SINGLE-CHANNEL SEQUENCING METHOD BASED ON SELF-LUMINESCENCE

Abstract

The present invention provides a sequencing method based on a single fluorescent dye, in which a self-luminescence signal is used to distinguish the sequential incorporation of different nucleotides, thereby realizing the determination of the polynucleotide sequence.

Claims

1. A method for sequencing a nucleic acid molecule, which comprises the following steps: (1) providing a nucleic acid molecule to be sequenced that is linked to a support, or linking a nucleic acid molecule to be sequenced to a support; (2) adding a primer for initiating a nucleotide polymerization reaction, a polymerase for performing the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; wherein, the four compounds are respectively derivatives of nucleotides A, (T/U), C and G, and have the ability of base complementary pairing; and, the hydroxyl (—OH) at the 3′-position of ribose or deoxyribose of the four compounds is protected by a protecting group; and, the first compound is linked with a first molecular label, the second compound is linked with a second molecular label, the third compound is linked with a first molecular label and a second molecular label, or a part of the third compound is linked with a first molecular label and another part of the third compound is linked with a second molecular label, the fourth compound is not linked with any molecular label; (3) annealing the primer to the nucleic acid molecule to be sequenced, and forming a duplex linked to the support by using the primer as an initial growing nucleic acid chain together with the nucleic acid molecule to be sequenced; (4) using the polymerase to carry out the nucleotide polymerization reaction under a condition that allows the polymerase to carry out the nucleotide polymerization reaction, thereby incorporating one of the four compounds into the 3′-end of the growing nucleic acid chain; (5) allowing the duplex of the previous step to contact with two different luciferases and perform a ligation reaction, wherein the two luciferases can specifically be ligated with the first molecular label and the second molecular label, respectively; then, allowing the luciferase to undergo a fluorescence reaction in the presence of a substrate, and detecting an emitted fluorescence signal; and (6) removing the molecular label of each nucleotide.

2. The method according to claim 1, wherein in step (5), the duplex is contacted with the two different luciferases in a one-step reaction and undergoes the ligation reaction; or in step (5), the duplex is sequentially contacted with the two luciferases and undergoes the ligation reaction.

3. The method according to claim 1, which comprises the following steps: (1) providing a nucleic acid molecule to be sequenced that is linked to a support, or linking a nucleic acid molecule to be sequenced to a support; (2) adding a primer for initiating a nucleotide polymerization reaction, a polymerase for performing the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; wherein, the four compounds are respectively derivatives of nucleotides A, (T/U), C and G, and have the ability of base complementary pairing; and, the hydroxyl (—OH) at the 3′-position of ribose or deoxyribose of the four compounds is protected by a protecting group; and, the first compound is linked with a first molecular label, the second compound is linked with a second molecular label, the third compound is linked with a first molecular label and a second molecular label, or a part of the third compound is linked with a first molecular label and another part of the third compound is linked with a second molecular label, the fourth compound is not linked with any molecular label; (3) annealing the primer to the nucleic acid molecule to be sequenced, and forming a duplex linked to the support by using the primer as an initial growing nucleic acid chain together with the nucleic acid molecule to be sequenced; (4) using the polymerase to carry out the nucleotide polymerization reaction under a condition that allows the polymerase to carry out the nucleotide polymerization reaction, thereby incorporating one of the four compounds into the 3′-end of the growing nucleic acid chain; (5) removing the solution phase of the reaction system in the previous step, keeping the duplex linked to the support, and adding two different luciferases to carry out the ligation reaction, wherein the two luciferases can be specifically ligated with the first molecular label and the second molecular label, respectively; (6) removing unbound luciferase by using an elution buffer; (7) adding a substrate of the first luciferase and detecting fluorescence signal at the same time; (8) removing the solution of the previous step reaction; (9) adding a substrate of the second luciferase and detecting fluorescence signal at the same time; (10) removing the solution of the previous step reaction; and (11) removing the molecular label and 3′-protecting group of each nucleotide.

