PARASITE PURIFICATION
20220204916 · 2022-06-30
Assignee
Inventors
- Andrew Blagborough (London, GB)
- Joshua Blight (London, GB)
- Arturo Reyes-Sandoval (London, GB)
- Katarzyna Sala (London, GB)
- Jacob Baum (London, GB)
Cpc classification
A61K39/015
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
The invention relates to parasites, and to methods for purifying a metabolically active obligate parasite of vertebrates and arthropods. The invention is especially concerned with methods of purifying Plasmodium and Theileria parasites, such as P. falciparum and T. parva, and highly motile parasite forms thereof, called sporozoites. The invention also relates to obligate parasites of vertebrates and arthropods purified by the methods of the invention and their use thereof.
Claims
1. A method for purifying a metabolically active obligate parasite of vertebrates and arthropods, the method comprising: (A) providing an arthropod infected with an obligate parasite of vertebrates and arthropods; (B) a) (i) homogenising the arthropod of step (A); and (ii) filtering the homogenate of step (i); and/or (iii) pre-purifying the filtered homogenate resulting from step (ii); or b) (i) dissecting the salivary gland of the infected arthropod of step (A); and (ii) homogenising the dissected glands from step (i); (C) separating the homogenate resulting from step (B) into fractions by electrophoresis; and (D) obtaining a fraction from step (C) comprising the obligate parasite of vertebrates and arthropods, thereby obtaining a purified metabolically active obligate parasite of vertebrates and arthropods.
2. The method according to claim 1, comprising: (A) providing an arthropod infected with an obligate parasite of vertebrates and arthropods; (B) (b) (i) dissecting the salivary gland of the infected arthropod of step (A); and (ii) homogenizing the dissected glands from step (i); (C) separating the homogenate resulting from step (B) into fractions by electrophoresis; and (D) obtaining a fraction from step (C) comprising the obligate parasite of vertebrates and arthropods, thereby obtaining a purified metabolically active obligate parasite of vertebrates and arthropods.
3. The method according to claim 2, wherein step (B) further comprises: (iii) filtering the homogenate of step (ii); and/or (iv) pre-purifying the filtered homogenate resulting from step (iii).
4. The method according to claim 1, comprising: (A) providing an arthropod infected with an obligate parasite of vertebrates and arthropods; (B) (a) (i) homogenising the arthropod of step (A); (ii) filtering the homogenate of step (i); and (iii) pre-purifying the filtered homogenate resulting from step (ii); (C) separating the homogenate resulting from step (B) into fractions by electrophoresis; and (D) obtaining a fraction from step (C) comprising the obligate parasite of vertebrates and arthropods, thereby obtaining a purified metabolically active obligate parasite of vertebrates and arthropods.
5. The method according to any preceding claim, wherein the obligate parasite is a parasite selected from the group consisting of: Plasmodium species parasite, Theileria species parasite, Trypanosoma species parasite, Leishmania species parasite and protozoan parasites of arthropods and vector borne viruses.
6. The method according to any preceding claim, wherein the obligate parasite is a Plasmodium species parasite, optionally wherein the obligate parasite is P. falciparum.
7. The method according to any one of claims 1 to 5, wherein the obligate parasite is a Theileria species parasite, optionally wherein the obligate parasite is T. parva.
8. The method according to any preceding claim, wherein the arthropod is an arthropod selected from the group consisting of: a mosquito, Rhipicephalus spp., Tsetse fly and triatominae spp.
9. The method according to any one of claims 1 to 6 or claim 8, wherein the arthropod is a mosquito, optionally wherein the mosquito is selected from a group consisting of: Anopheles gambiaes; Anopheles coluzzi; Anopheles merus; Anopheles arabiensis; Anopheles quadriannulatus; Anopheles stephensi; Anopheles dirus, Anopheles arabiensis; Anopheles funestus; and Anopheles melas.
10. The method according to any one of claims 1 to 5, claim 7 or claim 8, wherein the arthropod is a Rhipicephalus spp, optionally wherein the Rhipicephalus spp is Rhipicephalus appendiculatus.
11. The method according to any preceding claim, wherein steps B (a) (i) or B(b) (ii) further comprise: (aa) centrifuging the homogenate at low speed, of equal to, or less than 140 xg; and (bb) obtaining parasites retained in the supernatant.
12. The method according to any preceding claim, wherein filtering comprises passing the homogenate sequentially through size exclusion filters.
13. The method according to claim 12, wherein the homogenate is passed through, sequentially: (aa) a 200 μm to 70 μm pore size filter; (bb) a 7 μm to 4 μm pore size filter; (cc) a 4 μm to 25 μm pore size filter; (dd) a 25 μm to 15 μm pore size filter; and/or (ee) a 15 μm to 5 μm pore size filter.
14. The method according to either claim 12 or claim 13, wherein the homogenate is passed through, sequentially: (aa) a 100 μm pore size filter; (bb) a 70 μm pore size filter (cc) a 4 μm pore size filter; and (dd) a 20 μm pore size filter;
15. The method according to any preceding claim, wherein the pre-purifying step is performed by density gradient purification or gel filtration.
16. The method according to claim 15, wherein the pre-purification step comprises: aa) loading filtered homogenate onto a density gradient; bb) centrifuging the homogenate present in the density gradient of step aa); and cc) obtaining parasites from the parasite enriched boundary.
17. The method according to claim 16, wherein the pre-purification step further comprises: (dd) centrifuging parasites obtained in step (cc); (ee) aspirating the supernatant resulting from step (dd); and (ff) resuspending the parasites in buffer.
18. The method according to claim 15, wherein the pre-purification step is performed by cross-linked dextran gel filtration, or G-15 Medium grade gel filtration.
19. The method according to any preceding claim, wherein separation step (C) comprises continuous zone electrophoresis or interval zone electrophoresis.
20. An obligate parasite of vertebrates and arthropods obtained or obtainable by the method of any one of claims 1 to 19.
21. A preparation of attenuated obligate parasite of vertebrates and arthropods, wherein: i) the preparation is capable of inducing a cellular and humoral immune response when introduced into a subject; ii) the preparation does not comprise detectable amounts of free circumsporozoite protein (CSP); iii) the preparation does not comprise detectable amounts of arthropod protein, preferably when assessed by silver stain; iv) the preparation does not comprise detectable bacterial contamination, preferably when assessed by colony forming units; v) the preparation enables detection of parasite proteins by mass spectrometry; vi) the preparation of parasites show no reduction in gliding motility; vii) the preparation, when introduced into an in vitro culture of hepatocytes, results in infection of at least 1% of total hepatocytes present in the culture; viii) the preparation, when introduced into an in vitro culture of peripheral blood mononuclear cells, results in infection of at least 1% of total peripheral blood mononuclear cells present in the culture; ix) the preparation, when injected in vivo into rodents, shows improved time to patency; and/or x) the preparation, when injected in vivo into bovines, shows improved time to patency.
22. The preparation according to claim 21, wherein the obligate parasite is a parasite selected from the group consisting of: Plasmodium species parasite, Theileria species parasite, Trypanosoma species parasite, Leishmania species parasite and a protozoan parasites of arthropods and vector borne viruses.
23. The preparation according to either claim 21 or claim 22, wherein the obligate parasite is a Plasmodium species parasite, optionally wherein the obligate parasite is P. falciparum.
24. The preparation according to either claim 21 or claim 22, wherein the obligate parasite is a Theileria species parasite, optionally wherein the obligate parasite is T. parva
25. A pharmaceutical composition comprising an attenuated obligate parasite of vertebrates and arthropods according to any one of claims 20 to 24, and a pharmaceutically acceptable vehicle.
26. An attenuated obligate parasite of vertebrates and arthropods according to any one of claims 20 to 24, or the pharmaceutical composition according to claim 25, for use as a medicament.
27. An attenuated obligate parasite of vertebrates and arthropods according to any one of claims 20 to 24, or the pharmaceutical composition according to claim 25, for use in the prevention, amelioration or treatment of a parasitic infection.
28. The attenuated obligate parasite of vertebrates and arthropods according to any one of claims 20 to 23, or the pharmaceutical composition according to claim 25, for use according to claim 27, wherein the attenuated obligate parasite is a Plasmodium spp. and the infection is malaria.
29. The attenuated obligate parasite of vertebrates and arthropods according to any one of claims 20 to 22, claim 24, or the pharmaceutical composition according to claim 25, for use according to claim 27, wherein the attenuated obligate parasite is a Theileria species and the infection is East Coast fever.
30. An attenuated obligate parasite of vertebrates and arthropods according to any one of claims 20 to 24, or the pharmaceutical composition according to claim 25, for use as a vaccine.
