim 23 wherein the cleavage site is selected from the group consisting of a Csy4 cleavage site, a tRNA sequence, a ribozyme sequence, an intron sequence, or a target sequence for an RNA directed cleavage complex.

25. The single RNA molecule according to any of claims 23 or 24 wherein the single RNA molecule comprises between 11 and 100 nucleic acid sequences that direct RNA mediated gene regulation or editing, optionally comprises between 12 and 90, 13 and 80, 14 and 70, 15 and 60, 20 and 50, 30 and 40, nucleic acid sequences that direct RNA mediated gene regulation or editing; or comprises 11 or 12 nucleic acid sequences that direct RNA mediated gene regulation or editing.

26. The single RNA molecule according to any of claims 23-25 wherein the single RNA molecule has been produced by the method of any of claims 1-22.

27. An RNA mediated gene regulating or editing nucleic acid construct which is a single nucleic acid molecule that comprises at least 2 nucleic acid sequences that encode an RNA mediated gene regulation or editing directing nucleic acid polymer, wherein between each sequence that encodes an RNA mediated gene regulation or editing directing nucleic acid polymer is a sequence that when in RNA form is a cleavage site.

28. The RNA mediated gene regulating or editing nucleic acid construct according to claim 27 wherein the cleavage site is selected from the group consisting of a Csy4 cleavage site, a tRNA sequence, a ribozyme sequence, an intron sequence or a target sequence for an RNA directed cleavage complex.

29. The RNA mediated gene regulating or editing nucleic acid construct according to any of claims 27 or 28 wherein the single nucleic acid molecule comprises a promoter capable of driving expression from the at least 2 nucleic acid sequences to form one single RNA transcript.

30. The RNA mediated gene regulating or editing nucleic acid construct according to any of claims 27-29 wherein the single nucleic acid molecule comprises between 1 and 100 nucleic acid sequences that encode an RNA mediated gene regulation or editing directing nucleic acid polymer, optionally between 11 and 100 nucleic acid sequences that encode an RNA mediated gene regulation or editing directing nucleic acid polymer, optionally between 12 and 90 13 and 80, 14 and 70, 15 and 60, 20 and 50, 30 and 40 nucleic acid sequences that encode an RNA mediated gene regulation or editing directing nucleic acid polymer, optionally wherein the single nucleic acid molecule comprises 11 or 12 nucleic acid sequences that encode an RNA mediated gene regulation or editing nucleic acid polymer.

31. The RNA mediated gene regulating or editing nucleic acid construct according to any of claims 27-30 wherein the single nucleic acid molecule has been produced by the method of any of claims 1-22.

32. A phage or viral vector comprising the single RNA molecule of any of claims 23-26 or the single nucleic acid molecule or any of claims 27-31, optionally wherein the phage or viral vector is selected from the group consisting of adeno-associated virus (AAV), Hybrid Adenoviral Vectors or Herpes simplex viruses.

33. A cell comprising the single RNA molecule of any of claims 23-26 or the single nucleic acid molecule or any of claims 27-31 or the phage or viral vector of claim 32.

34. The cell of claim 33 wherein the cell expresses or comprises or is exposed to an agent that is capable of cleaving the sequence that when in RNA form comprises a cleavage site, optionally wherein where the sequence that when in RNA form is a cleavage site comprises the Csy4 cleavage site, the cell expresses or comprises or is exposed to Csy4 polypeptide; where the sequence that when in RNA form is a cleavage site comprises a tRNA sequence, the cell expresses or comprises or is exposed to RNase P, RNase Z and/or RNase E; where the sequence that when in RNA form is a cleavage site comprises a ribozyme cleavage site, the cell expresses or comprises or is exposed to the appropriate ribozyme; where the sequence that when in RNA form is a cleavage site comprises an intron, the cell expresses or comprises or is exposed to native splicing machinery.

35. A method of producing at least two nucleic acid sequences that direct RNA mediated gene regulation or editing wherein the method comprises expressing an RNA transcript from the RNA mediated gene regulating or editing nucleic acid construct according to any of claims 27-31.

36. The method according to claim 35 wherein the method produces at least 11 or at least 12 nucleic acid polymers that direct RNA mediated gene regulation or editing.

37. The method of any of claims 35 or 26 wherein the RNA transcript is expressed in the presence of an agent that is capable of cleaving the sequence that when in RNA form is specifically cleavable, optionally expressed in the presence of Csy4.

38. The method of any of claims 35-37 wherein the method further comprises transforming the RNA mediated gene regulating or editing nucleic acid construct of any of claims 27-31 into a cell, optionally wherein the cell expresses or comprises or is exposed to an agent that is capable of cleaving the sequence that when in RNA form is specifically cleavable, optionally expresses or comprises or is exposed to Csy4.

39. The method of any of claims 35-38 wherein where at least one of the nucleic acid sequences that directs RNA mediated gene regulation or editing is a sgRNA, the method further comprises co-expressing a polypeptide capable of associating with the sgRNA.

40. The method according to claim 39 wherein the polypeptide capable of associating with the sgRNA is: a) Cas9 or Cas9-like polypeptide, optionally wherein the Cas9 polypeptide is a Streptococcus pyogenes Cas9 polypeptide; Cas12a; Cas12b; Cas13a; Cas13b; LbCpf1 (Lachnospiraceae bacterium ND2006)—most commonly used; AsCpf1 (from Acidaminococcus); or FnCpf1 (Francisella novicida); and/or b) fused to an activation and/or repression domain, optionally wherein the activation domain is selected from the group consisting of VP, VP16, VP64, Gal4, or B42; and/or wherein the repression domain is selected from the group consisting of KRAB-like effectors (e.g. Mxi1), RD1152, RD11, RD5 or RD2; or c) an error prone DNA polymerase.

41. A method for the regulation or editing of at least one gene in a cell wherein the method comprises the method for producing an RNA mediated gene regulating or editing nucleic acid construct that comprises at least two sequences that are transcribed into nucleic acid polymers that each separately direct RNA mediated gene regulation or editing according to any of claims 1-22; the method for producing at least two nucleic acid polymers that direct RNA mediated gene regulation or editing according to any of claims 35-40; the use of the nucleic acid molecule according to any of claims 23-26; the use of the RNA mediated gene regulating or editing nucleic acid construct according to any one of claims 27-31; the use of the phage according to claim 32; and/or the use of the cell according to claim 33 or 34.

42. A single nucleic acid according to any of claims 23 to 26, the RNA mediated gene regulating or editing nucleic acid construct according to any one of claims 27-31, the phage according to claim 32, or the cell according to any of claims 33 or 34 for use in medicine, optionally for use in the treatment and/or prevention of a disease, optionally for use as a vaccine.

43. The single nucleic acid according to any of claims 23 to 26, the RNA mediated gene regulating or editing nucleic acid construct according to any one of claims 27-31, the phage according to claim 32, or the cell according to any of claims 33 or 34 for use according to claim 42 for the treatment or prevention of a disease in which entire pathways are dysregulated, optionally wherein the disease is selected from the group consisting of Glioblastoma multiforme, Diabetes (type I and type II), Multiple sclerosis, Autoimmune diseases and Huntington's disease.

44. The single nucleic acid according to any of claims 23 to 26, the RNA mediated gene regulating or editing nucleic acid construct according to any one of claims 27-31, the phage according to claim 32, or the cell according to any of claims 33 or 34 for use in an industrial process, optionally for use in brewing, large-scale protein production, pharmaceutical production, metabolite production, optionally the production of chemicals or fuels, biomass vs. growth or metabolic ‘valves’.

45. A gene regulating RNA generating (GRRG) vector comprising a selectable marker and a nucleic acid sequence that when in RNA form comprises a cleavage site, optionally wherein the cleavage site is selected from a Csy4 cleavage site, a tRNA, a ribozyme cleavage site, an intron, or a target sequence for an RNA directed cleavage complex.

46. The gene regulating RNA generating vector of claim 45 wherein the vector further comprises a scaffold sequence that when in RNA form allows association of the RNA with a polypeptide capable of regulating or editing a gene, optionally wherein the polypeptide capable of regulating or editing a gene is: a) Cas9 or Cas9-like polypeptide, optionally wherein the Cas9 polypeptide is a Streptococcus pyogenes Cas9 polypeptide; Cas12a; Cas12b; Cas13a; Cas13b; LbCpf1 (Lachnospiraceae bacterium ND2006)—most commonly used; AsCpf1 (from Acidaminococcus); or FnCpf1 (Francisella novicida); and/or b) fused to an activation and/or repression domain, optionally wherein the activation domain is selected from the group consisting of VP, VP16, VP64, Gal4, or B42; and/or wherein the repression domain is selected from the group consisting of KRAB-like effectors (e.g. Mxi1), RD1152, RD11, RD5 or RD2; and/or c) an error prone DNA polymerase.

47. The gene regulating RNA generating vector according to any of claims 45 or 46 wherein the vector comprises the following components in the following order 5′ to 3′: a) nucleic acid sequence that when in RNA form comprises a Csy4 cleavage site, a tRNA, a ribozyme cleavage site, an intron or a target sequence for an RNA directed cleavage complex b) the selectable marker; and c) the scaffold sequence.

48. A kit comprising any two or more of: i) a GRRG vector according to any of claims 45-47 or as defined in any of the preceding ii) a GRRG forward and reverse primer according to the invention iii) one or more linking primer pairs according to the invention iv) a destination vector according to the invention v) a nucleic acid encoding a polypeptide capable of regulating or editing a gene, optionally wherein the polypeptide capable of regulating or editing a gene is: a) Cas9 or Cas9-like polypeptide, optionally wherein the Cas9 polypeptide is a Streptococcus pyogenes Cas9 polypeptide; Cas12a; Cas12b; Cas13a; Cas13b; LbCpf1 (Lachnospiraceae bacterium ND2006)—most commonly used; AsCpf1 (from Acidaminococcus); or FnCpf1 (Francisella novicida); and/or b) fused to an activation and/or repression domain, optionally wherein the activation domain is selected from the group consisting of VP, VP16, VP64, Gal4, or B42; and/or wherein the repression domain is selected from the group consisting of KRAB-like effectors (e.g. Mxi1), RD1152, RD11, RD5 or RD2; and.or c) an error prone DNA polymerase vi) one or more Type II S restriction enzymes, optionally BsmBI; vii) a nucleic acid encoding a Csy4 polypeptide, optionally wherein the nucleic acid is a circular vector; vii) one or more restriction enzymes ix) DNA polymerase x) DNA ligase xi) one or more intermediate vectors optionally wherein the kit comprises the GRRG vector of (i).

Description

FIGURE LEGENDS

[0380] FIG. 1: Schematic showing exemplary method for producing an RNA mediated gene regulating nucleic acid construct that comprises at least two sequences that are transcribed into nucleic acid polymers that each separately direct RNA mediated gene regulation, wherein the at least two nucleic acid sequences are transcribed into a single transcript from a single promoter

[0381] FIG. 2: CHORDS assembly and efficiency.

[0382] (A) Schematic overview of one particular embodiment of the method for the construction of gRNA arrays. A Guide-Generating Vector is first used to add the gRNA targeting sequence of interest, via a designed forward primer overhang and a fixed, phosphorylated reverse primer. The generated, linear PCR fragment with the added gRNA is then annealed. The resulting, circularized vector is then amplified in a second round of PCR, in which both a forward and reverse primer are used to add designed BsmBI overhangs. The resulting PCR fragments can then be inserted into a Destination Vector containing a promoter, 3′ Csy4 site and terminator via Golden Gate assembly. Primers are indicated by arrows, with slanted lines indicating primer overhangs. (B) BsmBI recognition site and 4 bp overhangs used in this study. Twelve different 4 bp overhangs were validated for use with CHORDS. Shaded brown rectangle indicates the Type IIs BsmBI restriction enzyme, which recognizes the sequence 5′-CGTCTC-3′ and generates an adjacent 4 bp overhang. (C) (Left) Assembly efficiency for the construction of gRNA arrays with CHORDS. White colonies were counted and compared to the total E. coli colonies (white indicating GFP-negative) after CHORDS assembly (n=8 transformed and streaked plates, 50 μl cells, for each condition). Error bars represent the standard deviation in white/total counts between the replicates. (Right) Restriction digests with BsaI were used to validate insert size within the Destination Vectors (n=16 colonies each condition).

[0383] FIG. 3: Multiplexing of gRNAs for combinatorial transcriptional repression in S. cerevisiae.

[0384] (A) Spatial positions of the gRNAs tested and containing 20 nt sequences complementary to the ScALD6, ScHHF1 or ScTEF1 and adjacent to a PAM sequence 5′-NGG-3. gRNAs were targeted between −300 bp upstream and +1 bp downstream of the start codon.

[0385] Numbers in the gray boxes correspond to the results plotted in panel (B) for each of the three fluorescent reporters. (B) Relative repression of fluorescence for each gRNA tested with n=4 biological replicates each condition. (C) Relative repression of fluorescence by combinatorial, multiplexed expression of gRNA arrays. Each gRNA array (from 3 through 12) has an additional three gRNAs, one targeting each of the fluorescent reporters in our system and validated from (B). WT, wildtype BY4741 yeast; -gRNAs, no gRNA expressed. RFU, relative fluorescence units. All values plotted are mean averages from n=8 samples (3, 6, 9, 12 gRNA arrays) or n=4 (WT, -gRNA, Blank 3-part) and error bars represent one standard deviation from the mean. Asterisks denote two-tail p-value as determined by two-sample t-test, with *p≤0.05, **p≤0.01, and ***p≤0.0001.

