Abstract
The invention relates to the field of gene therapy. In addition the invention relates to the field of interfering RNA and/or microRNA (miRNA). In particular the invention relates to gene therapy involving such miRNA's and more in particular to methods and means to improve delivery of said miRNAs to target cells of a patient. The invention provides for a gene delivery vehicle for use in delivery of a miRNA to a cell resulting in silencing of a desired gene and whereby spread of said miRNA to other non-transduced cells results in silencing of said desired gene in said non-transduced cells.
Claims
1. A gene delivery vehicle comprising a miRNA scaffold for delivery of a miRNA to a target cell resulting in silencing of a desired gene in the transduced target cell, whereby spread of the miRNA to other non-transduced target cells results in silencing of the desired gene in the non transduced target cells.
2. The gene delivery vehicle according to claim 1, wherein the gene delivery vehicle comprises a mir-451 scaffold or a functional equivalent thereof.
3. The gene delivery vehicle according to claim 1, whereby the spread occurs through packaging of the miRNA in extracellular vesicles.
4. The gene delivery vehicle according to claim 3, wherein the extracellular vesicles are exosomes or microvesicles.
5. The gene delivery vehicle according to claim 1, wherein the silencing comprises nuclear silencing.
6. The gene delivery vehicle according to claim 1, wherein the silencing comprises cytoplasmic silencing.
7. The gene delivery vehicle according to claim 1, wherein the gene delivery vehicle is a virus derived particle.
8. The gene delivery vehicle according to claim 7, wherein the virus derived particle is an AAV based particle.
9. The gene delivery vehicle according to claim 1, wherein the miRNA is under control of a relatively weak promoter.
10. The gene delivery vehicle according to claim 9, wherein the promoter is selected from the group consisting of Polymerase II promotor, a chicken-beta actin promoter, a CAG promoter, an EF1alpha promoter, a PGK promoter and a tissue-specific promoter.
11. A method of treating a neurodegenerative disease, comprising administering to a subject in need thereof a gene delivery vehicle according to claim 1.
12. The method according to claim 9, wherein the neurodegenerative disease is selected from the group consisting of Huntington's disease, amyotrophic lateral sclerosis (ALS), spinocerebellar ataxias, Parkinson's disease, Alzheimer's disease, and frontotemporal dementia (FTD).
13. The method according to claim 9, wherein the miRNA is delivered to a brain cell resulting in silencing of a desired gene and spread of the miRNA to other brain cells for silencing of the desired gene, wherein the gene delivery vehicle comprises a mir-451 scaffold or a functional equivalent thereof.
14. The method according to claim 9, wherein the administration is intravenous, intrathecal, intraparenchymal, intravitreal, or subretinal administration.
15. The method according to claim 14, wherein the administration is intraportal or intracoronary delivery or isolated limb perfusion.
16. The method according to claim 13, wherein the miRNA is delivered wherein the miRNA is under control of a relatively weak promoter, such as a promoter is selected from the group consisting of a Polymerase II promotor, a chicken-beta actin promoter, an EF1alpha promoter, a CAG promoter, a PGK promoter or a tissue-specific promoter for liver expression such as LP1, or AAT.
17. A method of treating a liver disease or metabolic disorder, comprising administering to a subject in need thereof a gene delivery vehicle according to claim 1.
18. The method according to claim 9, wherein the miRNA is delivered to a liver cell resulting in silencing of a desired gene and spread of the miRNA to other liver cells for silencing of the desired gene, wherein the gene delivery vehicle comprises a mir-451 scaffold or a functional equivalent thereof.
19. A pharmaceutical composition comprising a gene delivery vehicle according to claim 1 and suitable excipients.
Description
FIGURES
[0169] FIGS. 1A-1B. FIG. 1A. Schematic of miR451 scaffold RNA structure indicating the first RNA sequence as it is designed. FIG. 1A discloses SEQ ID NO: 27. FIG. 1B. Schematic of expression cassette of a miRNA scaffold.
