Compounds and compositions for treating conditions associated with NLRP activity

11370763 · 2022-06-28

Assignee

Inventors

Cpc classification

International classification

Abstract

In one aspect, compounds of Formula AA, or a pharmaceutically acceptable salt thereof, are featured. The variables shown in Formula AA are as defined in the claims. The compounds of formula AA are NLRP3 activity modulators and, as such, can be used in the treatment of metabolic disorders (e.g. Type 2 diabetes, atherosclerosis, obesity or gout), a disease of the central nervous system (e.g. Alzheimer's disease, multiple sclerosis, Amyotrophic Lateral Sclerosis or Parkinson's disease), lung disease (e.g. asthma, COPD or pulmonary idiopathic fibrosis), liver disease (e.g. NASH syndrome, viral hepatitis or cirrhosis), pancreatic disease (e.g. acute pancreatitis or chronic pancreatitis), kidney disease (e.g. acute kidney injury or chronic kidney injury), intestinal disease (e.g. Crohn's disease or Ulcerative Colitis), skin disease (e.g. psoriasis), musculoskeletal disease (e.g. scleroderma), a vessel disorder (e.g. giant cell arteritis), a disorder of the bones (e.g. osteoarthritis, osteoporosis or osteopetrosis disorders), eye disease (e.g. glaucoma or macular degeneration), a disease caused by viral infection (e.g. HIV or AIDS), an autoimmune disease (e.g. Rheumatoid Arthritis, Systemic Lupus Erythematosus or Autoimmune Thyroiditis), cancer or aging. ##STR00001##

Claims

1. A compound of Formula AA ##STR00909## wherein m=0, 1, or 2; n=0, 1, or 2; o=1 or 2; p=0, 1, 2, or 3; wherein A is: thiophenyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2; phenyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2; thiazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2; oxazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2; pyridyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2; pyrazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2; B is phenyl, pyridyl, or pyrimidinyl; wherein at least one R.sup.6 is ortho to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA; R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, S(O)C.sub.1-C.sub.6 alkyl, 5- to 10-membered heteroaryl, and 3- to 7-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy and oxo; R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2 COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo, or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo; each of R.sup.4 and R.sup.5 is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl; R.sup.10 is C.sub.1-C.sub.6 alkyl; each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to; R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl; each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl; R.sup.3 is hydrogen, or a pharmaceutically acceptable salt thereof.

2. The compound of claim 1, wherein A is any one of: thiophenyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2; oxazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2R.sup.2; thiazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2R.sup.2; or phenyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2R.sup.2.

3. The compound of claim 1, wherein m=1 and n=0; optionally wherein the substituted ring A is any one of: ##STR00910## ##STR00911##

4. The compound of claim 1, wherein m=1 and n=1; optionally wherein the substituted ring A is any one of: ##STR00912##

5. The compound of claim 1, wherein m=2 and n=1; optionally wherein the substituted ring A is any one of: ##STR00913##

6. The compound of claim 1, wherein R.sup.1 is selected from the group consisting of 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; S(O.sub.2)CH.sub.3; and S(O.sub.2)NR.sup.11R.sup.12.

7. The compound of claim 1, wherein R.sup.2 is selected from the group consisting of fluoro; chloro; cyano; methyl; methoxy; ethoxy; isopropyl; 1-hydroxy-2-methylpropan-2-yl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; COCH.sub.3; COPh; 2-methoxy-2-propyl; (dimethylamino)methyl; S(O.sub.2)CH.sub.3; and S(O.sub.2)NR.sup.11R.sup.12.

8. The compound of claim 1, wherein B is phenyl substituted with 1 or 2 R.sup.6 and optionally substituted with 1, 2, or 3 R.sup.7; optionally wherein the substituted ring B is any one of ##STR00914##

9. The compound of claim 1, wherein B is pyridyl; o=1 or 2; and p=0, 1, or 2; optionally wherein the substituted ring B is ##STR00915##

10. The compound of claim 1, wherein each of R.sup.4 and R.sup.5 is hydrogen.

11. The compound, selected from the group consisting of the compounds below: TABLE-US-00031 Compound Structure 101 embedded image 101a embedded image 101b embedded image 102 embedded image 103 embedded image 104 embedded image 104a embedded image 104b embedded image 105 embedded image 106 embedded image 106a embedded image 106b embedded image 107 embedded image 107a embedded image 107b embedded image 108 embedded image 109 embedded image 110 embedded image 110a embedded image 110b embedded image 111 embedded image 112 embedded image 112a embedded image 112b embedded image 113 embedded image 114 embedded image 114a embedded image 114b embedded image 115 embedded image 116 embedded image 116a embedded image 116b embedded image 117 embedded image 117a embedded image 117b embedded image 118 embedded image 119 embedded image 120 embedded image 121 embedded image 122 embedded image 123 embedded image 123a embedded image 123b embedded image 124 embedded image 125 embedded image 126 embedded image 126a embedded image 126b embedded image 127 embedded image 128 embedded image 129 embedded image 129a embedded image 129b embedded image 130 embedded image 130a embedded image 130b embedded image 131 embedded image 131a embedded image 131b embedded image 132 embedded image 132a embedded image 132b embedded image 133 embedded image 133a embedded image 133b embedded image 134 embedded image 135 embedded image 136 embedded image 137 embedded image 138 embedded image 138a embedded image 138b embedded image 139 embedded image 139a embedded image 139b embedded image 140 embedded image 140a embedded image 140b embedded image 141 embedded image 141a embedded image 141b embedded image 142 embedded image 143 embedded image 144 embedded image 144a embedded image 144b embedded image 145 embedded image 145a embedded image 145b embedded image 146 embedded image 147 embedded image 147a embedded image 147b embedded image 148 embedded image 148a embedded image 148b embedded image 149a embedded image 149b embedded image 150 embedded image 150a embedded image 150b embedded image 151 embedded image 152 embedded image 152a embedded image 152b embedded image 153 embedded image 154 embedded image 155 embedded image 158 embedded image 159 embedded image 160 embedded image 161 embedded image 162 embedded image 163 embedded image 164 embedded image 165 embedded image 168 embedded image 169 embedded image 170 embedded image 171 embedded image 172 embedded image 173 embedded image 176 embedded image 177 embedded image 178 embedded image 180 embedded image 181 embedded image 182 embedded image 183 embedded image 184 embedded image 185 embedded image 186 embedded image 189 embedded image 190 embedded image 191 embedded image 192 embedded image 194 embedded image 195 embedded image 196 embedded image 197 embedded image 197a embedded image 197b embedded image 198 embedded image 198a embedded image 198b embedded image TABLE-US-00032 Compound Structure 104a embedded image 104b embedded image 106a embedded image 106b embedded image 107a embedded image 107b embedded image 110a embedded image 110b embedded image 126a embedded image 126b embedded image 130a embedded image 130b embedded image 146 embedded image 147 embedded image 148 embedded image 149a embedded image 149b embedded image 150 embedded image 151 embedded image 152 embedded image 152a embedded image 152b embedded image 110a′ embedded image 110b′ embedded image 201 embedded image 201b embedded image 201a embedded image 202 embedded image 202a embedded image 203 embedded image 203b embedded image 204 embedded image 204b embedded image 204a embedded image 205 embedded image 206 embedded image 207 embedded image 208 embedded image 209 embedded image 210 embedded image 210b embedded image 211 embedded image 213 embedded image 213a embedded image 213b embedded image 215 embedded image 216 embedded image 216a embedded image 216b embedded image 217 embedded image 217a embedded image 218 embedded image 218a embedded image 219 embedded image 220 embedded image 220a embedded image 221 embedded image 221a embedded image 221b embedded image 222 embedded image 224 embedded image 225 embedded image 225a embedded image 226 embedded image 226a embedded image 226b embedded image 227 embedded image 227a embedded image 227b embedded image 228 embedded image 228a embedded image 228b embedded image 229 embedded image 229a embedded image 229b embedded image 230 embedded image 231 embedded image 232 embedded image 233 embedded image 234 embedded image 234a embedded image 234b embedded image 236 embedded image 236a embedded image 236b embedded image 237 embedded image 238 embedded image 238a embedded image 238b embedded image 239 embedded image 239a embedded image 239b embedded image 241 embedded image 242 embedded image 242a embedded image 242b embedded image 243 embedded image 243a embedded image 243b embedded image 244ba embedded image 245 embedded image 247 embedded image 248 embedded image 249 embedded image 249a embedded image 249b embedded image 250 embedded image 251 embedded image 251a embedded image 251b embedded image 252 embedded image 253 embedded image 254 embedded image 255 embedded image 256 embedded image 256a embedded image 256b embedded image 257 embedded image 258 embedded image 258a embedded image 258b embedded image 261a embedded image 261b embedded image 262b embedded image 263 embedded image 263a embedded image 263b embedded image 264 embedded image 264a embedded image and a pharmaceutically acceptable salt thereof.

12. The compound of claim 1, wherein the sulfur in the moiety S(═O)(NHR.sup.3)═N— has (S) stereochemistry, or (R) stereochemistry.

13. A pharmaceutical composition comprising a compound or salt as claimed in claim 1 and one or more pharmaceutically acceptable excipients.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 depicts ball-and-stick representations of two crystallographically independent molecules of compound 132b in the asymmetrical unit.

DETAILED DESCRIPTION

(2) In some embodiments, provided herein is a compound of Formula AA

(3) ##STR00013##
wherein
m=0, 1, or 2
n=0, 1, or 2
o=1 or 2
p=0, 1, 2, or 3
wherein
A is a 5-10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
B is a 5-10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
wherein
at least one R.sup.6 is ortho to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA; R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, C.sub.3-C.sub.10 cycloalkyl and 3- to 10-membered heterocycloalkyl, and a C.sub.2-C.sub.6 alkenyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen and optionally substituted with one or more halo, OH, oxo, or C.sub.1-C.sub.6 alkyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 4- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, NR.sup.20, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.10 is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or
R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.3 is selected from hydrogen, cyano, hydroxy, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, and

(4) ##STR00014##
wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted by oxo;
R.sup.14 is hydrogen, C.sub.1-C.sub.6 alkyl, 5-10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1, 2, or 3 R.sup.6
or a pharmaceutically acceptable salt thereof.

(5) In some embodiments, provided herein is a compound of Formula AA

(6) ##STR00015##
wherein
m=0, 1, or 2
n=0, 1, or 2
o=1 or 2
p=0, 1, 2, or 3
wherein
A is a 5-10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
B is a 5-10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
wherein
at least one R.sup.6 is ortho to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA;
R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, C.sub.3-C.sub.10 cycloalkyl and 3- to 10-membered heterocycloalkyl, and a C.sub.2-C.sub.6 alkenyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen and optionally substituted with one or more halo, OH, oxo, or C.sub.1-C.sub.6 alkyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.10, is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.3 is selected from hydrogen, cyano, hydroxy, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, and

(7) ##STR00016##
wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted by oxo;
R.sup.14 is hydrogen, C.sub.1-C.sub.6 alkyl, 5-10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1, 2, or 3 R.sup.6
or a pharmaceutically acceptable salt thereof.

(8) In some embodiments, provided herein is a compound of Formula AA

(9) ##STR00017##
wherein
m=0, 1, or 2
n=0, 1, or 2
o=1 or 2
p=0, 1, 2, or 3
wherein
A is a 5-10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
B is a 5-10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
wherein
at least one R.sup.6 is ortho to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA;
R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, C.sub.3-C.sub.10 cycloalkyl and 3- to 10-membered heterocycloalkyl, and a C.sub.2-C.sub.6 alkenyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen and optionally substituted with one or more halo, OH, oxo, or C.sub.1-C.sub.6 alkyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.10, is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.3 is selected from hydrogen, cyano, hydroxy, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, and

(10) ##STR00018##
wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted by oxo;

(11) R.sup.14 is hydrogen, C.sub.1-C.sub.6 alkyl, 5-10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1, 2, or 3 R.sup.6

(12) or a pharmaceutically acceptable salt thereof.

(13) In some embodiments, provided herein is a compound of Formula AA

(14) ##STR00019##
wherein
m=0, 1 or 2
n=0, 1 or 2
o=1 or 2
p=0, 1, 2 or 3
wherein
A is a 5-10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
B is a 5-10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
wherein
at least one R.sup.6 is ortho to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA;
R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.10 cycloalkyl and 3- to 10-membered heterocycloalkyl, and a C.sub.2-C.sub.6 alkenyl,
wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.10, is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or
R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl; and
R.sup.3 is selected from hydrogen, cyano, hydroxy, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, and

(15) ##STR00020##
wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted by oxo;
R.sup.14 is hydrogen, C.sub.1-C.sub.6 alkyl, 5-10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1 or 2 R.sup.6
or a pharmaceutically acceptable salt thereof.

(16) In some embodiments, provided herein is a compound of Formula AA

(17) ##STR00021##
wherein
m=0, 1, or 2;
n=0, 1, or 2;
o=1 or 2;
p=0, 1, 2, or 3;
wherein
A is a 5-10-membered heteroaryl or a C.sub.6-C.sub.10 aryl;
B is a 5-10-membered heteroaryl or a C.sub.6-C.sub.10 aryl;
wherein
at least one R.sup.6 is ortho to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA;
R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, C.sub.3-C.sub.10 cycloalkyl, 3- to 10-membered heterocycloalkyl, and C.sub.2-C.sub.6 alkenyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) of the R.sup.1 or R.sup.2 C.sub.1-C.sub.6 alkyl, the R.sup.1 or R.sup.2 C.sub.1-C.sub.6 haloalkyl, the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl, or the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, 3- to 7-membered heterocycloalkyl, and C.sub.2-C.sub.6 alkenyl,
wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxy, halo, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.10 is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13).sub.NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or
R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.3 is selected from hydrogen, cyano, hydroxy, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, and

(18) ##STR00022##
wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted by oxo;
and
R.sup.14 is hydrogen, C.sub.1-C.sub.6 alkyl, 5-10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1, 2, or 3 R.sup.6;
or a pharmaceutically acceptable salt thereof.

(19) In some embodiments, provided herein is a compound of Formula AA

(20) ##STR00023##
wherein
m=0, 1, or 2;
n=0, 1, or 2;
o=1 or 2;
p=0, 1, 2, or 3;
wherein
A is a 5-10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
B is a 5-10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
wherein
at least one R.sup.6 is ortho to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA;
R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) of the R.sup.1 or R.sup.2 C.sub.1-C.sub.6 alkyl, the R.sup.1 or R.sup.2 C.sub.1-C.sub.6 haloalkyl, the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl, or the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.10 cycloalkyl and 3- to 10-membered heterocycloalkyl, and C.sub.2-C.sub.6 alkenyl,
wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.10, is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or
R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
and
R.sup.3 is selected from hydrogen, cyano, hydroxy, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, and

(21) ##STR00024##
wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted by oxo;
R.sup.14 is hydrogen, C.sub.1-C.sub.6 alkyl, 5-10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1 or 2 R.sup.6;
or a pharmaceutically acceptable salt thereof.

(22) Provided herein is a compound of Formula AA

(23) ##STR00025##
wherein
m=0, 1, or 2;
n=0, 1, or 2;
o=1 or 2;
p=0, 1, 2, or 3;
wherein
A is a 5-10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
B is a 5-10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
wherein
at least one R.sup.6 is ortho to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA;
R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) of the R.sup.1 or R.sup.2 C.sub.1-C.sub.6 alkyl, the R.sup.1 or R.sup.2 C.sub.1-C.sub.6 haloalkyl, the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl, or the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.10 cycloalkyl and 3- to 10-membered heterocycloalkyl, and C.sub.2-C.sub.6 alkenyl,
wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.10, is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or
R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
and
R.sup.3 is selected from hydrogen, cyano, hydroxy, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, and

(24) ##STR00026##
wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted by oxo;
R.sup.14 is hydrogen, C.sub.1-C.sub.6 alkyl, 5-10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1 or 2 R.sup.6;
or a pharmaceutically acceptable salt thereof.

(25) In some embodiments, provided herein is a compound of Formula AA

(26) ##STR00027##
wherein
m=0, 1, or 2;
n=0, 1, or 2;
o=1 or 2;
p=0, 1, 2, or 3;
wherein
A is a 5-10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
B is a 5-10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl;
wherein
at least one R.sup.6 is ortho to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA;
R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, NHCOOCC.sub.1-C.sub.6 alkyl, NH—(C═NR.sup.13)NR.sup.11R.sup.12, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, C.sub.3-C.sub.10 cycloalkyl and 3- to 10-membered heterocycloalkyl, and a C.sub.2-C.sub.6 alkenyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl;
wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo;
wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen;
wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl; or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9;
each of R.sup.4 and R.sup.5 is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.10, is C.sub.1-C.sub.6 alkyl;
each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or
R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to;
R.sup.13 is C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, or 5- to 10-membered heteroaryl;
each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl;
R.sup.3 is selected from hydrogen, cyano, hydroxy, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, and

(27) ##STR00028##
wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted by oxo;
R.sup.14 is hydrogen, C.sub.1-C.sub.6 alkyl, 5-10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1, 2, or 3 R.sup.6
or a pharmaceutically acceptable salt thereof.

(28) In some embodiments the variables shown in the formulae herein are as follows:

(29) The Variables m and n

(30) In some embodiments m=0, 1, or 2.

(31) In some embodiments m=0 or 1.

(32) In some embodiments m=1 or 2.

(33) In some embodiments m=0 or 2.

(34) In some embodiments m=0.

(35) In some embodiments m=1.

(36) In some embodiments m=2.

(37) In some embodiments n=0, 1, or 2.

(38) In some embodiments n=0 or 1.

(39) In some embodiments n=1 or 2.

(40) In some embodiments n=0 or 2.

(41) In some embodiments n=0.

(42) In some embodiments n=1.

(43) In some embodiments n=2.

(44) In some embodiments, m=0 and n=0.

(45) In some embodiments, m=1 and n=0.

(46) In some embodiments, m=1 and n=1.

(47) The Ring A and Substitutions on the Ring A

(48) In some embodiments, A is a 5-10-membered (e.g., 5-6-membered) monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, such as phenyl.

(49) In some embodiments, A is a 5-10-membered (e.g., 5-6-membered) monocyclic or bicyclic heteroaryl.

(50) In some embodiments, A is a 5-membered heteroaryl containing a sulfur and optionally one or more nitrogens.

(51) In some embodiments, A is a C.sub.6-C.sub.10 (e.g., C.sub.6) monocyclic or bicyclic aryl.

(52) In some embodiments, A is phenyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

(53) In some embodiments, A is furanyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

(54) In some embodiments, A is thiophenyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

(55) In some embodiments, A is oxazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

(56) In some embodiments, A is thiazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

(57) In some embodiments, A is pyrazolyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

(58) In some embodiments, A is pyridyl optionally substituted with 1 or 2 R.sup.1 and optionally substituted with 1 or 2 R.sup.2.

(59) In some embodiments, A is phenyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.

(60) In some embodiments, A is furanyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.

(61) In some embodiments, A is thiophenyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.

(62) In some embodiments, A is oxazolyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.

(63) In some embodiments, A is thiazolyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.

(64) In some embodiments, A is pyrazolyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.

(65) In some embodiments, A is pyridyl substituted with 1 R.sup.1 and optionally substituted with 1 R.sup.2.

(66) In some embodiments, A is phenyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.

(67) In some embodiments, A is furanyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.

(68) In some embodiments, A is thiophenyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.

(69) In some embodiments, A is oxazolyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.

(70) In some embodiments, A is thiazolyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.

(71) In some embodiments, A is pyrazolyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.

(72) In some embodiments, A is pyridyl substituted with 1 R.sup.1 and substituted with 1 R.sup.2.

(73) In some embodiments, A is phenyl, m is 0, 1, or 2; and n is 0, 1, or 2.

(74) In some embodiments, A is furanyl, m is 0, 1, or 2, and n is 0, 1, or 2.

(75) In some embodiments, A is thiophenyl, m is 0, 1, or 2, and n is 0, 1, or 2.

(76) In some embodiments, A is oxazolyl, m is 0, 1, or 2, and n is 0, 1, or 2.

(77) In some embodiments, A is thiazolyl, m is 0, 1, or 2, and n is 0, 1, or 2.

(78) In some embodiments, A is pyrazolyl, m is 0, 1, or 2, and n is 0, 1, or 2.

(79) In some embodiments, A is pyridyl m is 0, 1, or 2, and n is 0, 1, or 2.

(80) In some embodiments, A is phenyl, m is 0 or 1, and n is 0 or 1.

(81) In some embodiments, A is furanyl, m is 0 or 1, and n is 0 or 1.

(82) In some embodiments, A is thiophenyl, m is 1 and n is 0 or 1.

(83) In some embodiments, A is oxazolyl, m is 1 and n is 0 or 1.

(84) In some embodiments, A is thiazolyl, m is 1 and n is 0 or 1.

(85) In some embodiments, A is pyrazolyl, m is 1 and n is 0 or 1.

(86) In some embodiments, A is pyridyl, m is 1 and n is 0 or 1.

(87) In some embodiments, A is phenyl, m is 1 and n is 1.

(88) In some embodiments, A is furanyl, m is 1 and n is 1.

(89) In some embodiments, A is thiophenyl, m is 1 and n is 1.

(90) In some embodiments, A is oxazolyl, m is 1 and n is 1.

(91) In some embodiments, A is thiazolyl, m is 1 and n is 1.

(92) In some embodiments, A is pyrazolyl, m is 1 and n is 1.

(93) In some embodiments, A is pyridyl, m is 1 and n is 1.

(94) In some embodiments, A is phenyl, m is 0 or 1, and n is 0, 1, or 2.

(95) In some embodiments, A is furanyl, m is 0 or 1, and n is 0, 1, or 2.

(96) In some embodiments, A is thiophenyl, m is 0 or 1, and n is 0, 1, or 2.

(97) In some embodiments, A is oxazolyl, m is 0 or 1, and n is 0, 1, or 2.

(98) In some embodiments, A is thiazolyl, m is 0 or 1, and n is 0, 1, or 2.

(99) In some embodiments, A is pyrazolyl, m is 0 or 1, and n is 0, 1, or 2.

(100) In some embodiments, A is pyridyl, m is 0 or 1, and n is 0, 1, or 2.

(101) In some embodiments, A is phenyl, m is 0, and n is 0 or 1.

(102) In some embodiments, A is furanyl, m is 0, and n is 0 or 1.

(103) In some embodiments, A is thiophenyl, m is 0, and n is 0 or 1.

(104) In some embodiments, A is oxazolyl, m is 0, and n is 0 or 1.

(105) In some embodiments, A is thiazolyl, m is 0, and n is 0 or 1.

(106) In some embodiments, A is pyrazolyl, m is 0, and n is 0 or 1.

(107) In some embodiments, A is pyridyl, m is 0, and n is 0 or 1.

(108) In some embodiments, A is one of the rings disclosed hereinbelow optionally substituted as disclosed hereinbelow, wherein in each case the bond that is shown as being broken by the wavy line custom character connects A to the S(O)(NHR.sup.3)═N moiety of Formula AA.

(109) In some embodiments, the optionally substituted ring A is

(110) ##STR00029##

(111) In some embodiments, the optionally substituted ring A is

(112) ##STR00030##

(113) In some embodiments, the optionally substituted ring A is

(114) ##STR00031##

(115) In some embodiments, the optionally substituted ring A is

(116) ##STR00032##

(117) In some embodiments, the optionally substituted ring A is

(118) ##STR00033##

(119) In some embodiments, the optionally substituted ring A is

(120) ##STR00034##

(121) In some embodiments, the optionally substituted ring A is

(122) ##STR00035##

(123) In some embodiments, the optionally substituted ring A is

(124) ##STR00036##

(125) In some embodiments, the optionally substituted ring A is

(126) ##STR00037##

(127) In some embodiments, the optionally substituted ring A is

(128) ##STR00038##

(129) In some embodiments, the optionally substituted ring A is

(130) ##STR00039##

(131) In some embodiments, the optionally substituted ring A is

(132) ##STR00040##

(133) In some embodiments, the optionally substituted ring A is

(134) ##STR00041##

(135) In some embodiments, the optionally substituted ring A is

(136) ##STR00042##

(137) In some embodiments, the optionally substituted ring A is

(138) ##STR00043##

(139) In some embodiments, the optionally substituted ring A is

(140) ##STR00044##

(141) In some embodiments, the optionally substituted ring A is

(142) ##STR00045##

(143) In some embodiments, the optionally substituted ring A is

(144) ##STR00046##

(145) In some embodiments, the optionally substituted ring A is

(146) ##STR00047##

(147) In some embodiments, the optionally substituted ring A is

(148) ##STR00048##

(149) In some embodiments, the optionally substituted ring A is

(150) ##STR00049##

(151) In some embodiments, the optionally substituted ring A is

(152) ##STR00050##

(153) In some embodiments, the optionally substituted ring A is

(154) ##STR00051##

(155) In some embodiments, the optionally substituted ring A is

(156) ##STR00052##

(157) In some embodiments, the optionally substituted ring A is

(158) ##STR00053##

(159) In some embodiments, the optionally substituted ring A is

(160) ##STR00054##

(161) In some embodiments, the optionally substituted ring A is

(162) ##STR00055##

(163) In some embodiments, the optionally substituted ring A is

(164) ##STR00056##

(165) In some embodiments, the optionally substituted ring A is

(166) ##STR00057##

(167) In some embodiments, the optionally substituted ring A is

(168) ##STR00058##

(169) In some embodiments, the optionally substituted ring A is

(170) ##STR00059##

(171) In some embodiments, the optionally substituted ring A is

(172) ##STR00060##

(173) In some embodiments, the optionally substituted ring A is

(174) ##STR00061##

(175) In some embodiments, the optionally substituted ring A is

(176) ##STR00062##

(177) In some embodiments, the optionally substituted ring A is

(178) ##STR00063##

(179) In some embodiments, the optionally substituted ring A is

(180) ##STR00064##

(181) In some embodiments, the optionally substituted ring A is

(182) ##STR00065##

(183) In some embodiments, the optionally substituted ring A is

(184) ##STR00066##

(185) In some embodiments, the optionally substituted ring A is

(186) ##STR00067##

(187) In some embodiments, the optionally substituted ring A is

(188) ##STR00068##

(189) In some embodiments, the optionally substituted ring A is

(190) ##STR00069##

(191) In some embodiments, the optionally substituted ring A is

(192) ##STR00070##

(193) In some embodiments, the optionally substituted ring A is

(194) ##STR00071##

(195) In some embodiments, the optionally substituted ring A is

(196) ##STR00072##

(197) In some embodiments, the optionally substituted ring A is

(198) ##STR00073##

(199) In some embodiments, the optionally substituted ring A is

(200) ##STR00074##

(201) In some embodiments, the optionally substituted ring A is

(202) ##STR00075##

(203) In some embodiments, the optionally substituted ring A is

(204) ##STR00076##

(205) In some embodiments, the optionally substituted ring A is

(206) ##STR00077##

(207) In some embodiments, the optionally substituted ring A is

(208) ##STR00078##

(209) In some embodiments, the optionally substituted ring A is

(210) ##STR00079##

(211) In some embodiments, the optionally substituted ring A is

(212) ##STR00080##

(213) In some embodiments, the optionally substituted ring A is

(214) ##STR00081##

(215) In some embodiments, the optionally substituted ring A is

(216) ##STR00082##

(217) In some embodiments, the optionally substituted ring A is

(218) ##STR00083##

(219) In some embodiments, the optionally substituted ring A is

(220) ##STR00084##

(221) In some embodiments, the optionally substituted ring A is

(222) ##STR00085##

(223) In some embodiments, the optionally substituted ring A is

(224) ##STR00086##

(225) In some embodiments, the optionally substituted ring A is

(226) ##STR00087##

(227) In some embodiments, the optionally substituted ring A is

(228) ##STR00088##

(229) In some embodiments, the optionally substituted ring A is

(230) ##STR00089##

(231) In some embodiments, the optionally substituted ring A is

(232) ##STR00090##

(233) In some embodiments, the optionally substituted ring A is

(234) ##STR00091##
The Groups R.sup.1 and R.sup.2

(235) In some embodiments,

(236) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(237) In some embodiments,

(238) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(239) In some embodiments,

(240) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is further optionally independently substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(241) In some embodiments,

(242) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each C.sub.1-C.sub.6 alkyl substituent and each C.sub.1-C.sub.6 alkoxy substituent of the R.sup.1 or R.sup.2 C.sub.3-C.sub.7 cycloalkyl or of the R.sup.1 or R.sup.2 3- to 7-membered heterocycloalkyl is unsubstituted; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are unsubstituted;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(243) In some embodiments,

(244) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl.

(245) In some embodiments,

(246) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl are each unsubstituted;
or at least one pair of R.sup.1 and R.sup.2 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(247) In some embodiments,

(248) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, S(O)C.sub.1-C.sub.6 alkyl, 5- to 10-membered heteroaryl, and 3- to 7-membered heterocycloalkyl,

(249) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy and oxo.

(250) In some embodiments, each of R.sup.1 and R.sup.2 is independently selected from the group consisting of C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, halo, oxo, C.sub.1-C.sub.6 alkoxy, or NR.sup.8R.sup.9; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, halo, oxo, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkyl, or NR.sup.8R.sup.9 wherein the C.sub.1-C.sub.6 alkoxy or C.sub.1-C.sub.6 alkyl is further optionally substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, or NR.sup.8R.sup.9 wherein the C.sub.1-C.sub.6 alkoxy or C.sub.1-C.sub.6 alkyl is further optionally substituted with one to three hydroxy, halo, NR.sup.8R.sup.9, or oxo; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; CO—C.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; S(O.sub.2)NR.sup.11R.sup.12; S(O)C.sub.1-C.sub.6 alkyl; and S(O.sub.2)C.sub.1-C.sub.6 alkyl. In some embodiments, R.sup.1 is selected from the group consisting of 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; S(O.sub.2)CH.sub.3, and S(O.sub.2)NR.sup.11R.sup.12. In some embodiments, R.sup.2 is selected from the group consisting of fluoro, chloro, cyano, methyl; methoxy; ethoxy; isopropyl; 1-hydroxy-2-methylpropan-2-yl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; COCH.sub.3; COPh; 2-methoxy-2-propyl; (dimethylamino)methyl; S(O.sub.2)CH.sub.3, and S(O.sub.2)NR.sup.11R.sup.12.

(251) In some embodiments, m=1; n=0; and

(252) R.sup.1 is selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl.