4. The method according to claim 1, which comprises the following steps: (1) providing a nucleic acid molecule to be sequenced that is linked to a support, or linking a nucleic acid molecule to be sequenced to a support; (2) adding a primer for initiating a nucleotide polymerization reaction, a polymerase for performing the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; wherein, the four compounds are respectively derivatives of nucleotides A, (T/U), C and G, and have the ability of base complementary pairing; and, the hydroxyl (—OH) at the 3′-position of ribose or deoxyribose of the four compounds is protected by a protecting group; and, the first compound is linked with a first molecular label, the second compound is linked with a second molecular label, the third compound is linked with a first molecular label and a second molecular label, or a part of the third compound is linked with a first molecular label and another part of the third compound is linked with a second molecular label, the fourth compound is not linked with any molecular label; (3) annealing the primer to the nucleic acid molecule to be sequenced, and forming a duplex linked to the support by using the primer as an initial growing nucleic acid chain together with the nucleic acid molecule to be sequenced; (4) using the polymerase to carry out the nucleotide polymerization reaction under a condition that allows the polymerase to carry out the nucleotide polymerization reaction, thereby incorporating one of the four compounds into the 3′-end of the growing nucleic acid chain; (5) removing the solution phase of the reaction system in the previous step, keeping the duplex linked to the support, and adding a first luciferase to perform a ligation reaction, wherein the first luciferase can specifically bind to the first molecular label; (6) removing unbound first luciferase by using an elution buffer; (7) adding a substrate of the first luciferase and detecting fluorescence signal at the same time; (8) removing the solution of the previous step reaction; (9) adding a second luciferase to perform a ligation reaction, wherein the second luciferase can specifically bind to the second molecular label; (10) removing unbound second luciferase by using an elution buffer; (11) adding a substrate of the second luciferase and detecting fluorescence signal at the same time; and (12) removing the solution of the previous step reaction.

5. The method according to claim 3, wherein the first luciferase and the second luciferase contain different luciferases.

6. The method according to claim 1, which comprises the following steps: (1) providing a nucleic acid molecule to be sequenced that is linked to a support, or linking a nucleic acid molecule to be sequenced to a support; (2) adding a primer for initiating a nucleotide polymerization reaction, a polymerase for performing the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; wherein, the four compounds are respectively derivatives of nucleotides A, (T/U), C and G, and have the ability of base complementary pairing; and, the hydroxyl (—OH) at the 3′-position of ribose or deoxyribose of the four compounds is protected by a protecting group; and, the first compound is linked with a first molecular label, the second compound is linked with a second molecular label, the third compound is linked with a first molecular label and a second molecular label, or a part of the third compound is linked with a first molecular label and another part of the third compound is linked with a second molecular label, the fourth compound is not linked with any molecular label; (3) annealing the primer to the nucleic acid molecule to be sequenced, and forming a duplex linked to the support by using the primer as an initial growing nucleic acid chain together with the nucleic acid molecule to be sequenced; (4) using the polymerase to carry out the nucleotide polymerization reaction under a condition that allows the polymerase to carry out the nucleotide polymerization reaction, thereby incorporating one of the four compounds into the 3′-end of the growing nucleic acid chain; (5) removing the solution phase of the reaction system in the previous step, keeping the duplex linked to the support, and adding a first luciferase to perform a ligation reaction, wherein the first luciferase can specifically bind to the first molecular label; (6) removing unbound first luciferase by using an elution buffer; (7) adding a substrate of the luciferase and detecting fluorescence signal at the same time; (8) removing the solution of the previous step reaction; (9) adding a reagent for denaturing the luciferase; (10) removing the solution of the previous step reaction; (11) adding a second luciferase to perform a ligation reaction, wherein the second luciferase can specifically bind to the second molecular label; (12) removing unbound second luciferase by using an elution buffer; and (13) adding a substrate of the luciferase and detecting fluorescence signal at the same time.

7. The method according to claim 6, wherein the first luciferase and the second luciferase may contain the same luciferase.

8. The method according to claim 1, wherein the first molecular label and the second molecular label are selected from the group consisting of biotin, digoxin, N3G or FITC, and the first luciferase and the second luciferase are respectively labeled with streptavidin, digoxin antibody, N3G antibody or FITC antibody.