[0386] FIG. 4: Experimental protocol schematic for CHORDS Assembly. Arrows indicate the steps through the protocol over a two-day period.

[0387] FIG. 5: Schematic

[0388] FIG. 6: Up to 12 gRNAs are Expressed in S. cerevisiae and Enable Highly Multiplexed Regulation of Gene Expression.

[0389] Combinatorial repression of three targets simultaneously via highly multiplexed gRNA expression. mVenus (left), mTagBFP (center) and mRuby2 fluorescence (right) in BY4741 expressing green, blue and red fluorescent proteins, dCas9 and Csy4. This strain was transformed with either a blank integration vector, one blank gRNA, three blank gRNAs, or 3, 6, 9 or 12-guide assemblies constructed by CHORDS and fluorescence measured via three-channel flow cytometry. *, p<0.05; **, p<0.005; ‡, p<0.001; n.s., not significant. Statistics assessed by student's t-test for each condition compared to the strain indicated by the connecting black line. BY4741 (WT), URA3 blank integration, one blank guide, 3 blank guides are the mean of n=4 samples ±SD, while the 3, 6, 9 and 12-guide assemblies are the mean of n=8 samples ±SD. RFU, relative fluorescence units.

[0390] FIG. 7: Frequency of cleavage of restriction sites in some common nucleic acid molecules

[0391] FIG. 8: Exemplary method according to the invention, wherein at least two different nucleic acid arrays are cloned into intermediate vectors and are then subsequently cloned (either directly by digestion of the intermediate vector, or indirectly by amplification of the nucleic acid array) into a single destination or expression vector.

[0392] We illustrate exemplary embodiments of the present invention in the following non-limiting examples.

EXAMPLES

Example 1

[0393] The efficiency of CHORDS assembly was tested for the construction of highly repetitive DNA sequences. As a proof-of-concept, a series of gRNA arrays were built containing an increasing number of gRNAs (3, 6, 9 or 12) within a single transcriptional unit (FIG. 2a). Components compatible with the YTK were created due to the expansive use of this toolkit in synthetic biology research and the total absence of existing multiplexing gRNA systems for yeasts, the most industrially-relevant organism.

[0394] Briefly, PCR with a high-fidelity Phusion polymerase was used to add the gRNA sequence of interest to a Guide-Generating Vector, which consists of a 20 nt Csy4 recognition site followed by a superfolder GFP gene and a 3′ Cas9 scaffold. The forward primer adds the gRNA targeting sequence via primer overhangs, while a phosphorylated reverse primer completes replication of the PCR fragment and results in dropout of the sfGFP, which facilitates E. coli colony screening. The resulting, linear PCR fragment is annealed, and a second round of PCR performed to add BsmBI restriction sites with pre-defined 4 bp overhangs (FIG. 2b). The resulting PCR fragments can then be inserted into a Destination Vector, which consists of a promoter, sfGFP gene, 3′ Csy4 recognition site and terminator, via Golden Gate assembly. New destination vectors can be made in one day via Gibson Assembly with current promoters and terminators in the standard YTK. The destination vectors also contain designed BsaI cut sites for straightforward diagnostic restriction digestion and designed XhoI/BglII sites on the 3′ end of the promoter and 5′ end of the terminator, respectively, to enable the swapping of constructed gRNA arrays between different destination vectors.

[0395] After Golden Gate assembly, TurboComp E. coli were chemically transformed and plated on LB containing chloramphenicol. Screening of these colonies for expression of GFP under UV light was used to assess the ratio of colonies containing some form of our genetic construct (FIG. 2c, left). For construction of gRNA arrays with 3, 6 and 9 gRNAs, >98% of E. coli colonies were GFP negative. For E. coli transformed with the 12 gRNA array, >96% of E. coli colonies were GFP negative.

[0396] To validate the true assembly efficiency of CHORDS, however, insert length was screened for within the destination vector via diagnostic restriction digest with BsaI and then sequence-verified putative colonies by Sanger sequencing (see Supplemental Information). As expected, restriction digests of the arrays indicated a decrease in assembly efficiency with higher orders of gRNAs. A construction efficiency >40% was observed on gRNA arrays up to 9 gRNAs, with a subsequent drop-off in efficiency for higher orders of gRNAs (FIG. 2c). All colonies with expected restriction digest band patterns sent for sequencing were sequence-verified without any observed mutations.

[0397] To demonstrate the utility of CHORDS in an industrially-relevant model organism, the multiplexing capabilities of gRNAs expressed from a single promoter in S. cerevisiae was tested. It was hypothesized that, due to elevated rates of homologous recombination at genomic regions containing highly repetitive DNA sequences, only a few gRNAs could be expressed from a single promoter in S. cerevisiae. An experiment was designed to test the multiplexing limits of gRNAs in yeast which did not rely on quantitative PCR, as the high similarity between the gRNAs could confound quantitation of our transcript counts. Instead, a flow cytometry experiment was designed in which a series of fluorescent reporters (green, blue and red) are transcriptionally repressed by increasing numbers of gRNAs.

[0398] Golden Gate and the YTK was first used to engineer S. cerevisiae strain BY4741 to express three fluorescent reporters, ScTEF1-mTagBFP2, ScHHF1-mRuby2 and ScALD6-Venus, which were genome-integrated at the HO-site. This yeast strain was also transformed with a LEU2-integrated vector that expresses dCas9 with nuclear localization signals on the 5′ and 3′ ends, driven by the ScPGK1 promoter, and a Csy4 enzyme with a 5′ nuclear localization signal under control of the ScHHF2 promoter (BY4741.sup.−gRNAs). Before constructing large arrays of gRNAs, the repression efficiency of different gRNAs was validated for each of the fluorescent reporters individually. BY4741.sup.−gRNAs were transformed with single gRNAs (integrated at the URA3 locus) driven by the Pol III tRNA Phe promoter with a 5′ HDV ribozyme. Each gRNA targeted one of the three different promoters—TEF1, HHF1 and ALD6—and changes in fluorescence of each reporter following integration of the gRNA were assessed by flow cytometry (FIG. 3a). Each gRNA resulted in varied repression efficiencies and functioned orthogonally to one another (i.e. they did not repress other fluorescent reporters) (FIG. 3b). Using these results, we selected four gRNAs targeting each promoter based on two criteria: 1) Weak repression of fluorescent output (which was hypothesized to enable visualization of combinatorial effects when multiplexing) and 2) Distributed spatial positionings within the promoter region, which was hypothesized to enhance the likelihood of observing gRNA combinatorial effects for transcriptional repression. For mVenus repression, gRNAs #1, 4, 6, 8 targeting the ScALD6 promoter were used (in that order). For mRuby2 repression, gRNAs #2, 8, 6, 4 targeting the ScHHF1 promoter were used. For mTagBFP2 repression, gRNAs #1-4 targeting the ScTEF1 promoter were used.

[0399] Arrays of 3, 6, 9 or 12 gRNAs were built within a single transcriptional unit with CHORDS; as arrays increased in size, an additional gRNA was targeted to each fluorescent reporter. In the 12 gRNA array, for example, there are 4 gRNAs targeting the promoter upstream of each fluorescent reporter. Each gRNA is flanked by Csy4 recognition sites. Arrays were sequence-verified and then genome-integrated at the URA3 locus into BY474.sup.−gRNAs. In the transformed yeast strains, a combinatorial, non-synergistic repression of fluorescence was observed in all three channels with increasing numbers of gRNAs targeted to each promoter (FIG. 3c). In all conditions except two, the expression of an additional gRNA resulted in a significant decrease in fluorescence of the respective reporter.

[0400] Since homologous recombination in bacteria and yeast is more active in regions containing repetitive DNA sequences,.sup.11,12 the stability of these repetitive gRNA arrays overtime was also assessed. Flow cytometry was performed every day for three days, with each yeast strain back-diluted 1:100 twice a day and grown for 12 hours between passages (FIG. 3d). Both flow cytometry data and colony PCR on yeast from day 1 and day 3 (5×1:100 dilutions) indicated sustained function and preservation of gRNA arrays overtime in vivo (FIG. 3e).

[0401] CHORDS offers a rapid and stable method by which large arrays of gRNAs can be constructed and utilized in vivo. This will facilitate applications in metabolic engineering prototyping and testing of genetic targets from computational predictions. This technology will enable the use of CRISPR for diverse applications in the multiplexed, transcriptional regulation of gene expression in this industrially-useful organism.

Example 2

[0402] CHORDS Assembly

[0403] CHORDS assembly is a dual PCR, Type IIs Golden Gate method for constructing transcriptional units that contain repetitive DNA sequences flanked by short, variable DNA sequences. Dual PCR, in this case, refers to the two separate rounds of PCR which are performed in CHORDS assembly. After the two rounds of PCR, a Golden Gate reaction is performed to join all of the PCR fragments generated together in a one-pot reaction. FIG. 4 is a schematic/experimental guideline for performing CHORDS assembly. In the text that follows, the use of CHORDS for the assembly of highly repetitive gRNA arrays that are compatible with the Yeast Toolkit is described. However, it is strongly suspected that these primers and vectors could be modified for the assembly of other repetitive sequences, such as gRNAs flanked by introns or tRNAs, or to assemble repetitive Spinach aptamers.

[0404] The first step in CHORDS assembly to build gRNA arrays is to perform PCR on a ‘Guide-Generating Vector’ (template) with different combinations of primers. In round 1 PCR, the forward primer may have a 20 bp overhang on its 5′ end, which adds the gRNA target sequence of interest upon PCR amplification. A different forward primer must be ordered from an oligo manufacturer for every gRNA sequence to be constructed. In round 1 PCR, the reverse primer is fixed, meaning that it is the same primer for every reaction, and should be ordered from an oligo manufacturer with a phosphorylated 5′ end, which will facilitate ligation and re-circularization of these vectors in later steps.

[0405] Round 1 PCR Primers.

[0406] Primers for round 1 PCR, where N is the sequence of the gRNA from 5′ to 3′. 5′ Phos indicates that the 5′ end of the reverse primer should be ordered as a phosphorylated primer.

TABLE-US-00007 Forward Primer with Overhang - [SEQ ID NO: 23] NNNNNNNNNNNNNNNNNNNNgttttagagctagaaatagcaagttaaaata ag Reverse Primer - [SEQ ID NO: 24] 5′ Phos-ctgcctatacggcagtgaac

[0407] Where N can be any length and any sequence, and denotes the gRNA targeting sequence.

[0408] During Round 1 PCR, the same template plasmid is used for all reactions. When constructing gRNA arrays flanked by Csy4 sites, a Guide-Generating Vector as described herein can be used.

[0409] Performing Round 1 PCR:

[0410] Components, concentrations and volumes to add to each PCR reaction mixture:

TABLE-US-00008 TABLE 2 PCR components for Round 1, which adds the desired gRNA sequences. Component Volume (μL) Nuclease-free water 31.5 5 × Phusion HF Buffer 10 dNTPs (10 mM) 1 Forward Primer (10 μM) 2.5 Reverse Primer (10 μM) 2.5 Guide-Generating Vector Template (10 ng/μL) 0.5 DMSO 1.5 Phusion Polymerase 0.5 Reaction volume 50

[0411] Phusion Polymerase was used for CHORDS assembly due to its high-fidelity (see New England Biolabs product information: https://www.neb.com/faqs/2012/09/06/what-is-the-error-rate-of-phusion-reg-high-fldelity-dna-polymerase). In Phusion HF buffer, its reported fidelity is 4.4×10.sup.−7.

[0412] For each gRNA sequence to be constructed, a separate PCR reaction can be set up, with the only variation between reactions being the forward primer used.

[0413] PCR thermocycler conditions for Round 1 PCR:

TABLE-US-00009 TABLE 3 Thermocycler settings for Round 1 PCR. Step Temp (° C.) Time (s) Initial Denaturation 98 30 25-35 Cycles 98 10 61 30 72 30 Final Extension 72 600 Hold 4 PCR product 1758 bp length

[0414] DpnI Digests:

[0415] After completing the Round 1 PCR, 0.3 μL of DpnI enzyme (purchased from New England Biolabs) is added to each PCR microtube. These samples are then incubated at 37° C. for 1 hour. DpnI cleaves methylated DNA—the Guide-Generating Vector in this case—and enhances isolation of the DNA fragments of interest in the next step by minimizing the likelihood that the template DNA is not isolated and used in the next round of PCR.

[0416] Gel Purify (1.sup.st Time):

[0417] After DpnI digests, PCR tubes are removed from the thermocycler. The next step is to purify the DNA via gel electrophoresis and agarose gel extraction. This process is incredibly important to enhance the purity of the PCR fragments. Any contamination of the different PCR fragments in this step will mean that, in round 2 PCR (in which BsmBI restriction sites are added), multiple different gRNAs could be amplified with the same overhang primers. This would mean that there could be final constructs in which gRNAs are misplaced within the final array.

[0418] To minimize contamination, it is recommended that PCR fragments post-Dpn/digest be loaded in spatially separated wells (i.e. leave a well between samples) and to not overfill wells, as this could contaminate the other wells if DNA floats freely in the TAE buffer. For gel electrophoresis, it is sufficient to add, for example, ˜20 μL of the digested DNA mixture from the previous step to ˜3 μL of 6×DNA loading dye. This mixture is loaded into wells of a 0.8% agarose gel and gel electrophoresis is performed until total separation of DNA bands or for approximately 45 minutes at 100 volts. After gel electrophoresis, gel bands are excised. Zymoclean Gel DNA Recovery kit (Zymo Research) can be used, precisely followed manufacturer instructions.