31. A vaccine comprising an attenuated obligate parasite of vertebrates and arthropods according to any one of claims 20 to 24, or the pharmaceutical composition according to claim 25.
Description
[0252] For a better understanding of the invention, and to show how embodiments of the same may be carried into effect, reference will now be made, by way of example, to the accompanying Figures, in which:—
[0253]
[0254]
[0255]
[0256]
[0257]
[0258]
[0259]
[0260]
[0261]
[0262]
[0263]
[0264]
[0265]
[0266]
[0267]
[0268]
[0269]
[0270]
EXAMPLES
[0271] Materials and Methods
[0272] Mosquito Maintenance:
[0273] An. stephensi mosquitos used for experiments were raised at 28° C., 70% relative humidity with a 12 hr light cycle. Larvae were fed with fish pellets and adults maintained on 10% fructose.
[0274] P. berghei Maintenance and Infection:
[0275] Two transgenic P. berghei ANKA lines were used in this study that express either mCherry or GFP under control of the uis4 promoter. For infection of mice, cryopreserved parasitized RBC's (day five) were thawed and injected into naïve Balb/c mice by the intraperitoneal (i.p.) route and An. stephensi mosquitos allowed to feed on anesthetised mice with 1-2% blood-stage parasitaemia. 7-10 days later these mosquitoes were allowed to take an additional bloodmeal on naïve Balb/c mice to increase sporozoite yields. Blood-fed mosquitos were maintained at 19° C. at 70% relative humidity for 19-22 days before sporozoites were extracted.
[0276] Manual Salivary Gland Dissection (SGD):
[0277] Mosquitoes were sedated on ice for 10 min, then placed on a glass slide with 100 μL complete Schneider's Drosophila medium (1% FBS, 4° C., NaHCO.sub.3 free, Pan-Biotech) and whole salivary glands removed by gentle separation of the head using micro-forceps. Both sets of glands were gently cleaned to remove other tissues then placed into a glass dounce tissue grinder on ice using 2 μL fresh medium. The glass slide was cleaned between each dissection. Each dissection took approximately (45-90 sec) and was carried out for no more than 2-3 hr maximum to reduce loss of infectivity. To release sporozoites the salivary glands were homogenised with three gentle but firm grinds using the pestle. The sample was transferred to protein lo-bind Eppendorf (used to prevent loss of sporozoites by adhesion to plastic-ware) and mixed well before a sample was added to a haemocytometer and the average of four 16 square fields counted. Sample was diluted if too concentrated to accurately count.
[0278] Homogenisation
[0279] Mosquitoes sedated on ice were placed in a Petri dish with 2 mL (per 400 mosquitoes) complete Schneider's Drosophila media and gently homogenised with the end of a 10 mL syringe barrel for 30-60 sec. Liquid was removed and collected in a 50 mL tube. A further 1.5 mL media was added to the petri dish, gently homogenised and repeated once more. Alternatively, sedated mosquitoes were added to C/M-tube (Miltenyi Biotec) with complete Schneider's Drosophila media (approximately 6-8 mL/300 mosquitoes) and homogenised using gentleMACS (Miltenyi Biotec). Optionally, prior to homogenisation regions of the mosquito were removed depending on the maturilty level of sporozoite required. For example, if mature sporozoites are required the abdomen is removed prior.
[0280] Size Exclusion and Differential Centrifugation:
[0281] The homogenate is subsequently passed through a 100 μM filter and the filter washed with 1 mL media. This was repeated for the 70, 40 and 20 μM filters. In later purification revisions a 10 μM filter was also included (M). All steps were carried out on ice. One some occasions the product was centrifuged at 15×g for 1-5 min at 4° C. and the pellet discarded.
[0282] Density Gradient and Size Exclusion:
[0283] 1 mL homogenate was loaded onto a 3 mL Accudenz cushion (4° C.) in a 15 mL centrifuge tube and centrifuged (2500 xg, 4° C.) as per reference (22). Subsequently, 400 μL was taken from the sporozoite enriched boundary (at the 3 mL mark). 1 mL aliquots of Accudenz sporozoites were put into 2 mL protein lo-bind eppendorfs (Eppendorf), made up to 2 mL with complete Schneider's media and centrifuged (12,000 xg, 4° C., 3 min). The resultant pellet was re-suspended in complete Schneider's media (MA).
[0284] Alternatively, sample was passed through a sephadex G15-medium column. Firstly, sephadex was hydrated in 3% sodium citrate 50:50 v/v and left at 4° C. overnight. He next day either a glass syringe of a PD-10 column was packed with hydrated sephadex to approximately 3-6 cm height. Homogenate was applied to the column and either pushed through the syringe or centrifuge in the PD-10 column (800-5000 rpm, 1-5 min). The eluted product was centrifuged as above and resuspended in complete Schneider's media (MA).
[0285] If the sample was then to be used for free-flow electrophoresis (FFE) it was re-suspended to a mosquito equivalent (ME) of 200 mq/mL (mosquitoes/mL; unless stated otherwise), which was based on the original number of whole mosquitoes homogenised and the final volume this was in. The resultant sporozoite suspension was in most cases was further purified by FFE.
[0286] Free-Flow Electrophoresis—Continuous Zone Electrophoresis:
[0287] Prior to sporozoite extraction the FFE machine (FFE Service GmbH) was setup for continuous ZE (cZE) using a 0.5 mm ZE spacer, 0.8 mm filter paper. A separation buffer of 10 mM triethanolamine (TEA), 10 mM glacial acetic acid (HAc) and 250 mM sucrose was used with a stabilisation buffer of 100 mM TEA, 100 mM HAc and 250 mM sucrose injected into the separation chamber at 300 mL/hr for BD instruments or 150 mL/hr for FFE Service instruments. Electrodes were kept in 100 mM TEA, 100 mM HAc and 250 mM sucrose with a voltage of 750V and current and power limit of no greater than 250 mA and 200 W respectively for BD instruments or 900 v, max 250 mA and max 200 W for FFE Service instruments. Flow rate and voltage could be varied +/−50 mL/hr and 100V respectively. MA sample was mixed 1:1 with separation buffer (now at 100 mq/mL) and injected into the separation chamber at the cathode end at a rate of 1600 μL/hr and fractions collected 14 min after injection started and stopped 14 min after sample finished. Fractions were collected in 2 mL protein lo-bind deepwell plates (Eppendorf) containing 400 uL complete Schneider's medium. The peak sporozoite fraction(s) was identified by a haemocytometer and centrifuged in 2 mL protein lo-bind tubes (max, 4° C., 3 min) and the pellet re-suspended in 100-500 μL complete Schneider's media (MAF). To compare purification stages all samples were re-suspended to the same ME. FFE ME dose was calculated based on the volume collected in the peak fraction.
[0288] Free-Flow Electrophoresis—Interval Zone Electrophoresis:
[0289] Prior to sporozoite extraction the FFE machine (FFE Service GmbH) was setup for interval ZE (cZE) using a 0.2 mm ZE spacer, 0.4 mm filter paper. A separation buffer of 10 mM triethanolamine (TEA), 10 mM glacial acetic acid (HAc) and 250 mM sucrose was used with a stabilisation buffer of 100 mM TEA, 100 mM HAc and 250 mM sucrose injected into the separation chamber at 120 mL/hr. Electrodes were kept in 100 mM TEA, 100 mM HAc and 250 mM sucrose. Chamber was precoated with HPMC. MA sample was mixed 1:4 with separation buffer (now at 150 mq/mL) and injected into the separation chamber at the cathode end at a rate of 1000-1800 μL/hr. After 50 seconds the flow rate was changed to 20 mL/hr and voltage applied at 60 seconds (1200V, 120 W, 150 mA). At 4 min, 30 sec the voltage was stopped and flow rate returned to 120 mL/hr before fractions were collected at 6 min until 7 min 55 sec. Fractions were collected in 2 mL protein lo-bind deepwell plates (Eppendorf) containing 400 uL complete Schneider's medium. The peak sporozoite fraction(s) was identified by a haemocytometer and centrifuged in 2 mL protein lo-bind tubes (max, 4° C., 3 min) and the pellet re-suspended in 100-500 μL complete Schneider's media (MAF). To compare purification stages all samples were re-suspended to the same ME. FFE ME dose was calculated based on the volume collected in the highly pure peak fraction. Alternatively, a BISTRIS buffer system was used with varying settings (see Table 1 below).