(253) In some embodiments, m=1; n=0; and,

(254) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, S(O)C.sub.1-C.sub.6 alkyl, and 3- to 7-membered heterocycloalkyl,

(255) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy and oxo.

(256) In some embodiments, m=1; n=0; and,

(257) R.sup.1 is selected from C.sub.1-C.sub.6 alkyl, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, S(O)C.sub.1-C.sub.6 alkyl, and 3- to 7-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy and oxo.

(258) In some embodiments, m=1; n=1; and

(259) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, CO—C.sub.6-C.sub.10 aryl, CO-5- to 10-membered heteroaryl, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, SC.sub.1-C.sub.6 alkyl, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, S(O)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl.

(260) In some embodiments, m=1; n=1; and,

(261) R.sup.1 and R.sup.2 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, S(O)C.sub.1-C.sub.6 alkyl, and 3- to 7-membered heterocycloalkyl,

(262) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy and oxo.

(263) In some embodiments, m=1; n=1; and

(264) R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.4-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(265) In some embodiments, m=1; n=1; and

(266) R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(267) In some embodiments, m=1; n=1; and

(268) R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 carbocyclic ring or a 5-to-6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(269) In some embodiments, m=1; n=1; and

(270) R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5 carbocyclic ring or a 5-to-6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(271) In some embodiments, m=1; n=1; and

(272) R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is unsubstituted.

(273) In some embodiments, m=1; n=1; and

(274) R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is unsubstituted.
Particular Embodiments Wherein m=1 and n=0:

(275) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy.

(276) In some embodiments, R.sup.1 is 1-hydroxy-2-methylpropan-2-yl.

(277) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl.

(278) In some embodiments, R.sup.1 is methyl.

(279) In some embodiments, R.sup.1 is isopropyl.

(280) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl substituted with hydroxy at the carbon directly connected to ring A.

(281) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl.

(282) In some embodiments, R.sup.1 is hydroxymethyl.

(283) In some embodiments, R.sup.1 is 1-hydroxyethyl.

(284) In some embodiments, R.sup.1 is 2-hydroxyethyl.

(285) In some embodiments, R.sup.1 is 1-hydroxy-2-propyl.

(286) In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy.

(287) In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl.

(288) In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl substituted with hydroxy at the carbon directly connected to ring A.

(289) In some embodiments, R.sup.1 is 1-hydroxy-1-cyclopropyl.

(290) In some embodiments, R.sup.1 is 1-hydroxy-1-cyclobutyl.

(291) In some embodiments, R.sup.1 is 1-hydroxy-1-cyclopentyl.

(292) In some embodiments, R.sup.1 is 1-hydroxy-1-cyclohexyl.

(293) In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy.

(294) In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl.

(295) In some embodiments, R.sup.1 is morpholinyl (e.g., 4-morpholinyl).

(296) In some embodiments, R.sup.1 is 1,3-dioxolan-2-yl.

(297) In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl substituted with hydroxy at the carbon directly connected to ring A.

(298) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo.

(299) In some embodiments, R.sup.1 is COCH.sub.3.

(300) In some embodiments, R.sup.1 is COCH.sub.2CH.sub.3.

(301) In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more oxo.

(302) In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more oxo.

(303) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy.

(304) In some embodiments, R.sup.1 is 2-methoxy-2-propyl.

(305) In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy.

(306) In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy.

(307) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9.

(308) In some embodiments, R.sup.1 is (dimethylamino)methyl.

(309) In some embodiments, R.sup.1 is 2-(dimethylamino)prop-2-yl.

(310) In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more NR.sup.8R.sup.9.

(311) In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more NR.sup.8R.sup.9.

(312) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy and one or more oxo.

(313) In some embodiments, R.sup.1 is C(Me).sub.2C(O)OH.

(314) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 haloalkyl optionally substituted with one or more hydroxy.

(315) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkoxy.

(316) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 haloalkoxy.

(317) In some embodiments, R.sup.1 is halo.

(318) In some embodiments, R.sup.1 is fluoro.

(319) In some embodiments, R.sup.1 is chloro.

(320) In some embodiments, R.sup.1 is CN.

(321) In some embodiments, R.sup.1 is NO.sub.2.

(322) In some embodiments, R.sup.1 is COC.sub.1-C.sub.6 alkyl.

(323) In some embodiments, R.sup.1 is CO—C.sub.6-C.sub.10 aryl.

(324) In some embodiments, R.sup.1 is CO-5- to 10-membered heteroaryl.

(325) In some embodiments, R.sup.1 is CO.sub.2C.sub.1-C.sub.6 alkyl.

(326) In some embodiments, R.sup.1 is CO.sub.2C.sub.3-C.sub.8 cycloalkyl.

(327) In some embodiments, R.sup.1 is OCOC.sub.1-C.sub.6 alkyl.

(328) In some embodiments, R.sup.1 is OCOC.sub.6-C.sub.10 aryl.

(329) In some embodiments, R.sup.1 is OCO (5- to 10-membered heteroaryl).

(330) In some embodiments, R.sup.1 is OCO (3- to 7-membered heterocycloalkyl).

(331) In some embodiments, R.sup.1 is C.sub.6-C.sub.10 aryl.

(332) In some embodiments, R.sup.1 is phenyl.

(333) In some embodiments, R.sup.1 is 5- to 10-membered heteroaryl.

(334) In some embodiments, R.sup.1 is pyridyl (e.g., 4-pyridyl).

(335) In some embodiments, R.sup.1 is pyrazolyl (e.g., 1-pyrazolyl).

(336) In some embodiments, R.sup.1 is NH.sub.2.

(337) In some embodiments, R.sup.1 is NHC.sub.1-C.sub.6 alkyl.

(338) In some embodiments, R.sup.1 is N(C.sub.1-C.sub.6 alkyl).sub.2.

(339) In some embodiments, R.sup.1 is CONR.sup.8R.sup.9.

(340) In some embodiments, R.sup.1 is SF.sub.5.

(341) In some embodiments, R.sup.1 is SC.sub.1-C.sub.6 alkyl,

(342) In some embodiments, R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(343) In some embodiments, R.sup.1 is S(O.sub.2)CH.sub.3.

(344) In some embodiments, R.sup.1 is S(O.sub.2)NR.sup.11R.sup.12.

(345) In some embodiments, R.sup.1 is S(O.sub.2)N(CH.sub.3).sub.2.

(346) In some embodiments, R.sup.1 is S(O)C.sub.1-C.sub.6 alkyl.

(347) In some embodiments, R.sup.1 is S(O)CH.sub.3.

(348) In some embodiments, R.sup.1 is attached to a carbon of an aryl ring A.

(349) In some embodiments, R.sup.1 is attached to a carbon of a heteroaryl ring A.

(350) In some embodiments, R.sup.1 is attached to a nitrogen of a heteroaryl ring A.

(351) Particular embodiments wherein m=1 and n=1:

(352) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy.

(353) In some embodiments, R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl.

(354) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl.

(355) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl.

(356) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl.

(357) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl.

(358) In some embodiments, R.sup.1 is hydroxymethyl and R.sup.2 is methyl.

(359) In some embodiments, R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl.

(360) In some embodiments, R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl.

(361) In some embodiments, R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl.

(362) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl.

(363) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl.

(364) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl.

(365) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl.

(366) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl.

(367) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5.

(368) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SC.sub.1-C.sub.6 alkyl.

(369) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(370) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)CH.sub.3.

(371) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo.

(372) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro.

(373) In some embodiments, R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro.

(374) In some embodiments, R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl.

(375) In some embodiments, R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl.

(376) In some embodiments, R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl.

(377) In some embodiments, R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl.

(378) In some embodiments, R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl.

(379) In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl.

(380) In some embodiments, R.sup.1 is morpholinyl, and R.sup.2 is methyl.

(381) In some embodiments, R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl.

(382) In some embodiments, R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo.

(383) In some embodiments, R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro.

(384) In some embodiments, R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro.

(385) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl.

(386) In some embodiments, R.sup.1 is COCH.sub.3, and R.sup.2 is methyl.

(387) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl.

(388) In some embodiments, R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl.

(389) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl.

(390) In some embodiments, R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl.

(391) In some embodiments, R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo.

(392) In some embodiments, R.sup.1 is (dimethylamino)methyl, and R.sup.2 is fluoro.

(393) In some embodiments, R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl.

(394) In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl.

(395) In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl.

(396) In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl.

(397) In some embodiments, R.sup.2 is hydroxymethyl and R.sup.1 is methyl.

(398) In some embodiments, R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl.

(399) In some embodiments, R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl.

(400) In some embodiments, R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl.

(401) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl.

(402) In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.7 is phenyl.

(403) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl.

(404) In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl.

(405) In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl.

(406) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5.

(407) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SC.sub.1-C.sub.6 alkyl.

(408) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(409) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3.

(410) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo.

(411) In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro.

(412) In some embodiments, R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro.

(413) In some embodiments, R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

(414) In some embodiments, R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl.

(415) In some embodiments, R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl.

(416) In some embodiments, R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl.

(417) In some embodiments, R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl.

(418) In some embodiments, R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

(419) In some embodiments, R.sup.2 is morpholinyl, and R.sup.1 is methyl.

(420) In some embodiments, R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl.

(421) In some embodiments, R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo.

(422) In some embodiments, R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro.

(423) In some embodiments, R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro.

(424) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl.

(425) In some embodiments, R.sup.2 is COCH.sub.3, and R.sup.1 is methyl.

(426) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

(427) In some embodiments, R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl.

(428) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl.

(429) In some embodiments, R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.

(430) In some embodiments, R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

(431) In some embodiments, R.sup.2 is (dimethylamino)methyl, and R.sup.1 is fluoro.

(432) In some embodiments, R.sup.1 and R.sup.2 are each attached to a carbon of an aryl ring A.

(433) In some embodiments, R.sup.1 and R.sup.2 are each attached to a carbon of a heteroaryl ring A.

(434) In some embodiments, R.sup.1 is attached to a carbon and R.sup.2 is attached to a nitrogen of a heteroaryl ring A.

(435) In some embodiments, R.sup.2 is attached to a carbon and R.sup.1 is attached to a nitrogen of a heteroaryl ring A.

(436) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5 carbocyclic ring optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(437) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5 aliphatic carbocyclic ring.

(438) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5 saturated carbocyclic ring.

(439) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 aromatic carbocyclic ring.

(440) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 carbocyclic ring optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(441) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 aliphatic carbocyclic ring.

(442) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 saturated carbocyclic ring.

(443) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 aromatic carbocyclic ring.

(444) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(445) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

(446) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

(447) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(448) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

(449) In some embodiments, R.sup.1 and R.sup.2 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

(450) In some embodiments, R.sup.1 and R.sup.2 are different.

(451) In some embodiments, R.sup.1 and R.sup.2 are different, and R.sup.2 comprises a carbonyl group.

(452) In some embodiments, R.sup.1 and R.sup.2 are different, and R.sup.2 comprises 1 or 2 (e.g., 1) nitrogen atoms.

(453) In some embodiments, R.sup.1 and R.sup.2 are different, and R.sup.2 comprises 1 or 2 (e.g., 1) oxygen atoms.

(454) In some embodiments, R.sup.1 and R.sup.2 are different, and R.sup.2 comprises a sulfur atom.

(455) In some embodiments, R.sup.2 and R.sup.1 are different, and R.sup.2 comprises a carbonyl group.

(456) In some embodiments, R.sup.2 and R.sup.1 are different, and R.sup.2 comprises 1 or 2 (e.g., 1) nitrogen atoms.

(457) In some embodiments, R.sup.2 and R.sup.1 are different, and R.sup.2 comprises 1 or 2 (e.g., 1) oxygen atoms.

(458) In some embodiments, R.sup.2 and R.sup.1 are different, and R.sup.2 comprises a sulfur atom.

(459) In some embodiments, R.sup.1 and R.sup.2 are the same.

(460) In some embodiments, R.sup.1 is para or meta to R.sup.2.

(461) In some embodiments, R.sup.1 is para or ortho to R.sup.2.

(462) In some embodiments, R.sup.1 is ortho or meta to R.sup.2.

(463) In some embodiments, R.sup.1 is para to R.sup.2.

(464) In some embodiments, R.sup.1 is meta to R.sup.2.

(465) In some embodiments, R.sup.1 is ortho to R.sup.2.

(466) The Variables o and p

(467) In some embodiments o=1 or 2.

(468) In some embodiments o=1.

(469) In some embodiments o=2.

(470) In some embodiments p=0, 1, 2, or 3.

(471) In some embodiments p=0.

(472) In some embodiments p=1.

(473) In some embodiments p=2.

(474) In some embodiments, o=1 and p=0.

(475) In some embodiments, o=2 and p=0.

(476) In some embodiments, o=1 and p=1.

(477) In some embodiments, o=1 and p=2.

(478) In some embodiments, o=2 and p=1.

(479) In some embodiments, o=2 and p=2.

(480) In some embodiments, o=2 and p=3.

(481) The ring B and substitutions on the ring B

(482) In some embodiments, B is a 5-10-membered monocyclic or bicyclic heteroaryl or a C.sub.6-C.sub.10 monocyclic or bicyclic aryl, such as phenyl.

(483) In some embodiments, B is a 5-6-membered monocyclic heteroaryl or a C.sub.6 monocyclic aryl.

(484) In some embodiments, B is a 5-10-membered monocyclic or bicyclic heteroaryl.

(485) In some embodiments, B is a C.sub.6-C.sub.10 monocyclic or bicyclic aryl.

(486) In some embodiments, B is a 5-membered monocyclic or bicyclic heteroaryl.

(487) In some embodiments, B is a 7-10 membered monocyclic or bicyclic heteroaryl.

(488) In some embodiments, B is a 6-membered bicyclic heteroaryl.

(489) In some embodiments, B is a 6-membered monocyclic heteroaryl containing 2 or more N atoms.

(490) In some embodiments, B is phenyl, o is 1 or 2, and p is 0, 1, 2, or 3.

(491) In some embodiments, B is pyridyl, o is 1 or 2, and p is 0, 1, 2, or 3.

(492) In some embodiments, B is 3-pyridyl, o is 1 or 2, and p is 0, 1, 2, or 3.

(493) In some embodiments, B is phenyl, o is 1, or 2, and p is 0, 1, 2, or 3.

(494) In some embodiments, B is pyridyl (e.g., 3-pyridyl), o is 1 or 2, and p is 0, 1, 2, or 3.

(495) In some embodiments, B is phenyl, o is 1, and p is 1, 2, or 3.

(496) In some embodiments, B is phenyl, o is 2, and p is 1, 2, or 3.

(497) In some embodiments, B is pyridyl (e.g., 3-pyridyl), o is 1, and p is 0, 1, 2, or 3.

(498) In some embodiments, B is pyridyl (e.g., 3-pyridyl), o is 2, and p is 0, 1, 2, or 3.

(499) In some embodiments, B is phenyl, o is 1 or 2, and p is 0, 1, 2, or 3.

(500) In some embodiments, B is pyridyl (e.g., 3-pyridyl), o is 1 or 2, and p is 0, 1, 2, or 3.

(501) In some embodiments, B is phenyl, o is 1, and p is 0, 1, 2, or 3.

(502) In some embodiments, B is phenyl, o is 2, and p is 0, 1, 2, or 3.

(503) In some embodiments, B is pyridyl (e.g., 3-pyridyl), o is 1, and p is 0, 1, 2, or 3.

(504) In some embodiments, B is pyridyl (e.g., 3-pyridyl), o is 2, and p is 0, 1, or 2.

(505) In some embodiments, B is pyrimidinyl (e.g., pyrimidin-5-yl), o is 1, and p is 0, 1, or 2.

(506) In some embodiments, B is pyrimidinyl (e.g., pyrimidin-5-yl), o is 2, and p is 0 or 1.

(507) In some embodiments, B is one of the rings disclosed hereinbelow, substituted as disclosed hereinbelow, wherein in each case the bond that is shown as being broken by the wavy line custom character connects B to the NH(CO) group of Formula AA.

(508) In some embodiments, the substituted ring B

(509) ##STR00092##

(510) In some embodiments, the substituted ring B is

(511) ##STR00093##

(512) In some embodiments, the substituted ring B is

(513) ##STR00094##

(514) In some embodiments, the substituted ring B is

(515) ##STR00095##

(516) In some embodiments, the substituted ring B is

(517) ##STR00096##

(518) In some embodiments, the substituted ring B is

(519) ##STR00097##

(520) In some embodiments, the substituted ring B is

(521) ##STR00098##

(522) In some embodiments, the substituted ring B is

(523) ##STR00099##

(524) In some embodiments, the substituted ring B is

(525) ##STR00100##

(526) In some embodiments, the substituted ring B is

(527) ##STR00101##

(528) In some embodiments, the substituted ring B is

(529) ##STR00102##

(530) In some embodiments, the substituted ring B is

(531) ##STR00103##

(532) In some embodiments, the substituted ring B is

(533) ##STR00104##

(534) In some embodiments, the substituted ring B is

(535) ##STR00105##

(536) In some embodiments, the substituted ring B is

(537) ##STR00106##

(538) In some embodiments, the substituted ring B is

(539) ##STR00107##

(540) In some embodiments, the substituted ring B is

(541) ##STR00108##

(542) In some embodiments, the substituted ring B is

(543) ##STR00109##

(544) In some embodiments, the substituted ring B is

(545) ##STR00110##

(546) In some embodiments, the substituted ring B is

(547) ##STR00111##

(548) In some embodiments, the substituted ring B is

(549) ##STR00112##

(550) In some embodiments, the substituted ring B is

(551) ##STR00113##

(552) In some embodiments, the substituted ring B is

(553) ##STR00114##

(554) In some embodiments, the substituted ring B is

(555) ##STR00115##

(556) In some embodiments, the substituted ring B is

(557) ##STR00116##

(558) In some embodiments, the substituted ring B is

(559) ##STR00117##

(560) In some embodiments, the substituted ring B is

(561) ##STR00118##

(562) In some embodiments, the substituted ring B is

(563) ##STR00119##

(564) In some embodiments, the substituted ring B is

(565) ##STR00120##
The Groups R.sup.6 and R.sup.1

(566) In some embodiments,

(567) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(568) In some embodiments,

(569) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.10 cycloalkyl and 3- to 10-membered heterocycloalkyl, and a C.sub.2-C.sub.6 alkenyl, wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from
hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl,
C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.6 aliphatic carbocyclic ring or at least one 5- to 6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(570) In some embodiments,

(571) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(572) In some embodiments,

(573) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(574) In some embodiments,

(575) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7- membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(576) In some embodiments,

(577) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein R.sup.6 and R.sup.7 are each optionally substituted with one or more substituents independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.2-C.sub.6 alkynyl, C.sub.6-C.sub.10 aryloxy, and S(O.sub.2)C.sub.1-C.sub.6 alkyl; and wherein the C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy that R.sup.6 or R.sup.7 is substituted with is optionally substituted with one or more hydroxyl, halo, C.sub.6-C.sub.10 aryl or NR.sup.8R.sup.9, or wherein R.sup.6 or R.sup.7 is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9, wherein the C.sub.1-C.sub.6 alkyl and C.sub.1-C.sub.6 alkoxy are optionally substituted with hydroxy, halo, oxo, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(578) In some embodiments,

(579) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(580) In some embodiments,

(581) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7- membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(582) In some embodiments,

(583) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(584) In some embodiments,

(585) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7- membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(586) In some embodiments,

(587) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are unsubstituted; or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(588) In some embodiments,

(589) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl are each unsubstituted;
or at least one pair of R.sup.6 and R′ on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring or at least one 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(590) In some embodiments,

(591) R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl;

(592) CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,

(593) wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; and R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(594) In some embodiments,

(595) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,

(596) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,

(597) or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

(598) In some embodiments,

(599) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,

(600) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,

(601) or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.6 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

(602) In some embodiments,

(603) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,

(604) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,

(605) or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the heterocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

(606) In some embodiments,

(607) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,

(608) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,

(609) or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

(610) In some embodiments,

(611) at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.6 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

(612) In some embodiments,

(613) at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

(614) In some embodiments,

(615) at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

(616) In some embodiments,

(617) at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.6 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

(618) In some embodiments,

(619) at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one 5- to 6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

(620) In some embodiments,

(621) at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one 5-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

(622) In some embodiments,

(623) at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one 6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

(624) In some embodiments,

(625) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,

(626) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,

(627) or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.6 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more C.sub.1-C.sub.6 alkyl.

(628) In some embodiments,

(629) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,

(630) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,

(631) or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one 5- to 8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the heterocyclic ring is optionally independently substituted with one or more C.sub.1-C.sub.6 alkyl.

(632) In some embodiments,

(633) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,

(634) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from C.sub.1-C.sub.6 alkyl.

(635) or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.8 carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more C.sub.1-C.sub.6 alkyl.

(636) In some embodiments,

(637) at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.6 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more C.sub.1-C.sub.6 alkyl.

(638) In some embodiments,

(639) at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more C.sub.1-C.sub.6 alkyl.

(640) In some embodiments,

(641) at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more C.sub.1-C.sub.6 alkyl.

(642) In some embodiments,

(643) at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.6 aliphatic carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more C.sub.1-C.sub.6 alkyl.

(644) In some embodiments,

(645) at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one 5- to 6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally independently substituted with one or more C.sub.1-C.sub.6 alkyl.

(646) In some embodiments,

(647) at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one 5-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally independently substituted with one or more C.sub.1-C.sub.6 alkyl.

(648) In some embodiments,

(649) at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one 6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally independently substituted with one or more C.sub.1-C.sub.6 alkyl.

(650) In some embodiments, o=1; p=0; and

(651) R.sup.6 is selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl.

(652) In some embodiments, o=1; p=1; and

(653) R.sup.6 is selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.8 carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

(654) In some embodiments, o=1 or 2; p=1, 2, or 3; and

(655) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.8 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NH.sub.2, NHC.sub.1-C.sub.6 alkyl, N(C.sub.1-C.sub.6 alkyl).sub.2, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (3- to 7-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein the 3- to 7-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl) and NHCO (3- to 7-membered heterocycloalkyl) are optionally substituted with one or more substituents independently selected from halo, C.sub.1-C.sub.6 alkyl, and OC.sub.1-C.sub.6 alkyl.

(656) In some embodiments, o=2; p=1; and

(657) each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl;

(658) CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,

(659) wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; and R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form C.sub.4-C.sub.7 carbocyclic ring or 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(660) In some embodiments, o=2; p=2 or 3; and

(661) each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl;

(662) CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,

(663) wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.7 (e.g., C.sub.4-C.sub.6) carbocyclic ring (e.g., aliphatic carbocyclic ring) or at least one 5-to-7-membered (e.g., 5-to-6-membered) heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(664) In some embodiments, o=1 or 2; p=1, 2, or 3; and

(665) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,

(666) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo,

(667) or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.5-C.sub.5 carbocyclic ring, wherein the carbocyclic ring is optionally independently substituted with one or more hydroxy or oxo.

(668) In some embodiments, o=1 or 2; p=1, 2, or 3; and

(669) R.sup.6 and R.sup.7 are each independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halo, CN, NO.sub.2, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, and 3- to 7-membered heterocycloalkyl,

(670) wherein the C.sub.1-C.sub.6 alkyl and 3- to 7-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy or oxo.

(671) In some embodiments, o=1 or 2; p=1, 2, or 3; and

(672) one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(673) In some embodiments, o=1 or 2; p=1, 2, or 3; and

(674) one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 carbocyclic ring or a 5-to-6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(675) In some embodiments, o=1 or 2; p=1, 2, or 3; and

(676) one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is unsubstituted.

(677) In some embodiments, o=2; p=2 or 3; and

(678) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein each carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(679) In some embodiments, o=2; p=2 or 3; and

(680) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.6 carbocyclic ring or a 5-to-6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(681) In some embodiments, o=2; p=2 or 3; and

(682) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is unsubstituted.
Particular Embodiments Wherein o=1; p=0:

(683) In some embodiments, R.sup.6 is C.sub.1-C.sub.6 alkyl.

(684) In some embodiments, R.sup.6 is isopropyl.

(685) In some embodiments, R.sup.6 is ethyl.

(686) In some embodiments, R.sup.6 is methyl.

(687) In some embodiments, R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo.

(688) In some embodiments, R.sup.6 is C.sub.1-C.sub.6 alkyl (e.g., methyl) substituted with one or more (e.g., one) C.sub.1-C.sub.6 alkoxy (e.g., methoxy). In some embodiments, R.sup.6 is methoxymethyl.

(689) In some embodiments, R.sup.6 is trifluoromethyl.

(690) In some embodiments, R.sup.6 is trifluoromethoxy.

(691) In some embodiments, R.sup.6 is C.sub.3-C.sub.7 cycloalkyl.

(692) In some embodiments, R.sup.6 is cyclopropyl.

(693) In some embodiments, R.sup.6 is halo.

(694) In some embodiments, R.sup.6 is chloro.

(695) In some embodiments, R.sup.6 is fluoro.

(696) In some embodiments, R.sup.6 is cyano.

(697) In some embodiments, R.sup.6 is attached to a carbon of an aryl ring B.

(698) In some embodiments, R.sup.6 is attached to a carbon of a heteroaryl ring B.

(699) In some embodiments, R.sup.6 is attached to a nitrogen of a heteroaryl ring B.

(700) Particular Embodiments Wherein o=1 or 2; p=1, 2, or 3:

(701) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo.

(702) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is halo.

(703) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl and at least one R.sup.7 is C.sub.1-C.sub.6 alkyl.

(704) In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is methyl.

(705) In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is isopropyl.

(706) In some embodiments, o=1; p=1; R.sup.6 is isopropyl; and R.sup.7 is isopropyl.

(707) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo.

(708) In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is trifluoromethyl.

(709) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.3-C.sub.7 cycloalkyl.

(710) In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is cyclopropyl.

(711) In some embodiments, o=1; p=1; R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl.

(712) In some embodiments, o=1; p=2; R.sup.6 is isopropyl; one R.sup.7 is cyclopropyl; and the other R.sup.7 is fluoro.

(713) In some embodiments, o=2; p=2; one R.sup.6 is isopropyl; one R.sup.7 is cyclopropyl; the other R.sup.6 is cyano; and the other R.sup.7 is fluoro.

(714) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is halo.

(715) In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is halo.

(716) In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is chloro.

(717) In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is fluoro.

(718) In some embodiments, o=1; p=1; R.sup.6 is isopropyl; and R.sup.7 is chloro.

(719) In some embodiments, o=2; p=1; at least one R.sup.6 is isopropyl; and R.sup.7 is chloro.

(720) In some embodiments, o=1; p=1; R.sup.6 is isopropyl; and R.sup.7 is fluoro.

(721) In some embodiments, o=2; p=1; at least one R.sup.6 is isopropyl, and R.sup.7 is fluoro.

(722) In some embodiments, o=2; p=1; each R.sup.6 is isopropyl, and R.sup.7 is fluoro.

(723) In some embodiments, o=1; p=1; R.sup.6 is isopropyl; and R.sup.7 is fluoro.

(724) In some embodiments, o=2; p=1; at least one R.sup.6 is isopropyl; and R.sup.7 is fluoro.

(725) In some embodiments, o=2; p=2; at least one R.sup.6 is isopropyl, one R.sup.7 is fluoro, and one R.sup.7 is phenyl substituted with trifluoromethyl (e.g., substituted at the meta position with trifluoromethyl).

(726) In some embodiments, o=2; p=2; at least one R.sup.6 is isopropyl; and R.sup.7 is fluoro.

(727) In some embodiments, o=2; p=2; at least one R.sup.6 is isopropyl; one R.sup.7 is fluoro; and the other R.sup.7 is cyano.

(728) In some embodiments, o=2; p=3; at least one R.sup.6 is isopropyl; two R.sup.7 are fluoro; and one R.sup.7 is chloro.

(729) In some embodiments, o=2; p=1; at least one R.sup.6 is ethyl; and R.sup.7 is fluoro.

(730) In some embodiments, o=2; p=1; at least one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and R.sup.7 is chloro.

(731) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is cyano.

(732) In some embodiments, at least one R.sup.6 is isopropyl and at least one R.sup.7 is cyano.

(733) In some embodiments, o=1; p=1; R.sup.6 is isopropyl; and R.sup.7 is cyano.

(734) In some embodiments, o=2; p=1; at least one R.sup.6 is isopropyl; and R.sup.7 is cyano.

(735) In some embodiments, at least one R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and at least one R.sup.7 is C.sub.3-C.sub.7 cycloalkyl.

(736) In some embodiments, at least one R.sup.6 is cyclopropyl, and at least one R.sup.7 is cyclopropyl.

(737) In some embodiments, at least one R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and at least one R.sup.7 is halo.

(738) In some embodiments, at least one R.sup.6 is cyclopropyl and at least one R.sup.7 is halo.

(739) In some embodiments, at least one R.sup.6 is cyclopropyl and at least one R.sup.7 is chloro.

(740) In some embodiments, at least one R.sup.6 is cyclopropyl and at least one R.sup.7 is fluoro.

(741) In some embodiments, o=1; p=1; R.sup.6 is cyclopropyl; and R.sup.7 is chloro.

(742) In some embodiments, o=1; p=1; R.sup.6 is cyclopropyl; and R.sup.7 is fluoro.

(743) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo.

(744) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy.

(745) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is methoxy.

(746) In some embodiments, o=1; p=1; R.sup.6 is isopropyl, and R.sup.7 is methoxy.

(747) In some embodiments, o=2; p=1; at least one R.sup.6 is isopropyl, and R.sup.7 is methoxy.

(748) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo.

(749) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is trifluoromethoxy.

(750) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is difluoromethoxy.

(751) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.1-C.sub.6 alkyl (e.g., methyl) substituted with one or more (e.g., one) C.sub.1-C.sub.6 alkoxy (e.g., methoxy).

(752) In some embodiments, at least on R.sup.6 is isopropyl, and at least one R.sup.7 is methoxymethyl.

(753) In some embodiments, o=2; p=1, each R.sup.6 is isopropyl, and R.sup.7 is methoxymethyl.

(754) In some embodiments, at least one R.sup.6 is halo, and at least one R.sup.7 is C.sub.1-C.sub.6 haloalkyl optionally substituted with hydroxy.

(755) In some embodiments, o=1; p=1; R.sup.6 is chloro, and R.sup.7 is trifluoromethyl.

(756) In some embodiments, at least one R.sup.6 is halo, and at least one R.sup.7 is C.sub.1-C.sub.6 haloalkoxy.