9. A kit for sequencing a polynucleotide, which comprises: (a) four compounds, the four compounds are respectively derivatives of nucleotides A, (T/U), C and G, and have the ability of base complementary pairing; and, the hydroxyl (—OH) at the 3′-position of ribose or deoxyribose of the four compounds is protected by a protecting group; and, the first compound is linked with a first molecular label, the second compound is linked with a second molecular label, the third compound is linked with a first molecular label and a second molecular label, or a part of the third compound is linked with a first molecular label and another part of the third compound is linked with a second molecular label, the fourth compound is not linked with any molecular label; and (b) two different luciferases, the two luciferases can specifically bind to the first molecular label and the second molecular label, respectively.

10. The kit according to claim 9, wherein the two different luciferases can contain the same luciferase or different luciferases.

11. The kit according to claim 9, wherein the first molecular label and the second molecular label are selected from the group consisting of biotin, digoxin, N3G or FITC, and the first luciferase and the second luciferase are respectively labeled with streptavidin, digoxin antibody, N3G antibody or FITC antibody.

12. The kit according to claim 9, further comprising: a reagent and/or device for extracting a nucleic acid molecule from a sample; a reagent for pretreating the nucleic acid molecule; a support for linking the nucleic acid molecule to be sequenced; a reagent for linking the nucleic acid molecule to be sequenced to the support; a primer for initiating a nucleotide polymerization reaction; a polymerase for performing the nucleotide polymerization reaction; one or more buffer solutions; one or more washing solutions; or any combination thereof

13. The method according to claim 1, further comprises the following step: (7) repeating steps (3) to (6) or (3) to (5) one or more times to obtain sequence information of the nucleic acid molecule.

14. The method according to claim 3, further comprises the following step: (12) removing the solution of the previous step reaction.

15. The method according to claim 14, further comprises the following step: (13) repeating steps (3) to (12) or (3) to (9) one or more times to obtain sequence information of the nucleic acid molecule.

16. The method according to claim 4, further comprises the following step: (13) removing the molecular label of each nucleotide.

17. The method according to claim 16, further comprises the following step: (14) repeating steps (3) to (13) or (3) to (11) one or more times to obtain sequence information of the nucleic acid molecule.

18. The method according to claim 6, further comprises the following step: (14) removing the solution of the previous step reaction.

19. The method according to claim 18, further comprises the following step: (15) removing the molecular label and 3′-protecting group of each nucleotide.

20. The method according to claim 19, further comprises the following step: (16) repeating steps (3) to (15) or (3) to (13) one or more times to obtain sequence information of the nucleic acid molecule.

21. The kit according to claim 12, wherein the reagent is a reagent for covalently or non-covalently linking the nucleic acid molecule to be sequenced to the support.

22. A compound for use in the method according to claim 1, which is shown in Formula I, Formula II, Formula III, or Formula IV. ##STR00002##

Description

BRIEF DESCRIPTION OF THE DRAWINGS:

[0159] FIG. 1: the procedure for the conjugation of antibody and Nluc, wherein the enzyme in the figure referred to Nluc, and the antibody in the figure referred to digoxin antibody.

EXAMPLES

Example 1

[0160] 1. Construction of Sequencing Library (1) The following DNA sequence was designed:

TABLE-US-00002 (SEQ ID NO: 1) GATATCTGCAGGCATAGAATGAATATTATTGAATCAATAATTA ATAATGGGCTGGATACATGGAATGATTATAGA TATATTAAGGAATAATGTTAATTAATGCCTAAATTAATTAATC TAAGGGGGTTAATACTTCAGCCTGTGATATC.
For the convenience of library construction, oligo sequences (bold font) were added at the two ends of the sequence, and the linker sequence (shaded part) of BGISEQ-500 was inserted in the middle part, the italicized bold part showed the first 10 bp bases of the sequence to be sequenced. The above sequence was synthesized by GenScript Biotechnology Company, and for unlimited use of the sequence, the synthesized sequence was inserted into the pUC57 vector and transformed into E. coli cells.