TABLE-US-00001 TABLE 1 Settings of Interval Zone Electrophoresis. Interval Zone Electrophoresis - TEA/Ac System FFE Service System (2013) Protocol iZE, 0.2 mm 1200 V, <250 mA, <200 W, 10° C. Spacer, HPMC Chamber Coating. Horizontal 220/20 mL/hr Buffers Separation/ 10 mM TEA, 10 mM Ac, 250 mM Counterflow Sucrose, pH 7.4 Stabilisation 100 mM TEA, 100 mM Ac, 250 mM Sucrose, pH 7.4 Injection 150 mosquitoes/mL (mq/mL), 1:4 Schneiders:seperation buffer Timings Start Injection: 0 sec Stop Injection: 50 sec Voltage On: 60 sec Voltage Off: 4 min, 30 sec Start Collection: 6 min Stop Collection: 7 min, 55 sec Interval Zone Electrophoresis - BISTRIS System FFE Service System (2013) Protocol iZE, 0.2 mm 420 V, <250 mA, <200 W, 10° C. Spacer, HPMC Chamber Coating. Horizontal 220/20 mL/hr Buffers Separation/ 30 mM NaCl, 40m M BISTRIS, Counterflow 20 mM EPPS, 170 mM Sucrose, 10 mM Glucose, pH 7.4 Stabilisation 150 mM Na.sub.2SO.sub.4, 40 mM BISTRIS (Anode) 20 mM EPPS, pH 7.4 Stabilisation 300 mM NaCl, 40 mM BISTRIS, (Cathode) 20 mM EPPS, 75 mM Sucrose, pH 7.4 Electrode 200 mM Na-acetate (Anode) Electrode 100 mM NaCl, 100 mM HCl, (Cathode) 200 mM Imidazol Injection 150 mq/mL injection, 1:4 Schneiders:separation buffer Timings Start Injection: 0 sec Stop Injection: 47 sec Voltage On: 60 sec Voltage Off: 6 min, 37 sec Start Collection: 8 min, 25 sec Stop Collection: 10 min, 36 sec
[0290] Hepatocyte Culture:
[0291] Tissue culture plates were pre-coated overnight or using plasma-treatment with a 0.1M bicarbonate buffer (pH9.4) (50) of collagen I, collagen IV, fibronectin and laminin (Sigma-Aldrich; 1 μg/cm.sup.2). Human HepG2 hepatoma cell lines were maintained in complete DMEM (10% FBS, 100 penicillin/streptomycin, 5% L-glutamine; Sigma-Aldrich) at 37° C. with 5% CO.sub.2. HCO4 hepatoma cell lines were maintained in DMEM/F12 medium (10% FBS, 1% penicillin/streptomycin, 5% L-glutamine, 15 mM HEPES; 1.15% Bicarbonate; Sigma-Aldrich). A confluent mono-layer was maintained using a 18G syringe needle. Corning Hepatocells were plated and maintained in Corning Hepatocyte Medium (10% FBS, 100 P/S; Corning). To obtain primary hepatocytes male Wistar rats [Crl:CD(SD), strain ooi] were anesthetised and a 21G cannula was inserted into the hepatic portal vein and secured using tissue adhesive (3M). Liver perfusion medium (Thermo Sci; 37° C.) was pumped through the cannula at 10 mL/min using a peristaltic pump and once the liver started to lighten (within 30 sec) the speed was adjusted to 20 mL/min. Subsequently the inferior vena cava was cut and over the next 5 min blocked 2-3 times and the pump increased to 40 mL/min. Following successful perfusion, the media was exchanged for liver digest medium (Thermo Sci; 37° C.) and the same blocking procedure carried out for 8 min. The liver was subsequently transferred quickly to 4° C. complete DMEM on ice, the liver disrupted and the passed through 100 μM cell strainers. The cell suspension was washed twice (50 xg, 5 min, 4° C.) with a final re-suspension into 19 mL complete DMEM and 20 mL sterile isotonic percoll (SIP; 90% percoll, 10% 10×PBS) and centrifuged (1.06 g/mL, 100 xg, 10 min, 40 C) to remove debris and dead cells (percoll purification modified from reference (51)). The pellet was washed in complete DMEM and used to seed plates. Importantly the plates were not moved for 30 min to allow the cells to adhere evenly across the plate. They were then transferred to an incubator (37° C., 5% CO.sub.2) for 1-2 hr before medium was exchanged with serum-free hepatocyte growth medium (Promocell) which was exchanged every 12-15 hr.
[0292] Sporozoite Motility Assessment
[0293] Sporozoites were added to 37° C. complete DMEM and centrifuged (1,500 rpm, 4 min) in glass bottom tissue culture plates to sediment sporozoites. Fluorescent images were captured at 2 Hz for 600 frames at 20× magnification. Motility was assessed using the ToAST ImageJ plugin (52).
[0294] Murine Sporozoite Challenge
[0295] P. berghei sporozoites were extracted from infected mosquitoes using one of the described methods and diluted in complete Schneider's Drosophila medium (1% FBS, 4° C.). Mice were placed in a 37° C. heat-box for 10 min prior to injection of 50 μL intravenously (i.v.) into either lateral tail vein of restrained mice. From day five parasitaemia was monitored by thin-blood film until three days of positive smears were obtained, mice were then sacrificed. Time to 1% parasitaemia was then calculated by linear regression. If parasites were not detected by day 14 the mice were sacrificed.
[0296] In Vitro Hepatocyte Challenge
[0297] In vitro sporozoite challenges were carried out on hepatocytes 24 hr after plating. Sporozoites in 4° C. complete Schneider's Drosophila media were diluted in pre-warmed (37° C.) complete DMEM (for HepG2; Sigma-Aldrich) or primary hepatocyte medium (for primary hepatocytes; Promocell) to achieve a desired ratio of sporozoite to hepatocyte (usually 1:1 or 1:2) and the culture media was exchanged with the sporozoite media. Cell cultures were carefully returned to the incubator to prevent swirling and an uneven distribution of sporozoites. Media was then no-longer exchanged for the remainder of the experiment.
[0298] Ex Vivo Hepatocyte Challenge
[0299] Rats were i.v. challenged with 30 million GFP transgenic sporozoites and 14 hr later hepatocytes extracted by liver perfusion (above). Infected (GFP positive) hepatocytes were sorted (MoFlo) and plated for up to 30 hr.
[0300] Bacterial Contaminant Quantification
[0301] To assess the sterility of each purification step, tryptic soya broth (TSB; Oxoid) was inoculated with samples normalised by meq and absorbance at 600 nm measured after 16 hr incubation at 37° C. Alternatively, samples normalised by meq were serially diluted in PBS and spread on blood-agar plates incubated overnight at 37° C. Negative growth was confirmed by a further 24 hr incubation.
[0302] Protein Purity Quantification
[0303] For western blotting, sample was lysed using RIPA buffer with protease inhibitor cocktail (Sigma-Aldrich), protein concentration normalised using Pierce BCA protein assay kit (Thermo Scientific) and sample loaded onto a 12% TGX SDS-PAGE gel using reducing Laemmli buffer and transferred by semi-dry transfer onto a PVDF membrane (Bio-rad Laboratories). P. berghei CSP protein was probed using the 3D11 monoclonal (53) and detected using HRP chemiluminescence. Total protein concentration of purified mosquito sample was assessed in SDS-PAGE gels using Pierce silver stain kit (Thermo Scientific) or in solution using a Pierce BCA protein assay kit (Thermo Scientific). Dot blots were conducted on FFE fractions by loading 200 uL of each fraction onto a multiscreen-IP plate (0.45 μM, Millipore) pre-activated with methanol and incubated overnight (4° C.) before probing and detection of anti-mosquito actin (Sigma, A2066) similar to western blotting using HRP and ECL. Alternatively, protein contaminants were assessed using liquid chromatography tandem-mass spectrometry (LC-MS/MS) with prior sample preparation in 6M urea, 100 mM tris (pH7.8), 5 mM dithiothreitol, 20 mM iodoacetamide with subsequent trypsin digestion overnight and desalting. Mass spectrometry output data was analysed using the Mascot algorithm (V2.4) and UniProt database.
[0304] Flow Cytometry
[0305] Flow cytometry was carried out using an LSRII (Becton Dickson). Hepatocytes were washed three times in ix PBS and removed by gentle cell scraping. Hepatocytes were gated for single cell using FSC-H versus FSC-A and mCherry-P. berghei infected cells detected in the PE-Texas Red channel by comparing to APC channel auto fluorescence. Uninfected hepatocytes were run as controls. GFP-expressing P. berghei infected primary hepatocytes were sorted using a MoFlo cytometer (Beckman) gated for GFP positive single cells.
[0306] Fluorescent Microscopy
[0307] Timelapse imaging was carried out using 1.5 mm glass bottom dishes/plates (Mattek) on a fluorescent microscope with LED fluorescence light source at 2 Hz (Ludwig Institute, Oxford). Late stage schizonts captured using structured illumination microscopy with a Zeiss, Elyra (Imperial College London, FILM facility).