[0170] FIG. 2. DNA sequence of an expression construct (SEQ ID NO. 1) encoding a miR451 scaffold comprising a first RNA sequence of 22 nucleotides targeting a sequence of human ATXN3. The expression cassette comprises a CAG promotor shown in bold (position 43-1712), the sequence encoding the first RNA sequence that replaces the miRNA is shown in bold and underlined (position 2031-2052), followed by a second RNA sequence shown underlined (position 2053-2070), the hGH poly A signal shown in bold and italics (2318-2414). The first RNA sequence corresponds with the sequence that targets ATXN3, i.e. SEQ ID NO. 2. The pri-miRNA sequence comprises a pre-miRNA sequence. The pri-miRNA encoding sequence is shown between [brackets] (position 2015-2086).
[0171] The sequence corresponding with the sequence encoding a miRNA designed to target the Huntington gene is 5′-CTTGGGAATGGCAAGGAAGGACTTGAGGGACTCGAAGACGAGTCCCTCAAGTCCTCTCT TGCTATACCCAGA-3′ (SEQ ID NO. 4) which sequence can replace the sequence in between [brackets], thereby obtaining an expression cassette for the miRNA targeting Huntington. The pre-miRNA sequence comprises the first RNA sequence and the second RNA sequence and the sequence encoding it is shown underlined, either normal or bold, (position 2031-2070). The pre-miRNA or pri-miRNA encoding sequence may be replaced e.g. by another sequence encoding a pre-miRNA. The first RNA sequence of the pre-miRNA or pri-miRNA can be any sequence of 22 nucleotides selected to bind and target a sequence in e.g. the ATXN3 gene or the HTT gene, or any other suitable target sequence. The second RNA sequence is selected and adapted to be complementary to the first RNA sequence. The secondary structure is checked on mfold by folding the RNA sequence using standard settings utilizing the RNA folding form, with folding temperature fixed at 37 degrees Celcius (as available online <URL:http://unafold.rna.albany.edu/?q=mfold>; Zuker et al., Nucleic Acids Res. 31 (13), 3406-15, (2003)) for folding, and adapted if necessary, into a miR-451 pri-miRNA structure as depicted in FIG. 1.
[0172] FIG. 3. Dose-dependent transduction of HD-iPSC derived neuronal cells with three doses of AAV5-miHTT (3E11gc, 3E12gc and 3E13gc) and two doses of AAV5-miATXN (3E12gc and 3E13gc) at 20 days after transduction. Results are expressed as AAV5 gc/ug genomic DNA (average+/−SEM of 3 wells per condition).
[0173] FIG. 4. Dose-dependent expression of miHTT in extracellular vesicles (EVs) isolated from medium of control and AAV5-miHTT transduced HD-iPSC derived neuronal cells. Results are expressed as miHTT levels with respect to an endogenous miRNA (miR-16), and with respect to levels in medium of control (PBS-treated) cells (average+/−SEM).
[0174] FIG. 5. Dose-dependent expression of miATXN in extracellular vesicles (EVs) isolated from medium of control and AAV5-miATXN transduced HD-iPSC derived neuronal cells. Results are expressed as miATXN levels with respect to an endogenous miRNA (miR-16), and with respect to levels in medium of control (PBS-treated) cells (average+/−SEM).
[0175] FIGS. 6A-6B. Summary data from n=6 independent experiments showing a robust correlation between secreted miHTT molecules detected in the medium of transduced cells and both FIG. 6A viral dose (expressed as log 10 of AAV5 genome copies) and FIG. 6B miHTT expression within the cells (expressed as miHTT relative expression).
[0176] FIG. 7. Composition of EVs precipitated from the medium, analyzed with different markers by western blot. Both total cell lysate and EV fraction after Exoquick precipitation are shown. In the EV precipitate we detected EV and exosomal markers (CD63, Alix and TSG-101), microvesicle markers (Calnexin) and proteins from RISC complex (Ago2) to which functional miRNAs are bound. Cellular markers (a-tubulin and ATPase) were used as controls to confirm the absence of cells or cellular debris.