[0419] T4 Ligation:

[0420] Once the DNA has been gel-purified, PCR fragments can be obtained that consist of our gRNA (5′ end of fragment), followed immediately by a Cas scaffold sequence, ColE1 and chloramphenicol resistance genes, and finally a Csy4 site on the 3′ end. By annealing these blunt-end, linear PCR fragments, a circularized vector is obtained that places the Csy4 site next to the gRNA targeting sequence and gRNA scaffold (see FIG. 1A in main text).

[0421] To Anneal the Isolated DNA Fragments:

TABLE-US-00010 TABLE 4 Ligation components to anneal PCR fragments generated in Round 1. Component Volume (μL) T4 ligase buffer (NEB) 1 T4 DNA ligase (NEB) 0.5 100 ng isolated DNA Varies Water (up to 10 μL total volume) Varies Reaction volume 10

[0422] The annealing reaction mixtures were incubated at 37° C. for a minimum of 30 minutes.

[0423] Recommended, Optional Sequencing Step:

[0424] After obtaining circularized DNA vectors containing the gRNAs added via PCR, it is recommended that the DNA fragments be sequence-verified while simultaneously continuing with the next steps of the protocol. Sequencing is optional, and highly repetitive gRNA arrays can be constructed before sequence verification, but it is useful to have individual gRNA vectors be sequence-validated in case they are needed again later, in different constructs.

[0425] To sequence verify the DNA vectors with gRNAs, E. coli was transformed with each gRNA-containing vector and the cells were plated on LB agar with 1:1000 concentration of chloramphenicol.

[0426] After incubation at 37° C., colonies were picked and sent for Sanger sequencing, using the following primer, which binds in the ColE1 sequence of the annealed vector preceding the Csy4 site:

[0427] Primer for sequence verification of gRNA sequences in annealed vectors after Round 1 PCR—Forward Primer for sequencing of fragments after Round 1 PCR and isolation:

TABLE-US-00011 [SEQ ID NO. 25] CTCACATGTTCTTTCCTGCG

[0428] After sending the annealed vectors containing the gRNA sequence for sequence validation, either wait for the sequencing results to be confirmed before proceeding (to ensure no contamination in round 1, which would be indicated by overlaps in peaks within the gRNA sequence regions in the chromatograms generated from Sanger sequencing) or continue immediately with the next stages of the CHORDS assembly protocol.

[0429] Round 2 PCR: Add BsmBI Overhangs

[0430] The next step is to add overhangs to each of the annealed vectors from the previous stages, which will enable their incorporation into a destination vector via BsmBI Golden Gate assembly. For this step, each PCR tube will contain a different template (the DNA vector with the gRNA sequences of interest) and a unique pair of forward and reverse primers, which are different than those used previously.

[0431] Round 2 PCR uses a small ‘library’ of primers that are fixed, meaning the primers can be ordered from an oligo manufacturer, for example, one time and then used repeatedly for CHORDS assembly. Each pair of primers adds a specific BsmBI recognition site and designed 4 bp overhang, which is compatible with the next gRNA in the final assembly. This enables the gRNAs generated in the previous steps to be placed in any position within the final transcript, simply by changing the primer pair used in this round for PCR.

[0432] The first gRNA in the array must always use the Position 1—Forward primer and the last gRNA in the array (whether an array is built with 5 gRNAs, 9 gRNAs, or 12 gRNAs, for example) must use the Position 12—Reverse primer.

[0433] List of primer pairs used in Round 2 PCR:

TABLE-US-00012 TABLE 5 Primer pairs for Round 2 PCR, which together add unigue BsmBI overhangs for Golden Gate assembly. 4bp SEQ Forward/ BsmBI ID Position Reverse Sequence Overhang Note NO: 1 Forwald GCATCGTCTCATGCCgttcactgccgtataggcag TGCC Must always be used for 26 gRNA in first position. 1 Reverse ATGCCGTCTCATAGTaaaagcaccgactcggtg 27 2 Forward GCATCGTCICAACTAgttcactgccataggcag ACTA 28 2 Reverse ATGCCGTCTCATCTGaaaagcaccgactcGgtg 29 3 Forward GCATCGTCTCACAGAgttcactgccgtataggcag CAGA 30 3 Reverse ATGCCGTCTCAGTAAaaaagcaccgactcggtg 31 4 Forward GCATCGTCTCATTACgttcactgccgtataggcag TTAC 32 4 Reverse ATGCCGTCTCACACAaaaagcaccgactcggtg 33 5 Forward GCATCGTCTCATGTGgttcactgccgtaggcag TGTG 34 5 Reverse ATGCCGTCTCAGCTCaaaagcaccgactcggtg 35 6 Forward GCATCGTCTCAGAGCgttcactgccgtataggcag GAGC 35 6 Reverse ATGCCGTCTCAGAATaaaagcaccgactcggtg 37 7 Forward GCATCGTCTCAATTCgttcactgccgtaggcag ATTC 38 7 Reverse ATGCCGTCTCATTCGaaaagcaccgactcggtg 39 8 Forward GCATCGTCTCACGAAgttcatgccgtataggcag CGAA 40 8 Reverse ATGCCGTCTCACGGTaaaagcaccgactcggtg 41 9 Forward GCATCGTCTCACCGgttcactgccgtataggcag ACCG 42 9 Reverse ATGCCGTCTCAAGTTaaaagcaccgactcggtg 43 10 Forward GCATCGTCTCAAACTgttcactgccgtataggcag AACT 44 10 Reverse ATGCCGTCTCATCCTaaaagcaccgactcggtg 45 11 Forward GCATCGTCTCAAAAAgttcactgccgtataggcag AGGA 46 11 Reverse ATGCCGTCTCATTTTaaaagcaccgactcggtg 47 12 Forward GCATCGTCTCAAAAAgttcactgccgtataggcag AAAA 48 12 Reverse ATGCCGTCTCATTGCaaaagcaccgactcggtg Must always be used for 49 gRNA in termnal position

[0434] We report here are 12 different sets of primers, which enables up to 12 gRNAs to be assembled in a single array. However, these primer pairs are not limiting, and additional pairs could be designed to enable even longer gRNA arrays to be constructed. One of the only limitations regarding the number of gRNAs that can be assembled into a single array is considered to be the method used to join the gRNA sequences together, e.g. the Gold Gate reaction.

[0435] Once primer pairs were chosen (an example array assembly is provided in the next few paragraphs), the PCR reactions were setup with the different forward/reverse primer pairs and the unique, annealed guide-generating vector with the gRNA of interest, which was created in the previous steps.

[0436] To Set Up the PCR Reactions:

TABLE-US-00013 TABLE 6 PCR components for Round 2, which adds the BsmBI overhangs for Golden Gate. Component Volume (μL) Nuclease-free water 31 5 × Phusion HF Buffer 10 dNTPs (10 mM) 1 Forward Primer (10 μM) 2.5 Reverse Primer (10 μM) 2.5 Annealed Guide-Generating Vector w/ gR NA (10 ng/μL) 1 DMSO 1.5 Phusion Polymerase 0.5 Reaction volume 50

[0437] Once the PCR tubes have been mixed, place samples in a thermocycler with the following settings (note the 61.3° C. annealing temperature):

TABLE-US-00014 TABLE 7 Thermocycler settings for Round 2 PCR. Step Temp (° C.) Time (s) Initial Denaturation 98 30 25-35 Cycles 98 10 61.3 30 72 30 Final Extension 72 600 Hold 4 PCR product 150 bp length

[0438] Example of Primer Selection for Round 2 PCR:

[0439] In order to build a gRNA array with six unique gRNAs within a single transcriptional unit primer pairs for Round 2 PCR would be selected accordingly. It is essential that careful attention is paid to the selection of primer pairs, as these will ultimately add the 4 bp BsmBI overhangs that are crucial for Golden Gate assembly to create the final array in subsequent steps.

[0440] For the six-gRNA array, the following primers and templates indicated mar be used:

TABLE-US-00015 TABLE 8 Example primers to use to construct an array with six gRNAs with CHORDS. PCR Tube Template DNA Primers #1 Annealed Vector w/ gRNA for Position 1 Forward, Position Position 1 in Array 1 Reverse #2 Annealed Vector w/ gRNA for Position 2 Forward, Position Position 2 in Array 2 Reverse #3 Annealed Vector w/ gRNA for Position 3 Forward, Position Position 3 in Array 3 Reverse #4 Annealed Vector w/ gRNA for Position 4 Forward, Position Position 4 in Array 4 Reverse #5 Annealed Vector w/ gRNA for Position 5 Forward, Position Position 5 in Array 5 Reverse #6 Annealed Vector w/ gRNA for Position 6 Forward, Position Position 6 in Array 12 Reverse Note the primer that is underlined—the gRNA in the final position must always use the Position 12 Reverse primer.

[0441] BsmBI and DpnI Double Digest:

[0442] After PCR, PCR tubes were removed, and a digestion was performed with restriction enzymes. If, for round 2 PCR, a template vector was used that had previously been transformed into E. coli, it will be necessary to digest the PCR mixture with DpnI and BsmBI.

[0443] If, for round 2 PCR, a template vector was used which had not been transformed into E. coli, it is necessary to digest the PCR mixture with BsmBI only.

[0444] To each PCR tube, 0.3 μL of each restriction enzyme was added. For a BsmBI/DpnI digest, samples were incubated at 37° C. for 30 minutes, followed by 55° C. for 30 minutes.

[0445] For a BsmBI digest, samples were incubated at 55° C. for 30 minutes.

[0446] A BsmBI digest was performed prior to gel purification to pre-digest the gRNA fragments. This step is thought to increase the efficiency of the Golden Gate reaction in subsequent steps.

[0447] Both BsmBI and DpnI retain activity in PCR buffers. See: https://www.neb.com/tools-and-resources/usage-guidelines/activity-of-restriction-enzymes-in-pcr-buffers

[0448] Gel Purify (2.sup.rd Time):

[0449] The digest PCR samples were gel purified by performing agarose gel electrophoresis and gel extraction as described previously. In this second gel purification stage, it is not essential to spatially separate the DNA samples, as all extracted fragments will be added into the same Golden Gate reaction mixture in the steps that follow.

[0450] Golden Gate Reaction to Obtain the Final gRNA Array:

[0451] Once samples have been gel purified, their DNA concentration was determined via a NanoDrop machine. Each sample was diluted to 50 fmol for the Golden Gate reaction.

[0452] The Golden Gate reaction uses a plasmid backbone (which we term the Destination Vector) containing BsmBI sites, which the gRNA fragments with added BsmBI sites can be assembled into.

[0453] The Destination Vector used in this study consists of a promoter (the native yeast TDH3 promoter, for example), followed by a GFP gene (which is flanked by BsmBI sites and thus excised upon Golden Gate and a terminator (see FIG. 1a). Importantly, the Destination Vector also contains designed XhoI and BglII sites after the promoter and before the terminator, which enables any gRNA array, once assembled, to be swapped between different destination vectors.

[0454] The TDH3 destination vector used in this study will be made available on Addgene and its plasmid map can be viewed on Benchling. Simple instructions to create new destination vectors in a single day with Gibson Assembly is outlined later in this section.

[0455] While performing the Golden Gate reaction, all components were kept on ice and care was taken when pipetting. It is important to ensure that each part is diluted correctly, as this will increase the efficiency of the assembly.

[0456] To Set Up the Golden Gate Reaction:

TABLE-US-00016 TABLE 9 Components for the Golden Gate reaction, which is used to assemble the final gRNA array. Component Volume (μL) 50 fmol Destination Vector 0.15 50 fmol gRNAs + BsmBI overhangs (parts) 0.5 (each) T4 DNA ligase 1 10 × T4 ligase buffer 1 BsmBI restriction enzyme 1.5 Water Varies Reaction volume 10

[0457] Once the reaction mixture has been set up, the microtube was placed into a thermocycler using the following settings:

TABLE-US-00017 TABLE 10 Thermocycler settings for the Golden Gate reaction. Step Temp (° C.) Time (min) 30 Cycles 42 5 16 5 Incubation 55 10 Incubation #2 80 20 Hold 4 ∞ Size of Vector w/ gRNA — Destination Vector (bp) + Array #gRNAs*150 bp

[0458] Following the Golden Gate reaction, E. coli was transformed using a preferred method for cloning and streaked on LB agar plates with 1:1000 chloramphenicol.

[0459] The next day, white colonies were picked and prepared to screen for a colony containing the gRNA array of interest.

[0460] Screening for Correctly Assembled gRNA Arrays:

[0461] After picking white, single colonies of E. coli, cultures were inoculated in liquid LB with 1:1000 concentration of chloramphenicol at 37° C. for 6 hours. DNA purification (miniprep) was performed for stable extraction of plasmid DNA.

[0462] The destination vector utilized in the Golden Gate reaction contains BsaI restriction sites on the 5′ end of the promoter and 3′ end of the terminator, which enables straightforward screening of array size by BsaI digest.

[0463] Once a colony yielded an ‘expected’ band pattern following digestion with BsaI, it was essential that the putative plasmid be sequence-verified.

[0464] For gRNA arrays with 5 or less gRNAs, only one primer needs to be used (as the gRNA array is only about 750 bp in length). For gRNA arrays with 6 or more gRNAs, it is recommended that sequencing is performed with both a forward and reverse primer.