(757) In some embodiments, at least one R.sup.6 is chloro, and at least one R.sup.7 is trifluoromethoxy.

(758) In some embodiments, o=1; p=1; R.sup.6 is chloro, and R.sup.7 is trifluoromethoxy.

(759) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkoxy; and at least one R.sup.7 is halo.

(760) In some embodiments, o=1; p=2; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and at least one R.sup.7 is chloro.

(761) In some embodiments, at least one R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; and at least one R.sup.7 is C.sub.1-C.sub.6 haloalkyl optionally substituted with hydroxy.

(762) In some embodiments, at least one R.sup.6 is cyclopropyl; and at least one R.sup.7 is trifluoromethyl.

(763) In some embodiments, o=1; p=2; R.sup.6 is cyclopropyl; one R.sup.7 is trifluoromethyl; and the other R.sup.7 is fluoro.

(764) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.6-C.sub.10 aryl, wherein the C.sub.6-C.sub.10 aryl is optionally substituted or optionally fused as described elsewhere herein.

(765) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is C.sub.6-C.sub.10 aryl, wherein the

(766) C.sub.6-C.sub.10 aryl is optionally substituted as described elsewhere herein.

(767) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is dichlorophenyl (e.g., 3,4-dichlorophenyl).

(768) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is dimethylphenyl (e.g., 3,4-dimethylphenyl).

(769) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is naphthyl (e.g., napthyl substituted with one methoxy).

(770) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is C.sub.6-C.sub.10 aryl, wherein the C.sub.6-C.sub.10 aryl is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen (e.g., R.sup.7 is

(771) ##STR00121##

(772) In some embodiments, o=2; p=1, each R.sup.6 is isopropyl; and R.sup.7 is C.sub.6-C.sub.10 aryl, wherein the C.sub.6-C.sub.10 aryl is optionally substituted as described elsewhere herein (e.g., R.sup.7 is dimethylphenyl; or R.sup.7 is dichlorophenyl; or R.sup.7 is naphthyl).

(773) In some embodiments, o=2; p=1, each R.sup.6 is isopropyl; and R.sup.7 is C.sub.6-C.sub.10 aryl, wherein the C.sub.6-C.sub.10 aryl is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen (e.g., R.sup.7 is

(774) ##STR00122##

(775) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is 3- to 7-membered heterocycloalkyl, wherein the 3- to 7-membered heterocycloalkyl is optionally substituted or optionally fused as described elsewhere herein.

(776) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is 3- to 7-membered heterocycloalkyl, wherein the 3- to 7-membered heterocycloalkyl is optionally substituted as described elsewhere herein.

(777) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is tetrahydrofuranyl.

(778) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is

(779) ##STR00123##

(780) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is 5- to 10-membered heteroaryl, wherein the 5- to 10-membered heteroaryl is optionally substituted or optionally fused as described elsewhere herein.

(781) In some embodiments, at least one R.sup.6 isopropyl, and at least one R.sup.7 is 5- to 10-membered heteroaryl, wherein the 5- to 10-membered heteroaryl is optionally substituted or optionally fused as described elsewhere herein.

(782) In some embodiments, at least one R.sup.6 isopropyl, and at least one R.sup.7 is pyrazolyl.

(783) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo.

(784) In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is methyl.

(785) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo.

(786) In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is trifluoromethyl.

(787) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is C.sub.3-C.sub.7 cycloalkyl.

(788) In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is cyclopropyl.

(789) In some embodiments, o=1; p=1; R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl.

(790) In some embodiments, o=2; p=1; R.sup.7 is isopropyl; one R.sup.6 is cyclopropyl; and the other R.sup.6 is fluoro.

(791) In some embodiments, o=2; p=2; one R.sup.7 is isopropyl; one R.sup.6 is cyclopropyl; the other R.sup.7 is cyano; and the other R.sup.6 is fluoro.

(792) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is halo.

(793) In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is halo.

(794) In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is chloro.

(795) In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is fluoro.

(796) In some embodiments, o=1; p=1; R.sup.7 is isopropyl; and R.sup.6 is chloro.

(797) In some embodiments, o=2; p=1; at least one R.sup.7 is isopropyl; and at least one R.sup.6 is chloro.

(798) In some embodiments, o=1; p=1; R.sup.7 is isopropyl; and R.sup.6 is fluoro.

(799) In some embodiments, o=2; p=1; R.sup.7 is isopropyl; and at least one R.sup.6 is fluoro.

(800) In some embodiments, o=1; p=2; each R.sup.7 is isopropyl, and R.sup.6 is fluoro.

(801) In some embodiments, o=2; p=2; at least one R.sup.7 is isopropyl; and at least one R.sup.6 is fluoro.

(802) In some embodiments, o=2; p=2; at least one R.sup.7 is isopropyl; one R.sup.6 is fluoro; and the other R.sup.6 is cyano.

(803) In some embodiments, o=2; p=1; R.sup.7 is ethyl; and at least one R.sup.6 is fluoro.

(804) In some embodiments, o=1; p=2; one R.sup.7 is isopropyl; the other R.sup.7 is trifluoromethyl; and R.sup.6 is chloro.

(805) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is cyano.

(806) In some embodiments, at least one R.sup.7 is isopropyl and at least one R.sup.6 is cyano.

(807) In some embodiments, o=1; p=1; R.sup.7 is isopropyl; and R.sup.6 is cyano.

(808) In some embodiments, o=2; p=1; R.sup.7 is isopropyl; and at least one R.sup.6 is cyano.

(809) In some embodiments, at least one R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and at least one R.sup.6 is C.sub.3-C.sub.7 cycloalkyl.

(810) In some embodiments, at least one R.sup.7 is cyclopropyl, and at least one R.sup.6 is cyclopropyl.

(811) In some embodiments, at least one R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and at least one R.sup.6 is halo.

(812) In some embodiments, at least one R.sup.7 is cyclopropyl and at least one R.sup.6 is halo.

(813) In some embodiments, at least one R.sup.7 is cyclopropyl and at least one R.sup.6 is chloro.

(814) In some embodiments, at least one R.sup.7 is cyclopropyl and at least one R.sup.6 is fluoro.

(815) In some embodiments, o=1; p=1; R.sup.7 is cyclopropyl; and R.sup.6 is chloro.

(816) In some embodiments, o=1; p=1; R.sup.7 is cyclopropyl; and R.sup.6 is fluoro.

(817) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo.

(818) In some embodiments, at least one R.sup.7 is isopropyl, and at least one R.sup.6 is C.sub.1-C.sub.6 alkoxy.

(819) In some embodiments, at least one R.sup.7 is isopropyl, and at least one R.sup.6 is methoxy.

(820) In some embodiments, o=1; p=1; R.sup.7 is isopropyl, and R.sup.6 is methoxy.

(821) In some embodiments, o=2; p=1; R.sup.7 is isopropyl, and at least one R.sup.6 is methoxy.

(822) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo.

(823) In some embodiments, at least one R.sup.7 is isopropyl, and at least one R.sup.6 is trifluoromethoxy.

(824) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is C.sub.1-C.sub.6 alkyl (e.g., methyl) substituted with one or more (e.g., one) C.sub.1-C.sub.6 alkoxy (e.g., methoxy).

(825) In some embodiments, at least on R.sup.7 is isopropyl, and at least one R.sup.6 is methoxymethyl.

(826) In some embodiments, o=2; p=1, each R.sup.7 is isopropyl, and R.sup.6 is methoxymethyl.

(827) In some embodiments, at least one R.sup.7 is halo, and at least one R.sup.6 is C.sub.1-C.sub.6 haloalkyl optionally substituted with hydroxy.

(828) In some embodiments, o=1; p=1; R.sup.7 is chloro, and R.sup.6 is trifluoromethyl.

(829) In some embodiments, at least one R.sup.7 is halo, and at least one R.sup.6 is C.sub.1-C.sub.6 haloalkoxy.

(830) In some embodiments, at least one R.sup.7 is chloro, and at least one R.sup.6 is trifluoromethoxy.

(831) In some embodiments, o=1; p=1; R.sup.7 is chloro, and R.sup.6 is trifluoromethoxy.

(832) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy; and at least one R.sup.6 is halo.

(833) In some embodiments, o=1; p=2; at least one R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.

(834) In some embodiments, at least one R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; and at least one R.sup.6 is C.sub.1-C.sub.6 haloalkyl optionally substituted with hydroxy.

(835) In some embodiments, at least one R.sup.7 is cyclopropyl; and at least one R.sup.6 is trifluoromethyl.

(836) In some embodiments, o=2; p=1; R.sup.7 is cyclopropyl; one R.sup.6 is trifluoromethyl; and the other R.sup.6 is fluoro.

(837) In some embodiments, at least one R.sup.6 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.7 is C.sub.6-C.sub.10 aryl, wherein the C.sub.6-C.sub.10 aryl is optionally substituted or optionally fused as described elsewhere herein.

(838) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is C.sub.6-C.sub.10 aryl, wherein the C.sub.6-C.sub.10 aryl is optionally substituted as described elsewhere herein.

(839) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is dichlorophenyl (e.g., 3,4-dichlorophenyl).

(840) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is dimethylphenyl (e.g., 3,4-dimethylphenyl).

(841) In some embodiments, at least one R.sup.6 is isopropyl, and at least one R.sup.7 is naphthyl (e.g., napthyl substituted with one methoxy).

(842) In some embodiments, at least one R.sup.7 is isopropyl, and at least one R.sup.6 is C.sub.6-C.sub.10 aryl, wherein the C.sub.6-C.sub.10 aryl is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen

(843) (e.g., R.sup.7 is

(844) ##STR00124##

(845) In some embodiments, o=2; p=1, each R.sup.7 is isopropyl; and R.sup.6 is C.sub.6-C.sub.10 aryl, wherein the C.sub.6-C.sub.10 aryl is optionally substituted as described elsewhere herein (e.g., R.sup.6 is dimethylphenyl; or R.sup.6 is dichlorophenyl; or R.sup.6 is naphthyl).

(846) In some embodiments, o=2; p=1, each R.sup.7 is isopropyl; and R.sup.6 is C.sub.6-C.sub.10 aryl, wherein the C.sub.6-C.sub.10 aryl is optionally fused to a five-to-seven-membered carbocyclic ring or heterocyclic ring containing one or two heteroatoms independently selected from oxygen, sulfur and nitrogen (e.g., R.sup.7 is

(847) ##STR00125##

(848) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is 3- to 7-membered heterocycloalkyl, wherein the 3- to 7-membered heterocycloalkyl is optionally substituted or optionally fused as described elsewhere herein.

(849) In some embodiments, at least one R.sup.7 is isopropyl, and at least one R.sup.6 is 3- to 7-membered heterocycloalkyl, wherein the 3- to 7-membered heterocycloalkyl is optionally substituted as described elsewhere herein.

(850) In some embodiments, at least one R.sup.7 is isopropyl, and at least one R.sup.6 is tetrahydrofuranyl.

(851) In some embodiments, at least one R.sup.7 is isopropyl, and at least one R.sup.6 is

(852) ##STR00126##

(853) In some embodiments, at least one R.sup.7 is C.sub.1-C.sub.6 alkyl, and at least one R.sup.6 is 5- to 10-membered heteroaryl, wherein the 5- to 10-membered heteroaryl is optionally substituted or optionally fused as described elsewhere herein.

(854) In some embodiments, at least one R.sup.7 isopropyl, and at least one R.sup.6 is 5- to 10-membered heteroaryl, wherein the 5- to 10-membered heteroaryl is optionally substituted or optionally fused as described elsewhere herein.

(855) In some embodiments, at least one R.sup.7 isopropyl, and at least one R.sup.6 is pyrazolyl.

(856) In some embodiments, R.sup.6 and R.sup.7 are each attached to a carbon of an aryl ring B.

(857) In some embodiments, R.sup.6 and R.sup.7 are each attached to a carbon of a heteroaryl ring B.

(858) In some embodiments, R.sup.6 is attached to a carbon and R.sup.7 is attached to a nitrogen of a heteroaryl ring B.

(859) In some embodiments, R.sup.7 is attached to a carbon and R.sup.6 is attached to a nitrogen of a heteroaryl ring B.

(860) In some embodiments, one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5 carbocyclic ring optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(861) In some embodiments, R.sup.6 and Ware on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5 aliphatic carbocyclic ring.

(862) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 carbocyclic ring optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(863) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 aliphatic carbocyclic ring.

(864) In some embodiments, R.sup.6 and Ware on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.6 aromatic carbocyclic ring.

(865) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(866) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

(867) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 5-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

(868) In some embodiments, R.sup.6 and Ware on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(869) In some embodiments, R.sup.6 and Ware on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

(870) In some embodiments, R.sup.6 and R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a 6-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

(871) In some embodiments, one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S,

(872) wherein the ring is fused to the B ring at the ortho- and meta-positions relative to the bond connecting the B ring to the C(R.sup.4R.sup.5) group.

(873) In some embodiments, one R.sup.6 and one R.sup.7 are on adjacent atoms, and taken together with the atoms connecting them, form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S,

(874) wherein the ring is fused to the B ring at the meta- and para-positions relative to the bond connecting the B ring to the C(R.sup.4R.sup.5) group.

(875) In some embodiments, o=2; p=2 or 3; and

(876) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 carbocyclic ring optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(877) In some embodiments, o=2; p=2 or 3; and

(878) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring.

(879) In some embodiments, o=2; p=2 or 3; and

(880) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.6 carbocyclic ring optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(881) In some embodiments, o=2; p=2 or 3; and

(882) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring.

(883) In some embodiments, o=2; p=2 or 3; and

(884) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.6 aromatic carbocyclic ring.

(885) In some embodiments, o=2; p=2 or 3; and

(886) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(887) In some embodiments, o=2; p=2 or 3; and

(888) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

(889) In some embodiments, o=2; p=2 or 3; and

(890) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

(891) In some embodiments, o=2; p=2 or 3; and

(892) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, optionally substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(893) In some embodiments, o=2; p=2 or 3; and

(894) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered aliphatic heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

(895) In some embodiments, o=2; p=2 or 3; and

(896) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered heteroaromatic ring containing 1 or 2 heteroatoms independently selected from O, N, and S.

(897) In some embodiments, o=2; p=2 or 3; and

(898) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them independently form a C.sub.5-C.sub.8 carbocyclic ring or a 5-to-8-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S,

(899) wherein one of the two rings is fused to the B ring at the 2- and 3-positions relative to the bond connecting the B ring to the C(R.sup.4R.sup.5) group, and the other of the two rings is fused to the B ring at the 5- and 6-positions relative to the bond connecting the B ring to the C(R.sup.4R.sup.5) group.

(900) In some embodiments, o=2; p=2; and

(901) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring.

(902) In some embodiments, o=2; p=3; and

(903) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.7 is halo (e.g., Cl or F).

(904) In some embodiments, o=2; p=3; and

(905) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.7 is CN.

(906) In some embodiments, one R.sup.7 is pyrazolyl and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(907) In some embodiments, one R.sup.7 is 3-pyrazolyl and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(908) In some embodiments, one R.sup.7 is 4-pyrazolyl and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(909) In some embodiments, one R.sup.7 is 5-pyrazolyl and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(910) In some embodiments, one R.sup.7 is thiazolyl and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(911) In some embodiments, one R.sup.7 is 4-thiazolyl and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(912) In some embodiments, one R.sup.7 is 5-thiazolyl and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(913) In some embodiments, one R.sup.7 is furyl and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(914) In some embodiments, one R.sup.7 is 2-furyl and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(915) In some embodiments, one R.sup.7 is thiophenyl and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(916) In some embodiments, one R.sup.7 is 2-thiophenyl and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(917) In some embodiments, one R.sup.7 is phenyl and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(918) In some embodiments, one R.sup.7 is naphthyl (e.g., unsubstituted naphthyl or methoxynaphthyl) and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(919) In some embodiments, one R.sup.7 is isochromanyl and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(920) In some embodiments, one R.sup.7 is cycloalkenyl (e.g., cyclopentenyl, e.g., 1-cyclopentenyl) and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(921) In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more C.sub.1-C.sub.6 alkyl (e.g., methyl or propyl, e.g., 2-propyl) optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9 (e.g., dimethylamino), or C.sub.6-C.sub.10 aryl (e.g., phenyl, naphthyl, or methylenedioxyphenyl and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(922) In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy (e.g., methoxy) optionally substituted with one or more hydroxyl, NR.sup.8R.sup.9 (e.g., dimethylamino), or C.sub.6-C.sub.10 aryl (e.g., phenyl, naphthyl, or methylenedioxyphenyl and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(923) In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more C.sub.6-C.sub.10 aryloxy (e.g., phenoxy) and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(924) In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more CN and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(925) In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more halo (e.g., F, Cl) and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(926) In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more COOC.sub.1-C.sub.6 alkyl (e.g., CO.sub.2t-Bu) and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(927) In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more S(O.sub.2)C.sub.1-C.sub.6 alkyl (e.g., S(O.sub.2)methyl) and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(928) In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more 3- to 7-membered heterocycloalkyl (e.g., morpholinyl) and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(929) In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more CONR.sup.8R.sup.9 (e.g., unsubstituted amido) and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(930) In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more C.sub.1-C.sub.6 alkyl (e.g., methyl or propyl, e.g., 2-propyl) and with one or more halo (e.g., F, Cl) and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(931) In some embodiments, one R.sup.7 is phenyl optionally substituted with one or more C.sub.1-C.sub.6 alkyl (e.g., methyl or propyl, e.g., 2-propyl) optionally substituted with one or more (e.g., one) halo (e.g., fluoro) and is para to the bond connecting the B ring to the C(R.sup.4R.sup.5) group of Formula AA.

(932) In some embodiments, R.sup.6 and R.sup.7 are each attached to a carbon of an aryl ring B.

(933) In some embodiments, R.sup.6 and R.sup.7 are each attached to a carbon of a heteroaryl ring B.

(934) In some embodiments, R.sup.6 is attached to a carbon and R.sup.7 is attached to a nitrogen of a heteroaryl ring B.

(935) In some embodiments, R.sup.7 is attached to a carbon and R.sup.6 is attached to a nitrogen of a heteroaryl ring B. In some embodiments, the substituted ring B is

(936) ##STR00127##
and each R.sup.6 is independently selected from the group consisting of: C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl. In some embodiments, the substituted ring B is

(937) ##STR00128##
and each R.sup.6 is independently selected from the group consisting of: C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, and C.sub.3-C.sub.7 cycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, or oxo. In some embodiments, the substituted ring B is

(938) ##STR00129##
and each R.sup.6 is independently selected from the group consisting of: C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl. In some embodiments, the substituted ring B is

(939) ##STR00130##
and each R.sup.6 is independently selected from the group consisting of: C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, and C.sub.3-C.sub.7 cycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, or oxo. In some embodiments, the substituted ring B is

(940) ##STR00131##
wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), 6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form C.sub.4-C.sub.7 carbocyclic ring or 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(941) In some embodiments, the substituted ring B is

(942) ##STR00132##
wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form C.sub.4-C.sub.7 carbocyclic ring or 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.

(943) In some embodiments, the substituted ring B is

(944) ##STR00133##
wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy.

(945) In some embodiments, the substituted ring B is

(946) ##STR00134##
wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form C.sub.4-C.sub.7 carbocyclic ring or 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9. In some embodiments, the substituted ring B is

(947) ##STR00135##
wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy. In some embodiments, the substituted ring B is

(948) ##STR00136##
wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9. In some embodiments, the substituted ring B is

(949) ##STR00137##
wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy;
or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9. In some embodiments, the substituted ring B is

(950) ##STR00138##
wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy; or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form C.sub.4-C.sub.7 carbocyclic ring or 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9. In some embodiments, the substituted ring B is

(951) ##STR00139##
wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy; or R.sup.6 and R.sup.7, taken together with the atoms connecting them, independently form C.sub.4-C.sub.7 carbocyclic ring or 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9. In some embodiments, the substituted ring B is

(952) ##STR00140##
wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy; or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9. In some embodiments, the substituted ring B is

(953) ##STR00141##
wherein each R.sup.6 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CO—C.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, and 4- to 6-membered heterocycloalkyl,
wherein the C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl is optionally substituted with one or more substituents each independently selected from hydroxy, halo, CN, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, CONR.sup.8R.sup.9, 4- to 6-membered heterocycloalkyl, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (4- to 6-membered heterocycloalkyl), NHCOC.sub.1-C.sub.6 alkyl, NHCOC.sub.6-C.sub.10 aryl, NHCO (5- to 10-membered heteroaryl), NHCO (4- to 6-membered heterocycloalkyl), and NHCOC.sub.2-C.sub.6 alkynyl; wherein each R.sup.7 is independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkoxy, halo, CN, COC.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.1-C.sub.6 alkyl, CO.sub.2C.sub.3-C.sub.6 cycloalkyl, OCOC.sub.1-C.sub.6 alkyl, OCOC.sub.6-C.sub.10 aryl, OCO (5- to 10-membered heteroaryl), OCO (3- to 7-membered heterocycloalkyl), C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, CONR.sup.8R.sup.9, SF.sub.5, S(O.sub.2)C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.7 cycloalkyl and 4- to 6-membered heterocycloalkyl, wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one to two C.sub.1-C.sub.6 alkoxy; or at least one pair of R.sup.6 and R.sup.7 on adjacent atoms, taken together with the atoms connecting them, independently form at least one C.sub.4-C.sub.7 carbocyclic ring or at least one 5-to-7-membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from O, N, and S, wherein the carbocyclic ring or heterocyclic ring is optionally independently substituted with one or more substituents independently selected from hydroxy, hydroxymethyl, halo, oxo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, NR.sup.8R.sup.9, CH.sub.2NR.sup.8R.sup.9, ═NR.sup.10, COOC.sub.1-C.sub.6 alkyl, C.sub.6-C.sub.10 aryl, and CONR.sup.8R.sup.9.
The Groups R.sup.4 and R.sup.5

(954) In some embodiments, each of R.sup.4 and R.sup.5 is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl.

(955) In some embodiments, R.sup.4 is hydrogen.

(956) In some embodiments, R.sup.5 is hydrogen.

(957) In some embodiments, each of R.sup.4 and R.sup.5 is hydrogen.

(958) In some embodiments, R.sup.4 is C.sub.1-C.sub.6 alkyl.

(959) In some embodiments, R.sup.5 is C.sub.1-C.sub.6 alkyl.

(960) In some embodiments, each of R.sup.4 and R.sup.5 is C.sub.1-C.sub.6 alkyl,

(961) In some embodiments, R.sup.4 is hydrogen and R.sup.5 is C.sub.1-C.sub.6 alkyl.

(962) In some embodiments, R.sup.4 is hydrogen; R.sup.5 is C.sub.1-C.sub.6 alkyl; and the carbon bonded to R.sup.4 and R.sup.5 has (S) stereochemistry.

(963) In some embodiments, R.sup.4 is hydrogen; and R.sup.5 is C.sub.1-C.sub.6 alkyl; and the carbon bonded to R.sup.4 and R.sup.5 has (R) stereochemistry.

(964) The group R.sup.3

(965) In some embodiments, R.sup.3 is selected from hydrogen, C.sub.1-C.sub.6 alkyl, and

(966) ##STR00142##
wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted by oxo.

(967) In some embodiments, R.sup.3 is hydrogen.

(968) In some embodiments, R.sup.3 is cyano.

(969) In some embodiments, R.sup.3 is hydroxy.

(970) In some embodiments, R.sup.3 is C.sub.1-C.sub.6 alkoxy.

(971) In some embodiments, R.sup.3 is C.sub.1-C.sub.6 alkyl.

(972) In some embodiments, R.sup.3 is methyl.

(973) In some embodiments, R.sup.3 is

(974) ##STR00143##
wherein the C.sub.1-C.sub.2 alkylene group is optionally substituted by oxo.

(975) In some embodiments, R.sup.3 is —CH.sub.2R.sup.14.

(976) In some embodiments, R.sup.3 is —C(O)R.sup.14.

(977) In some embodiments, R.sup.3 is —CH.sub.2CH.sub.2R.sup.14.

(978) In some embodiments, R.sup.3 is —CHR.sup.14CH.sub.3.

(979) In some embodiments, R.sup.3 is —CH.sub.2C(O)R.sup.14.

(980) In some embodiments, R.sup.3 is —C(O)CH.sub.2R.sup.14.

(981) The group R.sup.14

(982) In some embodiments, R.sup.14 is hydrogen, C.sub.1-C.sub.6 alkyl, 5-10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1 or 2 R.sup.6.

(983) In some embodiments, R.sup.14 is hydrogen or C.sub.1-C.sub.6 alkyl.

(984) In some embodiments, R.sup.14 is hydrogen, 5-10-membered monocyclic or bicyclic heteroaryl or C.sub.6-C.sub.10 monocyclic or bicyclic aryl, wherein each C.sub.1-C.sub.6 alkyl, aryl or heteroaryl is optionally independently substituted with 1 or 2 R.sup.6.

(985) In some embodiments, R.sup.14 is hydrogen.

(986) In some embodiments, R.sup.14 is C.sub.1-C.sub.6 alkyl.

(987) In some embodiments, R.sup.14 is methyl.

(988) In some embodiments, R.sup.14 is 5-10-membered monocyclic or bicyclic heteroaryl optionally independently substituted with 1 or 2 R.sup.6.

(989) In some embodiments, R.sup.14 is C.sub.6-C.sub.10 monocyclic or bicyclic aryl optionally independently substituted with 1 or 2 R.sup.6.

(990) The moiety S(═O)(NHR.sup.3)═N—

(991) In some embodiments, the sulfur in the moiety S(═O)(NHR.sup.3)═N— has (S) stereochemistry.

(992) In some embodiments, the sulfur in the moiety S(═O)(NHR.sup.3)═N— has (R) stereochemistry.

(993) The group R.sup.10

(994) In some embodiments, R.sup.10, is C.sub.1-C.sub.6 alkyl.

(995) In some embodiments, R.sup.10, is methyl.

(996) In some embodiments, R.sup.10, is ethyl.

(997) The groups R.sup.8 and R.sup.9

(998) In some embodiments, each of R.sup.8 and R.sup.9 at each occurrence is independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, (C═NR.sup.13)NR.sup.11R.sup.12, S(O.sub.2)C.sub.1-C.sub.6 alkyl, S(O.sub.2)NR.sup.11R.sup.12, COR.sup.13, CO.sub.2R.sup.13 and CONR.sup.11R.sup.12; wherein the C.sub.1-C.sub.6 alkyl is optionally substituted with one or more hydroxy, halo, C.sub.1-C.sub.6 alkoxy, C.sub.6-C.sub.10 aryl, 5- to 10-membered heteroaryl, C.sub.3-C.sub.7 cycloalkyl or 3- to 7-membered heterocycloalkyl; or R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3- to 7-membered ring optionally containing one or more heteroatoms in addition to the nitrogen they are attached to.

(999) In some embodiments, each of R.sup.8 and R.sup.9 at each occurrence is hydrogen,

(1000) In some embodiments, each R.sup.8 at each occurrence is hydrogen and each R.sup.9 at each occurrence is C.sub.1-C.sub.6 alkyl.

(1001) In some embodiments, each R.sup.8 at each occurrence is hydrogen and each R.sup.9 at each occurrence is methyl.

(1002) In some embodiments, each R.sup.8 at each occurrence is hydrogen and each R.sup.9 at each occurrence is ethyl.

(1003) In some embodiments, each of R.sup.8 and R.sup.9 at each occurrence is methyl.

(1004) In some embodiments, each of R.sup.8 and R.sup.9 at each occurrence is ethyl.

(1005) In some embodiments, R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 3-membered ring.

(1006) In some embodiments, R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 4-membered ring.

(1007) In some embodiments, R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 5-membered ring.

(1008) In some embodiments, R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 6-membered ring optionally containing one or more oxygen atoms in addition to the nitrogen they are attached to.

(1009) In some embodiments, R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 6-membered ring optionally containing one or more nitrogen atoms in addition to the nitrogen they are attached to.

(1010) In some embodiments, R.sup.8 and R.sup.9 taken together with the nitrogen they are attached to form a 7-membered ring.

(1011) The Group R.sup.13

(1012) In some embodiments, R.sup.13 is C.sub.1-C.sub.6 alkyl.

(1013) In some embodiments, R.sup.13 is methyl.

(1014) In some embodiments, R.sup.13 is ethyl.

(1015) In some embodiments, R.sup.13 is C.sub.6-C.sub.10 aryl.

(1016) In some embodiments, R.sup.13 is phenyl.

(1017) In some embodiments, R.sup.13 is 5- to 10-membered heteroaryl.

(1018) The Groups R.sup.11 and R.sup.12

(1019) In some embodiments, each of R.sup.11 and R.sup.12 at each occurrence is independently selected from hydrogen and C.sub.1-C.sub.6 alkyl.

(1020) In some embodiments, each of R.sup.11 and R.sup.12 at each occurrence is hydrogen,

(1021) In some embodiments, each R.sup.11 at each occurrence is hydrogen and each R.sup.12 at each occurrence is C.sub.1-C.sub.6 alkyl.

(1022) In some embodiments, each R.sup.11 at each occurrence is hydrogen and each R.sup.12 at each occurrence is methyl.

(1023) In some embodiments, each R.sup.11 at each occurrence is hydrogen and each R.sup.12 at each occurrence is ethyl.

(1024) In some embodiments, each of R.sup.11 and R.sup.12 at each occurrence is methyl.

(1025) In some embodiments, each of R.sup.11 and R.sup.12 at each occurrence is ethyl.