[0308] Quantitative PCR
[0309] DNA was extracted from cultures using phenol-chloroform-isopropanol precipitation and re-suspended in molecular grade water. Nucleic acid concentration was determined using a Qubit fluorometer (Thermo Scientific). Quantification of P. berghei hepatocyte infection density based in absolute genome copies was determined using a standard curve plasmid containing a 271 bp fragment from murine heat shock protein (HSP) 60 (Ensembl: ENSMUST00000027123) housekeeping gene and a 176 bp fragment from P. berghei HSP70 gene (PBANKA_071190). 100 ng of DNA template was amplified using SsoAdvanced Universal SYBR green supermix (Bio-Rad Laboratories) run on a CFX Connect RT-PCR machine (Bio-Rad Laboratories) as per manufacturers standard protocol and parasite genome numbers determined using linear fit normalised to HSP60 housekeeping (HSP60 HepG2 F.: GACCAAAGACGATGCCATGC—SEQ ID No:1, R: GCACAGCCACTCCATCTGAA—SEQ ID No: 2; HSP60 Rat F: TGGAGAGGTCATCGTCACCA SEQ ID No: 3, R: CACAGCTACTCCATCTGAGAGT—SEQ ID No:4; HSP70 P. berghei F: AGGAATGCCAGGAGGAATGC—SEQ ID No: 5, R: AGTTGGTCCACTTCCAGCTG—SEQ ID No: 6).
[0310] Animal Research
[0311] All animal work in this thesis was carried out according to the Animals (Scientific Procedures) Act 1986 Amendment Regulations 2012 (SI 2012/3039) with approval from the University of Oxford and Imperial College London Ethical Review Committee (PPL 30/2889 Oxford, 70/8788 Imperial). The Office of Laboratory Animal Welfare Assurance for Imperial College covers all Public Health Service supported activities involving live vertebrates in the US (no. A5634-01). Rats and mice were kept in individually ventilated cages.
[0312] Murine Vaccination
[0313] Sporozoites were diluted to 30-40×10.sup.4 sporozoites/mL in Schneider's drosophila medium and 100 μL injected per mouse.
[0314] Falciparum Fluorescent Microscopy
[0315] P. falciparum-infected cells were imaged on a Nikon wide-field microscope. Image processing and analysis was automated by running a custom macro in Fiji. Quantification of intracellular versus extracellular parasites was determined using the macro. Cell infection was calculated as the % ratio of intracellular parasites to HC-04 nuclei.
[0316] Theileria parva Parasite Material
[0317] A single vial of 1 ml of homogenized Theileria parva-infected Rhipicephalus appendiculatus ticks was collected (approximately 5-10 coarsely ground R. appendiculatus adults), frozen and stored in liquid Nitrogen. The vial was thawed and centrifuged at 100 xg for 5 minutes to pellet large insoluble particular material (+P). A second high-speed centrifugation step followed at 14,000 rpm for 5 minutes yielding a supernatant fraction (+S) and pellet fraction presumed to contain Theileria sporozoites (+).
[0318] Free-Flow Electrophoresis for Theileria parva Separation
[0319] Prior to sporozoite extraction the FFE machine (FFE Service GmbH) was setup for continuous ZE (cZE) using a 0.5 mm ZE spacer. A separation buffer of 10 mM triethanolamine (TEA), 10 mM glacial acetic acid (HAc) and 250 mM sucrose was used with a stabilisation buffer of 100 mM TEA, 100 mM HAc and 250 mM sucrose injected into the separation chamber at 150-180 mL/hr. Electrodes were kept in 100 mM TEA, 100 mM HAc and 250 mM sucrose with a voltage of 900-950V and current and power limit of 150 mA and 150 W respectively. The pelleted parasites were resuspended in separation buffer and injected into the separation chamber at the cathode end at a rate of 700 μL/hr and fractions collected 14 min after injection started and stopped 14 min after sample finished. Fractions were collected in 2 mL protein lo-bind deep well plates (Eppendorf).
[0320] Dot Blot
[0321] Dot blots for each of 96-well fractions were collected and probed with either polyclonal serum (made by immunising a rat with 60 μg schizont protein suspension, isolated from TaCl2 cells(4)) at 1:2000 dilution or a mouse monoclonal antibody to T. parva Hsp70 protein (5) again at 1:2000 dilution (both antibodies a kind gift from Professor Philipp Olias, Institute of Animal Pathology, University of Bern, Switzerland). A secondary HRP-conjugated antibody was used at 1:500. Densitometry was performed using the ImageLab software (BioRad Laboratories).
[0322] Statistical Analysis
[0323] Data was assessed for normality and equality of variance and used to determine the suitable statistical test as per John Tukey's exploratory data analysis method (54). Parametric data was assessed using a t-test and non-parametrically using a Mann-Whitney U test for single treatment comparisons. Multiple treatments were compared using a t-test with Bonferroni correction. Kaplan-Meier curves were compared using the Mantel-Cox test.
[0324] Results
[0325] Rapid isolation of sporozoites from whole mosquitoes by density and charge Infection rates of manual salivary gland dissected (SGD)-sporozoites in in vitro cell cultures using HepG2 or primary hepatocytes achieved less than 1% infected cells, consistent with previous studies (
[0326] MalPure 2.0 includes a combination of vital changes (i) removal of abdomens prior to homogenisation, (ii) addition of extra filters for size exclusion and optional differential centrifugation, (iii) the option of replacement of the density gradient with a sephadex column and (iv) use of new FFE protocol (iZE) (
[0327] Homogenisation:
[0328] To overcome the limiting factors of sporozoite yield and reduce the time from isolation till addition to tissue culture, whole mosquitoes were homogenised to release mCherry-expressing P. berghei sporozoites. For MalPure V2.0 samples were homogenised using an automated system (gentleMACS) in specific tubes (
[0329] Filtration
[0330] Homogenate was filtered sequentially through 100 μm to 200 μm filters in as short a period of time as possible (approx. 10 min). Up to 1000 mosquitoes at once were processed using this protocol. —MalPure V1.0
[0331] Additionally, a 10 μm filter was added and optional differential centrifugation at 18×g to remove larger debris. The inventors note that this may mitigate need to abdominal removal (Differential centrifugation)—MalPure V2.0
[0332] Density Gradient Purification:
[0333] The filtered mosquito homogenate/mash (abbreviated to M) was separated by density centrifugation using Accudenz (abbreviated to MA when combined with M), as previously described (22), to remove larger mosquito-associated debris from sporozoites (
[0334] Alternatively, sample could be pre-purfied using spehadex-G15 column (
[0335] Continuous Zone Electrophoresis (MalPure V1.0):
[0336] The sporozoite layer was subsequently separated based on total net charge by FFE (total process abbreviated to MAF when combined with MA;
[0337] Interval Zone Electrophoresis (MalPure V2.0):
[0338] Alternatively, the pre-purified sporozoites were separated using an the iZE FFE method (
[0339] MAF purified sporozoites show reduced contamination with mosquito-associated proteins and debris compared to manual salivary-gland dissected sporozoites Following separation, mosquito contaminants were assessed in comparison to those isolated by manual SGD. Samples were normalised in mosquito equivalents (meq), based on number of mosquitoes (mq) homogenised and volume (units: mq/mL) as opposed to sporozoite dose, which can vary between batches. To assess total protein contaminants, extract from uninfected mosquitoes and P. berghei infected mosquitoes were separated by FFE at three different mosquito equivalents (300, 100 and 50 mq/mL) following MA purification. Infected mosquitoes were used as controls to confirm the location of the peak FFE sporozoite fraction. All media used for protein assessment was protein free. Equivalent volumes were injected and collected for each treatment and total protein in each fraction quantified (
[0340] Subsequently, to directly compare the different steps of the purification process each step was normalised to an equivalent meq dose (200 mq/mL) and 4 meq's worth run on a reducing SDS-PAGE and silver-stained (sensitivity of 25 ng) to assess protein levels. Uninfected dissected salivary gland homogenate was included to represent the current method. Comparing steps using uninfected mosquitoes it was evident that M and MA gave the highest total protein levels, followed by SGD preparations, with MAF showing almost undetectable levels of protein contaminants (
[0341] Whilst higher mosquito equivalents (100-300 mq/mL) used for FFE purification increased the amount of mosquito contaminants encroaching on the sporozoite fraction, the peak sporozoite fraction was still free of detectable protein. The location of the peak sporozoite fraction was, however, not affected by mosquito dose. For the remainder of this study, unless specified otherwise, FFE experiments were run using a meq dose of 100 mq/mL injected into the chamber.