[0161] (2) A suitable amount of E. coli containing a known library was cultured, and plasmids were extracted; the following pair of primers was designed: GATATCTGCAGGCAT (SEQ ID NO: 2, Primer 1), GATATCACAGGCTGA (SEQ ID NO: 3, Primer 2), the known sequence was amplified according to the following system (Table 1) and process (Table 2), and the PCR product was purified with magnetic beads. The purified PCR product was added with split oligo (ATGCCTGCAGATATCGATATCACAGGCTGA, SEQ ID NO: 4) and subjected to circularization and library construction according to instruction and process of the BGISEQ-500 SE50 circularization library construction kit (MGI) for later use;

TABLE-US-00003 TABLE 1 (the enzymes were from BGI's own production) 1 x 5× high-fidelity enzyme reaction solution 20 μl dNTPs mixure (each 10 mM) 5 μl High-fidelity enzyme (1U/μl) 1 μl Primer 1 (20 μM) 6 μl Primer 2 (20 μM) 6 μl Plasmid DNA template (20 ng/μl) 1 μl Molecular water 61 μl Total volume 100 μl

TABLE-US-00004 TABLE 2 98° C. 3 min; 98° C. 20 s 33 cycles 60° C. 15 s 72° C. 30 s {close oversize bracket} 72° C. 5 min  4° C. ∞

[0162] 2. Amplification of Library Sequences

[0163] A 96-well plate coated with streptavidin was purchased from Thermo Fisher Company, and 100 W of 1 μM 5′-end biotin-modified primer GCCATGTCGTTCTGTGAGCCAAGG (SEQ ID NO: 5) was incubated in one of the wells at room temperature for 30 minutes, the reaction liquid was discarded, 6 ng of the library constructed in Section 1 above and 20 μl of the DNB preparation buffer I in the BGISEQ-500 kit (made by MGI) were added, primer hybridization with the above biotin-modified primer was performed at 60° C. for 5 minutes, 40 μl of the DNB polymerase I in the BGISEQ-500 sequencing kit (made by MGI) and 4 μl of DNB polymerase II were added, reaction was performed at 30° C. for 60 minutes, after being heated to 65° C., the reaction was terminated, and the reaction solution was carefully discarded. 100 μl of 5 μM sequencing primer GCTCACAGAACGACATGGCTACGATCCGACTT (SEQ ID NO: 6) was added, hybridization was performed at room temperature for 30 minutes, and the reaction solution was carefully discarded;

[0164] 3. Sequencing

[0165] (1) Four dNTPs as shown below were synthesized by Acme Bioscience as outsourcing company:

##STR00001##

[0166] (2) Preparation of Two Luciferases:

[0167] a. SA-Gluc (purchased from adivity company)

[0168] b. Antibody (purchased from Abcam) conjugated with Nluc (purchased from avidity) to prepare Ab-Nluc

[0169] protein coupling kit was purchased from Thermo, and the conjugation of antibody and Nluc was performed according to the instructions and the procedure as shown in FIG. 1.

[0170] (3) Preparation of Reagents:

[0171] Preparation of other reagents needed in the sequencing reaction Polymerization reaction solution: 50 mM Tris-Hcl, 50 mM NaCl, 10 mM (NH4)2SO4, 0.02 mg/ml polymerase BG9 (BGI), 3 mM MgSO.sub.4, 1 mM EDTA, 1 μM each of the above four dNTPs

[0172] Elution buffer: 5×SSC, 0.05% of Tween-20;

[0173] Enzyme binding reaction solution: the above two enzymes were diluted into TBST buffer, and the final concentration of each of the two enzymes was 2 μg/ml;

[0174] Substrate 1 reaction solution: 50 mM tris-Hcl 0.5 mM Nacl buffer was prepared, and 50X Coelenterazine (nanolight) was diluted to 1×;

[0175] Substrate 2 reaction solution: 50 mM tris-Hcl 0.5 mM Nacl buffer was prepared, and 50X NLuc FLASH Substrate (nanolight) was diluted to 1×;

[0176] Resection buffer: 20 mM THPP, 0.5 M NaCl, 50 mM Tris-HCl, pH 9.0, 0.05% tween-20;

[0177] (4) Sequencing Reaction:

[0178] Sequencing Process:

[0179] a. Polymerization: 100 μl of polymerase reaction solution was added to each well of the amplified library, the temperature of a microplate reader was elevated to 55° C., and reaction was performed for 3 minutes so that the four dNTPs were polymerized onto the amplified library. After the reaction solution was carefully discarded, 100 μl of elution reaction solution was added, gently pipetted for several times to remove the elution reaction solution;