(1026) In some embodiments of the compound of formula AA,

(1027) the substituted ring A is

(1028) ##STR00144##
and R.sup.1 is selected from:

(1029) C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1030) In some embodiments of the compound of formula AA,

(1031) the substituted ring A is

(1032) ##STR00145##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

(1033) In some embodiments of the compound of formula AA,

(1034) the substituted ring A is

(1035) ##STR00146##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1036) In some embodiments of the compound of formula AA,

(1037) the substituted ring A is

(1038) ##STR00147##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

(1039) In some embodiments of the compound of formula AA,

(1040) the substituted ring A is

(1041) ##STR00148##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1042) In some embodiments of the compound of formula AA,

(1043) the substituted ring A is

(1044) ##STR00149##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

(1045) In some embodiments of the compound of formula AA,

(1046) the substituted ring A is

(1047) ##STR00150##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1048) In some embodiments of the compound of formula AA,

(1049) the substituted ring A is

(1050) ##STR00151##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

(1051) In some embodiments of the compound of formula AA,

(1052) the substituted ring A is

(1053) ##STR00152##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1054) In some embodiments of the compound of formula AA,

(1055) the substituted ring A is

(1056) ##STR00153##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

(1057) In some embodiments of the compound of formula AA,

(1058) the substituted ring A is

(1059) ##STR00154##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1060) In some embodiments of the compound of formula AA,

(1061) the substituted ring A is

(1062) ##STR00155##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

(1063) In some embodiments of the compound of formula AA,

(1064) the substituted ring A is

(1065) ##STR00156##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1066) In some embodiments of the compound of formula AA,

(1067) the substituted ring A is

(1068) ##STR00157##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

(1069) In some embodiments of the compound of formula AA,

(1070) the substituted ring A is

(1071) ##STR00158##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1072) In some embodiments of the compound of formula AA,

(1073) the substituted ring A is

(1074) ##STR00159##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

(1075) In some embodiments of the compound of formula AA,

(1076) the substituted ring A is

(1077) ##STR00160##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1078) In some embodiments of the compound of formula AA,

(1079) the substituted ring A is

(1080) ##STR00161##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

(1081) In some embodiments of the compound of formula AA,

(1082) the substituted ring A is

(1083) ##STR00162##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1084) In some embodiments of the compound of formula AA,

(1085) the substituted ring A is

(1086) ##STR00163##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

(1087) In some embodiments of the compound of formula AA,

(1088) the substituted ring A is

(1089) ##STR00164##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1090) In some embodiments of the compound of formula AA,

(1091) the substituted ring A is

(1092) ##STR00165##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

(1093) In some embodiments of the compound of formula AA,

(1094) the substituted ring A is

(1095) ##STR00166##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1096) In some embodiments of the compound of formula AA,

(1097) the substituted ring A is

(1098) ##STR00167##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

(1099) In some embodiments of the compound of formula AA,

(1100) the substituted ring A is

(1101) ##STR00168##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1102) In some embodiments of the compound of formula AA,

(1103) the substituted ring A is

(1104) ##STR00169##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

(1105) In some embodiments of the compound of formula AA,

(1106) the substituted ring A is

(1107) ##STR00170##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1108) In some embodiments of the compound of formula AA,

(1109) the substituted ring A is

(1110) ##STR00171##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

(1111) In some embodiments of the compound of formula AA,

(1112) A is

(1113) ##STR00172##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1114) In some embodiments of the compound of formula AA,

(1115) A is

(1116) ##STR00173##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
A is

(1117) ##STR00174##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1118) In some embodiments of the compound of formula AA,

(1119) A is

(1120) ##STR00175##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
A is

(1121) ##STR00176##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.

(1122) In some embodiments of the compound of formula AA,

(1123) A is

(1124) ##STR00177##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

(1125) In some embodiments of the compound of formula AA,

(1126) A is

(1127) ##STR00178##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.
A is

(1128) ##STR00179##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.
A is

(1129) ##STR00180##
and R.sup.1 is selected from: C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy; 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy; C.sub.1-C.sub.6 alkyl substituted with one or more oxo; C.sub.3-C.sub.7 cycloalkyl substituted with one or more oxo; C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.3-C.sub.7 cycloalkyl substituted with one or more C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 alkyl substituted with one or more NR.sup.8R.sup.9; 3- to 7-membered heterocycloalkyl substituted with one or more NR.sup.8R.sup.9; C.sub.1-C.sub.6 haloalkyl; C.sub.1-C.sub.6 alkoxy; C.sub.1-C.sub.6 haloalkoxy; halo; CN; NO.sub.2; COC.sub.1-C.sub.6 alkyl; CO—C.sub.6-C.sub.10 aryl; CO-5- to 10-membered heteroaryl; CO.sub.2C.sub.1-C.sub.6 alkyl; CO.sub.2C.sub.3-C.sub.8 cycloalkyl; OCOC.sub.1-C.sub.6 alkyl; OCOC.sub.6-C.sub.10 aryl; OCO (5- to 10-membered heteroaryl); OCO (3- to 7-membered heterocycloalkyl); C.sub.6-C.sub.10 aryl; 5- to 10-membered heteroaryl; NH.sub.2; NHC.sub.1-C.sub.6 alkyl; N(C.sub.1-C.sub.6 alkyl).sub.2; CONR.sup.8R.sup.9; SF.sub.5; and S(O.sub.2)C.sub.1-C.sub.6 alkyl.
A is

(1130) ##STR00181##
and R.sup.1 is selected from: 1-hydroxy-2-methylpropan-2-yl; methyl; isopropyl; 2-hydroxy-2-propyl; hydroxymethyl; 1-hydroxyethyl; 2-hydroxyethyl; 1-hydroxy-2-propyl; 1-hydroxy-1-cyclopropyl; 1-hydroxy-1-cyclobutyl; 1-hydroxy-1-cyclopentyl; 1-hydroxy-1-cyclohexyl; morpholinyl; 1,3-dioxolan-2-yl; COCH.sub.3; COCH.sub.2CH.sub.3; 2-methoxy-2-propyl; (dimethylamino)methyl; 1-(dimethylamino)ethyl; fluoro; chloro; phenyl; pyridyl; pyrazolyl; and S(O.sub.2)CH.sub.3.

(1131) In some embodiments of the compound of formula AA,

(1132) A is

(1133) ##STR00182##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; (ii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; (iii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; (iv) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; (v) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (vi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (vii) R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (viii) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (ix) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (x) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; (xi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xiii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; (xiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; (xv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. (xvii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (xviii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xix) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xx) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxi) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xxii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (xxiii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or (xxv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

(1134) In some embodiments of the compound of formula AA,

(1135) the substituted ring A is

(1136) ##STR00183##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; (ii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; (iii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; (iv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; (v) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; (vi) R.sup.1 is hydroxymethyl and R.sup.2 is methyl; (vii) R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; (viii) R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; (ix) R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; (x) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; (xi) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; (xii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; (xiii) R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; (xiv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; (xv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; (xvi) R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; (xvii) R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; (xviii) R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; (xix) R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; (xx) R.sup.1 is morpholinyl, and R.sup.2 is methyl; (xxi) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; (xxii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; (xxiii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; (xxiv) R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; (xxv) R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; (xxvi) R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; (xxvii) R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; (xxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; (xxix) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; (xxx) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; (xxxi) R.sup.2 is hydroxymethyl and R.sup.1 is methyl; (xxxii) R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; (xxxiii) R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; (xxxiv) R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; (xxxv) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; (xxxvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xxxvii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; (xxxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; (xxxix) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; (xl) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; (xli) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; (xlii) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xliii) R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; (xliv) R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; (xlv) R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; (xlvi) R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; (xlvii) R.sup.2 is morpholinyl, and R.sup.1 is methyl; (xlviii) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; (xlix) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; (1) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; (1i) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (lii) R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; (liii) R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or (liv) R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.

(1137) In some embodiments, of the compound of formula AA,

(1138) the substituted ring A is

(1139) ##STR00184##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; (ii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; (iii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; (iv) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; (v) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (vi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (vii) R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (viii) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (ix) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (x) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; (xi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xiii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; (xiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; (xv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. (xvii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (xviii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xix) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xx) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxi) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xxii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (xxiii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or (xxv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

(1140) In some embodiments, of the compound of formula AA,

(1141) the substituted ring A is

(1142) ##STR00185##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; (ii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; (iii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; (iv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; (v) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; (vi) R.sup.1 is hydroxymethyl and R.sup.2 is methyl; (vii) R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; (viii) R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; (ix) R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; (x) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; (xi) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; (xii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; (xiii) R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; (xiv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; (xv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; (xvi) R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; (xvii) R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; (xviii) R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; (xix) R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; (xx) R.sup.1 is morpholinyl, and R.sup.2 is methyl; (xxi) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; (xxii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; (xxiii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; (xxiv) R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; (xxv) R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; (xxvi) R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; (xxvii) R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; (xxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; (xxix) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; (xxx) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; (xxxi) R.sup.2 is hydroxymethyl and R.sup.1 is methyl; (xxxii) R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; (xxxiii) R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; (xxxiv) R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; (xxxv) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; (xxxvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xxxvii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; (xxxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; (xxxix) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; (xl) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; (xli) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; (xlii) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xliii) R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; (xliv) R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; (xlv) R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; (xlvi) R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; (xlvii) R.sup.2 is morpholinyl, and R.sup.1 is methyl; (xlviii) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; (xlix) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; (l) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; (li) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (lii) R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; (liii) R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or (liv) R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.

(1143) In some embodiments, of the compound of formula AA, the substituted ring A is

(1144) ##STR00186##

(1145) and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; (ii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; (iii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; (iv) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; (v) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (vi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (vii) R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (viii) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (ix) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (x) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; (xi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xiii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; (xiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; (xv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. (xvii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (xviii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xix) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xx) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxi) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xxii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (xxiii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or (xxv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

(1146) In some embodiments, of the compound of formula AA,

(1147) the substituted ring A is

(1148) ##STR00187##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; (ii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; (iii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; (iv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; (v) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; (vi) R.sup.1 is hydroxymethyl and R.sup.2 is methyl; (vii) R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; (viii) R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; (ix) R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; (x) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; (xi) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; (xii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; (xiii) R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; (xiv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; (xv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; (xvi) R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; (xvii) R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; (xviii) R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; (xix) R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; (xx) R.sup.1 is morpholinyl, and R.sup.2 is methyl; (xxi) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; (xxii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; (xxiii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; (xxiv) R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; (xxv) R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; (xxvi) R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; (xxvii) R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; (xxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; (xxix) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; (xxx) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; (xxxi) R.sup.2 is hydroxymethyl and R.sup.1 is methyl; (xxxii) R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; (xxxiii) R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; (xxxiv) R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; (xxxv) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; (xxxvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xxxvii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; (xxxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; (xxxix) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; (xl) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; (xli) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; (xlii) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xliii) R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; (xliv) R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; (xlv) R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; (xlvi) R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; (xlvii) R.sup.2 is morpholinyl, and R.sup.1 is methyl; (xlviii) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; (xlix) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; (l) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; (li) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (lii) R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; (liii) R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or (liv) R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.

(1149) In some embodiments, of the compound of formula AA,

(1150) the substituted ring A is

(1151) ##STR00188##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; (ii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; (iii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; (iv) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; (v) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (vi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (vii) R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (viii) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (ix) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (x) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; (xi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xiii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; (xiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; (xv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. (xvii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (xviii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xix) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xx) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxi) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xxii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (xxiii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or (xxv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

(1152) In some embodiments, of the compound of formula AA,

(1153) the substituted ring A is

(1154) ##STR00189##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; (ii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; (iii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; (iv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; (v) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; (vi) R.sup.1 is hydroxymethyl and R.sup.2 is methyl; (vii) R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; (viii) R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; (ix) R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; (x) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; (xi) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; (xii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; (xiii) R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; (xiv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; (xv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; (xvi) R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; (xvii) R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; (xviii) R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; (xix) R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; (xx) R.sup.1 is morpholinyl, and R.sup.2 is methyl; (xxi) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; (xxii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; (xxiii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; (xxiv) R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; (xxv) R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; (xxvi) R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; (xxvii) R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; (xxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; (xxix) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; (xxx) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; (xxxi) R.sup.2 is hydroxymethyl and R.sup.1 is methyl; (xxxii) R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; (xxxiii) R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; (xxxiv) R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; (xxxv) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; (xxxvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xxxvii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; (xxxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; (xxxix) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; (xl) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; (xli) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; (xlii) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xliii) R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; (xliv) R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; (xlv) R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; (xlvi) R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; (xlvii) R.sup.2 is morpholinyl, and R.sup.1 is methyl; (xlviii) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; (xlix) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; (l) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; (li) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (lii) R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; (liii) R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or (liv) R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.

(1155) In some embodiments, of the compound of formula AA,

(1156) the substituted ring A is

(1157) ##STR00190##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; (ii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; (iii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; (iv) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; (v) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (vi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (vii) R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (viii) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (ix) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (x) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; (xi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xiii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; (xiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; (xv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. (xvii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (xviii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xix) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xx) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxi) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xxii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (xxiii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or (xxv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

(1158) In some embodiments, of the compound of formula AA,

(1159) the substituted ring A is

(1160) ##STR00191##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; (ii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; (iii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; (iv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; (v) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; (vi) R.sup.1 is hydroxymethyl and R.sup.2 is methyl; (vii) R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; (viii) R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; (ix) R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; (x) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; (xi) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; (xii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; (xiii) R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; (xiv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; (xv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; (xvi) R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; (xvii) R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; (xviii) R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; (xix) R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; (xx) R.sup.1 is morpholinyl, and R.sup.2 is methyl; (xxi) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; (xxii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; (xxiii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; (xxiv) R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; (xxv) R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; (xxvi) R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; (xxvii) R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; (xxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; (xxix) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; (xxx) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; (xxxi) R.sup.2 is hydroxymethyl and R.sup.1 is methyl; (xxxii) R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; (xxxiii) R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; (xxxiv) R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; (xxxv) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; (xxxvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xxxvii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; (xxxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; (xxxix) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; (xl) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; (xli) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; (xlii) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xliii) R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; (xliv) R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; (xlv) R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; (xlvi) R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; (xlvii) R.sup.2 is morpholinyl, and R.sup.1 is methyl; (xlviii) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; (xlix) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; (l) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; (li) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (lii) R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; (liii) R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or (liv) R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.

(1161) In some embodiments, of the compound of formula AA,

(1162) the substituted ring A is

(1163) ##STR00192##
and R.sup.1 and R.sup.2 are one of the following combinations:

(1164) (i) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; (ii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; (iii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; (iv) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; (v) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (vi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (vii) R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (viii) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (ix) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (x) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; (xi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xiii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; (xiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; (xv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. (xvii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (xviii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xix) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xx) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxi) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xxii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (xxiii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxv) or (xxvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

(1165) In some embodiments, of the compound of formula AA,

(1166) the substituted ring A is

(1167) ##STR00193##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; (ii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; (iii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; (iv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; (v) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; (vi) R.sup.1 is hydroxymethyl and R.sup.2 is methyl; (vii) R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; (viii) R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; (ix) R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; (x) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; (xi) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; (xii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; (xiii) R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; (xiv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; (xv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; (xvi) R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; (xvii) R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; (xviii) R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; (xix) R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; (xx) R.sup.1 is morpholinyl, and R.sup.2 is methyl; (xxi) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; (xxii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; (xxiii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; (xxiv) R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; (xxv) R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; (xxvi) R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; (xxvii) R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; (xxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; (xxix) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; (xxx) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; (xxxi) R.sup.2 is hydroxymethyl and R.sup.1 is methyl; (xxxii) R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; (xxxiii) R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; (xxxiv) R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; (xxxv) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; (xxxvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xxxvii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; (xxxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; (xxxix) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; (xl) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; (xli) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; (xlii) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xliii) R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; (xliv) R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; (xlv) R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; (xlvi) R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; (xlvii) R.sup.2 is morpholinyl, and R.sup.1 is methyl; (xlviii) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; (xlix) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; (l) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; (li) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (lii) R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; (liii) R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or (liv) R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.

(1168) In some embodiments, of the compound of formula AA,

(1169) the substituted ring A is

(1170) ##STR00194##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; (ii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; (iii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; (iv) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; (v) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (vi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (vii) R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (viii) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (ix) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (x) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; (xi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xiii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; (xiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; (xv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5; (xvii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (xviii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xix) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xx) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxi) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xxii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (xxiii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or (xxv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

(1171) In some embodiments, of the compound of formula AA,

(1172) the substituted ring A is

(1173) ##STR00195##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; (ii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; (iii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; (iv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; (v) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; (vi) R.sup.1 is hydroxymethyl and R.sup.2 is methyl; (vii) R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; (viii) R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; (ix) R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; (x) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; (xi) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; (xii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; (xiii) R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; (xiv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; (xv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; (xvi) R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; (xvii) R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; (xviii) R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; (xix) R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; (xx) R.sup.1 is morpholinyl, and R.sup.2 is methyl; (xxi) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; (xxii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; (xxiii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; (xxiv) R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; (xxv) R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; (xxvi) R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; (xxvii) R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; (xxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; (xxix) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; (xxx) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; (xxxi) R.sup.2 is hydroxymethyl and R.sup.1 is methyl; (xxxii) R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; (xxxiii) R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; (xxxiv) R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; (xxxv) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; (xxxvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xxxvii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; (xxxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; (xxxix) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; (xl) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; (xli) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; (xlii) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xliii) R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; (xliv) R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; (xlv) R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; (xlvi) R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; (xlvii) R.sup.2 is morpholinyl, and R.sup.1 is methyl; (xlviii) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; (xlix) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; (l) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; (li) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (lii) R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; (liii) R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or (liv) R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.

(1174) In some embodiments, of the compound of formula AA,

(1175) the substituted ring A is

(1176) ##STR00196##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; (ii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; (iii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; (iv) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; (v) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (vi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (vii) R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (viii) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (ix) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (x) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; (xi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xiii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; (xiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; (xv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. (xvii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (xviii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xix) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xx) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxi) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xxii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (xxiii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or (xxv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

(1177) In some embodiments, of the compound of formula AA,

(1178) the substituted ring A is

(1179) ##STR00197##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; (ii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; (iii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; (iv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; (v) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; (vi) R.sup.1 is hydroxymethyl and R.sup.2 is methyl; (vii) R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; (viii) R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; (ix) R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; (x) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; (xi) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; (xii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; (xiii) R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; (xiv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; (xv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; (xvi) R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; (xvii) R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; (xviii) R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; (xix) R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; (xx) R.sup.1 is morpholinyl, and R.sup.2 is methyl; (xxi) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; (xxii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; (xxiii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; (xxiv) R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; (xxv) R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; (xxvi) R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; (xxvii) R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; (xxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; (xxix) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; (xxx) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; (xxxi) R.sup.2 is hydroxymethyl and R.sup.1 is methyl; (xxxii) R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; (xxxiii) R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; (xxxiv) R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; (xxxv) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; (xxxvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xxxvii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; (xxxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; (xxxix) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; (xl) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; (xli) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; (xlii) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xliii) R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; (xliv) R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; (xlv) R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; (xlvi) R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; (xlvii) R.sup.2 is morpholinyl, and R.sup.1 is methyl; (xlviii) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; (xlix) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; (l) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; (li) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (lii) R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; (liii) R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or (liv) R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.

(1180) In some embodiments, of the compound of formula AA,

(1181) the substituted ring A is

(1182) ##STR00198##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; (ii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; (iii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; (iv) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; (v) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (vi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (vii) R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (viii) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (ix) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (x) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; (xi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xiii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; (xiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; (xv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. (xvii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (xviii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xix) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xx) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxi) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xxii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (xxiii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or (xxv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

(1183) In some embodiments, of the compound of formula AA,

(1184) the substituted ring A is

(1185) ##STR00199##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; (ii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; (iii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; (iv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; (v) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; (vi) R.sup.1 is hydroxymethyl and R.sup.2 is methyl; (vii) R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; (viii) R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; (ix) R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; (x) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; (xi) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; (xii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; (xiii) R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; (xiv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; (xv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; (xvi) R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; (xvii) R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; (xviii) R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; (xix) R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; (xx) R.sup.1 is morpholinyl, and R.sup.2 is methyl; (xxi) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; (xxii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; (xxiii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; (xxiv) R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; (xxv) R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; (xxvi) R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; (xxvii) R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; (xxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; (xxix) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; (xxx) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; (xxxi) R.sup.2 is hydroxymethyl and R.sup.1 is methyl; (xxxii) R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; (xxxiii) R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; (xxxiv) R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; (xxxv) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; (xxxvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xxxvii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; (xxxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; (xxxix) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; (xl) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; (xli) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; (xlii) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xliii) R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; (xliv) R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; (xlv) R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; (xlvi) R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; (xlvii) R.sup.2 is morpholinyl, and R.sup.1 is methyl; (xlviii) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; (xlix) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; (l) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; (li) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (lii) R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; (liii) R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or (liv) R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.

(1186) In some embodiments, of the compound of formula AA,

(1187) the substituted ring A is

(1188) ##STR00200##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; (ii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; (iii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; (iv) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; (v) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (vi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (vii) R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (viii) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (ix) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (x) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; (xi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xiii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; (xiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; (xv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. (xvii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (xviii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xix) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xx) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxi) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xxii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (xxiii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or (xxv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

(1189) In some embodiments, of the compound of formula AA,

(1190) the substituted ring A is

(1191) ##STR00201##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; (ii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; (iii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; (iv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; (v) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; (vi) R.sup.1 is hydroxymethyl and R.sup.2 is methyl; (vii) R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; (viii) R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; (ix) R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; (x) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; (xi) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; (xii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; (xiii) R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; (xiv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; (xv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; (xvi) R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; (xvii) R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; (xviii) R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; (xix) R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; (xx) R.sup.1 is morpholinyl, and R.sup.2 is methyl; (xxi) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; (xxii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; (xxiii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; (xxiv) R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; (xxv) R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; (xxvi) R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; (xxvii) R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; (xxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; (xxix) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; (xxx) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; (xxxi) R.sup.2 is hydroxymethyl and R.sup.1 is methyl; (xxxii) R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; (xxxiii) R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; (xxxiv) R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; (xxxv) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; (xxxvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xxxvii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; (xxxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; (xxxix) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; (xl) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; (xli) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; (xlii) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xliii) R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; (xliv) R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; (xlv) R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; (xlvi) R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; (xlvii) R.sup.2 is morpholinyl, and R.sup.1 is methyl; (xlviii) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; (xlix) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; (l) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; (li) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (lii) R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; (liii) R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or (liv) R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.

(1192) In some embodiments, of the compound of formula AA,

(1193) the substituted ring A is

(1194) ##STR00202##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; (ii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; (iii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; (iv) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; (v) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (vi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (vii) R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (viii) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (ix) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (x) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; (xi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xiii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; (xiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; (xv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. (xvii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (xviii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xix) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xx) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxi) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xxii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (xxiii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or (xxv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

(1195) In some embodiments, of the compound of formula AA,

(1196) the substituted ring A is

(1197) ##STR00203##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; (ii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; (iii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; (iv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; (v) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; (vi) R.sup.1 is hydroxymethyl and R.sup.2 is methyl; (vii) R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; (viii) R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; (ix) R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; (x) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; (xi) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; (xii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; (xiii) R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; (xiv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; (xv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; (xvi) R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; (xvii) R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; (xviii) R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; (xix) R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; (xx) R.sup.1 is morpholinyl, and R.sup.2 is methyl; (xxi) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; (xxii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; (xxiii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; (xxiv) R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; (xxv) R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; (xxvi) R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; (xxvii) R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; (xxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; (xxix) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; (xxx) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; (xxxi) R.sup.2 is hydroxymethyl and R.sup.1 is methyl; (xxxii) R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; (xxxiii) R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; (xxxiv) R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; (xxxv) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; (xxxvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xxxvii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; (xxxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; (xxxix) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; (xl) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; (xli) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; (xlii) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xliii) R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; (xliv) R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; (xlv) R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; (xlvi) R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; (xlvii) R.sup.2 is morpholinyl, and R.sup.1 is methyl; (xlviii) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; (xlix) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; (l) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; (li) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (lii) R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; (liii) R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or (liv) R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.

(1198) In some embodiments, of the compound of formula AA,

(1199) the substituted ring A is

(1200) ##STR00204##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; (ii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; (iii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; (iv) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; (v) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (vi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (vii) R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (viii) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (ix) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (x) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; (xi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xiii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; (xiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; (xv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. (xvii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (xviii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xix) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xx) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxi) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xxii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (xxiii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or (xxv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

(1201) In some embodiments, of the compound of formula AA,

(1202) the substituted ring A is

(1203) ##STR00205##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; (ii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; (iii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; (iv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; (v) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; (vi) R.sup.1 is hydroxymethyl and R.sup.2 is methyl; (vii) R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; (viii) R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; (ix) R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; (x) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; (xi) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; (xii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; (xiii) R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; (xiv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; (xv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; (xvi) R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; (xvii) R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; (xviii) R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; (xix) R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; (xx) R.sup.1 is morpholinyl, and R.sup.2 is methyl; (xxi) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; (xxii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; (xxiii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; (xxiv) R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; (xxv) R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; (xxvi) R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; (xxvii) R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; (xxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; (xxix) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; (xxx) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; (xxxi) R.sup.2 is hydroxymethyl and R.sup.1 is methyl; (xxxii) R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; (xxxiii) R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; (xxxiv) R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; (xxxv) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; (xxxvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xxxvii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; (xxxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; (xxxix) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; (xl) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; (xli) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; (xlii) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xliii) R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; (xliv) R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; (xlv) R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; (xlvi) R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; (xlvii) R.sup.2 is morpholinyl, and R.sup.1 is methyl; (xlviii) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; (xlix) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; (l) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; (li) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (lii) R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; (liii) R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or (liv) R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.

(1204) In some embodiments, of the compound of formula AA,

(1205) the substituted ring A is

(1206) ##STR00206##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; (ii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; (iii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; (iv) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; (v) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (vi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (vii) R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (viii) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (ix) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (x) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; (xi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xiii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; (xiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; (xv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. (xvii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (xviii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xix) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xx) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxi) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xxii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (xxiii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or (xxv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

(1207) In some embodiments, of the compound of formula AA,

(1208) the substituted ring A is

(1209) ##STR00207##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; (ii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; (iii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; (iv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; (v) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; (vi) R.sup.1 is hydroxymethyl and R.sup.2 is methyl; (vii) R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; (viii) R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; (ix) R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; (x) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; (xi) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; (xii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; (xiii) R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; (xiv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; (xv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; (xvi) R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; (xvii) R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; (xviii) R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; (xix) R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; (xx) R.sup.1 is morpholinyl, and R.sup.2 is methyl; (xxi) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; (xxii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; (xxiii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; (xxiv) R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; (xxv) R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; (xxvi) R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; (xxvii) R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; (xxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; (xxix) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; (xxx) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; (xxxi) R.sup.2 is hydroxymethyl and R.sup.1 is methyl; (xxxii) R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; (xxxiii) R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; (xxxiv) R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; (xxxv) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; (xxxvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xxxvii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; (xxxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; (xxxix) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; (xl) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; (xli) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; (xlii) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xliii) R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; (xliv) R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; (xlv) R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; (xlvi) R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; (xlvii) R.sup.2 is morpholinyl, and R.sup.1 is methyl; (xlviii) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; (xlix) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; (l) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; (li) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (lii) R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; (liii) R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or (liv) R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.

(1210) In some embodiments, of the compound of formula AA,

(1211) the substituted ring A is

(1212) ##STR00208##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy; (ii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.6-C.sub.10 aryl; (iii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is 5- to 10-membered heteroaryl; (iv) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is SF.sub.5; (v) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (vi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (vii) R.sup.1 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (viii) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (ix) R.sup.1 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.2 is halo; (x) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.2 is methyl; (xi) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is C.sub.1-C.sub.6 alkyl; (xiii) R.sup.1 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.2 is halo; (xiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.6-C.sub.10 aryl; (xv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is SF.sub.5. (xvii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)C.sub.1-C.sub.6 alkyl; (xviii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xix) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xx) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxi) R.sup.2 is 3- to 7-membered heterocycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is halo; (xxii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (xxiii) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more C.sub.1-C.sub.6 alkoxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xxiv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is C.sub.1-C.sub.6 alkyl; or (xxv) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more NR.sup.8R.sup.9, and R.sup.1 is halo.

(1213) In some embodiments, of the compound of formula AA,

(1214) the substituted ring A is

(1215) ##STR00209##
and R.sup.1 and R.sup.2 are one of the following combinations: (i) R.sup.1 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.2 is methyl; (ii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is methyl; (iii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is isopropyl; (iv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 2-hydroxy-2-propyl; (v) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is 1-hydroxyethyl; (vi) R.sup.1 is hydroxymethyl and R.sup.2 is methyl; (vii) R.sup.1 is 1-hydroxyethyl and R.sup.2 is methyl; (viii) R.sup.1 is 2-hydroxyethyl and R.sup.2 is methyl; (ix) R.sup.1 is 1-hydroxy-2-propyl and R.sup.2 is methyl; (x) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is phenyl; (xi) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyridyl; (xii) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is pyrazolyl; (xiii) R.sup.1 is 2-hydroxy-2-propyl, and R.sup.2 is S(O.sub.2)CH.sub.3; (xiv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is chloro; (xv) R.sup.1 is 2-hydroxy-2-propyl and R.sup.2 is fluoro; (xvi) R.sup.1 is 1-hydroxy-1-cyclopropyl, and R.sup.2 is methyl; (xvii) R.sup.1 is 1-hydroxy-1-cyclobutyl, and R.sup.2 is methyl; (xviii) R.sup.1 is 1-hydroxy-1-cyclopentyl, and R.sup.2 is methyl; (xix) R.sup.1 is 1-hydroxy-1-cyclohexyl, and R.sup.2 is methyl; (xx) R.sup.1 is morpholinyl, and R.sup.2 is methyl; (xxi) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is methyl; (xxii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is fluoro; (xxiii) R.sup.1 is 1,3-dioxolan-2-yl, and R.sup.2 is chloro; (xxiv) R.sup.1 is COCH.sub.3, and R.sup.2 is methyl; (xxv) R.sup.1 is 2-methoxy-2-propyl, and R.sup.2 is methyl; (xxvi) R.sup.1 is (dimethylamino)methyl, and R.sup.2 is methyl; (xxvii) R.sup.2 is 1-hydroxy-2-methylpropan-2-yl, and R.sup.1 is methyl; (xxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is methyl; (xxix) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is isopropyl; (xxx) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is 1-hydroxyethyl; (xxxi) R.sup.2 is hydroxymethyl and R.sup.1 is methyl; (xxxii) R.sup.2 is 1-hydroxyethyl and R.sup.1 is methyl; (xxxiii) R.sup.2 is 2-hydroxyethyl and R.sup.1 is methyl; (xxxiv) R.sup.2 is 1-hydroxy-2-propyl and R.sup.1 is methyl; (xxxv) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is phenyl; (xxxvi) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is 5- to 10-membered heteroaryl; (xxxvii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyridyl; (xxxviii) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is pyrazolyl; (xxxix) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more hydroxy, and R.sup.1 is S(O.sub.2)CH.sub.3; (xl) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is chloro; (xli) R.sup.2 is 2-hydroxy-2-propyl and R.sup.1 is fluoro; (xlii) R.sup.2 is C.sub.3-C.sub.7 cycloalkyl optionally substituted with one or more hydroxy, and R.sup.1 is C.sub.1-C.sub.6 alkyl; (xliii) R.sup.2 is 1-hydroxy-1-cyclopropyl, and R.sup.1 is methyl; (xliv) R.sup.2 is 1-hydroxy-1-cyclobutyl, and R.sup.1 is methyl; (xlv) R.sup.2 is 1-hydroxy-1-cyclopentyl, and R.sup.1 is methyl; (xlvi) R.sup.2 is 1-hydroxy-1-cyclohexyl, and R.sup.1 is methyl; (xlvii) R.sup.2 is morpholinyl, and R.sup.1 is methyl; (xlviii) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is methyl; (xlix) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is fluoro; (l) R.sup.2 is 1,3-dioxolan-2-yl, and R.sup.1 is chloro; (li) R.sup.2 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more oxo, and R.sup.1 is methyl; (lii) R.sup.2 is COCH.sub.3, and R.sup.1 is methyl; (liii) R.sup.2 is 2-methoxy-2-propyl, and R.sup.1 is methyl; or (liv) R.sup.2 is (dimethylamino)methyl, and R.sup.1 is methyl.