[0342] To further explore the purity of FFE-derived samples, purification steps (normalised by meq) were pelleted by centrifugation, demonstrating a clear visual reduction in mosquito associated debris such as melanin from the cuticle (
[0343] Finally, liquid chromatography tandem mass spectrometry (LC-MS/MS) analysis of each stage was used to sensitively assess protein purity at each stage of purification. LC-MS/MS raw data were searched against the Uniprot-Swissprot database using the MASCOT search algorithm. This led to the identification of several insect proteins across all three stages of purification (e.g. ATP synthase subunits a and b; Myosin heavy chain; ADP, ATP carrier protein 1/2) as well as other contaminating proteins (e.g. haemoglobin subunit b, specifically identified in MA). Importantly, P. berghei CSP protein was identified with three peptides exclusively in the fraction purified by MAF (
[0344] The Malpure 2.0 method shows increased protein purity as assessed by BCA, silver stain and pellets (
[0345] Purification by FFE can Yield Bacterial Contamination-Free Sporozoites
[0346] Having developed a workflow for sporozoite isolation, the inventors next sought to test the aseptic condition of purified parasites. A serial dilution of samples normalised to equal meq from each stage of purification was grown in the non-selective medium, tryptic soya broth (TSB), which is suited to the growth of a large variety of aerobic bacteria (55). After growth for 16 hr at 37° C., absorbance was measured at 600 nm (OD600) (Figure a). Only MAF purified samples reported undetectable OD600 absorbance during the seven dilutions, with MA and SGD parasites showing similar absorbance levels. Bacterial contamination was also assessed by measuring bacteria colony forming units per mL (cfu/mL) on blood-agar plates (samples normalised by meq's; 200 mq/mL). Homogenates from whole uninfected mosquitoes (Figure b) had the highest bacteria load (M: 12.0 log cfu/mL), which was reduced by Accudenz centrifugation (MA: 7.0 log cfu/mL), but remained significantly higher than manual dissection (SGD: 6.1 log cfu/mL). The sporozoite peak fraction from FFE purification of MA injected at meq's of 300, 100 and 50 mq/mL caused a significant reduction of bacterial load compared to manual dissection (MAF: 300 mq/mL: 4.9 log cfu/mL; 100 mq/mL: 4.2 log cfu/mL; 50 mq/mL: 3.9 log cfu/mL). The lowest FFE injected dose saw the most significant drop of 2.2 log in bacterial load compared to SGD, which translates to a 173-fold reduction in the bacterial load added to a hepatocyte culture compared to sporozoites obtained by SGD. When mosquitoes were sporozoite infected, a similar trend was also observed, with MAF loaded at 100 mq/mL able to significantly reduce bacterial load by 1.3 log compared to SGD (Figure c). Interestingly, when dissected salivary glands, rather than whole mosquitoes were used as homogenate, Accudenz purification (DA) significantly reduced the bacterial load by 1.7 log compared to SGD and when salivary gland homogenate was separated directly by FFE without density gradient centrifugation (DF) a larger reduction of 2.4 log was observed. However, when complete purification was conducted on dissected salivary glands (DAF) the process was able to remove all bacteria detectable by blood-plate agar growth (Figure d). Thus, by combining Accudenz and FFE with SGD, sterile sporozoites could be obtained (
[0347] Using MalPure 2.0, sporozoites can be purified aseptically without prior salivary gland dissection, instead, only removal of abdomens is required (
[0348] MAF purified sporozoites show improved infectivity compared to SGD sporozoites Following assessment of sporozoite purification and sterility the effect of purification on parasite viability was assessed by a number of in vitro and in vivo techniques. The motility of sporozoites is commonly used to assess viability (17,27), therefore motility of MAF purified sporozoites were compared to SGD parasites by analysis of their static, attached waving or gliding (clockwise or counter clockwise) 2D motion (52) (Figure a-c). Mean velocity (Figure b) and overall percentage of motility (Figure c) showed no significant difference between SGD and MAF purified sporozoites in any of the movement states. Next, in vitro infection rates of MAF purified sporozoites were assessed in HepG2 hepatoma and primary rat hepatocytes by RT-PCR, microscopy and flow cytometry. RT-PCR analysis of the absolute copy number of the housekeeping gene P. berghei hsp70 by RT-PCR, normalised to 1000 hsp70 copies for the SGD treatment, showed a 1.5 and 2.1 times higher copy number in MAF sporozoite infected HepG2 and primary rat hepatocytes compared to SGD sporozoite infected hepatocytes, respectively (Figure d).
[0349] Additionally, 24 hr time-lapse videos were taken of primary rat hepatocytes after infection with sporozoites and invasion rate determined by counting settled exo-erythrocytic forms (EEFs) present at 24 hr. Infections with MAF sporozoites showed a markedly improved infection rate of 5.4% compared to 0.4% when using SGD sporozoites (Figure e). When assessed by flow cytometry, rat primary hepatocytes infected with MAF sporozoites showed infection rates of 10.37% (302 out of 2808 cells) (
[0350] Subsequently, to explore in vivo infectivity and compare the outcome of different purification strategies, mice were challenged with sporozoites by intravenous (i.v.) injection and infectivity determined by measuring the time to reach 1% blood stage parasitaemia (prepatent period). Of note, since gliding motility of sporozoites in dissection buffer has been shown to decline over time (27), the inventors performed all isolation procedures in the same time period before injection into mice. Initially mice were infected intravenously with an escalating dose from 1000-5000 of MAF purified sporozoites, which all led to blood stage infection (Figure g). Furthermore, mice infected with 5000 sporozoites purified by either MA, MAF or SGD sporozoites all became blood stage positive (Figure h), but the time to 1% parasitaemia was on average 0.66 and 0.59 days longer for MA- and MAF-infected mice, respectively, than for mice injected with SGD sporozoites (MA**p=0.0049, MAF**p=0.0031; Mantel-Cox Test). There was, however, no significant difference between MAF or MA.
[0351] The modest reduction in in vivo infectivity of MA and MAF sporozoites compared to SGD sporozoites suggested that either Accudenz or isolation of sporozoites from whole mosquitoes may cause a reduction in infectiousness. To address this, mice were subsequently i.v. injected with 5000 sporozoites purified by MA using different mosquito homogenate sources (whole, decapitated, abdomen removed) and infectivity was compared to SGD sporozoites by assessing the time to reach 1% parasitaemia (Figure i). Removal of the abdomen prior to homogenisation was sufficient to revert the delay in parasitaemia, unlike using whole mosquitoes or removal of the head, which still caused a significant delay (MA-Whole**p=0.0016, MA-No Head**p=0.0016; Mantel-Cox Test). Increasing the dose of whole mosquito origin MA mosquitoes (180%, 1.8-fold increase) caused a reduction in delay indicating an increase in infectious dose. These results suggest that removal of immature sporozoite in oocysts (and possibly haemolymph) (56) found in the abdomen avoids the delay in time to patency. To investigate the contribution of oocyst-derived/haemolymph sporozoites, mosquitoes at 21 days post infectious blood feed were separated into abdomen, thorax (containing the salivary glands) and head. These different parts contained 70%, 29% and 1% of total sporozoites respectively (Figure j).
[0352] To confirm the delay was due to abdominal immature sporozoites, mice were infected with MAF purified sporozoites from mosquitoes that had their abdomens removed (MaAF; Figure k). Mice infected with 1000 MaAF purified sporozoites showed a significant decrease (*p=0.0415; Mantel-Cox Test) in time to 1% blood parasitaemia compared to mice infected with the same number of SGD sporozoites. Noteworthily, the same was not observed when only MA (i.e. no FFE) without abdomens (MA-No Abdomen) were used (Figure i). Combined, our observations indicate that MAF is thus also capable of significantly increasing the in vivo infectivity of sporozoites. The MAF method therefore provides a flexible workflow for the purification of high purity sporozoites which can be obtained from different sources (i.e. whole mosquitoes, no abdomens, no thorax/head or dissected salivary glands) as suited to the purpose, whilst giving superior infection rates in vitro and in vivo.