[0465] For gRNA arrays inserted into the destination vector with the TDH3 promoter and TDH1 terminator, the following primers may be used for sequencing:

TABLE-US-00018 Forward Primer (binds pTDH3)- [SEQ ID NO: 50] GACGGTAGGTATTGATTGTAATTC Reverse Primer (binds tTDH1- [SEQ ID NO: 51] TGCTTAATCTTGTCTTGGCTTA

[0466] Assembly of Reporter and dCas9/Csy4 Constructs

[0467] Golden Gate was used to assemble vectors for genomic integration at the LEU2, HO or URA3 locus as described previously..sup.10

[0468] Quantification of CHORDS Efficiency

[0469] 50 μL TurboComp E. coli cells after CHORDS assembly and heat shock were streaked onto LB+chloramphenicol agar plates. GFP-negative and -positive colonies were counted manually with a blue light. 16 white colonies were randomly selected for each assembly condition and a BsaI restriction digest on 100 ng isolated DNA by adding 5 U of BsaI, 1 μL CutSmart buffer in a 10 μL reaction volume with water. Samples were incubated at 37° C. for 1 hour. The 10 μL reaction mixture was added to 2 μL of New England Biolabs 6× purple loading dye and loaded onto a 0.8% agarose gel in 1× TAE buffer at 100V for 40 minutes. Gels were imaged with blue light and an overhead camera in FluorChem software.

[0470] Flow Cytometry

[0471] Yeast transformant colonies were inoculated into liquid Synthetic Dropout media lacking the corresponding, auxotrophic amino acids and incubated in a 96-well, 2.2 mL deepwell plate at 30° C. and 700 rpm over a 5 day period. Every 12 hours, yeast were diluted in fresh media 1:100, with flow cytometry performed 6 hours after the second dilution each day. Cell fluorescence was measured by a BD LSRFortessa X-20 flow cytometer, with an attached BD HTS autosample. Fluorescence data was collected from 10,000 cells for each experiment and analyzed using FlowJo software. Flow cytometry settings: FSC sensor E01, SSC voltage 350, SSC threshold 52. mVenus excitation was with a green laser (532 nm) and detection via 530 nm filter. mRuby2 excitation was with a yellow/green laser (561 nm) and detection via a 590 nm filter. mTagBFP excitation was with a violet laser (405 nm) and detection via a 450 nm filter.

[0472] Colony PCR

[0473] Genomic DNA was isolated from yeast using the GC Preps protocol previously described..sup.13 Before genomic DNA isolation, liquid yeast cultures were re-streaked onto Synthetic Dropout media and n=4 colonies picked for each condition at specified time points (either Day 1 or Day 5 of dilutions). Colony PCR was performed by adding 10 ng of the isolated genomic DNA to reaction mix containing 5 μL each of a forward (5′-gacggtaggtattgattgtaattc-3′ [SEQ ID NO: 50]) and reverse primer (5′-tgcttaatcttgtcttggctta-3′ [SEQ ID NO: 51]) (both 10 μM), 63 μL water, 20 μL 5× Phusion HF buffer, 2 μL dNTP mix (10 mM), 3 μL 100% DMSO and 1 μL high-fidelity Phusion polymerase. Thermocycler: 30 s denaturation at 98° C., 30 cycles of 98° C. for 10 s/59° C. for 30 s/72° C. for 30 s with final incubation at 72° C. for 10 min and hold at 4° C. Gel electrophoresis was performed as described above. References [0474] (1) Cermak, T., Doyle, E. L., Christian, M., Wang, L., Zhang, Y., Schmidt, C., Bailer, J. A., Somia, N. V., Bogdanove, A. J., and Voytas, D. F. (2011) Erratum: Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting (Nucleic Acids Research (2011) 39 (e82) DOI: 10.1093/nar/gkr218). Nucleic Acids Res. 39, 7879. [0475] (2) Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., and Charpentier, E. (2012) A Programmable Dual-RNA—Guided. Science 337, 816-822. [0476] (3) Qi, L. S., Larson, M. H., Gilbert, L. A., Doudna, J. A., Weissman, J. S., Arkin, A. P., and Lim, W. A. (2013) Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173-1183. [0477] (4) Didovyk, A., Borek, B., Tsimring, L., and Hasty, J. (2016) Transcriptional regulation with CRISPR-Cas9: Principles, advances, and applications. Curr. Opin. Biotechnol. 40, 177-184. [0478] (5) Nowak, C. M., Lawson, S., Zerez, M., and Bleris, L. (2016) Guide RNA engineering for versatile Cas9 functionality. Nucleic Acids Res. 44, 9555-9564. [0479] (6) Ferreira, R., Skrekas, C., Nielsen, J., and David, F. (2018) Multiplexed CRISPR/Cas9 Genome Editing and Gene Regulation Using Csy4 in Saccharomyces cerevisiae. ACS Synth. Biol. 7, 10-15. [0480] (7) Kurata, M., Wolf, N. K., Lahr, W. S., Weg, M. T., Kluesner, M. G., Lee, S., Hui, K., Shiraiwa, M., Webber, B. R., and Moriarity, B. S. (2018) Highly multiplexed genome engineering using CRISPR/Cas9 gRNA arrays. PLoS One 13, e0198714. [0481] (8) Jakočiunas, T., Jensen, M. K., and Keasling, J. D. (2016) CRISPR/Cas9 advances engineering of microbial cell factories. Metab. Eng. 34, 44-59. [0482] (9) Hughes, R. A., and Ellington, A. D. (2017) Synthetic DNA Synthesis and Assembly: Putting the Synthetic in Synthetic Biology. Cold Spring Hart. Perspect. Biol. 9, a023812. [0483] (10) Lee, M. E., DeLoache, W. C., Cervantes, B., and Dueber, J. E. (2015) A Highly Characterized Yeast Toolkit for Modular, Multipart Assembly. ACS Synth. Biol. 4, 975-986. [0484] (11) Bzymek, M., and Lovett, S. T. (2001) Instability of repetitive DNA sequences: The role of replication in multiple mechanisms. Proc. Natl. Acad. Sci. 98, 8319-8325. [0485] (12) Argueso, J. L., Westmoreland, J., Mieczkowski, P. A., Gawel, M., Petes, T. D., and Resnick, M. A. (2008) Double-strand breaks associated with repetitive DNA can reshape the genome. Proc. Natl. Acad. Sci. 105, 11845-11850. [0486] (13) Blount, B. A., Driessen, M. R. M., and Ellis, T. (2016) GC preps: Fast and easy extraction of stable yeast genomic DNA. Sci. Rep. 6, 1-4.

Example 3

[0487] In order to expand the number of DNA repetitive domains that can be assembled we have developed an additional step using Type IIS restriction enzymes (step (h)). The correct assembly becomes stochastically less probable with the increasing number of fragments assembled. Because of this, we have introduced additional hierarchy by assembling the domains in sets of up to 6. At least up to 4 of these sets may be joined in an additional step to reach 24 repetitive domains in total. It is considered preferable if no more than 7 fragments (for example, 1 backbone vector and 2-6 gRNA inserts) are assembled at each step, which keeps a high efficiency.

[0488] This additional step does not elongate the laboratory protocol. This is achieved by assembling the final array of repetitive domains directly into the vector that will be used for transformation, using a promoter and a marker of choice. The system is compatible most widely used toolkits of promoters and vectors to be used for regulation of the expression of the repetitive fragments.

[0489] Four intermediate vectors have been constructed to facilitate such longer arrays. See SEQ ID NO: 76-79. The partial arrays are assembled into these vectors. The choice of a vector depends on the position of the sub-array in the final assembly. As an example, four versions of a commonly used terminator tTDH1 have been constructed to allow for any length of the final array without spacers.

[0490] The workflow of the proposed methodology is as follows: the domains are designed as overhangs of a forward primer and assembled using PCR (using a stable reverse primer) and subsequent ligation into a guide generating vector. The original vector is digested by DpnI enzyme and also distinguished by expression of GFP in the host bacteria. This construct is optionally confirmed by sequencing. In the second round, PCR from this vector is conducted using a combination of primers that define the overhangs and hence the position in the array. The domain of interest is flanked by type IIS cut sites (as an example BsmBI) which will allow for specific overhangs used for the assembly. A reaction with a Type IIS restriction enzyme (as example BsmBI) and DNA ligase (as example T4) is set up to assemble up to 6 repetitive domains into one of the 4 intermediate vectors. The length of the inserts is confirmed by digestion or colony PCR. 1-4 of the filled intermediate vectors are used in a Type IIS restriction enzyme (as example BsaI) reaction with a final vector, promoter and terminator to create the final array. The length is confirmed by digestion of colony PCR.

[0491] As an example of application, this assembly has been demonstrated on arrays of gRNAs navigating Cas9 enzyme to its target. They have a repetitive structure where Csy4 cites are used to separate the gRNAs after transcription and a scaffold part repeats in every gRNA. The schematic of using the above described methodology for assembly of gRNAs is shown in FIG. 8.

Example 4—Exemplary Vector Sequences, Highlighting the Different Components of Each Vector

[0492]