(1216) In some embodiments of the compound of formula AA,

(1217) the substituted ring B is

(1218) ##STR00210##
and R.sup.6 is selected from: C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl substituted with one or more halo, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkoxy substituted with one or more halo, C.sub.3-C.sub.7 cycloalkyl, halo, and cyano.

(1219) In some embodiments of the compound of formula AA,

(1220) the substituted ring B is

(1221) ##STR00211##
and R.sup.6 is selected from: isopropyl, ethyl, methyl, trifluoromethyl, trifluoromethoxy, cyclopropyl, halo, chloro, and fluoro.

(1222) In some embodiments of the compound of formula AA,

(1223) the substituted ring B is

(1224) ##STR00212##
and R.sup.6 is selected from: C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl substituted with one or more halo, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkoxy substituted with one or more halo, C.sub.3-C.sub.7 cycloalkyl, halo, and cyano.

(1225) In some embodiments of the compound of formula AA,

(1226) the substituted ring B is

(1227) ##STR00213##
and R.sup.6 is selected from: isopropyl, ethyl, methyl, trifluoromethyl, trifluoromethoxy, cyclopropyl, halo, chloro, and fluoro.

(1228) In some embodiments of the compound of formula AA,

(1229) the substituted ring B is

(1230) ##STR00214##
and R.sup.6 is selected from: C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl substituted with one or more halo, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkoxy substituted with one or more halo, C.sub.3-C.sub.7 cycloalkyl, halo, and cyano.

(1231) In some embodiments of the compound of formula AA,

(1232) the substituted ring B is

(1233) ##STR00215##
and R.sup.6 is selected from: isopropyl, ethyl, methyl, trifluoromethyl, trifluoromethoxy, cyclopropyl, halo, chloro, and fluoro.

(1234) In some embodiments of the compound of formula AA,

(1235) the substituted ring B is

(1236) ##STR00216##
and R.sup.6 is selected from: C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl substituted with one or more halo, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkoxy substituted with one or more halo, C.sub.3-C.sub.7 cycloalkyl, halo, and cyano.

(1237) In some embodiments of the compound of formula AA,

(1238) the substituted ring B is

(1239) ##STR00217##
and R.sup.6 is selected from: isopropyl, ethyl, methyl, trifluoromethyl, trifluoromethoxy, cyclopropyl, halo, chloro, and fluoro.

(1240) In some embodiments of the compound of formula AA,

(1241) the substituted ring B is

(1242) ##STR00218##
and R.sup.6 is selected from: C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkyl substituted with one or more halo, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 alkoxy substituted with one or more halo, C.sub.3-C.sub.7 cycloalkyl, halo, and cyano.

(1243) In some embodiments of the compound of formula AA,

(1244) the substituted ring B is

(1245) ##STR00219##
and R.sup.6 is selected from: isopropyl, ethyl, methyl, trifluoromethyl, trifluoromethoxy, cyclopropyl, halo, chloro, and fluoro.

(1246) In some embodiments, of the compound of formula AA,

(1247) the substituted ring B is

(1248) ##STR00220##
and the two R.sup.6 are one of the following combinations: One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; One R.sup.6 is C.sub.1-C.sub.6 alkyl and the other R.sup.6 is C.sub.1-C.sub.6 alkyl; One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is halo; One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is cyano; One R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and the other R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; One R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and the other R.sup.6 is halo; One R.sup.6 is cyclopropyl and the other R.sup.6 is halo; One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.1-C.sub.6 alkoxy; One R.sup.6 is C.sub.1-C.sub.6 alkyl, and the other R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; One R.sup.6 is halo, and the other R.sup.6 is C.sub.1-C.sub.6 haloalkyl; One R.sup.6 is halo, and the other R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; One R.sup.6 is C.sub.1-C.sub.6 alkoxy; and the other R.sup.6 is halo; One R.sup.6 is C.sub.1-C.sub.6 alkoxy; and the other R.sup.6 is chloro.

(1249) In some embodiments, of the compound of formula AA,

(1250) the substituted ring B is

(1251) ##STR00221##
and the two R.sup.6 are one of the following combinations: One R.sup.6 is isopropyl; and the other R.sup.6 is methyl; One R.sup.6 is isopropyl; and the other R.sup.6 is n-propyl; One R.sup.6 is isopropyl; and the other R.sup.6 is isopropyl; One R.sup.6 is isopropyl; and the other R.sup.6 is trifluoromethyl; One R.sup.6 is isopropyl; and the other R.sup.6 is cyclopropyl; One R.sup.6 is isopropyl; and the other R.sup.6 is chloro; One R.sup.6 is isopropyl; and the other R.sup.6 is fluoro; One R.sup.6 is ethyl; and the other R.sup.6 is fluoro; One R.sup.6 is isopropyl; and the other R.sup.6 is cyano; One R.sup.6 is cyclopropyl; and the other R.sup.6 is cyclopropyl; One R.sup.6 is cyclopropyl; and the other R.sup.6 is chloro; One R.sup.6 is cyclopropyl; and the other R.sup.6 is fluoro; One R.sup.6 is isopropyl; and the other R.sup.6 is methoxy; One R.sup.6 is isopropyl; and the other R.sup.6 is trifluoromethoxy.

(1252) In some embodiments, of the compound of formula AA,

(1253) the substituted ring B is

(1254) ##STR00222##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; R.sup.6 is cyclopropyl and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro;

(1255) In some embodiments, of the compound of formula AA,

(1256) the substituted ring B is

(1257) ##STR00223##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is isopropyl; and R.sup.7 is methyl; R.sup.6 is isopropyl; and R.sup.7 is isopropyl; R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; R.sup.6 is isopropyl; and R.sup.7 is chloro; R.sup.6 is isopropyl; and R.sup.7 is fluoro; R.sup.6 is ethyl; and R.sup.7 is fluoro; R.sup.6 is isopropyl; and R.sup.7 is cyano; R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; R.sup.6 is cyclopropyl; and R.sup.7 is chloro; R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; R.sup.6 is isopropyl; and R.sup.7 is methoxy; R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; R.sup.7 is isopropyl; and R.sup.6 is methyl; R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; R.sup.7 is isopropyl; and R.sup.6 is chloro; R.sup.7 is ethyl; and R.sup.6 is fluoro; R.sup.7 is isopropyl; and R.sup.6 is cyano; R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; R.sup.7 is cyclopropyl; and R.sup.6 is chloro; R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; R.sup.7 is isopropyl; and R.sup.6 is methoxy; R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy.

(1258) In some embodiments, of the compound of formula AA,

(1259) the substituted ring B is

(1260) ##STR00224##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; R.sup.6 is cyclopropyl and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.

(1261) In some embodiments, of the compound of formula AA,

(1262) the substituted ring B is

(1263) ##STR00225##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is isopropyl; and R.sup.7 is methyl; R.sup.6 is isopropyl; and R.sup.7 is isopropyl; R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; R.sup.6 is isopropyl; and R.sup.7 is chloro; R.sup.6 is isopropyl; and R.sup.7 is fluoro; R.sup.6 is ethyl; and R.sup.7 is fluoro; R.sup.6 is isopropyl; and R.sup.7 is cyano; R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; R.sup.6 is cyclopropyl; and R.sup.7 is chloro; R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; R.sup.6 is isopropyl; and R.sup.7 is methoxy; R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; R.sup.7 is isopropyl; and R.sup.6 is methyl; R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; R.sup.7 is isopropyl; and R.sup.6 is chloro; R.sup.7 is ethyl; and R.sup.6 is fluoro; R.sup.7 is isopropyl; and R.sup.6 is cyano; R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; R.sup.7 is cyclopropyl; and R.sup.6 is chloro; R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; R.sup.7 is isopropyl; and R.sup.6 is methoxy; R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy.

(1264) In some embodiments, of the compound of formula AA,

(1265) the substituted ring B is

(1266) ##STR00226##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; R.sup.6 is cyclopropyl and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; or R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl.

(1267) In some embodiments, of the compound of formula AA,

(1268) the substituted ring B is

(1269) ##STR00227##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is isopropyl; and R.sup.7 is methyl; R.sup.6 is isopropyl; and R.sup.7 is isopropyl; R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; R.sup.6 is isopropyl; and R.sup.7 is chloro; R.sup.6 is isopropyl; and R.sup.7 is fluoro; R.sup.6 is ethyl; and R.sup.7 is fluoro; R.sup.6 is isopropyl; and R.sup.7 is cyano; R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; R.sup.6 is cyclopropyl; and R.sup.7 is chloro; R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; R.sup.6 is isopropyl; and R.sup.7 is methoxy; R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; R.sup.7 is isopropyl; and R.sup.6 is methyl; R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; R.sup.7 is isopropyl; and R.sup.6 is chloro; R.sup.7 is ethyl; and R.sup.6 is fluoro; R.sup.7 is isopropyl; and R.sup.6 is cyano; R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; R.sup.7 is cyclopropyl; and R.sup.6 is chloro; R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; R.sup.7 is isopropyl; and R.sup.6 is methoxy; R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatoms independently selected from O, N, and S; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatoms independently selected from O, N, and S; or R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring.

(1270) In some embodiments, of the compound of formula AA,

(1271) the substituted ring B is

(1272) ##STR00228##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; R.sup.6 is cyclopropyl and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; or R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl.

(1273) In some embodiments, of the compound of formula AA,

(1274) the substituted ring B is

(1275) ##STR00229##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is isopropyl; and R.sup.7 is methyl; R.sup.6 is isopropyl; and R.sup.7 is isopropyl; R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; R.sup.6 is isopropyl; and R.sup.7 is chloro; R.sup.6 is isopropyl; and R.sup.7 is fluoro; R.sup.6 is ethyl; and R.sup.7 is fluoro; R.sup.6 is isopropyl; and R.sup.7 is cyano; R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; R.sup.6 is cyclopropyl; and R.sup.7 is chloro; R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; R.sup.6 is isopropyl; and R.sup.7 is methoxy; R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; R.sup.7 is isopropyl; and R.sup.6 is methyl; R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; R.sup.7 is isopropyl; and R.sup.6 is chloro; R.sup.7 is ethyl; and R.sup.6 is fluoro; R.sup.7 is isopropyl; and R.sup.6 is cyano; R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; R.sup.7 is cyclopropyl; and R.sup.6 is chloro; R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; R.sup.7 is isopropyl; and R.sup.6 is methoxy; R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatoms independently selected from O, N, and S; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatoms independently selected from O, N, and S; or R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring.

(1276) In some embodiments, of the compound of formula AA,

(1277) the substituted ring B is

(1278) ##STR00230##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; R.sup.6 is cyclopropyl and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; R.sup.6 is C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; R.sup.6 is halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; R.sup.7 is halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.

(1279) In some embodiments, of the compound of formula AA,

(1280) the substituted ring B is

(1281) ##STR00231##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is isopropyl; and R.sup.7 is methyl; R.sup.6 is isopropyl; and R.sup.7 is isopropyl; R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; R.sup.6 is isopropyl; and R.sup.7 is chloro; R.sup.6 is isopropyl; and R.sup.7 is fluoro; R.sup.6 is ethyl; and R.sup.7 is fluoro; R.sup.6 is isopropyl; and R.sup.7 is cyano; R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; R.sup.6 is cyclopropyl; and R.sup.7 is chloro; R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; R.sup.6 is isopropyl; and R.sup.7 is methoxy; R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; R.sup.7 is isopropyl; and R.sup.6 is methyl; R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; R.sup.7 is isopropyl; and R.sup.6 is chloro; R.sup.7 is ethyl; and R.sup.6 is fluoro; R.sup.7 is isopropyl; and R.sup.6 is cyano; R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; R.sup.7 is cyclopropyl; and R.sup.6 is chloro; R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; R.sup.7 is isopropyl; and R.sup.6 is methoxy; R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy.

(1282) In some embodiments, of the compound of formula AA,

(1283) the substituted ring B is

(1284) ##STR00232##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; each R.sup.6 is independently cyclopropyl and R.sup.7 is halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is cyano; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is chloro; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.6 is halo or cyano; or R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.6 is halo or cyano.

(1285) In some embodiments, of the compound of formula AA,

(1286) the substituted ring B is

(1287) ##STR00233##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is isopropyl; and R.sup.7 is methyl; each R.sup.6 is isopropyl; and R.sup.7 is isopropyl; each R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; each R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; each R.sup.6 is isopropyl; and R.sup.7 is chloro; each R.sup.6 is isopropyl; and R.sup.7 is fluoro; each R.sup.6 is ethyl; and R.sup.7 is fluoro; each R.sup.6 is isopropyl; and R.sup.7 is cyano; each R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; each R.sup.6 is cyclopropyl; and R.sup.7 is chloro; each R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; each R.sup.6 is isopropyl; and R.sup.7 is methoxy; each R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; each R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; each R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; R.sup.7 is isopropyl; and each R.sup.6 is methyl; R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; R.sup.7 is isopropyl; and each R.sup.6 is chloro; R.sup.7 is ethyl; and each R.sup.6 is fluoro; R.sup.7 is isopropyl; and each R.sup.6 is cyano; R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; R.sup.7 is isopropyl; and each R.sup.6 is methoxy; R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and R.sup.7 is chloro; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatoms independently selected from O, N, and S; and one R.sup.6 is chloro, fluoro, or cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatoms independently selected from O, N, and S; and one R.sup.6 is chloro, fluoro, or cyano; or R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano.

(1288) In some embodiments, of the compound of formula AA,

(1289) the substituted ring B is

(1290) ##STR00234##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; each R.sup.6 is independently cyclopropyl and R.sup.7 is halo; ach R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is cyano; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is chloro; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.6 is halo or cyano; or R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.6 is halo or cyano.

(1291) In some embodiments, of the compound of formula AA,

(1292) the substituted ring B is

(1293) ##STR00235##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is isopropyl; and R.sup.7 is methyl; each R.sup.6 is isopropyl; and R.sup.7 is isopropyl; each R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; each R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; each R.sup.6 is isopropyl; and R.sup.7 is chloro; each R.sup.6 is isopropyl; and R.sup.7 is fluoro; each R.sup.6 is ethyl; and R.sup.7 is fluoro; each R.sup.6 is isopropyl; and R.sup.7 is cyano; each R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; each R.sup.6 is cyclopropyl; and R.sup.7 is chloro; each R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; each R.sup.6 is isopropyl; and R.sup.7 is methoxy; each R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; each R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; each R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; R.sup.7 is isopropyl; and each R.sup.6 is methyl; R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; R.sup.7 is isopropyl; and each R.sup.6 is chloro; R.sup.7 is ethyl; and each R.sup.6 is fluoro; R.sup.7 is isopropyl; and each R.sup.6 is cyano; R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; R.sup.7 is isopropyl; and each R.sup.6 is methoxy; R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and R.sup.7 is chloro; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatoms independently selected from O, N, and S; and one R.sup.6 is chloro, fluoro, or cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatoms independently selected from O, N, and S; and one R.sup.6 is chloro, fluoro, or cyano; or R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano.

(1294) In some embodiments, of the compound of formula AA,

(1295) the substituted ring B is

(1296) ##STR00236##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is cyano; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; R.sup.6 is cyclopropyl and each R.sup.7 is independently halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.6 is halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; R.sup.6 is halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is chloro; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.7 is independently halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; each R.sup.7 is independently halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.

(1297) In some embodiments, of the compound of formula AA,

(1298) the substituted ring B is

(1299) ##STR00237##
and R.sup.6 and Ware one of the following combinations: each R.sup.7 is isopropyl; and R.sup.6 is methyl; each R.sup.7 is isopropyl; and R.sup.6 is isopropyl; each R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; each R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; each R.sup.7 is isopropyl; and R.sup.6 is chloro; each R.sup.7 is isopropyl; and R.sup.6 is fluoro; each R.sup.7 is ethyl; and R.sup.6 is fluoro; each R.sup.7 is isopropyl; and R.sup.6 is cyano; each R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; each R.sup.7 is cyclopropyl; and R.sup.6 is chloro; each R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; each R.sup.7 is isopropyl; and R.sup.6 is methoxy; each R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; each R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; each R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy; R.sup.7 is isopropyl; and each R.sup.6 is methyl; R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; R.sup.7 is isopropyl; and each R.sup.6 is chloro; R.sup.7 is ethyl; and each R.sup.6 is fluoro; R.sup.7 is isopropyl; and each R.sup.6 is cyano; R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; R.sup.7 is isopropyl; and each R.sup.6 is methoxy; R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy.

(1300) In some embodiments, of the compound of formula AA,

(1301) the substituted ring B is

(1302) ##STR00238##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is cyano; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; R.sup.6 is cyclopropyl and each R.sup.7 is independently halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.6 is halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; R.sup.6 is halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is chloro; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.7 is independently halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; each R.sup.7 is independently halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.

(1303) In some embodiments, of the compound of formula AA,

(1304) the substituted ring B is

(1305) ##STR00239##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is isopropyl; and each R.sup.7 is methyl; R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; R.sup.6 is isopropyl; and each R.sup.7 is chloro; R.sup.6 is isopropyl; and each R.sup.7 is fluoro; R.sup.6 is ethyl; and each R.sup.7 is fluoro; R.sup.6 is isopropyl; and each R.sup.7 is cyano; R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; R.sup.6 is isopropyl; and each R.sup.7 is methoxy; R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; each R.sup.7 is isopropyl; and R.sup.6 is methyl; each R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; each R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; each R.sup.7 is isopropyl; and R.sup.6 is chloro; each R.sup.7 is ethyl; and R.sup.6 is fluoro; each R.sup.7 is isopropyl; and R.sup.6 is cyano; each R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; each R.sup.7 is cyclopropyl; and R.sup.6 is chloro; each R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; each R.sup.7 is isopropyl; and R.sup.6 is methoxy; each R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; each R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; each R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy.

(1306) In some embodiments, of the compound of formula AA,

(1307) the substituted ring B is

(1308) ##STR00240##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; each R.sup.6 is independently cyclopropyl and R.sup.7 is halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is cyano; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is chloro.

(1309) In some embodiments, of the compound of formula AA,

(1310) the substituted ring B is

(1311) ##STR00241##
and R.sup.6 and Ware one of the following combinations: each R.sup.6 is isopropyl; and R.sup.7 is methyl; each R.sup.6 is isopropyl; and R.sup.7 is isopropyl; each R.sup.6 is isopropyl; and R.sup.7 is trifluoromethyl; each R.sup.6 is isopropyl; and R.sup.7 is cyclopropyl; each R.sup.6 is isopropyl; and R.sup.7 is chloro; each R.sup.6 is isopropyl; and R.sup.7 is fluoro; each R.sup.6 is ethyl; and R.sup.7 is fluoro; each R.sup.6 is isopropyl; and R.sup.7 is cyano; each R.sup.6 is cyclopropyl; and R.sup.7 is cyclopropyl; each R.sup.6 is cyclopropyl; and R.sup.7 is chloro; each R.sup.6 is cyclopropyl; and R.sup.7 is fluoro; each R.sup.6 is isopropyl; and R.sup.7 is methoxy; each R.sup.6 is isopropyl; and R.sup.7 is trifluoromethoxy; each R.sup.6 is chloro; and R.sup.7 is trifluoromethyl; each R.sup.6 is chloro; and R.sup.7 is trifluoromethoxy; R.sup.7 is isopropyl; and each R.sup.6 is methyl; R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; R.sup.7 is isopropyl; and each R.sup.6 is chloro; R.sup.7 is ethyl; and each R.sup.6 is fluoro; R.sup.7 is isopropyl; and each R.sup.6 is cyano; R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; R.sup.7 is isopropyl; and each R.sup.6 is methoxy; R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and R.sup.7 is chloro.

(1312) In some embodiments, of the compound of formula AA,

(1313) the substituted ring B is

(1314) ##STR00242##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is cyano; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.6 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; R.sup.6 is cyclopropyl and each R.sup.7 is independently halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; R.sup.6 is C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.6 is halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; R.sup.6 is halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; R.sup.6 is C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is chloro; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and R.sup.6 is halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.6 is halo; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and R.sup.6 is halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.7 is independently halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkyl; each R.sup.7 is independently halo, and R.sup.6 is C.sub.1-C.sub.6 haloalkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.

(1315) In some embodiments, of the compound of formula AA,

(1316) the substituted ring B is

(1317) ##STR00243##
and R.sup.6 and R.sup.7 are one of the following combinations: R.sup.6 is isopropyl; and each R.sup.7 is methyl; R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; R.sup.6 is isopropyl; and each R.sup.7 is chloro; R.sup.6 is isopropyl; and each R.sup.7 is fluoro; R.sup.6 is ethyl; and each R.sup.7 is fluoro; R.sup.6 is isopropyl; and each R.sup.7 is cyano; R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; R.sup.6 is isopropyl; and each R.sup.7 is methoxy; R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; each R.sup.7 is isopropyl; and R.sup.6 is methyl; each R.sup.7 is isopropyl; and R.sup.6 is trifluoromethyl; each R.sup.7 is isopropyl; and R.sup.6 is cyclopropyl; each R.sup.7 is isopropyl; and R.sup.6 is chloro; each R.sup.7 is ethyl; and R.sup.6 is fluoro; each R.sup.7 is isopropyl; and R.sup.6 is cyano; each R.sup.7 is cyclopropyl; and R.sup.6 is cyclopropyl; each R.sup.7 is cyclopropyl; and R.sup.6 is chloro; each R.sup.7 is cyclopropyl; and R.sup.6 is fluoro; each R.sup.7 is isopropyl; and R.sup.6 is methoxy; each R.sup.7 is isopropyl; and R.sup.6 is trifluoromethoxy; each R.sup.7 is chloro; and R.sup.6 is trifluoromethyl; each R.sup.7 is chloro; and R.sup.6 is trifluoromethoxy.

(1318) In some embodiments, of the compound of formula AA,

(1319) the substituted ring B is

(1320) ##STR00244##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is cyano; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; each R.sup.6 is independently cyclopropyl and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is chloro; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is cyano; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is chloro; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.8 aliphatic carbocyclic ring; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; or two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl.

(1321) In some embodiments, of the compound of formula AA,

(1322) the substituted ring B is

(1323) ##STR00245##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is isopropyl; and each R.sup.7 is methyl; each R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; each R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; each R.sup.6 is isopropyl; and each R.sup.7 is chloro; each R.sup.6 is isopropyl; and each R.sup.7 is fluoro; each R.sup.6 is ethyl; and each R.sup.7 is fluoro; each R.sup.6 is isopropyl; and each R.sup.7 is cyano; each R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; each R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; each R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; each R.sup.6 is isopropyl; and each R.sup.7 is methoxy; each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; each R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; each R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; each R.sup.7 is isopropyl; and each R.sup.6 is methyl; each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; each R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; each R.sup.7 is isopropyl; and each R.sup.6 is chloro; each R.sup.7 is ethyl; and each R.sup.6 is fluoro; each R.sup.7 is isopropyl; and each R.sup.6 is cyano; each R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; each R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; each R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; each R.sup.7 is isopropyl; and each R.sup.6 is methoxy; each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; each R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; each R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and each R.sup.7 is chloro; each R.sup.6 is isopropyl; one R.sup.7 is fluoro; and the other R.sup.7 is cyano; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl; or two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl.

(1324) In some embodiments, of the compound of formula AA,

(1325) the substituted ring B is

(1326) ##STR00246##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is cyano; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; each R.sup.6 is independently cyclopropyl and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is chloro; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is cyano; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is chloro; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.8 aliphatic carbocyclic ring; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; or two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl.

(1327) In some embodiments, of the compound of formula AA,

(1328) the substituted ring B is

(1329) ##STR00247##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is isopropyl; and each R.sup.7 is methyl; each R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; each R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; each R.sup.6 is isopropyl; and each R.sup.7 is chloro; each R.sup.6 is isopropyl; and each R.sup.7 is fluoro; each R.sup.6 is ethyl; and each R.sup.7 is fluoro; each R.sup.6 is isopropyl; and each R.sup.7 is cyano; each R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; each R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; each R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; each R.sup.6 is isopropyl; and each R.sup.7 is methoxy; each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; each R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; each R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; each R.sup.7 is isopropyl; and each R.sup.6 is methyl; each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; each R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; each R.sup.7 is isopropyl; and each R.sup.6 is chloro; each R.sup.7 is ethyl; and each R.sup.6 is fluoro; each R.sup.7 is isopropyl; and each R.sup.6 is cyano; each R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; each R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; each R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; each R.sup.7 is isopropyl; and each R.sup.6 is methoxy; each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; each R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; each R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and each R.sup.7 is chloro; each R.sup.6 is isopropyl; one R.sup.7 is fluoro; and the other R.sup.7 is cyano; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl; or two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl.

(1330) In some embodiments, of the compound of formula AA,

(1331) the substituted ring B is

(1332) ##STR00248##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is cyano; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; each R.sup.6 is independently cyclopropyl and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is chloro; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is cyano; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is chloro.

(1333) In some embodiments, of the compound of formula AA,

(1334) the substituted ring B is

(1335) ##STR00249##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is isopropyl; and each R.sup.7 is methyl; each R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; each R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; each R.sup.6 is isopropyl; and each R.sup.7 is chloro; each R.sup.6 is isopropyl; and each R.sup.7 is fluoro; each R.sup.6 is ethyl; and each R.sup.7 is fluoro; each R.sup.6 is isopropyl; and each R.sup.7 is cyano; each R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; each R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; each R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; each R.sup.6 is isopropyl; and each R.sup.7 is methoxy; each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; each R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; each R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; each R.sup.7 is isopropyl; and each R.sup.6 is methyl; each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; each R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; each R.sup.7 is isopropyl; and each R.sup.6 is chloro; each R.sup.7 is ethyl; and each R.sup.6 is fluoro; each R.sup.7 is isopropyl; and each R.sup.6 is cyano; each R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; each R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; each R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; each R.sup.7 is isopropyl; and each R.sup.6 is methoxy; each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; each R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; each R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and each R.sup.7 is chloro; each R.sup.6 is isopropyl; one R.sup.7 is fluoro; and the other R.sup.7 is cyano.

(1336) In some embodiments, of the compound of formula AA,

(1337) the substituted ring B is

(1338) ##STR00250##
and R.sup.6 and Ware one of the following combinations: each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is cyano; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; each R.sup.6 is independently cyclopropyl and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is chloro; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is cyano; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is chloro; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.6 is halo or cyano; or R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.6 is halo or cyano.

(1339) In some embodiments, of the compound of formula AA,

(1340) the substituted ring B is

(1341) ##STR00251##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is isopropyl; and each R.sup.7 is methyl; each R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; each R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; each R.sup.6 is isopropyl; and each R.sup.7 is chloro; each R.sup.6 is isopropyl; and each R.sup.7 is fluoro; each R.sup.6 is ethyl; and each R.sup.7 is fluoro; each R.sup.6 is isopropyl; and each R.sup.7 is cyano; each R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; each R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; each R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; each R.sup.6 is isopropyl; and each R.sup.7 is methoxy; each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; each R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; each R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; each R.sup.7 is isopropyl; and each R.sup.6 is methyl; each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; each R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; each R.sup.7 is isopropyl; and each R.sup.6 is chloro; each R.sup.7 is ethyl; and each R.sup.6 is fluoro; each R.sup.7 is isopropyl; and each R.sup.6 is cyano; each R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; each R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; each R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; each R.sup.7 is isopropyl; and each R.sup.6 is methoxy; each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; each R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; each R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and each R.sup.7 is chloro; each R.sup.6 is isopropyl; one R.sup.7 is fluoro; and the other R.sup.7 is cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatoms independently selected from O, N, and S; and one R.sup.6 is chloro, fluoro, or cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatoms independently selected from O, N, and S; and one R.sup.6 is chloro, fluoro, or cyano; or R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano.

(1342) In some embodiments, of the compound of formula AA,

(1343) the substituted ring B is

(1344) ##STR00252##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is cyano; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; each R.sup.6 is independently cyclopropyl and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro.

(1345) In some embodiments, of the compound of formula AA,

(1346) the substituted ring B is

(1347) ##STR00253##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is isopropyl; and each R.sup.7 is methyl; each R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; each R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; each R.sup.6 is isopropyl; and each R.sup.7 is chloro; each R.sup.6 is isopropyl; and each R.sup.7 is fluoro; each R.sup.6 is ethyl; and each R.sup.7 is fluoro; each R.sup.6 is isopropyl; and each R.sup.7 is cyano; each R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; each R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; each R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; each R.sup.6 is isopropyl; and each R.sup.7 is methoxy; each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; each R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; each R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; each R.sup.7 is isopropyl; and each R.sup.6 is methyl; each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; each R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; each R.sup.7 is isopropyl; and each R.sup.6 is chloro; each R.sup.7 is ethyl; and each R.sup.6 is fluoro; each R.sup.7 is isopropyl; and each R.sup.6 is cyano; each R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; each R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; each R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; each R.sup.7 is isopropyl; and each R.sup.6 is methoxy; each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; each R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; each R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and each R.sup.7 is chloro; each R.sup.6 is isopropyl; one R.sup.7 is fluoro; and the other R.sup.7 is cyano.