[0177] FIGS. 8A-8C. FIG. 8A dose-dependent transfer of FIG. 8B miHTT and FIG. 8C miATXN to naïve neuronal cells. Medium from PBS, AAV5-miHTT and AAV5-miATXN transduced iPSC-derived neuronal cells, and EV isolated from the medium FIG. 8A. The EVs derived from the medium were added in different concentrations (0.1×, 0.5× 1×, 2× or 5×) to naïve iPSC-derived neuronal cells. Cells were harvested 24 hours after EV-transfer, and levels of miHTT or miATXN were measured (expressed as fold change with respect to PBS group).
[0178] FIGS. 9A-9C. Functional transfer of therapeutic miHTT between cells. FIG. 9A Experimental setup: transwell experiment in which iPS-derived cells (transduced with AAV5-miHTT) were seeded in polyester membrane cell culture inserts, and placed in a 6-well plate with naïve iPS-derived neurons. FIG. 9B AAV5 genome copies in control, donor and recipient cells; only donor cells had detectable AAV5 genome copies. FIG. 9C Knock-down of huntingtin mRNA (normalized to GADPH and expressed as % from control) in both donor and recipient cells (on average 30% knock-down with respect to control cells).
[0179] FIG. 10. Representative culture of iPSC-derived neuronal cells, immunocytochemically stained with markers of mature neurons (MAP2) and astrocytes (GFAP).
[0180] FIG. 11. Vector DNA levels (expressed in genome copies per ug of genomic DNA) in different brain regions of brain cynomolgous monkeys, injected with increasing doses of AAV5-miHTT (groups 2 to 4 as indicated in legend) (n=6 animals/group) by MRI-guided CED in putamen and caudate. Bars represent average+/−SD.
[0181] FIG. 12. miHTT levels (expressed in copies per ug of total RNA) in different brain regions of brain cynomolgous monkeys, injected with increasing doses of AAV5-miHTT (groups 2 to 4 as indicated in legend) (n=6 animals/group) by MRI-guided CED in putamen and caudate. Bars represent average+/−SD.
[0182] FIGS. 13A-13D: Detection of neuronal-secreted therapeutic miRNAs enriched in both EVs and protein-containing fractions by SEC. FIG. 13A) Image of qEV10 SEC column by Izon and collection of the different fractions. FIG. 13B) Fold change quantification of endogenous miR-16 in medium from AAV-transduced neuronal cells. miR-16 was found in association with proteins but not with EVs. FIGS. 13C and 13D) Quantification of abundance of therapeutic miRNAs (miHTT and miATXN3 respectively) in the medium of AAV-transduced neuronal cells. Both AAV-delivered miRNAs were enriched in both EVs and protein fractions.
[0183] FIG. 14: Experimental outline to investigate the functional transfer of therapeutic miRNAs in vitro. Neuronal cells, selected as secreting cells, were transduced with AAV-miATXN3 and co-culture together with fibroblast cells, selected as recipient cells for 8 days. (see methods)
[0184] FIGS. 15A-15C: Continuous transfer of secreted therapeutic miRNAs results in lowering of gene expression in recipient cells. FIG. 15A) Quantification of viral DNA genome copies shows an efficient transduction of neuronal cells, viral contamination of co-cultured fibroblast and high levels of viral DNA gc in directly transduced fibroblast. FIG. 15B) Quantification of miATXN3 molecules shows a high expression of miATXN3 molecules in neuronal cells and similar level of miATXN3 molecules in both co-cultured fibroblast and directly-transduced fibroblast. FIG. 15C) Relative expression of ATXN3 mRNA normalized to naïve cells of each group. There is a 45% lowering in AV-transduced neuronal cells, 20% lowering in co-cultured fibroblast and subtle or no lowering in directly transduced fibroblast.
[0185] FIG. 16. Dissection scheme of tgHD minipig brains. Brains were collected and sliced coronally (4 mm-thick sections), in regular intervals as indicated in the illustration on the right, collecting a total of 12 sections (indicated in roman numbers from I to XII). Thereafter brain punches of 3 mm in diameter were taken bilaterally. In animals sacrificed after 6 months, 54 punches were taken (red circles). In animals sacrificed after 12 months, a total of 170 punches were taken (red plus black circles). Each punch of the left hemisphere (even numbers) was divided in four parts for different purposes (DNA, RNA, protein or backup), while the punches from the right hemisphere (odd numbers) were not divided and kept as a backup.