TABLE-US-00019 [SEQ ID NO: 76] LOCUS pLS040_-_1st_acceptor_v 2680 bp ds- DNA circular 22 MAY 2019 DEFINITION . FEATURES Location/Qualifiers protein_bind 1813..1818 /label=BsmBI″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 terminator 1684..1812 /label=″BBa_B0015 Terminator″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 CDS 967..1683 /label=″sfGFP″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 CDS complement(1946..2605) /label=″CamR″ /ApEinfo_revcolor=#0000ff /ApEinfo_fwdcolor=#0000ff promoter 801..930 /label=″BBa_J72163 GlpT Promoter″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 RBS 931..966 /label=″sfGFP Ribosome Binding Site″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 misc_feature complement(1839..1945) /label=″CamR Terminator″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc rep_origin complement(31..773) /label=″ColE1″ /ApEinfo_revcolor=#7f7f7f /ApEinfo_fwdcolor=#7f7f7f promoter complement(join(2606..2680,1..30)) /label=″CamR Promoter″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc protein_bind complement(795..800) /label=″BsmBI″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 ORIGIN 1 aaagttggaa cctcttacgt gcccgatcaa tcatgaccaa aatcccttaa cgtgagtttt 61 cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 121 ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 181 tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 241 taccaaatac tgttcttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 301 caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 361 agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 421 gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 481 gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 541 ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 601 acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 661 tgtgatgctc gtcagggggg gccagcaacg cggccttttt acggttcctg gccttttgct 721 ggccttttgc tcacatgttc tttcctgcgt tatcccctga ttctgtggat aaccgtaggg 781 tctcaTTCTC TGCcgagacg gaaagtgaaa cgtgatttca tgcgtcattt tgaacatttt 841 gtaaatctta tttaataatg tgtgcggcaa ttcacattta atttatgaat gttttcttaa 901 catcgcggca actcaagaaa cggcaggttc ggatcttagc tactagagaa agaggagaaa 961 tactagatgc gtaaaggcga agagctgttc actggtgtcg tccctattct ggtggaactg 1021 gatggtgatg tcaacggtca taagttttcc gtgcgtggcg agggtgaagg tgacgcaact 1081 aatggtaaac tgacgctgaa gttcatctgt actactggta aactgccggt tccttggccg 1141 actctggtaa cgacgctgac ttatggtgtt cagtgctttg ctcgttatcc ggaccatatg 1201 aagcagcatg acttcttcaa gtccgccatg ccggaaggct atgtgcagga acgcacgatt 1261 tcctttaagg atgacggcac gtacaaaacg cgtgcggaag tgaaatttga aggcgatacc 1321 ctggtaaacc gcattgagct gaaaggcatt gactttaaag aggacggcaa tatcctgggc 1381 cataagctgg aatacaattt taacagccac aatgtttaca tcaccgccga taaacaaaaa 1441 aatggcatta aagcgaattt taaaattcgc cacaacgtgg aggatggcag cgtgcagctg 1501 gctgatcact accagcaaaa cactccaatc ggtgatggtc ctgttctgct gccagacaat 1561 cactatctga gcacgcaaag cgttctgtct aaacctccga acgagaaacg cgatcatatg 1621 gttctgctgg agttcgtaac cgcagcgggc atcacgcatg gtatggatga actgtacaaa 1681 tgaccaggca tcaaataaaa cgaaaggctc agtcgaaaga ctgggccttt cgttttatct 1741 gttgtttgtc ggtgaacgct ctctactaga gtcacactgg ctcaccttcg ggtgggcctt 1801 tctgcgttta tacgtctctA TCCTGCCtga gaccagacca ataaaaaacg cccggcggca 1861 accgagcgtt ctgaacaaat ccagatggag ttctgaggtc attactggat ctatcaacag 1921 gagtccaagc gagctcgata tcaaattacg ccccgccctg ccactcatcg cagtactgtt 1981 gtaattcatt aagcattctg ccgacatgga agccatcaca aacggcatga tgaacctgaa 2041 tcgccagcgg catcagcacc ttgtcgcctt gcgtataata tttgcccatg gtgaaaacgg 2101 gggcgaagaa gttgtccata ttggccacgt ttaaatcaaa actggtgaaa ctcacccagg 2161 gattggctga aacgaaaaac atattctcaa taaacccttt agggaaatag gccaggtttt 2221 caccgtaaca cgccacatct tgcgaatata tgtgtagaaa ctgccggaaa tcgtcgtggt 2281 attcactcca gagcgatgaa aacgtttcag tttgctcatg gaaaacggtg taacaagggt 2341 gaacactatc ccatatcacc agctcaccgt ctttcattgc catacgaaat tccggatgag 2401 cattcatcag gcgggcaaga atgtgaataa aggccggata aaacttgtgc ttatttttct 2461 ttacggtctt taaaaaggcc gtaatatcca gctgaacggt ctggttatag gtacattgag 2521 caactgactg aaatgcctca aaatgttctt tacgatgcca ttgggatata tcaacggtgg 2581 tatatccagt gatttttttc tccattttag cttccttagc tcctgaaaat ctcgataact 2641 caaaaaatac gccoggtagt gatcttattt cattatggtg // [SEQ ID NO: 77] LOCUS pLS041_-_2nd acceptor_v 2680 bp ds- DNA circular 6 JUN. 2019 DEFINITION . FEATURES Location/Qualifiers promoter 734..863 /label=″BBa_J72163 GlpT Promoter″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 CDS 900..1616 /label=″sfGFP″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 terminator 1617..1745 /label=″BBa_B0015 Terminator″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 protein_bind 1746..1751 /label=″BsmBI″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 RBS 864..899 /label=″sfGFP Ribosome Binding Site″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 rep_origin complement(join(2644..2680,1..706)) /label=″ColE1″ /ApEinfo_revcolor=#7f7f7f /ApEinfo_fwdcolor=#7f7f7f misc_feature complement(1772-1878) /label=″CamR Terminator″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc CDS complement(1879-2538) /label=″CamR″ /ApEinfo_revcolor=#0000ff /ApEinfo_fwdcolor=#0000ff protein_bind complement (728-733) /label=″BsmBi″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 promoter complement(2539-2643) /label=″CamR Promoter″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc ORIGIN 1 ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg 61 cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga 121 tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa 181 tactgttctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc 241 tacatacctc gctctgctaa tccLgttacc agtggctgct gccagtggcg ataagtcgtg 301 tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac 361 ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct 421 acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc 481 ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg 541 gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg 601 ctcgtcaggg ggggccagca acgcggcctt tttacggttc ctggcctttt gctggccttt 661 tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta gggtctcaTG 721 CCCTGCcgag acggaaagtg aaacgtgatt tcatgcgtca ttttgaacat tttgtaaatc 781 ttatttaata atgtgtgcgg caattcacat ttaatttatg aatgttttct taacatcgcg 841 gcaactcaag aaacggcagg ttcggatctt agctactaga gaaagaggag aaatactaga 901 tgcgtaaagg cgaagagctg ttcactggtg tcgtccctat tctggtggaa ctggatggtg 961 atgtcaacgg tcataagttt tccgtgcgtg gcgagggtga aggtgacgca actaatggta 1021 aactgacgct gaagttcatc tgtactactg gtaaactgcc ggttccttgg ccgactctgg 1081 taacgacgct gacttatggt gttcagtgct ttgctcgtta tccggaccat atgaagcagc 1141 atgacttatt caagtccgcc atgccggaag gctatgtgca ggaacgcacg atttccttta 1201 aggatgacgg cacgtacaaa acgcgtgcgg aagtgaaatt tgaaggcgat accctggtaa 1261 accgcattga gctgaaaggc attgacttta aagaggacgg caatatcctg ggccataagc 1321 tggaatacaa ttttaacagc cacaatgttt acatcaccgc cgataaacaa aaaaatggca 1381 ttaaagcgaa ttttaaaatt cgccacaacg tggaggatgg cagcgtgcag ctggctcctc 1441 actaccagca aaacactcca atcggtgatg gtcctgttct gctgccagac aatcactatc 1501 tgagcacgca aagcgttctg tctaaagatc cgaacgagaa acgcgatcat atggttctgc 1561 tggagttcgt aaccgcagcg ggcatcacgc atggtatgga tgaactgtac aaatgaccag 1621 gcatcaaata aaacgaaagg ctcagtcgaa agactgggcc tttcgtttta tctgttgttt 1681 gtcggtgaac gctctctact agagtcacac tggctcacct tcgggtgggc ctttctgcgt 1741 ttatacgtct ctATCCCTAA tgagaccaga ccaataaaaa acgcccggcg gcaaccgagc 1801 gttctgaaca aatccagatg gagttctgag gtcattactg gatctatcaa caggagtcca 1861 agcgagctcg atatcaaatt acgccccgcc ctgccactca tcgcagtact gttgtaattc 1921 attaagcatt ctgccgacat ggaagccatc acaaacggca tgatgaacct gaatcgccag 1981 cggcatcagc accttgtcgc cttgcgtata atatttgccc atggtgaaaa cgggggcgaa 2041 gaagttgtcc atattggcca cgtttaaatc aaaactggtg aaactcaccc agggattggc 2101 tgaaacgaaa aacatattct caataaaccc tttagggaaa taggccaggt tttcaccgta 2161 acacgccaca tcttgcgaat atatgtgtag aaactgccgg aaatcgtcgt ggtattcact 2221 ccagagcgat gaaaacgttt cagtttgctc atggaaaacg gtgtaacaag ggtgaacact 2281 atcccatatc accagctcac cgtctttcat tgccatacga aattccggat gagcattcat 2341 caggcgggca agaatgtgaa taaaggccgg ataaaacttg tgcttatttt tctttacggt 2401 ctttaaaaag gccgtaatat ccagctgaac ggtctggtta taggtacatt gagcaactga 2461 ctgaaatgcc tcaaaatgtt ctttacgatg ccattgggat atatcaacgg tggtatatcc 2521 agtgattttt ttctccattt tagcttcctt agctcctgaa aatctcgata actcaaaaaa 2581 tacgcccggt agtgatctta tttcattatg gtgaaagttg gaacctctta cgtgcccgat 2641 caatcatgac caaaatccct taacgtgagt tttcgttcca // [SEQ ID NO: 78] LOCUS pLS042_-_3rd_acceptor_v 2680 bp ds- DNA circular 11 APR. 2019 DEFINITION . FEATURES Location/Qualifiers terminator 2079..2207 /label=″BBa_B0015 Terminator″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 promoter complement(321..425) /label=″CamR Promoter″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc CDS 1362..2078 /label=″sfGFP″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 misc_feature complement(2234..2340) /label=″CamR Terminator″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc protein_bind 2208..2213 /label=″BsmBI″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 rep_origin complement(426..1168) /label=″ColE1″ /ApEinfo_devcolor=#7f7f7f /ApEinfo_fwdcolor=#7f7f7f RBS 1326..1361 /label=″sfGFP Ribosome Binding Site″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 promoter 1196..1325 /label=″BBa_J72163 GlpT Promoter″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 CDS complement(join(2341..2680,1..320)) /label=″CamR″ /ApEinfo_revcolor=#0000ff /ApEinfo_fwdcolor=#0000ff protein_bind complement(1190..1195) /label=″BsmBI″ /ApEinfo_devcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 ORIGIN 1 ctccagagcg atgaaaacgt ttcagtttgc tcatggaaaa cggtgtaaca agggtgaaca 61 ctatcccata tcaccagctc accgtctttc attgccatac gaaattccgg atgagcattc 121 atcaggcggg caagaatgtg aataaaggcc ggataaaact tgtgcttatt tttctttacg 181 gtctttaaaa aggccgtaat atccagctga acggtctggt tataggtaca ttgagcaact 241 gactgaaatg cctcaaaatg ttctttacga tgccattggg atatatcaac ggtggtatat 301 ccagtgattt ttttctccat tttagcttcc ttagctcctg aaaatctcga taactcaaaa 361 aatacgcccg gtagtgatct tatttcatta tggtgaaagt tggaacctct tacgtgcccg 421 atcaatcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt 481 agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca 541 aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct 601 ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc ttctagtgta 661 gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct 721 aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcctaccg ggttggactc 781 aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca 841 gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg agctatgaga 901 aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg 961 aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt 1021 cgggtttcgc cacctctgac ttgagcgtcg atttttgcga tgctcgtcag ggggggccag 1081 caacgcggcc tttttacggt tcctggcctt ttgctggcct tttgctcaca tgttctttcc 1141 tgcgttatcc cctgattctg tggataaccg tagggtctca CTAACTGCcg agacggaaag 1201 tgaaacgtga tttcatgcgt cattttgaac attttgtaaa tcttatttaa taatgtgtgc 1261 ggcaattcac atttaattta tgaatgtttt cttaacatcg cggcaactca agaaacggca 1321 ggttcggatc ttagctacta gagaaagagg agaaatacta gatgcgtaaa ggcgaagagc 1381 tgttcactgg tgtcgtccct attctggtgg aactggaagg tgatgtcaac ggtcataagt 1441 tttccgtgcg tggcgagggt gaaggtgacg caactaatgg taaactgacg ctgaagttca 1501 tctgtactac tggtaaactg ccggttcctt ggccgactct ggtaacgacg ctgacttatg 1561 gtgttcagtg ctttgctcgt tatccggacc atatgaagca gcatgacttc ttcaagtccg 1621 ccatgccgga aggctatgtg caggaacgca cgatttcctt taaggatgac ggcacgtaca 1681 aaacgcgtgc ggaagtgaaa tttgaaggcg ataccctggt aaaccgcatt gagctgaaag 1741 gcattgactt taaagaggac ggcaatatcc tgggccataa gctggaatac aattttaaca 1801 gccacaatgt ttacatcacc gccgataaac aaaaaaatgg cattaaagcg aattttaaaa 1861 ttcgccacaa cgtggaggat ggcagcgtgc agctggctga tcactaccaa caaaacactc 1921 caatcggtga tggtcctgtt ctgctgccag acaatcacta tctgagcacg caaagcgttc 1981 tgtctaaaga tccgaacgag aaacgcgatc atatggttct gctggagttc gtaaccgcag 2041 cgggcatcac gcatggtatg gatgaactgt acaaatgacc aggcatcaaa taaaacgaaa 2101 ggctcagtcg aaagactggg cctttcgttt tatctgttgt ttgtcggtga acgctctcta 2161 ctagagtcac actggctcac cttcgggtgg gcctttctgc gtttatacgt ctctATCCAC 2221 CAtgagacca gaccaataaa aaacgcccgg cggcaaccga gcgttctgaa caaatccaga 2281 tggagttctg aggtcattac tggatctatc aacaggagtc caagcgagct cgatatcaaa 2341 ttacgccccg ccctgccact catcgcagta ctgttgtaat tcattaagca ttctgccgac 2401 atggaagcca tcacaaacgg catgatgaac ctgaatcgcc agcggcatca gcaccttgtc 2461 gccttgcgta taatatttgc ccatggtgaa aacgggggcg aagaagttgt ccatattggc 2521 cacgtttaaa tcaaaactgg tgaaactcac ccagggattg gctgaaacga aaaacatatt 2581 ctcaataaac cctttaggga aataggccag gttttcaccg taacacgcca catcttgcga 2641 at-tatgtgt agaaactgcc ggaaatcgtc gtggtaLtca // [SEQ ID NO: 79] LOCUS pLS043_-_4th_acceptor_v 2680 bp ds- DNA circular 11 APR. 2019 DEFINITION . FEATURES Location/Qualifiers RBS 355..390 /label=″sfGFP Ribosome Binding Site″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 promoter 225..354 /label=″BBa_J72163 GlpT Promoter″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 promoter complement(2030..2134) /label=″CamR Promoter″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc protein_bind complement(219..224) /label=″BsmBI″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 CDS complement(1370..2029) /label=″CamR″ /ApEinfo_revcolor=#0000ff /ApEinfo_fwdcolor=#0000ff terminator 1108..1236 /label=″BBa_B0015 Terminator″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 CDS 391..1107 /label=″sfGFP″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 misc_feature complement(1263..1369) /label=″CamR Terminator″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc rep_origin complement(join(2135..2680,1..197)) /label=″ColE1″ /ApEinfo_revcolor=#7f7f7f /ApEinfo_fwdcolor=#7f7f7f protein_bind 1237..1242 /label=″BsmBI″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 ORIGIN 1 gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc 61 acctctgact tgagcgtcga tttttgtgat gctcgtcagg gggggccagc aacgcggcct 121 ttttacggtt cctggccttt tgctggcctt ttgctcacat gttctttcct gcgttatccc 181 ctgartctgt ggataaccgt agggtctcaA CCACTGCcga gacggaaagt gaaacgtgat 241 ttcatgcgtc attttgaaca ttttgtaaat cttatttaat aatgtgtgcg gcaattcaca 301 tttaatttat gaatgttttc ttaacatcgc ggcaactcaa gaaacggcag gttcggatct 361 tagctactag agaaagagga gaaatactag atgcgtaaag gcgaagagct gttcactggt 421 gtcgtcccta ttctggtgga actggatggt gatgtcaacg gtcataagtt ttccgtgcgt 481 ggcgagggtg aaggtgacgc aactaatggt aaactgacgc tgaagttcat ctgtactact 541 ggtaaactgc cggttccttg gccgactctg gtaacgacgc tgacttatgg tgttcagtgc 601 tttgctcgtt atccggacca tatgaagcag catgacttct tcaagtccgc catgccggaa 661 ggctatgtgc aggaacgcac gatttccttt aaggatgacg gcacgtacaa aacgcgtgcg 721 gaagtgaaat ttgaaggcga taccctggta aaccgcattg agctgaaagg cattgacttt 781 aaagaggacg gcaatatcct gggccataag ctggaataca attttaacag ccacaatgtt 841 tacatcaccg ccgataaaca aaaaaatggc attaaagcga attttaaaat tcgccacaac 901 gtggaggatg gcagcgtgca gctggctgat cactaccagc aaaacactcc aatcggtgat 961 ggtcctgttc tgctgccaga caatcactat ctgagcacgc aaagcgttct gtctaaagat 1021 ccgaacgaga aacgcgatca tatggttctg ctggagttcg taaccgcagc gggcatcacg 1081 catggtatgg atgaactgta caaatgacca ggcatcaaat aaaacgaaag gctcagtcga 1141 aagactgggc ctttcgtttt atctgttgtt tgtcggtgaa cgctctctac tagagtcaca 1201 ctggctcacc ttcgggtggg cctttctgcg tttatacgtc tctATCCATC Ctgagaccag 1261 accaataaaa aacgcccggc ggcaaccgag cgttctgaac aaatccagat ggagttctga 1321 ggtcattact ggatctatca acaggagtcc aagcgagctc gatatcaaat tacgccccgc 1381 cctgccactc atcgcagtac tgttgtaatt cattaagcat tctgccgaca tggaagccat 1441 cacaaacggc atgatgaacc tgaatcgcca gcggcatcag caccttgtcg ccttgcgtat 1501 aatatttgcc catggtgaaa acgggggcga agaagttgtc catattggcc acgtttaaat 1561 caaaactggt gaaactcacc cagggattgg ctgaaacgaa aaacatattc tcaacaaacc 1621 ctttagggaa ataggccagg ttttcaccgt aacacgccac atcttgcgaa tatatgtgta 1681 gaaactgccg gaaatcgtcg tggtattcac tccagagcga tgaaaacgtt tcagtttgct 1741 catggaaaac ggtgtaacaa gggtgaacac tatcccatat caccagctca ccgtctttca 1801 ttgccatacg aaattccgga tgagcattca tcaggcgggc aagaatgtga ataaaggccg 1861 gataaaactt gtgcttattt ttctttacgg tctttaaaaa ggccgtaata tccagctgaa 1921 cggtctggtt ataggtacat tgagcaactg actgaaatgc ctcaaaatgt tctttacgat 1981 gccattggga tatatcaacg gtggtatatc cagtgatttt tttctccatt ttagcttcct 2041 tagctcctga aaatctcgat aactcaaaaa atacgcccgg tagtgatctt atttcattat 2101 ggtgaaagtt ggaacctctt acgtgcccga tcaatcatga ccaaaatccc ttaacgtgag 2161 ttttcgttcc actgagcgtc agaccccgta gaaaagatca aaggatcttc ttgagatcct 2221 ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt 2281 tgtttgccgg atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg 2341 cagataccaa atactgttct tctagtgtag ccgtagttag gccaccactt caagaactct 2401 gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc 2461 gataagtcgt gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg 2521 tcgggctgaa cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa 2581 ctgagatacc tacagcgtga gctatgagaa agcgccacgc ttcccgaagg gagaaaggcg 2641 gacaggtatc cggtaagcgg cagggtcgga acaggagagc // [SEQ ID NO: 80] LOCUS pLS039_-_pTDH3_with_TTC 2351 bp ds- DNA circular 5 JUN. 2019 DEFINITION . FEATURES Location/Qualifiers CDS complement(join(2095..2351,1..403)) /label=″CamR″ /ApEinfo_revcolor=#0000ff /ApEinfo_fwdcolor=#0000ff protein_bind complement(1978..1983) label=″BsaI″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 protein_bind 1277..1282 /label=″BsaI″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 promoter 1288..1967 /label=″ScTDH3 Promoter″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc protein_bind 1284..1287 /label=″BsaI″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 terminator complement(1986..2094) /label=″CamR Terminator″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc rep_origin complement(509..1272) /label=″ColE1″ /ApEinfo_revcolor=#7f7f7f /ApEinfo_fwdcolor=#7f7f7f promoter complement(404..508) /label=″CamR Promoter″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc ORIGIN 1 ggaaataggc caggttttca ccgtaacacg ccacatcttg cgaatatatg tgtagaaact 61 gccggaaatc gtcgtggtat tcactccaga gcgatgaaaa cgtttcagtt tgctcatgga 121 aaacggtgta acaagggtga acactatccc atatcaccag ctcaccgtct ttcattgcca 181 tacgaaattc cggatgagca ttcatcaggc gggcaagaat gtgaataaag gccggataaa 241 acttgtgctt atttttcttt acggtcttta aaaaggccgt aatatccagc tgaacggtct 301 ggttataggt acattgagca actgactgaa atgcctcaaa atgttcttta cgatgccatt 361 gggatatatc aacggtggta tatccagtga tttttttctc cattttagct tccttagctc 421 ctgaaaatct cgataactca aaaaatacgc ccggtagtga tcttatttca ttatggtgaa 481 agttggaacc tcttacgtgc ccgatcaatc atgaccaaaa tcccttaacg tgagttttcg 541 ttccactgag cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt 601 ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg 661 ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata 721 ccaaatactg ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca 781 ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag 841 tcgtgtctta ccgggttgga ctcaagacga cagttaccgg ataaggcgca gcggtcgggc 901 tgaacggggg gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga 961 tacctacagc gtgagctatg agaaagcgcc acgattcccg aagggagaaa ggcggacagg 1021 tatccggtaa gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac 1081 gcctggtatc tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg 1141 tgatgctcgt caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg 1201 ttcctggcct tttgctggcc ttttgctcac atgttctttc ctgcgttatc ccctgattct 1261 gtggataacc gtagtcggtc tcaaacgcag ttcgagttta tcattatcaa tagtgccatt 1321 tcaaagaata cgtaaataat taatagtagt gattttccta actttattta gtcaaaaaat 1381 tagcctttta attctgctgt aacccgtaca tgcccaaaat agggggcggg ttacacagaa 1441 tatataacat cgtaggtgtc tgggtgaaca gtttattcct ggcatccact aaatataatg 1501 gagcccgctt tttaagctgg catccagaaa aaaaaagaat cccagcacca aaatattgtt 1561 ttcttcacca accatcagtt cataggtcca ttctcttagc gcaactacag agaacagggg 1621 cacaaacagg caaaaaacgg gcacaacctc aatggagtga tgcaacctgc ctggagtaaa 1681 tgatgacaca aggcaattga cccacgcatg tatctatctc attttcttac accttctatt 1741 accttctgct ctctctgatt tggaaaaagc tgaaaaaaaa ggttgaaacc agttccctga 1801 aattattccc ctacttgact aataagtata taaagacggt aggtattgat tgtaattctg 1861 taaatctatt tcttaaactt cttaaattct acttttatag ttagtctttt ttttagtttt 1921 aaaacaccaa gaacttagtt tcgaataaac acacataaac aaacaaaaga tcTTCTtgag 1981 accagaccaa taaaaaacgc ccggcggcaa ccgagcgttc tgaacaaatc cagatggagt 2041 tctgaggtca ttagtggatc tatcaacagg agtccaagcg agctcgatat caaattacgc 2101 cccgccctgc cactcatcgc agtactgttg taattcatta agcattctgc cgacatggaa 2161 gccatcacaa acggcatgat gaacctgaat cgccagcggc atcagcacct tgtcgccttg 2221 cgtataatat ttgcccatgg tgaaaacggg ggcgaagaag ttgtccatat tggccacgtt 2281 taaatcaaaa ctggtgaaac tcacccaggg attggctgaa acgaaaaaca tattctcaat 2341 aaacccttta g [SEQ ID NO: 81] LOCUS pLS070_-_tTDH1)_[4] _modi 1915 bp ds- DNA circular 15 JUN. 2019 DEFINITION . ″E. coli Marker: CamR″ KEYWORDS ″Seguence Verified″ ″Type: 4″ FEATURES Location/Qualifiers terminator 1570..1793 /label=″ScTDH1 Terminator″ /ApEinfo_revcolor=#ff9ccd /ApEinfo_fwdcolor=#ff9ccd protein_bind complement(1794..1797) /label=″BsaI″ /ApEinfo_revcolor=#b1tt67 /ApEinfo_fwdcolor=#b1ff67 terminator comp1e1nent(1807..1915) /label=″CamR Terminator″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc promoter complement(661..765) /label=″CamR Promoter″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc protein_bind complement(1799..1804) /label=″BsaI″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 misc_feature 1544..1563 /label=″Csy4″ /ApEinfo_revcolor=#f58a5e /ApEinfo_fwdcolor=#f58a5e rep_origin complement(766..1529) /label=″ColEl″ /ApEinfo_revcolor=#7f7f7f /ApEinfo_fwdcolor=#7f7f7f CDS complement(1..660) /label=″CamR″ /ApEinfo_revcolor=#0000ff /ApEinfo_fwdcolor=#0000ff ORIGIN 1 ttacgccccg ccctgccact catcgcagta ctgttgtaat tcattaagca ttctgccgac 61 atggaagcca tcacaaacgg catgatgaac ctgaatcgcc agcggcatca gcaccttgtc 121 gccttgcgta taatatttgc ccatggtgaa aacgggggcg aagaagttgt ccatattggc 181 cacgtttaaa tcaaaactgg tgaaactcac ccagggattg gctgaaacga aaaacatatt 241 ctcaataaac cctttaggga aataggccag gttttcaccg taacacgcca catcttgcga 301 atatatgtgt agaaactgcc ggaaatcgtc gtggtattca ctccagagcg atgaaaacgt 361 ttcagtttgc tcatggaaaa cggtgtaaca agggtgaaca ctatcccata tcaccagctc 421 accgtctttc attgccatac gaaattccgg atgagcattc atcaggcggg caagaatgtg 481 aataaaggcc ggataaaact tgtgcttatt tttctttacg gtctttaaaa aggccgtaat 541 atccagctga acggtctggt tataggtaca ttgagcaact gactgaaatg cctcaaaatg 601 ttctttacga tgccattggg atatatcaac ggtggtatat ccagtgattt ttttctccat 661 tttagcttcc ttagctcctg aaaatctcga taactcaaaa aatacgcccg gtagtgatct 721 tatttcatta tggtgaaagt tggaacctct tacgtgcccg atcaatcatg accaaaatcc 781 cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt 841 cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac 901 cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct 961 tcagcagagc gcagatacca aatactgttc ttctagtgta gccgtagtta ggccaccact 1021 tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg 1081 ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata 1141 aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga 1201 cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg cttcccgaag 1261 ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg 1321 agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac 1381 ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca 1441 acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg ttctttcctg 1501 cgttatcccc tgattctgtg gataaccgta tcggtctcaT GCCgttcact gccgtatagg 1561 cagctcgaga taaagcaatc ttgatgagga taatgatttt tttttgaata tacataaata 1621 ctaccgtttt tctgctagat tttgtgatga cgtaaataag tacatattac tttttaagcc 1681 aagacaagat taagcattaa ctttaccctt ttctttctaa gtttcaatat tagttatcac 1741 tgtttaaaag ttatggcgag aacgtcggcg gttaaaatat attaccctga acggctgtga 1801 gaccagacca ataaaaaacg cccggcggca accgagcgtt ctgaacaaat ccagatggag 1861 ttctgaggtc attactggat ctatcaacag gagtccaagc gagctcgata tcaaa // [SEQ ID NO: 82] LOCUS pLS071_-_tTDH1_[4]_modi 7915 bp ds- DNA circular 21 JUN. 2019 DEFINITION . ″E. coli Marker: CamR″ KEYWORDS ″Seguence Verified″ ″Type: 4″ FEATURES Location/Qualifiers promoter complement(511..615) /label=″CamR Promoter″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc protein_bind complement(1644..1647) /label=″BsaI″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 rep_origin complement(616..1379) /label=″ColE1″ /ApEinfo_revcolor=#7f7f7f /ApEinfo_fwdcolor=#7f7f7f misc_feature 1394..1413 /label=″Csy4″ /ApEinfo_revcolor=#f58a5e /ApEinfo_fwdcolor=#f58a5e protein_bind complement(1649..1654) /label=″BsaI″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 CDS complement(join(1766..1915,1..510)) /label=″CamR″ /ApEinfo_revcolor=#0000ff /ApEinfo_fwdcolor=#0000ff terminator 1420..1643 /label=″ScTDH1 Terminator″ /ApEinfo_revcolor=#ff9ccd /ApEinfo_fwdcolor=#ff9ccd terminator complement(1657..1765) /label=″CamR Terminator″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc ORIGIN 1 aacgggggcg aagaagttgt ccatattggc cacgtttaaa tcaaaactgg tgaaactcac 61 ccagggattg gctgaaacga aaaacatatt ctcaataaac cctttaggga aataggccag 121 gttttcaccg taacacgcca catcttgcga atatatgtgt agaaactgcc ggaaatcgtc 181 gtggtattca ctccagagcg atgaaaacgt ttcagtttgc tcatggaaaa cggtgtaaca 241 agggtgaaca ctatcccata tcaccagctc accgtctttc attgccatac gaaattccgg 301 atgagcattc atcaggcggg caagaatgtg aataaaggcc ggataaaact tgtgcttatt 361 tttctttacg gtctttaaaa aggccgtaat atccagctga acggtctggt tataggtaca 421 ttgagcaact gactgaaatg cctcaaaatg ttctttacga tgccattggg atatatcaac 481 ggtggtatat ccagtgattt ttttctccat tttagcttcc ttagctcctg aaaatctcga 541 taactcaaaa aatacgcccg gtagtgatct tatttcatta tggtgaaagt tggaacctct 601 tacgtgcccg atcaatcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 661 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 721 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 781 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 841 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 901 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 961 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1021 cgtgcacaca gcccagctcg gagcgaacga cctacaccga actgagatac ctacagcgtg 1081 agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1141 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1201 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgatcgtcag 1261 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1321 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1381 tcggtctcaC TAAgttcact gccgtatagg cagctcgaga taaagcaatc ttgatgagga 1441 taatgatttt tttttgaata tacataaata ctaccgtttt tctgctagat tttgtgatga 1501 cgtaaataag tacatattac tttttaagcc aagacaagat taagcattaa ctttaccctt 1561 ttctttctaa gtttcaatat tagttatcac tgtttaaaag ttatggcgag aacgtcggcg 1621 gttaaaatat attaccctga acggctgtga gaccagacca ataaaaaacg ccaggcggca 1681 accgagcgtt ctgaacaaat ccagatggag ttctgaggtc attactggat ctatcaacag 1741 gagtccaagc gagctcgata tcaaattacg ccccgccctg ccactcatcg cagtactgtt 1801 gtaattcatt aagcattctg ccgacatgga agccatcaca aacggcatga tgaacctgaa 1861 tcgccagcgg catcagcacc ttgtcgcctt gcgtataata tttgcccatg gtgaa // [SEQ ID NO: 83] LOCUS pL,S072_-_tTDH1_[4]_modi 1915 bp ds- DNA circular 21 JUN. 2019 DEFINITION . ″E. coli Marker: CamR″ KEYWORDS ″Seguence Verified″ ″Type: 4″ FEATURES Location/Qualifiers rep_origin complement(636..1399) /label=″ColE1″ /ApEinfo_revcolor=#7f7f7f /ApEinfo_fwdcolor=#7f7f7f CDS complement(join(1786..1915,1..530)) /label=″CamR″ /ApEinfo_revcolor=#0000ff /ApEinfo_fwdcolor=#0000ff misc_feature 1414..1433 /label=″Csy4″ /ApEinfo_revcolor=#f58a5e /ApEinfo_fwdcolor=#f58aSe protein_bind complement(1664..1667) /label=″BsaI″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 protein_bind complement(1669..1674) label=″BsaI″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 promoter complement(531..635) /label=″CamR Promoter″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc terminator 1440..1663 /label=″ScTDH1 Terminator″ /ApEinfo_revcolor=#ff9ccd /ApEinfo_fwdcolor=#ff9ccd termlnator complement(1677..1785) /label=″CamR Terminator″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc ORIGIN 1 taatatttgc ccatggtgaa aacgggggcg aagaagttgt ccatattggc cacgtttaaa 61 tcaaaactgg tgaaactcac ccagggattg gctgaaacga aaaacatatt ctcaataaac 121 cctttaggga aataggccag gttttcaccg taacacgcca catcttgcga atatatgtgt 181 agaaactgcc ggaaatcgtc gtggtattca ctccagagcg atgaaaacgt ttcagtttgc 241 tcatggaaaa cggtgtaaca agggtgaaca ctatcccata tcaccagctc accgtctttc 301 attgccatac gaaattccgg atgagcattc atcaggcggg caagaatgtg aataaaggcc 361 ggataaaact tgtgcttatt tttctttacg gtctttaaaa aggccgtaat atccagctga 421 acggtctggt tataggtaca ttgagcaact gactgaaatg cctcaaactg ttatttacga 481 tgccattggg atatatcaac ggtggtatat ccagtgattt ttttctccat tatttcatta 541 ttagctcctg aaaatctcga taactcaaaa aatacgcccg gtagtgatct tatttcatta 601 tggtgaaagt tggaacctct tacgtgcccg atcaatcatg accaaaatcc cttaacgtga 661 gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt cttgagatcc 721 tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt 781 ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct tcagcagagc 841 gcagatacca aatactgttc ttctagtgta gccgtagtta ggccaccact tcaagaactc 901 tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg ctgccagtgg 961 cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata aggcgcagcg 1021 gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga cctacaccga 1081 actgagatac ctacagcgtg agctatgaga aagcgccacg cttcccgaag ggagaaaggc 1141 ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg agcttccagg 1201 gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg 1261 atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca acgcggcctt 1321 tttacggttc ctggcctttt gctggccttt tgctcacatg ttctttcctg cgttatcccc 1381 tgattctgtg gataaccgta tcggtctcaA CCAgttcact gccgtatagg cagctcgaga 1441 taaagcaatc ttgatgagga taatgatttt tttttgaata tacataaata ctaccgtttt 1501 tctgctagat tttgtgatga cgtaaataag tacatattac tttttaagcc aagacaagat 1561 taagcattaa ctttaccctt ttctttctaa gtttcaatat tagttatcac tgtttaaaag 1621 ttatggcgag aacgtcggcg gttaaaatat attaccctga acggctgtga gaccagacca 1681 ataaaaaacg cccggcggca accgagcgtt ctgaacaaat ccagatggag ttctgaggtc 1741 attactggat ctatcaacag gagtccaagc gagctcgata tcaaattacg ccccgccctg 1801 ccactcatcg cagtactgtt gtaattcatt aagcattctg ccgacatgga agccatcaca 1861 aacggcatga tgaacctgaa tcgccagcgg catcagcacc ttgtcgoctt gcgta // [SEQ ID NO: 84] LOCUS pLS073_-_tTDH1[4]_modi 1915 bp ds- DNA circular 26 JUN. 2019 DEFINITION . ″E. coli Marker: CamR″ KEYWORDS ″Seguence Verified″ ″Type: 4″ FEATURES Location/Oualifers promoter complement(320..424) /label=″CamR Promoter″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc CDS complement(join(1575..1915,1..319)) /label=″CamR″ /ApEinfo_revcolor=#0000ff /ApEinfo_fwdcolor=#0000ff rep_origin complement(425..1188) /label=″ColEl″ /ApEinfo_revcolor=#7f7f7f /ApEinfo_fwdcolor=#7f7f7f misc_feature 1203..1222 /label=″Csy4″ /ApEinfo_revcolor=#f58a5e /ApEinfo_fwdcolor=#f58a5e protein_bind complement(1453..1456) /label=″BsaI″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 terminator 1229..1452 /label=″ScTDH1 Terminator″ /ApEinfo_revcolor=#ff9ccd /ApEinfo_fwdcolor=#ff9ccd protein_bind complement(1458..1463) /label=″BsaI″ /ApEinfo_revcolor=#b1ff67 /ApEinfo_fwdcolor=#b1ff67 terminator complement(1466..1574) /label=″CamR Terminator″ /ApEinfo_revcolor=#84b0dc /ApEinfo_fwdcolor=#84b0dc ORIGIN 1 tccagagcga tgaaaacgtt tcagtttgct catggaaaac ggtgtaacaa gggtgaacac 61 tatcccatat caccagctca ccgtctttca ttgccatacg aaattccgga tgagcattca 121 tcaggcgggc aagaatgtga ataaaggccg gataaaactt gtgcttattt ttctttacgg 181 tctttaaaaa ggccgtaata tccagctgaa cggtctggtt ataggtacat tgagcaactg 241 actgaaatgc ctcaaaatgt tctttacgat gccattggga tatatcaacg gtggtatatc 301 cagtgatttt tttctccatt ttagcttcct tagctcctga aaatctcgat aactcaaaaa 361 atacgcccgg tagtgatctt atttcattat ggtgaaagtt ggaacctctt acgtgcccga 421 tcaatcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta 481 gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa 541 acaaaaaaac caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt 601 tttccgaagg taactggctt cagcagagcg cagataccaa atactgttct tctagtgtag 661 ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta 721 atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca 781 agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag 841 cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa 901 agcgccacgc ttcccgdagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga 961 acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc 1021 gggtttcgcc acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc 1081 ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt 1141 gctcacatgt tctttcctgc gttatcccct gattctgtgg ataaccgtat cggtctcaAT 1201 CCgttcactg ccgtataggc agctcgagat aaagcaatct tgatgaggat aatgattttt 1261 ttttgaatat acataaatac taccgttttt ctgctagatt ttgtgatgac gtaaataagt 1321 acatattact ttttaagcca agacaagatt aagcattaac tttacccttt tctttctaag 1381 tttcaatatt agttatcact gtttaaaagt tatggcgaga acgtcggcgg ttaaaatata 1441 ttaccctgaa cggctgtgag accagaccaa taaaaaacgc ccggcggcaa ccgagcgttc 1501 tgaacaaatc cagatggagt tctgaggtca ttactggatc tatcaacagg agtccaagcg 1561 agctcgatat caaattacgc cccgccctgc cactcatcgc agtactgttg taattcatta 1621 agcattctgc cgacatggaa gccatcacaa acggcatgat gaacctgaat cgccagcggc 1681 atcagcacct tgtcgccttg cgtataatat ttgcccatgg tgaaaacggg ggcgaaccag 1741 ttgtccatat tggccacgtt taaatcaaaa ctggtgaaac tcacccaggg attggctgaa 1801 acgaaaaaca tattctcaat aaacccttta gggaaatagg ccaggttttc accgtaacac 1861 gccacatctt gcgaatatat gtgtagaaac tgccggaaat cgtcgtggta ttcac //