(1348) In some embodiments, of the compound of formula AA,

(1349) the substituted ring B is

(1350) ##STR00254##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is cyano; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.7 is independently halo; each R.sup.6 is independently cyclopropyl and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkyl; each R.sup.6 is independently halo, and each R.sup.7 is independently C.sub.1-C.sub.6 haloalkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is independently halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.7 is chloro; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is cyano; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; each R.sup.7 is independently halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; each R.sup.7 is independently C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is chloro; Two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.8 aliphatic carbocyclic ring; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.6 is halo or cyano; or R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.6 is halo or cyano.

(1351) In some embodiments, of the compound of formula AA,

(1352) the substituted ring B is

(1353) ##STR00255##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is isopropyl; and each R.sup.7 is methyl; each R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; each R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; each R.sup.6 is isopropyl; and each R.sup.7 is chloro; each R.sup.6 is isopropyl; and each R.sup.7 is fluoro; each R.sup.6 is ethyl; and each R.sup.7 is fluoro; each R.sup.6 is isopropyl; and each R.sup.7 is cyano; each R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; each R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; each R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; each R.sup.6 is isopropyl; and each R.sup.7 is methoxy; each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; each R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; each R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; each R.sup.7 is isopropyl; and each R.sup.6 is methyl; each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; each R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; each R.sup.7 is isopropyl; and each R.sup.6 is chloro; each R.sup.7 is ethyl; and each R.sup.6 is fluoro; each R.sup.7 is isopropyl; and each R.sup.6 is cyano; each R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; each R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; each R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; each R.sup.7 is isopropyl; and each R.sup.6 is methoxy; each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; each R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; each R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; one R.sup.6 is isopropyl; the other R.sup.6 is trifluoromethyl; and each R.sup.7 is chloro; each R.sup.6 is isopropyl; one R.sup.7 is fluoro; and the other R.sup.7 is cyano; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatoms independently selected from O, N, and S; and one R.sup.6 is chloro, fluoro, or cyano; R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatoms independently selected from O, N, and S; and one R.sup.6 is chloro, fluoro, or cyano; or R.sup.6 and R.sup.7 on adjacent atoms taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.6 is chloro, fluoro, or cyano.

(1354) In some embodiments, of the compound of formula AA,

(1355) the substituted ring B is

(1356) ##STR00256##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and each R.sup.7 is C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl and R.sup.7 is C.sub.1-C.sub.6 alkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkyl substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is cyano; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is C.sub.3-C.sub.7 cycloalkyl; each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl, and R.sup.7 is halo; each R.sup.6 is independently cyclopropyl and R.sup.7 is halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkyl, and R.sup.7 is C.sub.1-C.sub.6 alkoxy substituted with one or more halo; each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkyl; each R.sup.6 is independently halo, and R.sup.7 is C.sub.1-C.sub.6 haloalkoxy; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is halo; each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; and R.sup.7 is chloro; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkyl substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkyl and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and R.sup.6 is cyano; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently C.sub.3-C.sub.7 cycloalkyl; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl, and each R.sup.6 is independently halo; R.sup.7 is C.sub.3-C.sub.7 cycloalkyl and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy optionally substituted with one or more halo; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy; R.sup.7 is C.sub.1-C.sub.6 alkyl, and each R.sup.6 is independently C.sub.1-C.sub.6 alkoxy substituted with one or more halo; R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkyl; R.sup.7 is halo, and each R.sup.6 is independently C.sub.1-C.sub.6 haloalkoxy; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and each R.sup.6 is independently halo; R.sup.7 is C.sub.1-C.sub.6 alkoxy; and R.sup.6 is chloro; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.8 aliphatic carbocyclic ring; and one R.sup.7 is halo and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4-C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.7 is halo or cyano; or two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-to-6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring optionally substituted with one or more hydroxy, oxo, or C.sub.1-C.sub.6 alkyl; and one R.sup.7 is halo or cyano.

(1357) In some embodiments, of the compound of formula AA,

(1358) the substituted ring B is

(1359) ##STR00257##
and R.sup.6 and R.sup.7 are one of the following combinations: each R.sup.6 is isopropyl; and each R.sup.7 is methyl; each R.sup.6 is isopropyl; and each R.sup.7 is isopropyl; each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethyl; each R.sup.6 is isopropyl; and each R.sup.7 is cyclopropyl; each R.sup.6 is isopropyl; and each R.sup.7 is chloro; each R.sup.6 is isopropyl; and each R.sup.7 is fluoro; each R.sup.6 is ethyl; and each R.sup.7 is fluoro; each R.sup.6 is isopropyl; and each R.sup.7 is cyano; each R.sup.6 is cyclopropyl; and each R.sup.7 is cyclopropyl; each R.sup.6 is cyclopropyl; and each R.sup.7 is chloro; each R.sup.6 is cyclopropyl; and each R.sup.7 is fluoro; each R.sup.6 is isopropyl; and each R.sup.7 is methoxy; each R.sup.6 is isopropyl; and each R.sup.7 is trifluoromethoxy; each R.sup.6 is chloro; and each R.sup.7 is trifluoromethyl; each R.sup.6 is chloro; and each R.sup.7 is trifluoromethoxy; each R.sup.7 is isopropyl; and each R.sup.6 is methyl; each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethyl; each R.sup.7 is isopropyl; and each R.sup.6 is cyclopropyl; each R.sup.7 is isopropyl; and each R.sup.6 is chloro; each R.sup.7 is ethyl; and each R.sup.6 is fluoro; each R.sup.7 is isopropyl; and each R.sup.6 is cyano; each R.sup.7 is cyclopropyl; and each R.sup.6 is cyclopropyl; each R.sup.7 is cyclopropyl; and each R.sup.6 is chloro; each R.sup.7 is cyclopropyl; and each R.sup.6 is fluoro; each R.sup.7 is isopropyl; and each R.sup.6 is methoxy; each R.sup.7 is isopropyl; and each R.sup.6 is trifluoromethoxy; each R.sup.7 is chloro; and each R.sup.6 is trifluoromethyl; each R.sup.7 is chloro; and each R.sup.6 is trifluoromethoxy; each R.sup.6 is isopropyl; two R.sup.7 are fluoro; and one R.sup.7 is chloro; two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring; and one R.sup.7 is chloro; (i) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.4 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; and one R.sup.7 is fluoro or chloro; (ii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.5 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; and one R.sup.7 is fluoro or chloro; (iii) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a C.sub.6 aliphatic carbocyclic ring optionally substituted with one or more hydroxy, oxo, or methyl; and one R.sup.7 is fluoro or chloro; (iv) two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 5-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl; and one R.sup.7 is fluoro or chloro or two pairs, each of one R.sup.6 and one R.sup.7, are on adjacent atoms, and each pair of one R.sup.6 and one R.sup.7 taken together with the atoms connecting them form a 6-membered heterocyclic ring containing 1 heteroatom independently selected from O, N, and S, wherein the heterocyclic ring is optionally substituted with one or more hydroxy, oxo, or methyl; and one R.sup.7 is fluoro or chloro.

(1360) Unless otherwise indicated, when a disclosed compound is named or depicted by a structure without specifying the stereochemistry and has one or more chiral centers, it is understood to represent all possible stereoisomers of the compound.

(1361) It is understood that the combination of variables in the formulae herein is such that the compounds are stable.

(1362) In some embodiments, provided herein is a compound that is selected from the group consisting of the compounds in Table 1:

(1363) TABLE-US-00001 TABLE 1 Compound Structure 101 embedded image 101a embedded image 101b 0embedded image 102 embedded image 103 embedded image 104 embedded image 104a embedded image 104b embedded image 105 embedded image 106 embedded image 106a embedded image 106b embedded image 107 0embedded image 107a embedded image 107b embedded image 108 embedded image 109 embedded image 110 embedded image 110a′ embedded image 110b′ embedded image 110a embedded image 110b embedded image 111 0embedded image 112 embedded image 112a embedded image 112b embedded image 113 embedded image 114 embedded image 114a embedded image 114b embedded image 115 embedded image 116 embedded image 116a 0embedded image 116b embedded image 117 embedded image 117a embedded image 117b embedded image 118 embedded image 119 embedded image 120 embedded image 121 embedded image 122 embedded image 123 00embedded image 123a 01embedded image 123b 02embedded image 124 03embedded image 125 04embedded image 126 05embedded image 126a 06embedded image 126b 07embedded image 127 08embedded image 128 09embedded image 129 0embedded image 129a embedded image 129b embedded image 130 embedded image 130a embedded image 130b embedded image 131 embedded image 131a embedded image 131b embedded image 132 embedded image 132a 0embedded image 132b embedded image 133 embedded image 133a embedded image 133b embedded image 134 embedded image 135 embedded image 136 embedded image 137 embedded image 138 embedded image 138a 0embedded image 138b embedded image 139 embedded image 139a embedded image 139b embedded image 140 embedded image 140a embedded image 140b embedded image 141 embedded image 141a embedded image 141b 0embedded image 142 embedded image 143 embedded image 144 embedded image 144a embedded image 144b embedded image 145 embedded image 145a embedded image 145b embedded image 146 embedded image 147 0embedded image 147a embedded image 147b embedded image 148 embedded image 148a embedded image 148b embedded image 149a embedded image 149b embedded image 150 embedded image 150a embedded image 150b 0embedded image 151 embedded image 152 embedded image 152a embedded image 152b embedded image 153 embedded image 154 embedded image 155 embedded image 156 embedded image 157 embedded image 158 0embedded image 159 embedded image 160 embedded image 161 embedded image 162 embedded image 163 embedded image 164 embedded image 165 embedded image 166 embedded image 167 embedded image 168 0embedded image 169 embedded image 170 embedded image 171 embedded image 172 embedded image 173 embedded image 174 embedded image 175 embedded image 176 embedded image 177 embedded image 178 0embedded image 179 embedded image 180 embedded image 181 embedded image 182 embedded image 183 embedded image 184 embedded image 185 embedded image 186 embedded image 187 embedded image 188 00embedded image 189 01embedded image 190 02embedded image 191 03embedded image 192 04embedded image 193 05embedded image 194 06embedded image 195 07embedded image 196 08embedded image 197 09embedded image 197a 0embedded image 197b embedded image 198 embedded image 198a embedded image 198b embedded image 201 embedded image 201b embedded image 201a embedded image 202 embedded image 202b embedded image 202a 0embedded image 203 embedded image 203b embedded image 203a embedded image 204 embedded image 204b embedded image 204a embedded image 205 embedded image 206 embedded image 207 embedded image 208 0embedded image 209 embedded image 210 embedded image 210a embedded image 210b embedded image 211 embedded image 212 embedded image 213 embedded image 213a embedded image 213b embedded image 214 0embedded image 215 embedded image 216 embedded image 216a embedded image 216b embedded image 217 embedded image 217a embedded image 217b embedded image 218 embedded image 218a embedded image 218b 0embedded image 219 embedded image 220 embedded image 220a embedded image 220b embedded image 221 embedded image 221a embedded image 221b embedded image 222 embedded image 224 embedded image 224b 0embedded image 224ba embedded image 224aa embedded image 225 embedded image 225a embedded image 225b embedded image 226 embedded image 226a embedded image 226b embedded image 227 embedded image 227a 0embedded image 227b embedded image 228 embedded image 228a embedded image 228b embedded image 229 embedded image 229a embedded image 229b embedded image 230 embedded image 231 embedded image 232 0embedded image 233 embedded image 234 embedded image 234a embedded image 234b embedded image 235 embedded image 236 embedded image 236a embedded image 236b embedded image 237 embedded image 238 0embedded image 238a embedded image 238b embedded image 239 embedded image 239a embedded image 239b embedded image 240 embedded image 241 embedded image 242 embedded image 242a embedded image 242b 00embedded image 243 01embedded image 243a 02embedded image 243b 03embedded image 244 04embedded image 244aa 05embedded image 244b 06embedded image 244ba 07embedded image 245 08embedded image 246 09embedded image 247 0embedded image 248 embedded image 249 embedded image 249a embedded image 249b embedded image 250 embedded image 251 embedded image 251a embedded image 251b embedded image 252 embedded image 253 0embedded image 254 embedded image 255 embedded image 256 embedded image 256a embedded image 256b embedded image 257 embedded image 258 embedded image 258a embedded image 258b embedded image 259 0embedded image 259a embedded image 259b embedded image 260 embedded image 261a embedded image 261b embedded image 262a embedded image 262b embedded image 263 embedded image 263a embedded image 263b 0embedded image 264 embedded image 264a embedded image 264b embedded image

(1364) and pharmaceutically acceptable salts thereof.

(1365) In some embodiments, provided herein is a compound that is selected from the group consisting of the compounds in Table 1-3:

(1366) TABLE-US-00002 TABLE 1-3 301 embedded image 302 embedded image 303 embedded image 304 embedded image 305 embedded image 306 embedded image 307 0embedded image 309 embedded image 309a embedded image 309b embedded image 310 embedded image

(1367) or a pharmaceutically acceptable salt thereof.

(1368) Pharmaceutical Compositions and Administration

(1369) General

(1370) In some embodiments, a chemical entity (e.g., a compound that modulates (e.g., antagonizes) NLRP3, or a pharmaceutically acceptable salt, and/or hydrate, and/or cocrystal, and/or drug combination thereof) is administered as a pharmaceutical composition that includes the chemical entity and one or more pharmaceutically acceptable excipients, and optionally one or more additional therapeutic agents as described herein.

(1371) In some embodiments, the chemical entities can be administered in combination with one or more conventional pharmaceutical excipients. Pharmaceutically acceptable excipients include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, self-emulsifying drug delivery systems (SEDDS) such as d-α-tocopherol polyethylene glycol 1000 succinate, surfactants used in pharmaceutical dosage forms such as Tweens, poloxamers or other similar polymeric delivery matrices, serum proteins, such as human serum albumin, buffer substances such as phosphates, tris, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium-chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethyl cellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, and wool fat. Cyclodextrins such as α-, β, and γ-cyclodextrin, or chemically modified derivatives such as hydroxyalkylcyclodextrins, including 2- and 3-hydroxypropyl-β-cyclodextrins, or other solubilized derivatives can also be used to enhance delivery of compounds described herein. Dosage forms or compositions containing a chemical entity as described herein in the range of 0.005% to 100% with the balance made up from non-toxic excipient may be prepared. The contemplated compositions may contain 0.001%400% of a chemical entity provided herein, in one embodiment 0.1-95%, in another embodiment 75-85%, in a further embodiment 20-80%. Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in this art; for example, see Remington: The Science and Practice of Pharmacy, 22nd Edition (Pharmaceutical Press, London, UK. 2012).

(1372) Routes of Administration and Composition Components

(1373) In some embodiments, the chemical entities described herein or a pharmaceutical composition thereof can be administered to subject in need thereof by any accepted route of administration. Acceptable routes of administration include, but are not limited to, buccal, cutaneous, endocervical, endosinusial, endotracheal, enteral, epidural, interstitial, intra-abdominal, intra-arterial, intrabronchial, intrabursal, intracerebral, intracisternal, intracoronary, intradermal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intraileal, intralymphatic, intramedullary, intrameningeal, intramuscular, intraovarian, intraperitoneal, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratesticular, intrathecal, intratubular, intratumoral, intrauterine, intravascular, intravenous, nasal, nasogastric, oral, parenteral, percutaneous, peridural, rectal, respiratory (inhalation), subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transtracheal, ureteral, urethral and vaginal. In certain embodiments, a preferred route of administration is parenteral (e.g., intratumoral).

(1374) Compositions can be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular, sub-cutaneous, or even intraperitoneal routes. Typically, such compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for use to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and the preparations can also be emulsified. The preparation of such formulations will be known to those of skill in the art in light of the present disclosure.

(1375) The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil, or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that it may be easily injected. It also should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.

(1376) The carrier also can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

(1377) Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques, which yield a powder of the active ingredient, plus any additional desired ingredient from a previously sterile-filtered solution thereof.

(1378) Intratumoral injections are discussed, e.g., in Lammers, et al., “Effect of Intratumoral Injection on the Biodistribution and the Therapeutic Potential of HPMA Copolymer-Based Drug Delivery Systems” Neoplasia. 2006, 10, 788-795.

(1379) In certain embodiments, the chemical entities described herein or a pharmaceutical composition thereof are suitable for local, topical administration to the digestive or GI tract, e.g., rectal administration. Rectal compositions include, without limitation, enemas, rectal gels, rectal foams, rectal aerosols, suppositories, jelly suppositories, and enemas (e.g., retention enemas).

(1380) Pharmacologically acceptable excipients usable in the rectal composition as a gel, cream, enema, or rectal suppository, include, without limitation, any one or more of cocoa butter glycerides, synthetic polymers such as polyvinylpyrrolidone, PEG (like PEG ointments), glycerine, glycerinated gelatin, hydrogenated vegetable oils, poloxamers, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol Vaseline, anhydrous lanolin, shark liver oil, sodium saccharinate, menthol, sweet almond oil, sorbitol, sodium benzoate, anoxid SBN, vanilla essential oil, aerosol, parabens in phenoxyethanol, sodium methyl p-oxybenzoate, sodium propyl p-oxybenzoate, diethylamine, carbomers, carbopol, methyloxybenzoate, macrogol cetostearyl ether, cocoyl caprylocaprate, isopropyl alcohol, propylene glycol, liquid paraffin, xanthan gum, carboxy-metabisulfite, sodium edetate, sodium benzoate, potassium metabisulfite, grapefruit seed extract, methyl sulfonyl methane (MSM), lactic acid, glycine, vitamins, such as vitamin A and E and potassium acetate.

(1381) In certain embodiments, suppositories can be prepared by mixing the chemical entities described herein with suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum and release the active compound. In other embodiments, compositions for rectal administration are in the form of an enema.

(1382) In other embodiments, the compounds described herein or a pharmaceutical composition thereof are suitable for local delivery to the digestive or GI tract by way of oral administration (e.g., solid or liquid dosage forms.).

(1383) Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the chemical entity is mixed with one or more pharmaceutically acceptable excipients, such as sodium citrate or dicalcium phosphate and/or: a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like.

(1384) In one embodiment, the compositions will take the form of a unit dosage form such as a pill or tablet and thus the composition may contain, along with a chemical entity provided herein, a diluent such as lactose, sucrose, dicalcium phosphate, or the like; a lubricant such as magnesium stearate or the like; and a binder such as starch, gum acacia, polyvinylpyrrolidine, gelatin, cellulose, cellulose derivatives or the like. In another solid dosage form, a powder, marume, solution or suspension (e.g., in propylene carbonate, vegetable oils, PEG's, poloxamer 124 or triglycerides) is encapsulated in a capsule (gelatin or cellulose base capsule). Unit dosage forms in which one or more chemical entities provided herein or additional active agents are physically separated are also contemplated; e.g., capsules with granules (or tablets in a capsule) of each drug; two-layer tablets; two-compartment gel caps, etc. Enteric coated or delayed release oral dosage forms are also contemplated.

(1385) Other physiologically acceptable compounds include wetting agents, emulsifying agents, dispersing agents or preservatives that are particularly useful for preventing the growth or action of microorganisms. Various preservatives are well known and include, for example, phenol and ascorbic acid.

(1386) In certain embodiments the excipients are sterile and generally free of undesirable matter. These compositions can be sterilized by conventional, well-known sterilization techniques. For various oral dosage form excipients such as tablets and capsules sterility is not required. The USP/NF standard is usually sufficient.

(1387) In certain embodiments, solid oral dosage forms can further include one or more components that chemically and/or structurally predispose the composition for delivery of the chemical entity to the stomach or the lower GI; e.g., the ascending colon and/or transverse colon and/or distal colon and/or small bowel. Exemplary formulation techniques are described in, e.g., Filipski, K. J., et al., Current Topics in Medicinal Chemistry, 2013, 13, 776-802, which is incorporated herein by reference in its entirety.

(1388) Examples include upper-GI targeting techniques, e.g., Accordion Pill (Intec Pharma), floating capsules, and materials capable of adhering to mucosal walls.

(1389) Other examples include lower-GI targeting techniques. For targeting various regions in the intestinal tract, several enteric/pH-responsive coatings and excipients are available. These materials are typically polymers that are designed to dissolve or erode at specific pH ranges, selected based upon the GI region of desired drug release. These materials also function to protect acid labile drugs from gastric fluid or limit exposure in cases where the active ingredient may be irritating to the upper GI (e.g., hydroxypropyl methylcellulose phthalate series, Coateric (polyvinyl acetate phthalate), cellulose acetate phthalate, hydroxypropyl methylcellulose acetate succinate, Eudragit series (methacrylic acid-methyl methacrylate copolymers), and Marcoat). Other techniques include dosage forms that respond to local flora in the GI tract, Pressure-controlled colon delivery capsule, and Pulsincap.

(1390) Ocular compositions can include, without limitation, one or more of any of the following: viscogens (e.g., Carboxymethylcellulose, Glycerin, Polyvinylpyrrolidone, Polyethylene glycol); Stabilizers (e.g., Pluronic (triblock copolymers), Cyclodextrins); Preservatives (e.g., Benzalkonium chloride, ETDA, SofZia (boric acid, propylene glycol, sorbitol, and zinc chloride; Alcon Laboratories, Inc.), Purite (stabilized oxychloro complex; Allergan, Inc.)).

(1391) Topical compositions can include ointments and creams. Ointments are semisolid preparations that are typically based on petrolatum or other petroleum derivatives. Creams containing the selected active agent are typically viscous liquid or semisolid emulsions, often either oil-in-water or water-in-oil. Cream bases are typically water-washable, and contain an oil phase, an emulsifier and an aqueous phase. The oil phase, also sometimes called the “internal” phase, is generally comprised of petrolatum and a fatty alcohol such as cetyl or stearyl alcohol; the aqueous phase usually, although not necessarily, exceeds the oil phase in volume, and generally contains a humectant. The emulsifier in a cream formulation is generally a nonionic, anionic, cationic or amphoteric surfactant. As with other carriers or vehicles, an ointment base should be inert, stable, nonirritating and non-sensitizing.

(1392) In any of the foregoing embodiments, pharmaceutical compositions described herein can include one or more one or more of the following: lipids, interbilayer crosslinked multilamellar vesicles, biodegradeable poly(D,L-lactic-co-glycolic acid) [PLGA]-based or poly anhydride-based nanoparticles or microparticles, and nanoporous particle-supported lipid bilayers.

(1393) Enema Formulations

(1394) In some embodiments, enema formulations containing the chemical entities described herein are provided in “ready-to-use” form.

(1395) In some embodiments, enema formulations containing the chemical entities described herein are provided in one or more kits or packs. In certain embodiments, the kit or pack includes two or more separately contained/packaged components, e.g. two components, which when mixed together, provide the desired formulation (e.g., as a suspension). In certain of these embodiments, the two component system includes a first component and a second component, in which: (1) the first component (e.g., contained in a sachet) includes the chemical entity (as described anywhere herein) and optionally one or more pharmaceutically acceptable excipients (e.g., together formulated as a solid preparation, e.g., together formulated as a wet granulated solid preparation); and (ii) the second component (e.g., contained in a vial or bottle) includes one or more liquids and optionally one or more other pharmaceutically acceptable excipients together forming a liquid carrier. Prior to use (e.g., immediately prior to use), the contents of (1) and (ii) are combined to form the desired enema formulation, e.g., as a suspension. In other embodiments, each of component (1) and (ii) is provided in its own separate kit or pack.

(1396) In some embodiments, each of the one or more liquids is water, or a physiologically acceptable solvent, or a mixture of water and one or more physiologically acceptable solvents. Typical such solvents include, without limitation, glycerol, ethylene glycol, propylene glycol, polyethylene glycol and polypropylene glycol. In certain embodiments, each of the one or more liquids is water. In other embodiments, each of the one or more liquids is an oil, e.g. natural and/or synthetic oils that are commonly used in pharmaceutical preparations.

(1397) Further pharmaceutical excipients and carriers that may be used in the pharmaceutical products herein described are listed in various handbooks (e.g. D. E. Bugay and W. P. Findlay (Eds) Pharmaceutical excipients (Marcel Dekker, New York, 1999), E-M Hoepfner, A. Reng and P. C. Schmidt (Eds) Fiedler Encyclopedia of Excipients for Pharmaceuticals, Cosmetics and Related Areas (Edition Cantor, Munich, 2002) and H. P. Fielder (Ed) Lexikon der Hilfsstoffe für Pharmazie, Kosmetik and angrenzende Gebiete (Edition Cantor Aulendorf, 1989)).

(1398) In some embodiments, each of the one or more pharmaceutically acceptable excipients can be independently selelcted from thickeners, viscosity enhancing agents, bulking agents, mucoadhesive agents, penetration enhanceers, buffers, preservatives, diluents, binders, lubricants, glidants, disintegrants, fillers, solubilizing agents, pH modifying agents, preservatives, stabilizing agents, anti-oxidants, wetting or emulsifying agents, suspending agents, pigments, colorants, isotonic agents, chelating agents, emulsifiers, and diagnostic agents.

(1399) In certain embodiments, each of the one or more pharmaceutically acceptable excipients can be independently selelcted from thickeners, viscosity enhancing agents, mucoadhesive agents, buffers, preservatives, diluents, binders, lubricants, glidants, disintegrants, and fillers.

(1400) In certain embodiments, each of the one or more pharmaceutically acceptable excipients can be independently selelcted from thickeners, viscosity enhancing agents, bulking agents, mucoadhesive agents, buffers, preservatives, and fillers.

(1401) In certain embodiments, each of the one or more pharmaceutically acceptable excipients can be independently selelcted from diluents, binders, lubricants, glidants, and disintegrants.

(1402) Examples of thickeners, viscosity enhancing agents, and mucoadhesive agents include without limitation: gums, e.g. xanthan gum, guar gum, locust bean gum, tragacanth gums, karaya gum, ghatti gum, cholla gum, psyllium seed gum and gum arabic; poly(carboxylic acid-containing) based polymers, such as poly (acrylic, maleic, itaconic, citraconic, hydroxyethyl methacrylic or methacrylic) acid which have strong hydrogen-bonding groups, or derivatives thereof such as salts and esters; cellulose derivatives, such as methyl cellulose, ethyl cellulose, methylethyl cellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxyethyl ethyl cellulose, carboxymethyl cellulose, hydroxypropylmethyl cellulose or cellulose esters or ethers or derivatives or salts thereof; clays such as manomorillonite clays, e.g. Veegun, attapulgite clay; polysaccharides such as dextran, pectin, amylopectin, agar, mannan or polygalactonic acid or starches such as hydroxypropyl starch or carboxymethyl starch; polypeptides such as casein, gluten, gelatin, fibrin glue; chitosan, e.g. lactate or glutamate or carboxymethyl chitin; glycosaminoglycans such as hyaluronic acid; metals or water soluble salts of alginic acid such as sodium alginate or magnesium alginate; schleroglucan; adhesives containing bismuth oxide or aluminium oxide; atherocollagen; polyvinyl polymers such as carboxyvinyl polymers; polyvinylpyrrolidone (povidone); polyvinyl alcohol; polyvinyl acetates, polyvinylmethyl ethers, polyvinyl chlorides, polyvinylidenes, and/or the like; polycarboxylated vinyl polymers such as polyacrylic acid as mentioned above; polysiloxanes; polyethers; polyethylene oxides and glycols; polyalkoxys and polyacrylamides and derivatives and salts thereof. Preferred examples can include cellulose derivatives, such as methyl cellulose, ethyl cellulose, methylethyl cellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxyethyl ethyl cellulose, carboxymethyl cellulose, hydroxypropylmethyl cellulose or cellulose esters or ethers or derivatives or salts thereof (e.g., methyl cellulose); and polyvinyl polymers such as polyvinylpyrrolidone (povidone).

(1403) Examples of preservatives include without limitation: benzalkonium chloride, benzoxonium chloride, benzethonium chloride, cetrimide, sepazonium chloride, cetylpyridinium chloride, domiphen bromide (Bradosol®), thiomersal, phenylmercuric nitrate, phenylmercuric acetate, phenylmercuric borate, methylparaben, propylparaben, chlorobutanol, benzyl alcohol, phenyl ethyl alcohol, chlorohexidine, polyhexamethylene biguanide, sodium perborate, imidazolidinyl urea, sorbic acid, Purite®), Polyquart®), and sodium perborate tetrahydrate and the like.

(1404) In certain embodiments, the preservative is a paraben, or a pharmaceutically acceptable salt thereof. In some embodiments, the paraben is an alkyl substituted 4-hydroxybenzoate, or a pharmaceutically acceptable salt or ester thereof. In certain embodiments, the alkyl is a C1-C4 alkyl. In certain embodiments, the preservative is methyl 4-hydroxybenzoate (methylparaben), or a pharmaceutically acceptable salt or ester thereof, propyl 4-hydroxybenzoate (propylparaben), or a pharmaceutically acceptable salt or ester thereof, or a combination thereof.

(1405) Examples of buffers include without limitation: phosphate buffer system (sodium dihydrogen phospahate dehydrate, disodium phosphate dodecahydrate, bibasic sodium phosphate, anhydrous monobasic sodium phosphate), bicarbonate buffer system, and bisulfate buffer system.

(1406) Examples of disintegrants include, without limitation: carmellose calcium, low substituted hydroxypropyl cellulose (L-HPC), carmellose, croscarmellose sodium, partially pregelatinized starch, dry starch, carboxymethyl starch sodium, crospovidone, polysorbate 80 (polyoxyethylenesorbitan oleate), starch, sodium starch glycolate, hydroxypropyl cellulose pregelatinized starch, clays, cellulose, alginine, gums or cross linked polymers, such as cross-linked PVP (Polyplasdone XL from GAF Chemical Corp). In certain embodiments, the disintegrant is crospovidone.

(1407) Examples of glidants and lubricants (aggregation inhibitors) include without limitation: talc, magnesium stearate, calcium stearate, colloidal silica, stearic acid, aqueous silicon dioxide, synthetic magnesium silicate, fine granulated silicon oxide, starch, sodium laurylsulfate, boric acid, magnesium oxide, waxes, hydrogenated oil, polyethylene glycol, sodium benzoate, stearic acid glycerol behenate, polyethylene glycol, and mineral oil. In certain embodiments, the glidant/lubricant is magnesium stearate, talc, and/or colloidal silica; e.g., magnesium stearate and/or talc.

(1408) Examples of diluents, also referred to as “fillers” or “bulking agents” include without limitation: dicalcium phosphate dihydrate, calcium sulfate, lactose (e.g., lactose monohydrate), sucrose, mannitol, sorbitol, cellulose, microcrystalline cellulose, kaolin, sodium chloride, dry starch, hydrolyzed starches, pregelatinized starch, silicone dioxide, titanium oxide, magnesium aluminum silicate and powdered sugar. In certain embodiments, the diluent is lactose (e.g., lactose monohydrate).