[0353] With MalPure 2.0 the inventors also see an increase in the fitness of parasites (i.e. their ability to establish a blood-stage infection in mice), which is clear at lower infective doses (
[0354] Additionally, P. falciparum sporozoites can be successfully purified by MalPure V1.0 and V2.0 to successfully invade hepatocytes in vitro (
[0355] Purified MAF Human P. falciparum Sporozoites are More Infective In Vitro Compared to SGD
[0356] With P. falciparum, MAF sporozoites increased HC-04 invasions by 2.98-fold, with a 3-fold increase in the percentage of sporozoites inside host cells compared to SGD sporozoites (
[0357] Purified MAF Human P. Falciparum Sporozoites Offer Sterile Protection as an Irradiated Parasite Vaccine
[0358] Having developed a method which produces sporozoites with a high purity and improved infectivity over SGD sporozoites the inventors next sought to assess the potential of the MAF sporozoites as a radiation attenuated sporozoite vaccine (RASv). Prior to immunisation the effective irradiation dose was determined to be 60Gy by i.v. challenge with varying doses of gamma irradiated sporozoites (
[0359] Application Offree-Flow Electrophoresis to Purification of Theileria parva Sporozoites from Rhipicephalus appendiculatus Tick-Infected Homogenate
[0360] Processing R. appendiculatus tick homogenate infected with T. parva by centrifugation and free-flow electrophoresis (FFE) resulted in a clear fraction of purified T. parva parasites. Two alternative methods were trialled (A, 900 volts at 150 mL/hour vs. B 950 volts at 180 mL/hour). As predicted method A (slower and lower voltage) produced a narrower fraction peak as determined by densitometry of dot blots than method B (
DISCUSSION
[0361] Although the pre-erythrocytic stage of malaria is an attractive intervention point to prevent the development of clinical malaria in human hosts, the field has struggled to understand and identify possible intervention targets of this developmental stage (57). A major barrier to progress has been the limited success of in vitro liver stage systems that yield low numbers of infected hepatocytes (10, 13, 16, 58, 59) when compared to comparable asexual blood-stage or sexual stage high throughput in vitro platforms (60-63). One of the key stumbling blocks for in vitro cultures is obtaining large numbers of purified and highly hepatocyte-infectious sporozoites. The work presented here helps to break down this major barrier to liver stage research, showing the development of a protocol for the purification of sporozoites in large quantities in a short period of time that is associated with markedly improved infection rates when compared to industry-standard salivary gland dissection.
[0362] Importantly, in addition to the speed and infectivity of sporozoites derived by FFE, parasites purified through this process yield entirely sterile sporozoites. This is especially important for controlling bacterial growth in long-term cultures. Sporozoite hepatocyte cultures, in particular those from P. falciparum, are commonly associated with contamination because they require at least seven days to complete the full developmental cycle. In addition to bacterial contamination, isolation of SGD sporozoites, but not MAF purified sporozoites, likely brings with it other host factors that may act as hepatocyte stress factors as evidence by the development of abnormal morphology in primary hepatocytes (
[0363] One notable difference observed between MAF-derived versus SGD sporozoites was the integrity of the major sporozoite surface protein, CSP. Immunoblotting of each separation stage against CSP highlighted three phenomena. Firstly, there was a reduction in total CSP following each step, indicating a loss of sporozoites and/or CSP shedding at each stage. Secondly, steps prior to FFE separation contained CSP fragments (as detected with anti-CSP antibody 3D11 (53) (
[0364] Using MAF sporozoites for in vitro infections led to a significant increase in successful infections from 24 to 40 hr after invasion, measured by either RT-PCR or microscopy. Infection rates of 10.4% were observed by flow cytometry. These sporozoites fully developed into late-stage exoerythrocytic schizonts in vitro (
[0365] Overall, the flexibility of our protocol, when combined with its high yield, high purity, improved infectivity and scalability enable a wealth of applications, from small scale in vitro experiments to mass throughput drug screening assays and significantly enhanced whole-parasite vaccine opportunities. For example, many hundreds of whole mosquitoes can be directly processed to provide tens of millions of sporozoites in hours (the inventors have validated up to 1000 mosquitoes in one purification). By way of illustration, in one of our experiments rats were i.v. challenged with 30×10.sup.7 MAF purified P. berghei GFP sporozoites from 400 mosquitoes within 2 hours (
[0366] In conclusion, the work presented here shows the development of a complete protocol for purification of large numbers of highly infectious sporozoites in rapid and scalable approach that is entirely compatible with basic biological, drug-screening and whole-parasite vaccine studies. Based on FFE, our approach yields sporozoites at higher purity compared to those from dissected preparations alone and is associated with a marked increase in in vitro hepatocyte infections and enhanced in vivo infectivity when abdominal sporozoites are removed. Sporozoites harvested by FFE also show markedly reduced levels of bacterial and when combined with SGD, sporozoites isolated using FFE can be routinely produced entirely bacteria-free. Importantly, the procedure permits purification of high numbers of sporozoites in a very short period of time, promising a scalable means to improve a diversity of studies. For basic sciences, demonstration of the presence of CSP peptides provides evidence that this method will be an important step towards single cell-omic studies that will require large amounts of highly pure sporozoites, free of the mosquito-associated contaminants that often limit our ability to draw conclusions from these studies (71-73). The inventors believe that application of this method will have significant implications for increasing our understanding of malaria liver stage biology and the development of therapeutic approaches that thwart it.
[0367] The inventors work in Theileria species shows that the methods developed herein to purify Plasmodium species parasites is also suitable for purifying other obligate parasitic species, such as Theileria parva. Since mosquito proteins are known to negatively impact on Plasmodium parasite infection and transmission from mosquito to human as well as impact immunity that arises (79, 80) the inventors anticipate that the separation of Theileria sporozoites away from tick material, and its further optimisation towards purity of aseptic parasites, as shown in
REFERENCES