[0493] The invention also provides the following numbered embodiments:

1. A method for producing an RNA mediated gene regulating or editing nucleic acid construct that comprises at least two sequences that are transcribed into nucleic acid polymers that each separately direct RNA mediated gene regulation or editing
wherein the at least two nucleic acid sequences are transcribed into a single transcript from a single promoter, wherein the method comprises:
a) amplifying a cassette from a gene regulating RNA generating (GRRG) vector using at least two GRRG primer pairs, each GRRG primer pair comprising a forward and a reverse primer,

[0494] wherein the GRRG vector comprises a selectable marker nucleic acid sequence and a nucleic acid sequence that when in RNA form comprises a cleavage site, optionally wherein the cleavage site is selected from:

[0495] i) an endoribonuclease cleavage site, for example a site-specific RNA endonuclease site, for example an artificial site-specific RNA endonucleases or a Csy4 cleavage sequence

[0496] ii) a tRNA sequence

[0497] iii) a ribozyme sequence

[0498] iv) an intron

[0499] v) a target sequence for an RNA directed cleavage complex

[0500] wherein the forward and reverse GRRG primers comprise nucleic acid sequences that are complementary to sequences of the GRRG and allow hybridisation of the primers to the GRRG vector at either side of the selectable marker sequence such that upon hybridisation the primers are directed away from the selectable marker nucleic acid sequence,

[0501] wherein the reverse GRRG primer hybridises to a common portion of the sequence that when in RNA form comprises a cleavage site, optionally wherein the sequence of the reverse primer is the same for each reverse primer in each primer pair, and wherein the forward GRRG primer hybridises to a common forward primer hybridisation sequence of the GRRG vector,

[0502] wherein the forward GRRG primer of each primer pair further comprises a sequence that encodes an RNA polymer that directs RNA mediated gene regulation or editing,

which is not complementary to the vector nucleic acid sequence and which is located 5′ of the forward primer sequence that is complementary to the GRRG

[0503] wherein amplification using each of the forward and reverse GRRG primer pairs results in the production of a linear cassette that comprises the following components in the following order 5′ to 3′:

[0504] i) the sequence that encodes an RNA polymer that directs RNA mediated gene regulation or editing ii) the forward primer hybridisation sequence

[0505] iii) the nucleic acid sequence that when in RNA form comprises a cleavage site

[0506] but which does not comprise the marker nucleic acid sequence,

[0507] optionally wherein the linear cassette comprises intervening nucleic acid located between (ii) the forward primer hybridisation sequence and (iii) the nucleic acid sequence that when in RNA form comprises a cleavage site

b) separately circularising each of the linear cassettes produced in step (a) to produce a circular nucleic acid polymer such that the sequence that encodes an RNA polymer that directs RNA mediated gene regulation or editing, is located between the forward primer hybridisation sequence and the nucleic acid sequence that when in RNA form comprises a cleavage site, optionally wherein the circularising comprises ligation of the two ends the linear cassette
c) providing at least two linking primer pairs, each primer pair comprising

[0508] a forward linking primer and a reverse linking primer,

[0509] wherein the forward linking primer is capable of hybridising to the nucleic acid sequence that when in RNA form comprises a cleavage site and the reverse linking primer is capable of hybridising to the common forward primer hybridisation sequence of the GRRG vector,

[0510] wherein each of the forward and reverse linking primers comprises a nucleic acid sequence capable of forming a single-stranded overhang, optionally wherein each primer comprises a Type II S restriction site or homing endonuclease site, wherein each pair of forward and reverse linking primers are designed so that following amplification the single-stranded overhang generated at one end of the amplification product generated by a first linking primer pair is able to hybridise with a compatible single-stranded overhang generated at one end of a second amplification product generated by a second linking primer pair;

d) amplifying each of the cassettes formed in step (b) with the appropriate pair of linking primers of (c),
e) treating the amplification products of (d) to generate a single-stranded overhang, optionally digesting the amplification products with an appropriate Type II S restriction enzyme(s) or homing endonuclease(s)
f) assembling the treated amplification products of (e) to one another to generate a single nucleic acid assembly comprising the assembled amplification products
g) ligating the single nucleic acid of (f) to a nucleic acid comprising a promoter sequence and optionally a terminator sequence,