[0186] FIGS. 17A-17B. FIG. 17A) Vector genome (VG) copies per μg of genomic DNA and FIG. 17B) mutant HTT protein (as % from naïve controls) in different brain regions of tgHD minipigs, at 6 (left bars) and 12 (right bars) months after intraparenchymal (caudate+putamen) MRI-guided CED administration of AAV5-miHTT. The shaded region indicates areas with relative low VG levels where a stronger mutant HTT protein lowering is observed at 12 months. LLoQ: lower limit of quantification.
[0187] FIGS. 18A-18B. FIG. 18A) Expression of miHTT (molecules/cell) in different brain regions of tgHD minipigs at 12 months after intraparenchymal (caudate+putamen) MRI-guided CED administration of AAV5-miHTT. Specific brain regions are indicated in the x-axes, together with the numbering of the dissection punches. Each square indicates the levels of a single punch per animal in any given brain region. LLoQ: lower limit of quantification. FIG. 18B) Correlation of miHTT (molecules/cell) with vector genome (VG) copies per μg of genomic DNA in different brain regions of tgHD minipigs at 12 months post-administration. A significant positive correlation was obtained (Pearson r 0.8963, p<0.0001).
[0188] FIG. 19. Mutant HTT protein levels (pg/μg total protein) in different brain regions of tgHD minipigs. Animals were sacrificed under control (untreated) conditions (left bars) or at 12 months (right bars) after intraparenchymal (caudate+putamen) MRI-guided CED administration of AAV5-miHTT. Significant differences between control and treated groups are indicated as *<0.05, **<0.005, ***0.0005, ****0.0001 or #0.1 (Student's t=test, corrected p value).
[0189] FIG. 20. Correlation of mutant HTT protein (as % from naïve controls) and vector genome (VG) copies per μg of genomic DNA in different brain regions of tgHD minipigs at 12 months post-administration of AAV5-miHTT in caudate and putamen. A significant negative correlation was obtained (Pearson r −0.3260, p<0.0001). Lines crossing the x-axis indicate the threshold estimated to be needed for efficacy of HTT lowering (10.sup.4 VG/μg DNA) and the minimum levels found in target areas (8×10.sup.5 VG/μg DNA). Line crossing the y-axis delimitates the efficacy threshold (75% mutant HTT expression with respect to control). The shadowed region delimitates punches where VG levels below the efficacy threshold showed mutant HTT expression below 75% from control.
[0190] FIGS. 21A-21C. Mutant HTT protein levels (as % from control) in FIG. 21A) target regions (caudate and putamen), FIG. 21B) regions directly connected to target regions (thalamus, amygdala, nucleus accumbens and cortex) and FIG. 21C) regions with indirect connections to target regions (brainstem, hippocampus, cerebellum and white matter). Pearson correlations with vector genome (VG)/μg DNA levels led to significant negative correlations in target regions (r −0.7190) and directly connected regions (r −0.2758), but not in regions with indirect connections (r −0.1871, p=0.1080).
[0191] FIG. 22. Mutant HTT protein levels (as % from control) in cortical regions directly or indirectly connected to target regions (caudate and putamen) of tgHD minipigs at 12 months post-administration of AAV5-miHTT. Cortical regions with direct connections include prefrontal, motor, insular somato-motor and perirhinal cortices. Cortical regions with indirect connections comprise cingulate, somatosensory, visual, retrosplenial and temporal cortices. Pearson correlations with vector genome (VG)/μg DNA levels led to significant negative correlations in directly connected regions (r −0.3734, p<0.0007) but not in regions with indirect connections (r −0.1157, p=0.2831).
[0192] FIGS. 23A-23C. FIG. 23A) Relative expression of miHTT in cerebrospinal fluid (CSF) of non-human primates (NHPs), two weeks after intrastriatal administration of AAV5-miHTT. Using size exclusion chromatography (SEC), miHTT was determined in both vesicle and (lipo)protein fractions. FIG. 23B) Relative expression of two endogenous microRNAs, miR-21 and miR-16, in SEC fractions from NHP CSF. FIG. 23C) Representative SEC column used to separate vesicle and (lipo)protein fractions from NHP CSF.