(1409) Examples of binders include without limitation: starch, pregelatinized starch, gelatin, sugars (including sucrose, glucose, dextrose, lactose and sorbitol), polyethylene glycol, waxes, natural and synthetic gums such as acacia tragacanth, sodium alginate cellulose, including hydroxypropylmethylcellulose, hydroxypropylcellulose, ethylcellulose, and veegum, and synthetic polymers such as acrylic acid and methacrylic acid copolymers, methacrylic acid copolymers, methyl methacrylate copolymers, aminoalkyl methacrylate copolymers, polyacrylic acid/polymethacrylic acid and polyvinylpyrrolidone (povidone). In certain embodiments, the binder is polyvinylpyrrolidone (povidone).

(1410) In some embodiments, enema formulations containing the chemical entities described herein include water and one or more (e.g., all) of the following excipients: One or more (e.g., one, two, or three) thickeners, viscosity enhancing agents, binders, and/or mucoadhesive agents (e.g., cellulose or cellulose esters or ethers or derivatives or salts thereof (e.g., methyl cellulose); and polyvinyl polymers such as polyvinylpyrrolidone (povidone); One or more (e.g., one or two; e.g., two) preservatives, such as a paraben, e.g., methyl 4-hydroxybenzoate (methylparaben), or a pharmaceutically acceptable salt or ester thereof, propyl 4-hydroxybenzoate (propylparaben), or a pharmaceutically acceptable salt or ester thereof, or a combination thereof; One or more (e.g., one or two; e.g., two) buffers, such as phosphate buffer system (e.g., sodium dihydrogen phospahate dehydrate, disodium phosphate dodecahydrate); One or more (e.g., one or two, e.g., two) glidants and/or lubricants, such as magnesium stearate and/or talc; One or more (e.g., one or two; e.g., one) disintegrants, such as crospovidone; and One or more (e.g., one or two; e.g., one) diluents, such as lactose (e.g., lactose monohydrate).

(1411) In certain of these embodiments, the chemical entity is a compound of Formula AA, or a pharmaceutically acceptable salt and/or hydrate and/or cocrystal thereof.

(1412) In certain embodiments, enema formulations containing the chemical entities described herein include water, methyl cellulose, povidone, methylparaben, propylparaben, sodium dihydrogen phospahate dehydrate, disodium phosphate dodecahydrate, crospovidone, lactose monohydrate, magnesium stearate, and talc. In certain of these embodiments, the chemical entity is a compound of Formula AA, or a pharmaceutically acceptable salt and/or hydrate and/or cocrystal thereof.

(1413) In certain embodiments, enema formulations containing the chemical entities described herein are provided in one or more kits or packs. In certain embodiments, the kit or pack includes two separately contained/packaged components, which when mixed together, provide the desired formulation (e.g., as a suspension). In certain of these embodiments, the two component system includes a first component and a second component, in which: (1) the first component (e.g., contained in a sachet) includes the chemical entity (as described anywhere herein) and one or more pharmaceutically acceptable excipients (e.g., together formulated as a solid preparation, e.g., together formulated as a wet granulated solid preparation); and (ii) the second component (e.g., contained in a vial or bottle) includes one or more liquids and one or more one or more other pharmaceutically acceptable excipients together forming a liquid carrier. In other embodiments, each of component (1) and (ii) is provided in its own separate kit or pack.

(1414) In certain of these embodiments, component (i) includes the chemical entity (e.g., a compound of Formula AA, or a pharmaceutically acceptable salt and/or hydrate and/or cocrystal thereof; e.g., a compound of Formula AA) and one or more (e.g., all) of the following excipients: (a) One or more (e.g., one) binders (e.g., a polyvinyl polymer, such as polyvinylpyrrolidone (povidone); (b) One or more (e.g., one or two, e.g., two) glidants and/or lubricants, such as magnesium stearate and/or talc; (c) One or more (e.g., one or two; e.g., one) disintegrants, such as crospovidone; and (d) One or more (e.g., one or two; e.g., one) diluents, such as lactose (e.g., lactose monohydrate).

(1415) In certain embodiments, component (i) includes from about 40 weight percent to about 80 weight percent (e.g., from about 50 weight percent to about 70 weight percent, from about 55 weight percent to about 70 weight percent; from about 60 weight percent to about 65 weight percent; e.g., about 62.1 weight percent) of the chemical entity (e.g., a compound of Formula AA, or a pharmaceutically acceptable salt and/or hydrate and/or cocrystal thereof).

(1416) In certain embodiments, component (i) includes from about 0.5 weight percent to about 5 weight percent (e.g., from about 1.5 weight percent to about 4.5 weight percent, from about 2 weight percent to about 3.5 weight percent; e.g., about 2.76 weight percent) of the binder (e.g., povidone).

(1417) In certain embodiments, component (i) includes from about 0.5 weight percent to about 5 weight percent (e.g., from about 0.5 weight percent to about 3 weight percent, from about 1 weight percent to about 3 weight percent; about 2 weight percent e.g., about 1.9 weight percent) of the disintegrant (e.g., crospovidone).

(1418) In certain embodiments, component (i) includes from about 10 weight percent to about 50 weight percent (e.g., from about 20 weight percent to about 40 weight percent, from about 25 weight percent to about 35 weight percent; e.g., about 31.03 weight percent) of the diluent (e.g., lactose, e.g., lactose monohydrate).

(1419) In certain embodiments, component (i) includes from about 0.05 weight percent to about 5 weight percent (e.g., from about 0.05 weight percent to about 3 weight percent) of the glidants and/or lubricants.

(1420) In certain embodiments (e.g., when component (i) includes one or more lubricants, such as magnesium stearate), component (i) includes from about 0.05 weight percent to about 1 weight percent (e.g., from about 0.05 weight percent to about 1 weight percent; from about 0.1 weight percent to about 1 weight percent; from about 0.1 weight percent to about 0.5 weight percent; e.g., about 0.27 weight percent) of the lubricant (e.g., magnesium stearate).

(1421) In certain embodiments (when component (i) includes one or more lubricants, such as talc), component (i) includes from about 0.5 weight percent to about 5 weight percent (e.g., from about 0.5 weight percent to about 3 weight percent, from about 1 weight percent to about 3 weight percent; from about 1.5 weight percent to about 2.5 weight percent; from about 1.8 weight percent to about 2.2 weight percent; about 1.93 weight percent) of the lubricant (e.g., talc).

(1422) In certain of these embodiments, each of (a), (b), (c), and (d) above is present.

(1423) In certain embodiments, component (i) includes the ingredients and amounts as shown in Table A.

(1424) TABLE-US-00003 TABLE A Ingredient Weight Percent A compound of Formula AA 40 weight percent to about 80 weight percent (e.g., from about 50 weight percent to about 70 weight percent, from about 55 weight percent to about 70 weight percent; from about 60 weight percent to about 65 weight percent; e.g., about 62.1 weight percent) Crospovidone (Kollidon CL) 0.5 weight percent to about 5 weight percent (e.g., from about 0.5 weight percent to about 3 weight percent, from about 1 weight percent to about 3 weight percent; about 1.93 weight percent lactose monohydrate about 10 weight percent to about 50 (Pharmatose 200M) weight percent (e.g., from about 20 weight percent to about 40 weight percent, from about 25 weight percent to about 35 weight percent; e.g., about 31.03 weight percent Povidone (Kollidon K30) about 0.5 weight percent to about 5 weight percent (e.g., from about 1.5 weight percent to about 4.5 weight percent, from about 2 weight percent to about 3.5 weight percent; e.g., about 2.76 weight percent talc 0.5 weight percent to about 5 weight percent (e.g., from about 0.5 weight percent to about 3 weight percent, from about 1 weight percent to about 3 weight percent; from about 1.5 weight percent to about 2.5 weight percent; from about 1.8 weight percent to about 2.2 weight percent; e.g., about 1.93 weight percent Magnesium stearate about 0.05 weight percent to about 1 weight percent (e.g., from about 0.05 weight percent to about 1 weight percent; from about 0.1 weight percent to about 1 weight percent; from about 0.1 weight percent to about 0.5 weight percent; e.g., about 0.27 weight percent

(1425) In certain embodiments, component (1) includes the ingredients and amounts as shown in Table B.

(1426) TABLE-US-00004 TABLE B Ingredient Weight Percent A compound of Formula AA About 62.1 weight percent) Crospovidone (Kollidon CL) About 1.93 weight percent lactose monohydrate About 31.03 weight percent (Pharmatose 200M) Povidone (Kollidon K30) About 2.76 weight percent talc About 1.93 weight percent Magnesium stearate About 0.27 weight percent

(1427) In certain embodiments, component (1) is formulated as a wet granulated solid preparation. In certain of these embodiments an internal phase of ingredients (the chemical entity, disintegrant, and diluent) are combined and mixed in a high-shear granulator. A binder (e.g., povidone) is dissolved in water to form a granulating solution. This solution is added to the Inner Phase mixture resulting in the development of granules. While not wishing to be bound by theory, granule development is believed to be facilitated by the interaction of the polymeric binder with the materials of the internal phase. Once the granulation is formed and dried, an external phase (e.g., one or more lubricants—not an intrinsic component of the dried granulation), is added to the dry granulation. It is believed that lubrication of the granulation is important to the flowability of the granulation, in particular for packaging.

(1428) In certain of the foregoing embodiments, component (ii) includes water and one or more (e.g., all) of the following excipients: (a′) One or more (e.g., one, two; e.g., two) thickeners, viscosity enhancing agents, binders, and/or mucoadhesive agents (e.g., cellulose or cellulose esters or ethers or derivatives or salts thereof (e.g., methyl cellulose); and polyvinyl polymers such as polyvinylpyrrolidone (povidone); (b′) One or more (e.g., one or two; e.g., two) preservatives, such as a paraben, e.g., methyl 4-hydroxybenzoate (methylparaben), or a pharmaceutically acceptable salt or ester thereof, propyl 4-hydroxybenzoate (propylparaben), or a pharmaceutically acceptable salt or ester thereof, or a combination thereof; and (c′) One or more (e.g., one or two; e.g., two) buffers, such as phosphate buffer system (e.g., sodium dihydrogen phospahate dihydrate, disodium phosphate dodecahydrate);

(1429) In certain of the foregoing embodiments, component (ii) includes water and one or more (e.g., all) of the following excipients: (a″) a first thickener, viscosity enhancing agent, binder, and/or mucoadhesive agent (e.g., a cellulose or cellulose ester or ether or derivative or salt thereof (e.g., methyl cellulose)); (a′″) a second thickener, viscosity enhancing agent, binder, and/or mucoadhesive agent (e.g., a polyvinyl polymer, such as polyvinylpyrrolidone (povidone)); (b″) a first preservative, such as a paraben, e.g., propyl 4-hydroxybenzoate (propylparaben), or a pharmaceutically acceptable salt or ester thereof; (b″) a second preservative, such as a paraben, e.g., methyl 4-hydroxybenzoate (methylparaben), or a pharmaceutically acceptable salt or ester thereof, (c″) a first buffer, such as phosphate buffer system (e.g., disodium phosphate dodecahydrate); (c′″) a second buffer, such as phosphate buffer system (e.g., sodium dihydrogen phospahate dehydrate),

(1430) In certain embodiments, component (ii) includes from about 0.05 weight percent to about 5 weight percent (e.g., from about 0.05 weight percent to about 3 weight percent, from about 0.1 weight percent to about 3 weight percent; e.g., about 1.4 weight percent) of (a′).

(1431) In certain embodiments, component (ii) includes from about 0.05 weight percent to about 5 weight percent (e.g., from about 0.05 weight percent to about 3 weight percent, from about 0.1 weight percent to about 2 weight percent; e.g., about 1.0 weight percent) of (a′″).

(1432) In certain embodiments, component (ii) includes from about 0.005 weight percent to about 0.1 weight percent (e.g., from about 0.005 weight percent to about 0.05 weight percent; e.g., about 0.02 weight percent) of (b″).

(1433) In certain embodiments, component (ii) includes from about 0.05 weight percent to about 1 weight percent (e.g., from about 0.05 weight percent to about 0.5 weight percent; e.g., about 0.20 weight percent) of (b′″).

(1434) In certain embodiments, component (ii) includes from about 0.05 weight percent to about 1 weight percent (e.g., from about 0.05 weight percent to about 0.5 weight percent; e.g., about 0.15 weight percent) of (c″).

(1435) In certain embodiments, component (ii) includes from about 0.005 weight percent to about 0.5 weight percent (e.g., from about 0.005 weight percent to about 0.3 weight percent; e.g., about 0.15 weight percent) of (c′″).

(1436) In certain of these embodiments, each of (a″)-(c′″) is present.

(1437) In certain embodiments, component (ii) includes water (up to 100%) and the ingredients and amounts as shown in Table C.

(1438) TABLE-US-00005 TABLE C Ingredient Weight Percent methyl cellulose (Methocel 0.05 weight percent to about 5 weight A15C premium) percent (e.g., from about 0.05 weight percent to about 3 weight percent, from about 0.1 weight percent to about 3 weight percent; e.g., about 1.4 weight percent Povidone (Kollidon K30) 0.05 weight percent to about 5 weight percent (e.g., from about 0.05 weight percent to about 3 weight percent, from about 0.1 weight percent to about 2 weight percent; e.g., about 1.0 weight percent propyl 4-hydroxybenzoate about 0.005 weight percent to about 0.1 weight percent (e.g., from about 0.005 weight percent to about 0.05 weight percent; e.g., about 0.02 weight percent) methyl 4-hydroxybenzoate about 0.05 weight percent to about 1 weight percent (e.g., from about 0.05 weight percent to about 0.5 weight percent; e.g., about 0.20 weight percent) disodium phosphate about 0.05 weight percent to about 1 dodecahydrate weight percent (e.g., from about 0.05 weight percent to about 0.5 weight percent; e.g., about 0.15 weight percent) sodium dihydrogen phospahate about 0.005 weight percent to about 0.5 dihydrate weight percent (e.g., from about 0.005 weight percent to about 0.3 weight percent; e.g., about 0.15 weight percent)

(1439) In certain embodiments, component (ii) includes water (up to 100%) and the ingredients and amounts as shown in Table D.

(1440) TABLE-US-00006 TABLE D Ingredient Weight Percent methyl cellulose (Methocel about 1.4 weight percent A15C premium) Povidone (Kollidon K30) about 1.0 weight percent propyl 4-hydroxybenzoate about 0.02 weight percent methyl 4-hydroxybenzoate about 0.20 weight percent disodium phosphate about 0.15 weight percent dodecahydrate sodium dihydrogen phospahate about 0.15 weight percent dihydrate

(1441) Ready-to-use” enemas are generally be provided in a “single-use” sealed disposable container of plastic or glass. Those formed of a polymeric material preferably have sufficient flexibility for ease of use by an unassisted patient. Typical plastic containers can be made of polyethylene. These containers may comprise a tip for direct introduction into the rectum. Such containers may also comprise a tube between the container and the tip. The tip is preferably provided with a protective shield which is removed before use. Optionally the tip has a lubricant to improve patient compliance.

(1442) In some embodiments, the enema formulation (e.g., suspension) is poured into a bottle for delivery after it has been prepared in a separate container. In certain embodiments, the bottle is a plastic bottle (e.g., flexible to allow for delivery by squeezing the bottle), which can be a polyethylene bottle (e.g., white in color). In some embodiments, the bottle is a single chamber bottle, which contains the suspension or solution. In other embodiments, the bottle is a multichamber bottle, where each chamber contains a separate mixture or solution. In still other embodiments, the bottle can further include a tip or rectal cannula for direct introduction into the rectum. In some embodiments, the enema formulation can be delivered in the device shown in FIGS. 3A-3C, which includes a plastic bottle, a breakable capsule, and a rectal cannula and single flow pack.

(1443) Dosages

(1444) The dosages may be varied depending on the requirement of the patient, the severity of the condition being treating and the particular compound being employed. Determination of the proper dosage for a particular situation can be determined by one skilled in the medical arts. The total daily dosage may be divided and administered in portions throughout the day or by means providing continuous delivery.

(1445) In some embodiments, the compounds described herein are administered at a dosage of from about 0.001 mg/Kg to about 500 mg/Kg (e.g., from about 0.001 mg/Kg to about 200 mg/Kg; from about 0.01 mg/Kg to about 200 mg/Kg; from about 0.01 mg/Kg to about 150 mg/Kg; from about 0.01 mg/Kg to about 100 mg/Kg; from about 0.01 mg/Kg to about 50 mg/Kg; from about 0.01 mg/Kg to about 10 mg/Kg; from about 0.01 mg/Kg to about 5 mg/Kg; from about 0.01 mg/Kg to about 1 mg/Kg; from about 0.01 mg/Kg to about 0.5 mg/Kg; from about 0.01 mg/Kg to about 0.1 mg/Kg; from about 0.1 mg/Kg to about 200 mg/Kg; from about 0.1 mg/Kg to about 150 mg/Kg; from about 0.1 mg/Kg to about 100 mg/Kg; from about 0.1 mg/Kg to about 50 mg/Kg; from about 0.1 mg/Kg to about 10 mg/Kg; from about 0.1 mg/Kg to about 5 mg/Kg; from about 0.1 mg/Kg to about 1 mg/Kg; from about 0.1 mg/Kg to about 0.5 mg/Kg).

(1446) In some embodiments, enema formulations include from about 0.5 mg to about 2500 mg (e.g., from about 0.5 mg to about 2000 mg, from about 0.5 mg to about 1000 mg, from about 0.5 mg to about 750 mg, from about 0.5 mg to about 600 mg, from about 0.5 mg to about 500 mg, from about 0.5 mg to about 400 mg, from about 0.5 mg to about 300 mg, from about 0.5 mg to about 200 mg; e.g., from about 5 mg to about 2500 mg, from about 5 mg to about 2000 mg, from about 5 mg to about 1000 mg; from about 5 mg to about 750 mg; from about 5 mg to about 600 mg; from about 5 mg to about 500 mg; from about 5 mg to about 400 mg; from about 5 mg to about 300 mg; from about 5 mg to about 200 mg; e.g., from about 50 mg to about 2000 mg, from about 50 mg to about 1000 mg, from about 50 mg to about 750 mg, from about 50 mg to about 600 mg, from about 50 mg to about 500 mg, from about 50 mg to about 400 mg, from about 50 mg to about 300 mg, from about 50 mg to about 200 mg; e.g., from about 100 mg to about 2500 mg, from about 100 mg to about 2000 mg, from about 100 mg to about 1000 mg, from about 100 mg to about 750 mg, from about 100 mg to about 700 mg, from about 100 mg to about 600 mg, from about 100 mg to about 500 mg, from about 100 mg to about 400 mg, from about 100 mg to about 300 mg, from about 100 mg to about 200 mg; e.g., from about 150 mg to about 2500 mg, from about 150 mg to about 2000 mg, from about 150 mg to about 1000 mg, from about 150 mg to about 750 mg, from about 150 mg to about 700 mg, from about 150 mg to about 600 mg, from about 150 mg to about 500 mg, from about 150 mg to about 400 mg, from about 150 mg to about 300 mg, from about 150 mg to about 200 mg; e.g., from about 150 mg to about 500 mg; e.g., from about 300 mg to about 2500 mg, from about 300 mg to about 2000 mg, from about 300 mg to about 1000 mg, from about 300 mg to about 750 mg, from about 300 mg to about 700 mg, from about 300 mg to about 600 mg; e.g., from about 400 mg to about 2500 mg, from about 400 mg to about 2000 mg, from about 400 mg to about 1000 mg, from about 400 mg to about 750 mg, from about 400 mg to about 700 mg, from about 400 mg to about 600 from about 400 mg to about 500 mg; e.g., 150 mg or 450 mg) of the chemical entity in from about 1 mL to about 3000 mL (e.g., from about 1 mL to about 2000 mL, from about 1 mL to about 1000 mL, from about 1 mL to about 500 mL, from about 1 mL to about 250 mL, from about 1 mL to about 100 mL, from about 10 mL to about 1000 mL, from about 10 mL to about 500 mL, from about 10 mL to about 250 mL, from about 10 mL to about 100 mL, from about 30 mL to about 90 mL, from about 40 mL to about 80 mL; from about 50 mL to about 70 mL; e.g., about 1 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, about 25 mL, about 30 mL, about 35 mL, about 40 mL, about 45 mL, about 50 mL, about 55 mL, about 60 mL, about 65 mL, about 70 mL, about 75 mL, about 100 mL, about 250 mL, or about 500 mL, or about 1000 mL, or about 2000 mL, or about 3000 mL; e.g., 60 mL) of liquid carrier.

(1447) In certain embodiments, enema formulations include from about 50 mg to about 250 mg (e.g., from about 100 mg to about 200; e.g., about 150 mg) of the chemical entity in from about 10 mL to about 100 mL (e.g., from about 20 mL to about 100 mL, from about 30 mL to about 90 mL, from about 40 mL to about 80 mL; from about 50 mL to about 70 mL) of liquid carrier. In certain embodiments, enema formulations include about 150 mg of the chemical entity in about 60 mL of the liquid carrier. In certain of these embodiments, the chemical entity is a compound of Formula AA, or a pharmaceutically acceptable salt and/or hydrate and/or cocrystal thereof. For example, enema formulations can include about 150 mg of a compound of Formula AA in about 60 mL of the liquid carrier.

(1448) In certain embodiments, enema formulations include from about 350 mg to about 550 mg (e.g., from about 400 mg to about 500; e.g., about 450 mg) of the chemical entity in from about 10 mL to about 100 mL (e.g., from about 20 mL to about 100 mL, from about 30 mL to about 90 mL, from about 40 mL to about 80 mL; from about 50 mL to about 70 mL) of liquid carrier. In certain embodiments, enema formulations include about 450 mg of the chemical entity in about 60 mL of the liquid carrier. In certain of these embodiments, the chemical entity is a compound of Formula AA, or a pharmaceutically acceptable salt and/or hydrate and/or cocrystal thereof. For example, enema formulations can include about 450 mg of a compound of Formula AA in about 60 mL of the liquid carrier.

(1449) In some embodiments, enema formulations include from about from about 0.01 mg/mL to about 50 mg/mL (e.g., from about 0.01 mg/mL to about 25 mg/mL; from about 0.01 mg/mL to about 10 mg/mL; from about 0.01 mg/mL to about 5 mg/mL; from about 0.1 mg/mL to about 50 mg/mL; from about 0.01 mg/mL to about 25 mg/mL; from about 0.1 mg/mL to about 10 mg/mL; from about 0.1 mg/mL to about 5 mg/mL; from about 1 mg/mL to about 10 mg/mL; from about 1 mg/mL to about 5 mg/mL; from about 5 mg/mL to about 10 mg/mL; e.g., about 2.5 mg/mL or about 7.5 mg/mL) of the chemical entity in liquid carrier. In certain of these embodiments, the chemical entity is a compound of Formula AA, or a pharmaceutically acceptable salt and/or hydrate and/or cocrystal thereof. For example, enema formulations can include about 2.5 mg/mL or about 7.5 mg/mL of a compound of Formula AA in liquid carrier.

(1450) Regimens

(1451) The foregoing dosages can be administered on a daily basis (e.g., as a single dose or as two or more divided doses) or non-daily basis (e.g., every other day, every two days, every three days, once weekly, twice weeks, once every two weeks, once a month).

(1452) In some embodiments, the period of administration of a compound described herein is for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more. In a further embodiment, a period of during which administration is stopped is for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more. In an embodiment, a therapeutic compound is administered to an individual for a period of time followed by a separate period of time. In another embodiment, a therapeutic compound is administered for a first period and a second period following the first period, with administration stopped during the second period, followed by a third period where administration of the therapeutic compound is started and then a fourth period following the third period where administration is stopped. In an aspect of this embodiment, the period of administration of a therapeutic compound followed by a period where administration is stopped is repeated for a determined or undetermined period of time. In a further embodiment, a period of administration is for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more. In a further embodiment, a period of during which administration is stopped is for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more.

(1453) Methods of Treatment

(1454) In some embodiments, methods for treating a subject having condition, disease or disorder in which a decrease or increase in NLRP3 activity (e.g., an increase, e.g., NLRP3 signaling) contributes to the pathology and/or symptoms and/or progression of the condition, disease or disorder are provided, comprising administering to a subject an effective amount of a chemical entity described herein (e.g., a compound described generically or specifically herein or a pharmaceutically acceptable salt thereof or compositions containing the same).

(1455) Indications

(1456) In some embodiments, the condition, disease or disorder is selected from: inappropriate host responses to infectious diseases where active infection exists at any body site, such as septic shock, disseminated intravascular coagulation, and/or adult respiratory distress syndrome; acute or chronic inflammation due to antigen, antibody and/or complement deposition; inflammatory conditions including arthritis, cholangitis, colitis, encephalitis, endocarditis, glomerulonephritis, hepatitis, myocarditis, pancreatitis, pericarditis, reperfusion injury and vasculitis, immune-based diseases such as acute and delayed hypersensitivity, graft rejection, and graft-versus-host disease; auto-immune diseases including Type 1 diabetes mellitus and multiple sclerosis. For example, the condition, disease or disorder may be an inflammatory disorder such as rheumatoid arthritis, osteoarthritis, septic shock, COPD and periodontal disease.

(1457) In some embodiments, the condition, disease or disorder is an autoimmune diseases. Non-limiting examples include rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, inflammatory bowel diseases (IBDs) comprising Crohn disease (CD) and ulcerative colitis (UC), which are chronic inflammatory conditions with polygenic susceptibility. In certain embodiments, the condition is an inflammatory bowel disease. In certain embodiments, the condition is Crohn's disease, autoimmune colitis, iatrogenic autoimmune colitis, ulcerative colitis, colitis induced by one or more chemotherapeutic agents, colitis induced by treatment with adoptive cell therapy, colitis associated by one or more alloimmune diseases (such as graft-vs-host disease, e.g., acute graft vs. host disease and chronic graft vs. host disease), radiation enteritis, collagenous colitis, lymphocytic colitis, microscopic colitis, and radiation enteritis. In certain of these embodiments, the condition is alloimmune disease (such as graft-vs-host disease, e.g., acute graft vs. host disease and chronic graft vs. host disease), celiac disease, irritable bowel syndrome, rheumatoid arthritis, lupus, scleroderma, psoriasis, cutaneous T-cell lymphoma, uveitis, and mucositis (e.g., oral mucositis, esophageal mucositis or intestinal mucositis).

(1458) In some embodiments, the condition, disease or disorder is selected from major adverse cardiovascular events such as cardiovascular death, non-fatal myocardial infarction and non-fatal stroke in patients with a prior hear attack and inflammatory atherosclerosis (see for example, NCT01327846).

(1459) In some embodiments, the condition, disease or disorder is selected from metabolic disorders such as type 2 diabetes, atherosclerosis, obesity and gout, as well as diseases of the central nervous system, such as Alzheimer's disease and multiple sclerosis and Amyotrophic Lateral Sclerosis and Parkinson disease, lung disease, such as asthma and COPD and pulmonary idiopathic fibrosis, liver disease, such as NASH syndrome, viral hepatitis and cirrhosis, pancreatic disease, such as acute and chronic pancreatitis, kidney disease, such as acute and chronic kidney injury, intestinal disease such as Crohn's disease and Ulcerative Colitis, skin disease such as psoriasis, musculoskeletal disease such as scleroderma, vessel disorders, such as giant cell arteritis, disorders of the bones, such as Osteoarthritis, osteoporosis and osteopetrosis disorders eye disease, such as glaucoma and macular degeneration, diseased caused by viral infection such as HIV and AIDS, autoimmune disease such as Rheumatoid Arthritis, Systemic Lupus Erythematosus, Autoimmune Thyroiditis, Addison's disease, pernicious anemia, cancer and aging.

(1460) In some embodiments, the condition, disease or disorder is a cardiovascular indication. In some embodiments, the condition, disease or disorder is myocardial infraction. In some embodiments, the condition, disease or disorder is stroke.

(1461) In some embodiments, the condition, disease or disorder is obesity.

(1462) In some embodiments, the condition, disease or disorder is Type 2 Diabetes.

(1463) In some embodiments, the condition, disease or disorder is NASH.

(1464) In some embodiments, the condition, disease or disorder is Alzheimer's disease.

(1465) In some embodiments, the condition, disease or disorder is gout.

(1466) In some embodiments, the condition, disease or disorder is SLE.

(1467) In some embodiments, the condition, disease or disorder is rheumatoid arthritis.

(1468) In some embodiments, the condition, disease or disorder is IBD.

(1469) In some embodiments, the condition, disease or disorder is multiple sclerosis.

(1470) In some embodiments, the condition, disease or disorder is COPD.

(1471) In some embodiments, the condition, disease or disorder is asthma.

(1472) In some embodiments, the condition, disease or disorder is scleroderma.

(1473) In some embodiments, the condition, disease or disorder is pulmonary fibrosis.

(1474) In some embodiments, the condition, disease or disorder is age related macular degeneration (AMD).

(1475) In some embodiments, the condition, disease or disorder is cystic fibrosis.

(1476) In some embodiments, the condition, disease or disorder is Muckle Wells syndrome.

(1477) In some embodiments, the condition, disease or disorder is familial cold autoinflammatory syndrome (FCAS).

(1478) In some embodiments, the condition, disease or disorder is chronic neurologic cutaneous and articular syndrome.

(1479) In some embodiments, the condition, disease or disorder is selected from: myelodysplastic syndromes (MDS); non-small cell lung cancer, such as non-small cell lung cancer in patients carrying mutation or overexpression of NLRP3; acute lymphoblastic leukemia (ALL), such as ALL in patients resistant to glucocorticoids treatment; Langerhan's cell histiocytosis (LCH); multiple myeloma; promyelocytic leukemia; acute myeloid leukemia (AML) chronic myeloid leukemia (CIVIL); gastric cancer; and lung cancer metastasis.

(1480) In some embodiments, the condition, disease or disorder is selected from: myelodysplastic syndromes (MDS); non-small cell lung cancer, such as non-small cell lung cancer in patients carrying mutation or overexpression of NLRP3; acute lymphoblastic leukemia (ALL), such as ALL in patients resistant to glucocorticoids treatment; Langerhan's cell histiocytosis (LCH); multiple myeloma; promyelocytic leukemia; gastric cancer; and lung cancer metastasis.

(1481) In some embodiments, the indication is MDS.

(1482) In some embodiments, the indication is non-small lung cancer in patients carrying mutation or overexpression of NLRP3.