[0368] 1. Prudêncio M, Rodriguez A, Mota M M. The silent path to thousands of merozoites: the Plasmodium liver stage. Nature Reviews Microbiology. 2006 November; 4(11):849-56. [0369] 2. Vanderberg J P. Plasmodium berghei: quantitation of sporozoites injected by mosquitoes feeding on a rodent host. Exp Parasitol. 1977 June; 42(1):169-81. [0370] 3. Sigler C I, Leland P, Hollingdale M R. In vitro infectivity of irradiated Plasmodium berghei sporozoites to cultured hepatoma cells. Am J Trop Med Hyg. 1984 July; 33(4):544-7. [0371] 4. Ntssler A, Follezou J Y, Miltgen F, Mazier D. Effect of irradiation on Plasmodium sporozoites depends on the species of hepatocyte infected. Trop Med Parasitol. 1989 December; 40(4):468-9. [0372] 5. Hoffman S L, Billingsley P F, James E, Richman A, Loyevsky M, Li T, et al. Development of a metabolically active, non-replicating sporozoite vaccine to prevent Plasmodium falciparum malaria. Human Vaccines. Taylor & Francis; 2010 Jan. 1; 6(1):97-106. [0373] 6. Hoffman S L, Doolan D L. Malaria vaccines-targeting infected hepatocytes—Nature Medicine. Nat Med. 2000 Nov. 1; 6(11):1218-9. [0374] 7. Hoffman S L, Goh L M L, Luke T C, Schneider I, Le T P, Doolan D L, et al. Protection of Humans against Malaria by Immunization with Radiation-Attenuated Plasmodium falciparumSporozoites. J INFECT DIS. 2002 Apr. 15; 185(8):1155-64. [0375] 8. HAWKING F. Pre-erythrocytic Stage in Mammalian Malaria Parasites. Nature. 1948 Jan. 31; 161(4083):175-5. [0376] 9. Hollingdale M R, Leland P, Schwartz A L. In vitro cultivation of the exoerythrocytic stage of Plasmodium berghei in a hepatoma cell line. Am J Trop Med Hyg. 1983 July; 32(4):682-4. [0377] 10. Sattabongkot J, Yimamnuaychoke N, Leelaudomlipi S, Rasameesoraj M, Jenwithisuk R, Coleman R E, et al. Establishment of a human hepatocyte line that supports in vitro development of the exo-erythrocytic stages of the malaria parasites Plasmodium falciparum and P. vivax. Am J Trop Med Hyg. 2006 May; 74(5):708-15. [0378] 11. March S, Ng S, Velmurugan S, Galstian A, Shan J, Logan D J, et al. A Microscale Human Liver Platform that Supports the Hepatic Stages of Plasmodium falciparum and vivax. Cell Host Microbe. 2013 July; 14(1):104-15. [0379] 12. Gosling R, Seidlein von L. The Future of the RTS,S/ASo1 Malaria Vaccine: An Alternative Development Plan. PLoS Med. Public Library of Science; 2016 Apr. 12; 13(4):e1001994. [0380] 13. Kaiser K, Camargo N, Kappe S H I. Transformation of Sporozoites into Early Exoerythrocytic Malaria Parasites Does Not Require Host Cells. The Rockefeller University Press; 2003 Apr. 21; 197(8):1045-50. [0381] 14. Coppi A, Natarajan R, Pradel G, Bennett B L, James E R, Roggero M A, et al. The malaria circumsporozoite protein has two functional domains, each with distinct roles as sporozoites journey from mosquito to mammalian host. Rockefeller University Press; 2011 Feb. 14; 208(2):341-56. [0382] 15. Zou X, House B L, Zyzak M D, Richie T L, Gerbasi V R. Towards an optimized inhibition of liver stage development assay (ILSDA) for Plasmodium falciparum. Malar J. 2013; 12(1):394. [0383] 16. House B L, Hollingdale M R, Sacci J B Jr., Richie T L. Functional immunoassays using an in-vitro malaria liver-stage infection model: where do we go from here? Trends Parasitol. 2009 November; 25(11):525-33. [0384] 17. Sato Y, Montagna G N, Matuschewski K. Plasmodium berghei sporozoites acquire virulence and immunogenicity during mosquito hemocoel transit. Infect Immun. American Society for Microbiology; 2014 March; 82(3):1164-72. [0385] 18. Ishino T, Yano K, Chinzei Y, Yuda M. Cell-Passage Activity Is Required for the Malarial Parasite to Cross the Liver Sinusoidal Cell Layer. Gary Ward, editor. PLoS Biol. Public Library of Science; 2004 Jan. 20; 2(1):e4. [0386] 19. Ishino T, Chinzei Y, Yuda M. Two proteins with 6-cys motifs are required for malarial parasites to commit to infection of the hepatocyte. Molecular Microbiology. 2005 Sep. 5; 58(5):1264-75. [0387] 20. Kariu T, Ishino T, Yano K, Chinzei Y, Yuda M. CelTOS, a novel malarial protein that mediates transmission to mosquito and vertebrate hosts. Molecular Microbiology. 2006 Jan. 20; 59(5):1369-79. [0388] 21. Hollingdale M R, Nardin E H, Tharavanij S, Schwartz A L, Nussenzweig R S. Inhibition of entry of Plasmodium falciparum and P. vivax sporozoites into cultured cells; an in vitro assay of protective antibodies. The Journal of Immunology. American Association of Immunologists; 1984 February; 132(2):909-13. [0389] 22. Kennedy M, Fishbaugher M E, Vaughan A M, Patrapuvich R, Boonhok R, Yimamnuaychok N, et al. A rapid and scalable density gradient purification method for Plasmodium sporozoites. Malar J. BioMed Central Ltd; 2012 Dec. 17; 11(1):421. [0390] 23. Mazier D, Beaudoin R L, Mellouk S, Druilhe P, Texier B, Trosper J, et al. Complete development of hepatic stages of Plasmodium falciparum in vitro. Science. 1985 Jan. 25; 227(4685):440-2. [0391] 24. Siau A, Silvie O, Franetich J-F, Yalaoui S, Marinach C, Hannoun L, et al. Temperature shift and host cell contact up-regulate sporozoite expression of Plasmodium falciparum genes involved in hepatocyte infection. Dietsch K, editor. PLoS Pathog. 2008 Aug. 8; 4(8):e1000121. [0392] 25. Corradetti A, Verolini F, Sebastiani A, Proietti A M, Amati L. FLUORESCENT ANTIBODY TESTING WITH SPOROZOITES OF PLASMODIA. Bulletin of the World Health Organization. World Health Organization; 1964; 30(5):747-50. [0393] 26. Bhanot P, Schauer K, Coppens I, Nussenzweig V. A Surface Phospholipase Is Involved in the Migration of Plasmodium Sporozoites through Cells. J Biol Chem. 2005 Feb. 18; 280(8):6752-60. [0394] 27. Lupton E J, Roth A, Patrapuvich R, Maher S P, Singh N, Sattabongkot J, et al. Enhancing longevity of Plasmodium vivax and P. falciparum sporozoites after dissection from mosquito salivary glands. Parasitology International. 2015 April; 64(2):211-8. [0395] 28. Hovlid M L, Winzeler E A. Phenotypic Screens in Antimalarial Drug Discovery. Trends Parasitol. Elsevier; 2016 Sep. 1; 32(9):697-707. [0396] 29. Ménard R, Tavares J, Cockburn I, Markus M, Zavala F, Amino R. Looking under the skin: the first steps in malarial infection and immunity. Nature Reviews Microbiology. Nature Research; 2013 Oct. 1; 11(10):701-12. [0397] 30. Schleicher T R, Yang J, Freudzon M, Rembisz A, Craft S, Hamilton M, et al. A mosquito salivary gland protein partially inhibits Plasmodium sporozoite cell traversal and transmission. Nature Communications. Nature Publishing Group; 2018 Jul. 25; 9(1):2908. [0398] 31. Vogt M B, Lahon A, Arya R P, Kneubehl A R, Clinton J L S, Paust S, et al. Mosquito saliva alone has profound effects on the human immune system. Dinglasan R R, editor. PLoS Negl Trop Dis. Public Library of Science; 2018 May 17; 12(5):e0006439. [0399] 32. Ozaki L S, Gwadz R W, Godson G N. Simple Centrifugation Method for Rapid Separation of Sporozoites from Mosquitoes. The Journal of Parasitology. 1984 October; 70(5):831. [0400] 33. Bosworth A B, Schneider I, Freier J E. Mass Isolation of Anopheles stephensi Salivary Glands Infected with Malarial Sporozoites. The Journal of Parasitology. 1975 August; 61(4):769. [0401] 34. Touray M G, Warburg A, Laughinghouse A, Krettli A U, Miller L H. Developmentally regulated infectivity of malaria sporozoites for mosquito salivary glands and the vertebrate host. 1992 Jun. 1; 175(6):1607-12. [0402] 35. KRETTLI A, CHEN DH, NUSSENZWEIG R S. Immunogenicity and Infectivity of Sporozoites of Mammalian Malaria Isolated by Density-Gradient Centrifugation. Journal of Eukaryotic Microbiology. Blackwell Publishing Ltd; 1973 Nov. 1; 20(5):662-5. [0403] 36. Beaudoin R L, Strome C P A, Mitchell F, Tubergen T A. Plasmodium berghei: Immunization of mice against the ANKA strain using the unaltered sporozoite as an antigen. Exp Parasitol. 1977 June; 42(1):1-s. [0404] 37. Pacheco N D, Strome C P A, Mitchell F, Bawden M P, Beaudoin R L. Rapid, Large-Scale Isolation of Plasmodium berghei Sporozoites from Infected Mosquitoes. The Journal of Parasitology. 1979 June; 65(3):414. [0405] 38. Wood D E, Smrkovski L L, McConnell E, Pacheco N D, Bawden M P. The use of membrane screen filters in the isolation of Plasmodium berghei sporozoites from mosquitos. Bulletin of the World Health Organization. World Health Organization; 1979; 57 Supp11(Suppl):69-74. [0406] 39. Schulman S, Oppenheim J D, Vanderberg J P. Plasmodium berghei and Plasmodium knowlesi: Serum binding to sporozoites. Exp Parasitol. 1980 June; 49(3):420-9. [0407] 40. Heidrich H-G, Danforth H D, Leef J L, Beaudoin R L. Free-Flow Electrophoretic Separation of Plasmodium berghei Sporozoites. The Journal of Parasitology. 1983 April; 69(2):360. [0408] 41. Mack S R, Vanderberg J P, Nawrot R. Column separation of Plasmodium berghei sporozoites. The Journal of Parasitology. 1978 February; 64(1):166-8. [0409] 42. MOSER G, BROHN FH, Danforth H D, NUSSENZWEIG R S. Sporozoites of Rodent and Simian Malaria, Purified by Anion Exchangers, Retain their Immunogenicity and Infectivity. Journal of Eukaryotic Microbiology. Blackwell Publishing Ltd; 1978 Feb. 1; 25(1):119-24. [0410] 43. Hannig K, Heidrich H-G. Free-Flow Electrophoresis: An Important Preparative and Analytical Technique for Biology, Biochemistry and Diagnostics. 