[0511] optionally wherein the promoter nucleic acid sequence and/or optional terminator sequence has compatible overhangs to the ends of the single nucleic acid of (f), such that the promoter is located 5′ to the ligated amplification products of (f) and is capable of driving expression of a single transcript from the ligated amplification products and the optional terminator is located 3′ to the ligated amplification products of (f)

optionally where steps (f) and (g) are performed simultaneously.
2. The method of embodiment 1 wherein the sequence of the portion of the GRRG forward primer that is complementary to a sequence of the GRRG and that allows hybridisation of the primer to the GRRG vector in step (a) is the same for each forward primer of each primer pair and/or
wherein the sequence of the GRRG reverse primer that is complementary to a sequence of the GRRG and that allows hybridisation of the primer to the GRRG vector in step (a) is the same for each reverse primer of each primer pair.
3. The method of any of embodiments 1-2 wherein the promoter in step (g) is located in a destination vector and the ligation of step (g) results in the incorporation of the single nucleic acid of (f) that comprises the amplification products of (d) into the destination vector under the control of the promoter.
4. The method of any of embodiments 1-3 wherein at least two sequences that are transcribed into nucleic acid polymers that each separately direct RNA mediated gene regulation or editing are suitable for use in any one or more of CRISPR, sense Suppression/Cosuppression, antisense suppression, double-stranded RNA interference, hairpin RNA interference, intron-containing hairpin RNA interference, siRNA, micro RNA, piRNA and snoRNA.
5. The method of any of embodiments 1-4 wherein the nucleic acid construct comprises between 3 and 100 nucleic acid sequences that are transcribed into nucleic acid polymers that each separately direct RNA mediated gene regulation or editing, wherein the between 3 and 100 nucleic acid polymers are expressed as a single transcript from a single promoter, optionally wherein the nucleic acid construct comprises between and 95, 10 and 90, 15 and 85, 20 and 80, 25 and 75, 30 and 70, 35 and 65, 40 and 60, and 55 nucleic acid polymers that are transcribed into nucleic acid polymers that each separately direct RNA mediated gene regulation or editing:
optionally at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or at least 20 nucleic acid sequences that are transcribed into nucleic acid polymers that each separately direct RNA mediated gene regulation or editing, optionally at least 11 or at least 12 nucleic acid sequences that are transcribed into nucleic acid polymers that each separately direct RNA mediated gene regulation or editing.
6. The method of any of embodiments 1-5 wherein the promoter of (g) is:
a) a Pol II promoter, optionally

[0512] wherein the Pol II promoter is classed as a strong promoter:

[0513] wherein the promoter is an inducible promoter; and/or

[0514] wherein the promoter is selected from the group consisting of TDH3 promoter, TEF1 promoter, PGK1 promoter, pCCW12 promoter, pTEF2 promoter, pHHF1 promoter, pHHF2 promoter, pALD6 promoter, pGal1 promoter (galactose-inducible), pPGK1 promoter, pHTB2 promoter or pCUP1 promoter (induced by copper-sulfate), or a tetracycline-inducible promoter; or

b) a Pol III promoter, optionally

[0515] wherein the Pol III promoter is classed as a strong Po 111I promoter;

[0516] wherein the Po III promoter is an inducible promoter; and/or

[0517] wherein the Pol III is selected from the group consisting of the tRNA Phe promoter with a 5′ HDV ribozyme, the U6 promoter or the H1 promoter.

7. The method of any of embodiments 1-6 wherein the sequence of the GRRG to which the forward GRRG primer hybridises does not form part of the nucleic acid that directs RNA mediated gene regulation or editing.
8. The method of any of embodiments 1-6 wherein the sequence of the GRRG to which the forward GRRG primer hybridises encodes part of the nucleic acid that directs RNA mediated gene regulation or editing.
9. The method of any of embodiments 1-8 wherein the GGRG vector comprises a scaffold sequence that when in RNA form allows association of the RNA with a polypeptide capable of regulating or editing a gene, optionally wherein the polypeptide is selected from the group consisting of:

[0518] Cas9 or Cas9-like polypeptide, optionally wherein the Cas9 polypeptide is a Streptococcus pyogenes Cas9 polypeptide; Cas12a; Cas12b; Cas13a; Cas13b; LbCpf1 (Lachnospiraceae bacterium ND2006)—most commonly used; AsCpf1 (from Acidaminococcus); or FnCpf1 (Francisella novicida).

10. The method of embodiment 9 wherein the common forward primer hybridisation sequence of the GRRG vector sequence at least partly overlaps with the scaffold sequence.
11. The method of any of embodiments 1-10 wherein the sequence that encodes an RNA mediated gene regulation or editing directing sequence that is part of the forward primer comprises RNA for association with a Cas9 or Cas9-like protein, optionally Cas13a/C3c2 optionally comprises sgRNA sequence.
12. The method of any of embodiments 1-11 wherein the at least two nucleic acid sequences that encode an RNA mediated gene regulation or editing directing sequence(s) are directed towards different genes, optionally wherein each nucleic acid sequence that encodes an RNA mediated gene regulation or editing directing sequence is directed towards a different gene.
13. A method of producing at least two nucleic acid sequences that direct RNA mediated gene regulation or editing wherein the method comprises expressing an RNA transcript from the RNA mediated gene regulating or editing nucleic acid construct according to any of embodiments 1-12,

[0519] optionally wherein the method produces at least 11 or at least 12 nucleic acid polymers that direct RNA mediated gene regulation or editing.

14. The method of embodiment 13 wherein the RNA transcript is expressed in the presence of an agent that is capable of cleaving the sequence that when in RNA form is specifically cleavable, optionally in the presence of Csy4.
15. The method of any of embodiments 13 and 14 wherein the method further comprises transforming the RNA mediated gene regulating or editing nucleic acid construct produced by the method of any of embodiments 1-12 into a cell, optionally wherein the cell expresses or comprises or is exposed to an agent that is capable of cleaving the sequence that when in RNA form is specifically cleavable, optionally expresses or comprises or is exposed to Csy4.
16. The method of any of embodiments 13-15 wherein where at least one of the nucleic acid sequences that directs RNA mediated gene regulation or editing is a sgRNA, the method further comprises co-expressing a polypeptide capable of associating with the sgRNA, wherein the polypeptide is selected from the group consisting of:
Cas9 or Cas9-like polypeptide, optionally wherein the Cas9 polypeptide is a Streptococcus pyogenes Cas9 polypeptide; Cas12a; Cas12b; Cas13a; Cas13b; LbCpf1 (Lachnospiraceae bacterium ND2006)—most commonly used; AsCpf1 (from Acidaminococcus); or FnCpf1 (Francisella novicida);

[0520] optionally wherein the polypeptide is fused to an activation and/or repression domain, optionally

[0521] wherein the activation domain is selected from the group consisting of VP, VP16, VP64, Gal4, or B42; and/or

[0522] wherein the repression domain is selected from the group consisting of KRAB-like effectors (e.g. Mxi1), RD1152, RD11, RD5 or RD2; or

optionally wherein the polypeptide is fused to an error prone DNA polymerase.
17. A single RNA molecule that comprises at least 2 nucleic acid sequences that are each separately capable of directing RNA mediated gene regulation or editing, wherein between each nucleic acid sequence that directs RNA mediated gene regulation or editing is a sequence that is a cleavage site, optionally wherein the cleavage site is selected from the group consisting of a Csy4 cleavage site, a tRNA sequence, a ribozyme sequence, an intron sequence, or a target sequence for an RNA directed cleavage complex

[0523] optionally wherein the single RNA molecule comprises between 11 and 100 nucleic acid sequences that direct RNA mediated gene regulation or editing, optionally 12 and 90, 13 and 80, 14 and 70, 15 and 60, 20 and 50, 30 and 40, nucleic acid sequences that direct RNA mediated gene regulation or editing,

[0524] optionally wherein the single RNA molecule comprises 11 or 12 nucleic acid sequences that direct RNA mediated gene regulation or editing,

[0525] optionally wherein the single RNA molecule has been produced by the method of any of embodiments 1-12.

18. A single nucleic acid molecule that comprises at least 2 nucleic acid sequences that encode an RNA mediated gene regulation or editing directing nucleic acid polymer, wherein between each sequence that encodes an RNA mediated gene regulation or editing directing nucleic acid polymer is a sequence that when in RNA form is a cleavage site, optionally wherein the cleavage site is selected from the group consisting of a Csy4 cleavage site, a tRNA sequence, a ribozyme sequence, an intron sequence or a target sequence for an RNA directed cleavage complex, wherein the single nucleic acid molecule comprises a promoter capable of driving expression from the at least 11 nucleic acid sequences to form one single RNA transcript,

[0526] optionally wherein the single nucleic acid molecule comprises between 11 and 100 nucleic acid sequences that encode an RNA mediated gene regulation or editing directing nucleic acid polymer, optionally 12 and 90 13 and 80, 14 and 70, 15 and 60, 20 and 50, and 40 nucleic acid sequences that encode an RNA mediated gene regulation or editing directing nucleic acid polymer,

[0527] optionally wherein the single nucleic acid molecule comprises 11 or 12 nucleic acid sequences that encode an RNA mediated gene regulation or editing nucleic acid polymer,

[0528] optionally wherein the single nucleic acid molecule has been produced by the method of any of embodiments 1-12, optionally wherein the nucleic acid is DNA.

19. A phage or viral vector comprising the single RNA molecule of embodiment 17 or the single nucleic acid molecule or any of embodiments 18, optionally wherein the phage or viral vector is selected from the group consisting of adeno-associated virus (AAV), Hybrid Adenoviral Vectors or Herpes simplex viruses.
20. A cell comprising the single RNA molecule of embodiment 17 or the single nucleic acid molecule or any of embodiments 18 or the phage vector of embodiment 19.
21. The cell of embodiment 20 wherein the cell expresses or comprises or is exposed to an agent that is capable of cleaving the sequence that when in RNA form comprises a cleavage site, optionally wherein

[0529] where the sequence that when in RNA form is a cleavage site comprises the Csy4 cleavage site, the cell expresses or comprises or is exposed to Csy4 polypeptide;

[0530] where the sequence that when in RNA form is a cleavage site comprises a tRNA sequence, the cell expresses or comprises or is exposed to RNase P, RNase Z and/or RNase E;

[0531] where the sequence that when in RNA form is a cleavage site comprises a ribozyme cleavage site, the cell expresses or comprises or is exposed to the appropriate ribozyme;

[0532] where the sequence that when in RNA form is a cleavage site comprises an intron, the cell expresses or comprises or is exposed to native splicing machinery;

22. A method for the regulation or editing of at least one gene in a cell wherein the method comprises

[0533] the method for producing an RNA mediated gene regulating or editing nucleic acid construct that comprises at least two sequences that are transcribed into nucleic acid polymers that each separately direct RNA mediated gene regulation or editing according to any of embodiments 1-12;

[0534] the method for producing at least two nucleic acid polymers that direct RNA mediated gene regulation or editing according to any of embodiments 13-16, optionally at least 11 or at least 12 nucleic acid polymers that direct RNA mediated gene regulation or editing according to any of embodiments 13-16;

[0535] the use of the nucleic acid molecule according to embodiment 17;

[0536] the use of the nucleic acid molecule according embodiment 18;

[0537] the use of the phage according to embodiment 19; and/or

[0538] the use of the cell according to embodiment 20 or 21.

23. A single nucleic acid according to any of embodiments 17 or 18, the phage according to embodiment 19, or the cell according to any of embodiments 20 or 21 for use in
a) medicine, optionally for use in the treatment and/or prevention of a disease, optionally for use as a vaccine,

[0539] optionally for the treatment or prevention of a disease in which entire pathways are dysregulated, optionally wherein the disease is selected from the group consisting of Glioblastoma multiforme, Diabetes (type I and type II), Multiple sclerosis, Autoimmune diseases and Huntington's disease; or

b) an industrial process, optionally for use in brewing, large-scale protein production, pharmaceutical production, metabolite production, optionally the production of chemicals or fuels, biomass vs. growth or metabolic ‘valves’.
24. A gene regulating RNA generating (GRRG) vector comprising a selectable marker and a nucleic acid sequence that when in RNA form comprises a cleavage site, optionally wherein the cleavage site is selected from a Csy4 cleavage site, a tRNA, a ribozyme cleavage site, an intron, or a target sequence for an RNA directed cleavage complex
25. The gene regulating RNA generating vector of embodiment 24 wherein the vector further comprises a scaffold sequence that when in RNA form allows association of the RNA with a polypeptide capable of regulating or editing a gene, optionally wherein the polypeptide is selected from the group consisting of:

[0540] Cas9 or Cas9-like polypeptide, optionally wherein the Cas9 polypeptide is a Streptococcus pyogenes Cas9 polypeptide; Cas12a; Cas12b; Cas13a; Cas13b; LbCpf1 (Lachnospiraceae bacterium ND2006)—most commonly used; AsCpf1 (from Acidaminococcus); or FnCpf1 (Francisella novicida);

[0541] optionally wherein the polypeptide is fused to an activation and/or repression domain, optionally

[0542] wherein the activation domain is selected from the group consisting of VP, VP16, VP64, Gal4, or B42; and/or

[0543] wherein the repression domain is selected from the group consisting of KRAB-like effectors (e.g. Mxi1), RD1152, RD11, RD5 or RD2.

26. The gene regulating RNA generating vector of embodiment 25 wherein the vector comprises the following components in the following order 5′ to 3′:
a) nucleic acid sequence that when in RNA form comprises a Csy4 cleavage site, a tRNA, a ribozyme cleavage site, an intron or a target sequence for an RNA directed cleavage complex
b) the selectable marker; and
c) the scaffold sequence.
27. A kit comprising any two or more of
i) a GRRG vector according to any of embodiments 24-26 or as defined in any of the preceding embodiments
ii) a GRRG forward and reverse primer according to the invention
iii) one or more linking primer pairs according to the invention
iv) a destination vector according to the invention
v) a nucleic acid encoding a polypeptide selected from the group consisting of Cas9, optionally
wherein the Cas9 polypeptide is a Streptococcus pyogenes Cas9 polypeptide; Cas12a; Cas12b; Cas13a; Cas13b; LbCpf1 (Lachnospiraceae bacterium ND2006)—most commonly used; AsCpf1 (from Acidaminococcus); or FnCpf1 (Francisella novicida),
optionally wherein the polypeptide is fused to an activator or repressor domain, or an error-prone DNA polymerase
vi) a Type II S restriction enzyme, optionally BsmBI;
vii) a nucleic acid encoding a Csy4 polypeptide, optionally wherein the nucleic acid is a circular vector;
vii) one or more restriction enzymes
ix) DNA polymerase
x) DNA ligase
optionally wherein the kit comprises the GRRG vector of (i).