[0180] b. Ligation of luciferase: 100 μl of enzyme binding reaction solution was added, incubated at 35° C. for 30 minutes, so that SA-gluc ligated to the biotin-labeled dCTP and dATP derivatives, and Ab-Nluc ligated to the digoxin-labeled dCTP and dTTP derivatives, the reaction solution was discarded, the elution solution was added and gently pipetted for several times to remove the elution solution;

[0181] c. Enzyme 1 signal detection: appropriate microplate reader parameters were set, the substrate 1 reaction solution was added, Enzyme 1 signal detection was performed, and the highest signal value was recorded;

[0182] d. Enzyme 2 signal detection: the substrate reaction solution 1 was removed, appropriate microplate reader parameters were set, the substrate 2 reaction solution was added, Enzyme 2 signal detection was performed, and the highest signal value was recorded;

[0183] e. Excision; the substrate 2 reaction solution was removed, 200 μl of elution buffer was added, after being gently pipetted for several times, the elution buffer was discarded, 100 μl of excision reaction solution was added, reaction was performed at 55° C. for 3 minutes, the excision reaction solution was discarded; 200 μl of elution buffer was added for washing, and the washing was repeated for three times;

[0184] f. Steps a-e were repeated for the next cycle of sequencing; and a total of 10 bp sequencing was performed.

[0185] (5) Sequencing Results

[0186] a. Signal values of the two luminescences were as follows:

TABLE-US-00005 Substrate 1 Substrate 2 signal (W) signal (W) cycle 1 0.1 210 cycle 2 188 0.12 cycle 3 173 169 cycle 4 206 0.11 cycle 5 198 0.13 cycle 6 176 171 cycle 7 0.13 186 cycle 8 203 0.15 cycle 9 166 159 cycle 10 0.12 0.16

[0187] b. Analysis of sequencing results:

[0188] According to the luminescence signal values, cycle1 and cycle7 only had signals when substrate 2 is introduced, so that it could be concluded that biotin-dTTP was polymerized in these two cycles, and the first and seventh bases of the library to be tested were T base;

[0189] For cycle2, cycle4, cycle5 and cycle8, signals were observed only when substrate 1 was introduced, so that it could be concluded that digoxin-dATP was polymerized in these four cycles, and the second, fourth, fifth and eighth bases of the library to be tested were A base;

[0190] For cycle3, cycle6 and cycle9, signals were observed when substrate 1 and substrate 2 were introduced, so that it could be concluded that biotin-digoxin-dCTP was polymerized in these three cycles, and the third, sixth and ninth bases of the library to be tested were C base;

[0191] For cycle10, luminescence was not observed when the two substrates were introduced, so that it could be concluded that coldG was polymerized in this cycle, and the tenth base of the library was G base.

[0192] In summary, the first 10 bases of the sequence to be tested were: TACAACTACG (SEQ ID NO: 7), which matched 100% with the first 10bp base sequence TACAACTACG (SEQ ID NO: 7) of the library to be tested.

Example 2

[0193] The construction of sequencing library and the amplification of library sequence were the same as shown in Example 1.

[0194] Sequencing:

[0195] (1) Four dNTPs: as Shown in Example 1

[0196] (2) Preparation of Luciferases and Related Proteins

[0197] a. SA-Gluc (purchased from adivity company)

[0198] b. Antibody (purchased from Abcam), and according to the instructions of thermo fisher NHS-s-s-biotin, the antibody was labeled with biotin label to obtain antibody-s-s-biotin.

[0199] (3) Preparation of Reagents Preparation of other reagents needed in the sequencing reaction Polymerization reaction solution: 50 mM Tris-Hcl, 50 mM NaCl, 10 mM (NH.sub.4).sub.2SO.sub.4, 0.02 mg/ml polymerase BG9 (BGI), 3 mM MgSO.sub.4, 1 mM EDTA, 1 μM each of the above four dNTPs

[0200] Elution buffer: 5×SSC, 0.05% of Tween-20;

[0201] Enzyme binding reaction solution: the above two proteins SA-Gluc and antibody-s-s-biotin were diluted into TBST buffer, respectively, and the final concentration of each of the two proteins was 2 μg/ml;