1st ed. Darmstadt: Git Verlag; 1990. [0411] 44. Angrisano F, Riglar D T, Sturm A, Volz J C, Delves M J, Zuccala E S, et al. Spatial Localisation of Actin Filaments across Developmental Stages of the Malaria Parasite. Templeton T J, editor. PLoS ONE. Public Library of Science; 2012 February 28; 7(2):e32188. [0412] 45. Lin J-W, Annoura T, Sajid M, Chevalley-Maurel S, Ramesar J, Klop O, et al. A novel “gene insertion/marker out” (GIMO) method for transgene expression and gene complementation in rodent malaria parasites. Kappe S, editor. PLoS ONE. 2011; 6(12):e29289. [0413] 46. S Hopp C, Chiou K, RT Ragheb D, M Salman A, M Khan S, J Liu A, et al. Longitudinal analysis of Plasmodium sporozoite motility in the dermis reveals component of blood vessel recognition. eLife. 2014; 4. [0414] 47. Mueller A-K, Camargo N, Kaiser K, Andorfer C, Frevert U, Matuschewski K, et al. Plasmodium liver stage developmental arrest by depletion of a protein at the parasite-host interface. Proc Natl Acad Sci USA. National Academy of Sciences; 2005 Feb. 22; 102(8):3022-7. [0415] 48. Salman A M, Mogollon C M, Lin J-W, van Pul F J A, Janse C J, Khan S M. Generation of Transgenic Rodent Malaria Parasites Expressing Human Malaria Parasite Proteins. In: Malaria Vaccines. New York, N.Y.: Humana Press, New York, N.Y.; 2015. pp. 257-86. (Methods in Molecular Biology; vol. 1325). [0416] 49. Janse C J, Ramesar J, Waters A P. High-efficiency transfection and drug selection of genetically transformed blood stages of the rodent malaria parasite <i>Plasmodium berghei</i>. Nature Protocols 2006 1:1. Nature Publishing Group; 2006 Jun. 1; 1(1):346-56. [0417] 50. Ingber D E. Fibronectin controls capillary endothelial cell growth by modulating cell shape. Proc Natl Acad Sci USA. 1990 May; 87(9):3579-83. [0418] 51. Kostadinova R, Boess F, Applegate D, Suter L, Weiser T, Singer T, et al. A long-term three dimensional liver co-culture system for improved prediction of clinically relevant drug-induced hepatotoxicity. Toxicology and Applied Pharmacology. 2013 Apr. 1; 268(1):1-16. [0419] 52. Hegge S, Kudryashev M, Smith A, Frischknecht F. Automated classification of Plasmodium sporozoite movement patterns reveals a shift towards productive motility during salivary gland infection. Biotechnology Journal. WILEY-VCH Verlag; 2009 Jun. 1; 4(6):903-13. [0420] 53. Yoshida N, Nussenzweig R S, Potocnjak P, Nussenzweig V, Aikawa M. Hybridoma produces protective antibodies directed against the sporozoite stage of malaria parasite. Science. American Association for the Advancement of Science; 1980 Jan. 4; 207(4426):71-3. [0421] 54. Tukey J W. Exploratory Data Analysis. 1st ed. Pearson; 1977. [0422] 55. Winn W C, Koneman E W. Koneman's Color Atlas and Textbook of Diagnostic Microbiology. 7 ed. Lippincott Williams & Wilkins; 2016. [0423] 56. Vanderberg J P. Development of Infectivity by the Plasmodium berghei Sporozoite. The Journal of Parasitology. 1975 February; 61(1):43. [0424] 57. Theander T G, Lusingu J. Efficacy and safety of RTS, S/AS01 malaria vaccine with or without a booster dose in infants and children in Africa. Lancet. 2015. [0425] 58. Vaccines TMCGO. A Research Agenda for Malaria Eradication: Vaccines. PLoS Med. Public Library of Science; 2011 Jan. 25; 8(1):e1000398. [0426] 59. Drugs TMCGO. A Research Agenda for Malaria Eradication: Drugs. PLoS Med. Public Library of Science; 2011 Jan. 25; 8(1):e1000402. [0427] 60. Plouffe D, Brinker A, McNamara C, Henson K, Kato N, Kuhen K, et al. In silicoactivity profiling reveals the mechanism of action of antimalarials discovered in a high-throughput screen. Proc Natl Acad Sci USA. National Acad Sciences; 2008 Jun. 25; 105(26):9059-64. [0428] 61. O'Neill P M, Amewu R K, Charman S A, Sabbani S, Gnidig N F, Straimer J, et al. A tetraoxane-based antimalarial drug candidate that overcomes PfK13-C580Y dependent artemisinin resistance. Nature Communications. Nature Publishing Group; 2017 May 24; 8:ncomms15159. [0429] 62. Rottmann M, McNamara C, Yeung B K S, Lee M C S, Bin Zou, Russell B, et al. Spiroindolones, a Potent Compound Class for the Treatment of Malaria. Science. American Association for the Advancement of Science; 2010 Sep. 3; 329(5996):1175-80. [0430] 63. Ruecker A, Mathias D K, Straschil U, Churcher T S, Dinglasan R R, Leroy D, et al. A male and female gametocyte functional viability assay to identify biologically relevant malaria transmission-blocking drugs. Antimicrobial Agents and Chemotherapy. American Society for Microbiology Journals; 2014 Sep. 29; 58(12):AAC.03666-14-7302. [0431] 64. Billman Z P, Seilie A M, Murphy S C. Purification of Plasmodium Sporozoites Enhances Parasite-Specific C D8+ T Cell Responses. Adams J H, editor. Infect Immun. American Society for Microbiology; 2016 Aug. 1; 84(8):2233-42. [0432] 65. Ferguson D J P, Balaban A E, Patzewitz E-M, Wall R J, Hopp C S, Poulin B, et al. The Repeat Region of the Circumsporozoite Protein is Critical for Sporozoite Formation and Maturation in Plasmodium. Silvie O, editor. PLoS ONE. 2014 Dec. 1; 9(12):e113923. [0433] 66. Coppi A, Tewari R, Bishop J R, Bennett B L, Lawrence R, Esko J D, et al. Heparan sulfate proteoglycans provide a signal to Plasmodium sporozoites to stop migrating and productively invade host cells. —PubMed—NCBI. Cell Host Microbe. 2007 November; 2(5):316-27. [0434] 67. Coppi A, Pinzon-Ortiz C, Hutter C, Sinnis P. The Plasmodium circumsporozoite protein is proteolytically processed during cell invasion. Rockefeller University Press; 2005 Jan. 3; 201(1):27-33. [0435] 68. Antonova-Koch Y, Meister S, Abraham M, Luth M R, Ottilie S, Lukens A K, et al. Open-source discovery of chemical leads for next-generation chemoprotective antimalarials. Science. American Association for the Advancement of Science; 2018 Dec. 7; 362(6419):eaat9446. [0436] 69. O'Brochta D A, Alford R, Harrell R, Aluvihare C, Eappen A G, Li T, et al. Is Saglin a mosquito salivary gland receptor for Plasmodium falciparum? Malar J. 2019 Jan. 3; 18(1):1330. [0437] 70. Ishino T, Murata E, Tokunaga N, Baba M, Tachibana M, Thongkukiatkul A, et al. Rhoptry neck protein 2 expressed in Plasmodium sporozoites plays a crucial role during invasion of mosquito salivary glands. Cell Microbiol. John Wiley & Sons, Ltd (10.1111); 2019 Jan. 1; 21(1):e12964. [0438] 71. Carlton J M, Angiuoli S V, Suh B B, Kooij T W, Pertea M, Silva J C, et al. Genome sequence and comparative analysis of the model rodent malaria parasite Plasmodium yoelii yoelii. Nature. 2002 Oct. 3; 419(6906):512-9. [0439] 72. Florens L, Washburn M P, Raine J D, Anthony R M, Grainger M, Haynes J D, et al. A proteomic view of the Plasmodium falciparum life cycle. Nature. 2002 Oct. 3; 419(6906):520-6. [0440] 73. Lasonder E, Janse C J, van Gemert G-J, Mair G R, Vermunt A M W, Douradinha B G, et al. Proteomic Profiling of Plasmodium Sporozoite Maturation Identifies New Proteins Essential for Parasite Development and Infectivity. Goldberg D E, editor. PLoS Pathog. Public Library of Science; 2008 Oct. 31; 4(10):e1000195. [0441] 74. V. Nene et al., The biology of Theileria parva and control of East Coast fever—Current status and future trends. Ticks Tick Borne Dis 7, 549-564 (2016). [0442] 75. D. E. Radley et al., East coast fever: 3. Chemoprophylactic immunization of cattle using oxytetracycline and a combination of theilerial strains. Veterinary Parasitology 1, 51-60 (1975). [0443] 76. G. Lynen et al., East Coast fever immunisation field trial in crossbred dairy cattle in Hanang and Handeni districts in northern Tanzania. Trop Anim Health Prod 44, 567-572 (2012). [0444] 77. O. Wiens et al., Cell cycle-dependent phosphorylation of Theileria annulata schizont surface proteins. PLoS One 9, e103821 (2014). [0445] 78. C. Daubenberger et al., Molecular characterisation of a cognate 70 kDa heat shock protein of the protozoan Theileria parva. Mol Biochem Parasitol 85, 265-269 (1997). [0446] 79. T. R. Schleicher et al., A mosquito salivary gland protein partially inhibits Plasmodium sporozoite cell traversal and 50 transmission. Nat Commun 9, 2908 (2018). [0447] 80. M. B. Vogt et al., Mosquito saliva alone has profound effects on the human immune system. PLoS Negl Trop Dis 12, eooo6439 (2018).