[0202] Substrate reaction solution: 50 mM Tris-HCl 0.5 mM NaCl buffer was prepared, and 50× Coelenterazine (nanolight) was diluted to 1×;

[0203] Enzyme inactivation buffer: 5 mM DTT, 50 mM Tris-HCl, pH 9.0;

[0204] Excision buffer: 20 mM THPP, 50 mM Tris-HCl, pH 9.0, 0.5M NaCl, 0.05% Tween-20;

[0205] (4) Sequencing Reaction

[0206] a. Polymerization: 100 μl of polymerase reaction solution was added to each well of the amplified library, the temperature of a microplate reader was elevated to 55° C., reaction was performed for 3 minutes to polymerize the four dNTPs onto the amplified library, the reaction solution was carefully removed, 100 μl of the elution reaction solution was added and gently pipetted for several times, and the elution reaction solution was removed;

[0207] b. Ligation of luciferase: 100 μl of luciferase SA-Gluc binding reaction solution was added, incubated for 30 min at 35° C., so that SA-gluc was ligated to the biotin-labeled dCTP and dATP derivatives, the reaction solution was removed, the elution solution was added and gently pipetted for several times, and the elution solution was removed;

[0208] c. First signal detection: appropriate microplate reader parameters were set, the substrate reaction solution was added, signal detection was performed, and the highest signal value was recorded;

[0209] d. Inactivation of enzyme: the substrate reaction solution was removed, the enzyme inactivation buffer was added and incubated at 35° C. for 10 minutes, the reaction solution was removed, and then the elution buffer was added for elution;

[0210] e. Second ligation of luciferase: antibody-S-S-biotin reaction solution was added and incubated at 35° C. for 30 minutes, so that antibody-s-s-biotin was ligated to digoxin-labeled dCTP and dTTP derivatives, the reaction solution was removed, the elution buffer was added and pipetted gently for several times, the elution solution was removed, 100 μl of SA-Gluc binding reaction solution was added and incubated at 35° C. for 30 minutes, after the reaction solution was removed, the elution buffer was added, after the elution was completed, the elution buffer was removed;

[0211] f. Second signal detection: appropriate microplate reader parameters were set, the substrate reaction solution was added, signal detection was performed, and the highest signal value was recorded;

[0212] g. Excision: the substrate 2 reaction solution was removed, 200 μl of the elution buffer was added and gently pipetted for several times, the elution buffer was removed, 100 μl of excision reaction solution was added, reaction was performed at 55° C. for 3 minutes, the excision reaction solution was removed; 200 μl of the elution buffer was added for washing, the washing was repeated for three times;

[0213] h. Steps a to g were repeated for the next cycle of sequencing; and a total of 10 bp sequencing was performed.

[0214] (5) Sequencing Results

[0215] a. Results of 10 bp signal detection were as follows:

TABLE-US-00006 First Second detection (W) detection (W) cycle 1 0.6 223 cycle 2 312 0.7 cycle 3 278 327 cycle 4 254 0.3 cycle 5 239 0.4 cycle 6 243 275 cycle 7 0.27 228 cycle 8 267 0.5 cycle 9 263 279 cycle 10 0.7 0.6

[0216] b. Analysis of sequencing results:

[0217] For cycle1 and cycle7, signal values were obtained only in the second detection, so that it could be concluded that biotin-dTTP was polymerized in these two cycles, and thus the first and seventh bases of the library to be tested were T;

[0218] For cycle2, cycle4, cycle5 and cycle8, signals were observed only in the first detection, so that it could be concluded that digoxin-dATP was polymerized in these four cycles, and thus the second, fourth, fifth and eighth bases of the library to be tested were A base;

[0219] For cycle3, cycle6 and cycle9, signals were generated in both of the first detection and the second detection, so that it could be concluded that biotin-digoxin-dCTP was polymerized in these two cycles, and thus the third, sixth and ninth of the library to be tested were C base;

[0220] For cycle10, light was not emitted in the two signal detections, so that it could be concluded that coldG wsa polymerized in this cycle, and thus the tenth base of this library was G base.

[0221] In summary, the first 10 bases of the sequence to be tested were: TACAACTACG (SEQ ID NO: 7), which matched 100% with the first 10 bp base sequence TACAACTACG (SEQ ID NO: 7) of the library to be tested.