(1483) In some embodiments, the indication is ALL in patients resistant to glucocorticoids treatment.

(1484) In some embodiments, the indication is LCH.

(1485) In some embodiments, the indication is multiple myeloma.

(1486) In some embodiments, the indication is promyelocytic leukemia.

(1487) In some embodiments, the indication is gastric cancer.

(1488) In some embodiments, the indication is lung cancer metastasis.

(1489) Combination Therapy

(1490) This disclosure contemplates both monotherapy regimens as well as combination therapy regimens.

(1491) In some embodiments, the methods described herein can further include administering one or more additional therapies (e.g., one or more additional therapeutic agents and/or one or more therapeutic regimens) in combination with administration of the compounds described herein.

(1492) In certain embodiments, the second therapeutic agent or regimen is administered to the subject prior to contacting with or administering the chemical entity (e.g., about one hour prior, or about 6 hours prior, or about 12 hours prior, or about 24 hours prior, or about 48 hours prior, or about 1 week prior, or about 1 month prior).

(1493) In other embodiments, the second therapeutic agent or regimen is administered to the subject at about the same time as contacting with or administering the chemical entity. By way of example, the second therapeutic agent or regimen and the chemical entity are provided to the subject simultaneously in the same dosage form. As another example, the second therapeutic agent or regimen and the chemical entity are provided to the subject concurrently in separate dosage forms.

(1494) In still other embodiments, the second therapeutic agent or regimen is administered to the subject after contacting with or administering the chemical entity (e.g., about one hour after, or about 6 hours after, or about 12 hours after, or about 24 hours after, or about 48 hours after, or about 1 week after, or about 1 month after).

(1495) Patient Selection

(1496) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related to NLRP3 polymorphism.

(1497) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related to NLRP3 where polymorphism is a gain of function

(1498) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related to NLRP3 polymorphism found in CAPS syndromes.

(1499) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related NLRP3 polymorphism where the polymorphism is VAR 014104 (R262W)

(1500) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related NLRP3 polymorphism where the polymorphism is a natural variant reported in http://www.uniprot.org/uniprot/Q96P20.

(1501) In some embodiments, the methods described herein further include the step of identifying a subject (e.g., a patient) in need of treatment for an indication related to NLRP3 activity, such as an indication related to point mutation of NLRP3 signaling.

(1502) Anti-TNFα Agents

(1503) The term “anti-TNFα agent” refers to an agent which directly or indirectly blocks, down-regulates, impairs, inhibits, impairs, or reduces TNFα activity and/or expression. In some embodiments, an anti-TNFα agent is an antibody or an antigen-binding fragment thereof, a fusion protein, a soluble TNFα receptor (a soluble tumor necrosis factor receptor superfamily member 1A (TNFR1) or a soluble tumor necrosis factor receptor superfamily 1B (TNFR2)), an inhibitory nucleic acid, or a small molecule TNFα antagonist. In some embodiments, the inhibitory nucleic acid is a ribozyme, small hairpin RNA, a small interfering RNA, an antisense nucleic acid, or an aptamer.

(1504) Exemplary anti-TNFα agents that directly block, down-regulate, impair, inhibit, or reduce TNFα activity and/or expression can, e.g., inhibit or decrease the expression level of TNFα or a receptor of TNFα (TNFR1 or TNFR2) in a cell (e.g., a cell obtained from a subject, a mammalian cell), or inhibit or reduce binding of TNFα to its receptor (TNFR1 and/or TNFR2) and/or. Non-limiting examples of anti-TNFα agents that directly block, down-regulate, impair, inhibit, or reduce TNFα activity and/or expression include an antibody or fragment thereof, a fusion protein, a soluble TNFα receptor (e.g., a soluble TNFR1 or soluble TNFR2), inhibitory nucleic acids (e.g., any of the examples of inhibitory nucleic acids described herein), and a small molecule TNFα antagonist.

(1505) Exemplary anti-TNFα agents that can indirectly block, down-regulate, impair, inhibit reduce TNFα activity and/or expression can, e.g., inhibit or decrease the level of downstream signaling of a TNFα receptor (e.g., TNFR1 or TNFR2) in a mammalian cell (e.g., decrease the level and/or activity of one or more of the following signaling proteins: AP-1, mitogen-activated protein kinase kinase kinase 5 (ASK1), inhibitor of nuclear factor kappa B (IKK), mitogen-activated protein kinase 8 (JNK), mitogen-activated protein kinase (MAPK), MEKK 1/4, MEKK 4/7, MEKK 3/6, nuclear factor kappa B (NF-κB), mitogen-activated protein kinase kinase kinase 14 (NIK), receptor interacting serine/threonine kinase 1 (RIP), TNFRSF1A associated via death domain (TRADD), and TNF receptor associated factor 2 (TRAF2), in a cell), and/or decrease the level of TNFα-induced gene expression in a mammalian cell (e.g., decrease the transcription of genes regulated by, e.g., one or more transcription factors selected from the group of activating transcription factor 2 (ATF2), c-Jun, and NF-κB). A description of downstream signaling of a TNFα receptor is provided in Wajant et al., Cell Death Differentiation 10:45-65, 2003 (incorporated herein by reference). For example, such indirect anti-TNFα agents can be an inhibitory nucleic acid that targets (decreases the expression) a signaling component downstream of a TNFα-induced gene (e.g., any TNFα-induced gene known in the art), a TNFα receptor (e.g., any one or more of the signaling components downstream of a TNFα receptor described herein or known in the art), or a transcription factor selected from the group of NF-κB, c-Jun, and ATF2.

(1506) In other examples, such indirect anti-TNFα agents can be a small molecule inhibitor of a protein encoded by a TNFα-induced gene (e.g., any protein encoded by a TNFα-induced gene known in the art), a small molecule inhibitor of a signaling component downstream of a TNFα receptor (e.g., any of the signaling components downstream of a TNFα receptor described herein or known in the art), and a small molecule inhibitor of a transcription factor selected from the group of ATF2, c-Jun, and NF-κB.

(1507) In other embodiments, anti-TNFα agents that can indirectly block, down-regulate, impair, or reduce one or more components in a cell (e.g., a cell obtained from a subject, a mammalian cell) that are involved in the signaling pathway that results in TNFα mRNA transcription, TNFα mRNA stabilization, and TNFα mRNA translation (e.g., one or more components selected from the group of CD14, c-Jun, ERK1/2, IKK, IκB, interleukin 1 receptor associated kinase 1 (IRAK), JNK, lipopolysaccharide binding protein (LBP), MEK1/2, MEK3/6, MEK4/7, MK2, MyD88, NF-κB, NIK, PKR, p38, AKT serine/threonine kinase 1 (rac), raf kinase (raf), ras, TRAF6, TTP). For example, such indirect anti-TNFα agents can be an inhibitory nucleic acid that targets (decreases the expression) of a component in a mammalian cell that is involved in the signaling pathway that results in TNFα mRNA transcription, TNFα mRNA stabilization, and TNFα mRNA translation (e.g., a component selected from the group of CD14, c-Jun, ERK1/2, IKK, IκB, IRAK, JNK, LBP, MEK1/2, MEK3/6, MEK4/7, MK2, MyD88, NF-κB, NIK, IRAK, lipopolysaccharide binding protein (LBP), PKR, p38, rac, raf, ras, TRAF6, TTP). In other examples, an indirect anti-TNFα agents is a small molecule inhibitor of a component in a mammalian cell that is involved in the signaling pathway that results in TNFα mRNA transcription, TNFα mRNA stabilization, and TNFα mRNA translation (e.g., a component selected from the group of CD14, c-Jun, ERK1/2, IKK, IκB, IRAK, JNK, lipopolysaccharide binding protein (LBP), MEK1/2, MEK3/6, MEK4/7, MK2, MyD88, NF-κB, NIK, IRAK, lipopolysaccharide binding protein (LBP), PKR, p38, rac, raf, ras, TRAF6, TTP).

(1508) Antibodies

(1509) In some embodiments, the anti-TNFα agent is an antibody or an antigen-binding fragment thereof (e.g., a Fab or a scFv). In some embodiments, an antibody or antigen-binding fragment of an antibody described herein can bind specifically to TNFα. In some embodiments, an antibody or antigen-binding fragment described herein binds specifically to any one of TNFα, TNFR1, or TNFR2. In some embodiments, an antibody or antigen-binding fragment of an antibody described herein can bind specifically to a TNFα receptor (TNFR1 or TNFR2).

(1510) In some embodiments, the antibody can be a humanized antibody, a chimeric antibody, a multivalent antibody, or a fragment thereof. In some embodiments, an antibody can be a scFv-Fc, a VHH domain, a VNAR domain, a (scFv).sub.2, a minibody, or a BiTE.

(1511) In some embodiments, an antibody can be a crossmab, a diabody, a scDiabody, a scDiabody-CH.sub.3, a Diabody-CH.sub.3, a DutaMab, a DT-IgG, a diabody-Fc, a scDiabody-HAS, a charge pair antibody, a Fab-arm exchange antibody, a SEEDbody, a Triomab, a LUZ-Y, a Fcab, a kλ-body, an orthogonal Fab, a DVD-IgG, an IgG(H)-scFv, a scFv-(H)IgG, an IgG(L)-scFv, a scFv-(L)-IgG, an IgG (L,H)-Fc, an IgG(H)-V, a V(H)-IgG, an IgG(L)-V, a V(L)-IgG, an KIH IgG-scFab, a 2scFv-IgG, an IgG-2scFv, a scFv4-Ig, a Zybody, a DVI-IgG, a nanobody, a nanobody-HSA, a DVD-Ig, a dual-affinity re-targeting antibody (DART), a triomab, a kih IgG with a common LC, an ortho-Fab IgG, a 2-in-1-IgG, IgG-ScFv, scFv2-Fc, a bi-nanobody, tanden antibody, a DART-Fc, a scFv-HAS-scFv, a DAF (two-in-one or four-in-one), a DNL-Fab3, knobs-in-holes common LC, knobs-in-holes assembly, a TandAb, a Triple Body, a miniantibody, a minibody, a TriBi minibody, a scFv-CH.sub.3 KIH, a Fab-scFv, a scFv-CH-CL-scFv, a F(ab')2-scFV2, a scFv-KIH, a Fab-scFv-Fc, a tetravalent HCAb, a scDiabody-Fc, a tandem scFv-Fc, an intrabody, a dock and lock bispecific antibody, an ImmTAC, a HSAbody, a tandem scFv, an IgG-IgG, a Cov-X-Body, and a scFv1-PEG-scFv2.

(1512) Non-limiting examples of an antigen-binding fragment of an antibody include an Fv fragment, a Fab fragment, a F(ab')2 fragment, and a Fab' fragment. Additional examples of an antigen-binding fragment of an antibody is an antigen-binding fragment of an antigen-binding fragment of an IgA (e.g., an antigen-binding fragment of IgA1 or IgA2) (e.g., an antigen-binding fragment of a human or humanized IgA, e.g., a human or humanized IgA1 or IgA2); an antigen-binding fragment of an IgD (e.g., an antigen-binding fragment of a human or humanized IgD); an antigen-binding fragment of an IgE (e.g., an antigen-binding fragment of a human or humanized IgE); an IgG (e.g., an antigen-binding fragment of IgG1, IgG2, IgG3, or IgG4) (e.g., an antigen-binding fragment of a human or humanized IgG, e.g., human or humanized IgG1, IgG2, IgG3, or IgG4); or an antigen-binding fragment of an IgM (e.g., an antigen-binding fragment of a human or humanized IgM).

(1513) Non-limiting examples of anti-TNFα agents that are antibodies that specifically bind to TNFα are described in Ben-Horin et al., Autoimmunity Rev. 13(1):24-30, 2014; Bongartz et al., JAMA 295(19):2275-2285, 2006; Butler et al., Eur. Cytokine Network 6(4):225-230, 1994; Cohen et al., Canadian J Gastroenterol. Hepatol. 15(6):376-384, 2001; Elliott et al., Lancet 1994; 344: 1125-1127, 1994; Feldmann et al., Ann. Rev. Immunol. 19(1):163-196, 2001; Rankin et al., Br. J Rheumatol. 2:334-342, 1995; Knight et al., Molecular Immunol. 30(16):1443-1453, 1993; Lorenz et al., J. Immunol. 156(4):1646-1653, 1996; Hinshaw et al., Circulatory Shock 30(3):279-292, 1990; Ordas et al., Clin. Pharmacol. Therapeutics 91(4):635-646, 2012; Feldman, Nature Reviews Immunol. 2(5):364-371, 2002; Taylor et al., Nature Reviews Rheumatol. 5(10):578-582, 2009; Garces et al., Annals Rheumatic Dis. 72(12):1947-1955, 2013; Palladino et al., Nature Rev. Drug Discovery 2(9):736-746, 2003; Sandborn et al., Inflammatory Bowel Diseases 5(2):119-133, 1999; Atzeni et al., Autoimmunity Reviews 12(7):703-708, 2013; Maini et al., Immunol. Rev. 144(1):195-223, 1995; Wanner et al., Shock 11(6):391-395, 1999; and U.S. Pat. Nos. 6,090,382; 6,258,562; and 6,509,015).

(1514) In certain embodiments, the anti-TNFα agent can include or is golimumab (Golimumab™), adalimumab (Humira™), infliximab (Remicade™), CDP571, CDP 870, or certolizumab pegol (Cimzia™). In certain embodiments, the anti-TNFα agent can be a TNFα inhibitor biosimilar. Examples of approved and late-phase TNFα inhibitor biosimilars include, but are not limited to, infliximab biosimilars such as Flixabi™ (SB2) from Samsung Bioepis, Inflectra® (CT-P13) from Celltrion/Pfizer, GS071 from Aprogen, Remsima™, PF-06438179 from Pfizer/Sandoz, NI-071 from Nichi-Iko Pharmaceutical Co., and ABP 710 from Amgen; adalimumab biosimilars such as Amgevita® (ABP 501) from Amgen and Exemptia™ from Zydus Cadila, BMO-2 or MYL-1401-A from Biocon/Mylan, CHS-1420 from Coherus, FKB327 from Kyowa Kirin, and BI 695501 from Boehringer Ingelheim; Solymbic®, SB5 from Samsung Bioepis, GP-2017 from Sandoz, ONS-3010 from Oncobiologics, M923 from Momenta, PF-06410293 from Pfizer, and etanercept biosimilars such as Erelzi™ from Sandoz/Novartis, Brenzys™ (SB4) from Samsung Bioepis, GP2015 from Sandoz, TuNEX® from Mycenax, LBEC0101 from LG Life, and CHS-0214 from Coherus.

(1515) In some embodiments of any of the methods described herein, the anti-TNFα agent is selected from the group consisting of: adalimumab, certolizumab, etanercept, golimumab, infliximabm, CDP571, and CDP 870.

(1516) In some embodiments, any of the antibodies or antigen-binding fragments described herein has a dissociation constant (K.sub.D) of less than 1×10.sup.−5M (e.g., less than 0.5×10.sup.−5 M, less than 1×10.sup.−6M, less than 0.5×10.sup.−6M, less than 1×10.sup.−7M, less than 0.5×10.sup.−7M, less than 1×10.sup.−8M, less than 0.5×10.sup.−8M, less than 1×10.sup.−9M, less than 0.5×10.sup.−9M, less than 1×10.sup.−10M, less than 0.5×10.sup.−10 M, less than 1×10.sup.−11M, less than 0.5×10.sup.−11M, or less than 1×10.sup.−12M), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR).

(1517) In some embodiments, any of the antibodies or antigen-binding fragments described herein has a K.sub.D of about 1×10.sup.−12 M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6 M, about 0.5×10.sup.−6M, about 1×10.sup.−7M, about 0.5×10.sup.−7M, about 1×10.sup.−8M, about 0.5×10.sup.−8M, about 1×10.sup.−9M, about 0.5×10.sup.−9M, about 1×10.sup.−10M, about 0.5×10.sup.−10M, about 1×10.sup.−11M, or about 0.5×10.sup.−11M (inclusive); about 0.5×10.sup.−11M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6M, about 0.5×10.sup.−6 M, about 1×10.sup.−7M, about 0.5×10.sup.−7M, about 1×10.sup.−8M, about 0.5×10.sup.−8M, about 1×10.sup.−9M, about 0.5×10.sup.−9M, about 1×10.sup.−10 M, about 0.5×10.sup.−10 M, or about 1×10.sup.−11M (inclusive); about 1×10.sup.−11M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6M, about 0.5×10.sup.−6M, about 1×10.sup.−7M, about 0.5×10.sup.−7M, about 1×10.sup.−8M, about 0.5×10.sup.−8M, about 1×10.sup.−9M, about 0.5×10.sup.−9M, about 1×10.sup.−10 M, or about 0.5×10.sup.−10 M (inclusive); about 0.5×10.sup.−10 M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6 M, about 0.5×10.sup.−6 M, about 1×10.sup.−7M, about 0.5×10.sup.−7M, about 1×10.sup.−8M, about 0.5×10.sup.−8M, about 1×10.sup.−9M, about 0.5×10.sup.−9M, or about 1×10.sup.−10 M (inclusive); about 1×10.sup.−10 M to about 1×10.sup.−5M, about 0.5×10.sup.−5 M, about 1×10.sup.−6M, about 0.5×10.sup.−6M, about 1×10.sup.−7M, about 0.5×10.sup.−7M, about 1×10.sup.−8M, about 0.5×10.sup.−8M, about 1×10.sup.−9M, or about 0.5×10.sup.−9M (inclusive); about 0.5×10.sup.−9M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6M, about 0.5×10.sup.−6M, about 1×10.sup.−7M, about 0.5×10.sup.−7M, about 1×10.sup.−8M, about 0.5×10.sup.−8M, or about 1×10.sup.−9M (inclusive); about 1×10.sup.−9M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6M, about 0.5×10.sup.−6M, about 1×10.sup.−7M, about 0.5×10.sup.−7M, about 1×10.sup.−8M, or about 0.5×10.sup.−8M (inclusive); about 0.5×10.sup.−8 M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6M, about 0.5×10.sup.−6M, about 1×10.sup.−7 M, about 0.5×10.sup.−7M, or about 1×10.sup.−8M (inclusive); about 1×10.sup.−8M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6M, about 0.5×10.sup.−6M, about 1×10.sup.−7M, or about 0.5×10.sup.−7M (inclusive); about 0.5×10.sup.−7M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6M, about 0.5×10.sup.−6M, or about 1×10.sup.−7M (inclusive); about 1×10.sup.−7M to about 1×10.sup.−5M, about 0.5×10.sup.−5M, about 1×10.sup.−6M, or about 0.5×10.sup.−6M (inclusive); about 0.5×10.sup.−6M to about 1×10.sup.−5 M, about 0.5×10.sup.−5M, or about 1×10.sup.−6M (inclusive); about 1×10.sup.−6M to about 1×10.sup.−5M or about 0.5×10.sup.−5M (inclusive); or about 0.5×10.sup.−5M to about 1×10.sup.−5M (inclusive), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR).

(1518) In some embodiments, any of the antibodies or antigen-binding fragments described herein has a K.sub.off of about 1×10.sup.−6 s.sup.−1 to about 1×10.sup.−3 s.sup.−1, about 0.5×10.sup.−3 s.sup.−1, about 1×10.sup.−4 s.sup.−1, about 0.5×10.sup.−4 s.sup.−1, about 1×10.sup.−5 s.sup.−1, or about 0.5×10.sup.−5 s.sup.−1 (inclusive); about 0.5×10.sup.−5 s.sup.−1 to about 1×10.sup.−3 s.sup.−1, about 0.5×10.sup.−3 s.sup.−1, about 1×10 s.sup.−1, about 0.5×10 s.sup.−1, or about 1×10.sup.−5 s.sup.−1 (inclusive); about 1×10.sup.−5 s.sup.−1 to about 1×10.sup.−3 s.sup.−1, about 0.5×10.sup.−3 s.sup.−1, about 1×10 s.sup.−1, or about 0.5×10.sup.−4 s.sup.−1 (inclusive); about 0.5×10.sup.−4 s.sup.−1 to about 1×10.sup.−3 s.sup.−1, about 0.5×10.sup.−3 s.sup.−1, or about 1×10.sup.−4 s.sup.−1 (inclusive); about 1×10.sup.−4 s.sup.−1 to about 1×10.sup.−3 s.sup.−1, or about 0.5×10.sup.−3 s.sup.−1 (inclusive); or about 0.5×10.sup.−5 s.sup.1 to about 1×10.sup.−3 s.sup.1 (inclusive), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR).

(1519) In some embodiments, any of the antibodies or antigen-binding fragments described herein has a K.sub.on of about 1×10.sup.2M.sup.−1 s.sup.−1 to about 1×10.sup.6M.sup.−1 s.sup.−1, about 0.5×10.sup.6 M.sup.−1 s.sup.−1, about 1×10.sup.5M.sup.−1 s.sup.−1, about 0.5×10.sup.5 M.sup.−1 s.sup.−1, about 1×10.sup.4M.sup.−1 s.sup.−1, about 0.5×10.sup.4 M.sup.−1 s.sup.−1, about 1×10.sup.3M.sup.−1 s.sup.−1, or about 0.5×10.sup.3 M.sup.−1 s.sup.−1(inclusive); about 0.5×10.sup.3M.sup.−1 s.sup.−1 to about 1×10.sup.6M.sup.−1 s.sup.−1, about 0.5×10.sup.6 M.sup.−1 s.sup.−1, about 1×10.sup.5M.sup.−1 s.sup.−1, about 0.5×10.sup.5 M.sup.−1 s.sup.−1, about 1×10.sup.4 M.sup.−1 s.sup.−1, about 0.5×10.sup.4 M.sup.−1 s.sup.−1, or about 1×10.sup.3 M.sup.−1 s.sup.−1 (inclusive); about 1×10.sup.3 M.sup.−1 s.sup.−1 to about 1×10.sup.6M.sup.−1 s.sup.−1, about 0.5×10.sup.6M.sup.−1 s.sup.−1, about 1×10.sup.5M.sup.−1 s.sup.−1, about 0.5×10.sup.5 M.sup.−1 s.sup.−1, about 1×10.sup.4 M.sup.−1 s.sup.−1, or about 0.5×10.sup.4 M.sup.−1 s.sup.−1 (inclusive); about 0.5×10.sup.4 M.sup.−1 s.sup.−1 to about 1×10.sup.6M.sup.−1 s.sup.−1, about 0.5×10.sup.6 M.sup.−1 s.sup.−1, about 1×10.sup.5M.sup.−1 s.sup.−1, about 0.5×10.sup.5 M.sup.−1 s.sup.−1, or about 1×10.sup.4 M.sup.−1 s.sup.−1 (inclusive); about 1×10.sup.4 M.sup.−1 s.sup.−1 to about 1×10.sup.6 M.sup.−1 s.sup.−1, about 0.5×10.sup.6 M.sup.−1 s.sup.−1, about 1×10.sup.5M.sup.−1 s.sup.−1, or about 0.5×10.sup.5M.sup.−1 s.sup.−1 (inclusive); about 0.5×10.sup.5M.sup.−1 s.sup.−1 to about 1×10.sup.6M.sup.−1 s.sup.−1, about 0.5×10.sup.6 M.sup.−1 s.sup.−1, or about 1×10.sup.5 M.sup.−1 s.sup.−1 (inclusive); about 1×10.sup.5M.sup.−1 s.sup.−1 to about 1×10.sup.6 M.sup.−1 s.sup.−1, or about 0.5×10.sup.6M.sup.−1 s.sup.−1 (inclusive); or about 0.5×10.sup.6M.sup.−1 s.sup.−1 to about 1×10.sup.6M.sup.−1 s.sup.−1 (inclusive), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR).

(1520) Fusion Proteins

(1521) In some embodiments, the anti-TNFα agent is a fusion protein (e.g., an extracellular domain of a TNFR fused to a partner peptide, e.g., an Fc region of an immunoglobulin, e.g., human IgG) (see, e.g., Deeg et al., Leukemia 16(2):162, 2002; Peppel et al., J Exp. Med. 174(6):1483-1489, 1991) or a soluble TNFR (e.g., TNFR1 or TNFR2) that binds specifically to TNFα. In some embodiments, the anti-TNFα agent includes or is a soluble TNFα receptor (e.g., Bjornberg et al., Lymphokine Cytokine Res. 13(3):203-211, 1994; Kozak et al., Am. J. Physiol. Reg. Integrative Comparative Physiol. 269(1):R23-R29, 1995; Tsao et al., Eur Respir J. 14(3):490-495, 1999; Watt et al., J Leukoc Biol. 66(6):1005-1013, 1999; Mohler et al., J. Immunol. 151(3):1548-1561, 1993; Nophar et al., EMBO J. 9(10):3269, 1990; Piguet et al., Eur. Respiratory J. 7(3):515-518, 1994; and Gray et al., Proc. Natl. Acad. Sci. U.S.A. 87(19):7380-7384, 1990). In some embodiments, the anti-TNFα agent includes or is etanercept (Enbrel™) (see, e.g., WO 91/03553 and WO 09/406,476, incorporated by reference herein). In some embodiments, the anti-TNFα agent inhibitor includes or is r-TBP-I (e.g., Gradstein et al., J. Acquir. Immune Defic. Syndr. 26(2): 111-117, 2001).

(1522) Inhibitory Nucleic Acids

(1523) Inhibitory nucleic acids that can decrease the expression of AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA expression in a mammalian cell include antisense nucleic acid molecules, i.e., nucleic acid molecules whose nucleotide sequence is complementary to all or part of a AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA (e.g., complementary to all or a part of any one of SEQ ID NOs: 1-37).

(1524) TABLE-US-00007 Human TNFα CDS (SEQ ID NO: 1) ATGAGCACTGAAAGCATGATCCGGGACGTGGAGCTGGCCGAGGAGGCGC TCCCCAAGAAGACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCT CAGCCTCTTCTCCTTCCTGATCGTGGCAGGCGCCACCACGCTCTTCTGC CTGCTGCACTTTGGAGTGATCGGCCCCCAGAGGGAAGAGTTCCCCAGGG ACCTCTCTCTAATCAGCCCTCTGGCCCAGGCAGTCAGATCATCTTCTCG AACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGCAAACCCTCAAGCT GAGGGGCAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGGCCA ATGGCGTGGAGCTGAGAGATAACCAGCTGGTGGTGCCATCAGAGGGCCT GTACCTCATCTACTCCCAGGTCCTCTTCAAGGGCCAAGGCTGCCCCTCC ACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCCGTCTCCTACC AGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGA GACCCCAGAGGGGGCTGAGGCCAAGCCCTGGTATGAGCCCATCTATCTG GGAGGGGTCTTCCAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCA ATCGGCCCGACTATCTCGACTTTGCCGAGTCTGGGCAGGTCTACTTTGG GATCATTGCCCTGTGA. Human TNFR1 CDS (SEQ ID NO: 2) ATGGGCCTCTCCACCGTGCCTGACCTGCTGCTGCCACTGGTGCTCCTGG AGCTGTTGGTGGGAATATACCCCTCAGGGGTTATTGGACTGGTCCCTCA CCTAGGGGACAGGGAGAAGAGAGATAGTGTGTGTCCCCAAGGAAAATAT ATCCACCCTCAAAATAATTCGATTTGCTGTACCAAGTGCCACAAAGGAA CCTACTTGTACAATGACTGTCCAGGCCCGGGGCAGGATACGGACTGCAG GGAGTGTGAGAGCGGCTCCTTCACCGCTTCAGAAAACCACCTCAGACAC TGCCTCAGCTGCTCCAAATGCCGAAAGGAAATGGGTCAGGTGGAGATCT CTTCTTGCACAGTGGACCGGGACACCGTGTGTGGCTGCAGGAAGAACCA GTACCGGCATTATTGGAGTGAAAACCTTTTCCAGTGCTTCAATTGCAGC CTCTGCCTCAATGGGACCGTGCACCTCTCCTGCCAGGAGAAACAGAACA CCGTGTGCACCTGCCATGCAGGTTTCTTTCTAAGAGAAAACGAGTGTGT CTCCTGTAGTAACTGTAAGAAAAGCCTGGAGTGCACGAAGTTGTGCCTA CCCCAGATTGAGAATGTTAAGGGCACTGAGGACTCAGGCACCACAGTGC TGTTGCCCCTGGTCATTTTCTTTGGTCTTTGCCTTTTATCCCTCCTCTT CATTGGTTTAATGTATCGCTACCAACGGTGGAAGTCCAAGCTCTACTCC ATTGTTTGTGGGAAATCGACACCTGAAAAAGAGGGGGAGCTTGAAGGAA CTACTACTAAGCCCCTGGCCCCAAACCCAAGCTTCAGTCCCACTCCAGG CTTCACCCCCACCCTGGGCTTCAGTCCCGTGCCCAGTTCCACCTTCACC TCCAGCTCCACCTATACCCCCGGTGACTGTCCCAACTTTGCGGCTCCCC GCAGAGAGGTGGCACCACCCTATCAGGGGGCTGACCCCATCCTTGCGAC AGCCCTCGCCTCCGACCCCATCCCCAACCCCCTTCAGAAGTGGGAGGAC AGCGCCCACAAGCCACAGAGCCTAGACACTGATGACCCCGCGACGCTGT ACGCCGTGGTGGAGAACGTGCCCCCGTTGCGCTGGAAGGAATTCGTGCG GCGCCTAGGGCTGAGCGACCACGAGATCGATCGGCTGGAGCTGCAGAAC GGGCGCTGCCTGCGCGAGGCGCAATACAGCATGCTGGCGACCTGGAGGC GGCGCACGCCGCGGCGCGAGGCCACGCTGGAGCTGCTGGGACGCGTGCT CCGCGACATGGACCTGCTGGGCTGCCTGGAGGACATCGAGGAGGCGCTT TGCGGCCCCGCCGCCCTCCCGCCCGCGCCCAGTCTTCTCAGATGA. Human TNFR2 CDS (SEQ ID NO: 3) ATTCTTCCCCTGGTGGCCATGGGACCCAGGTCAATGTCACCTGCATCGT GAACGTCTGTAGCAGCTCTGACCACAGCTCACAGTGCTCCTCCCAAGCC AGCTCCACAATGGGAGACACAGATTCCAGCCCCTCGGAGTCCCCGAAGG ACGAGCAGGTCCCCTTCTCCAAGGAGGAATGTGCCTTTCGGTCACAGCT GGAGACGCCAGAGACCCTGCTGGGGAGCACCGAAGAGAAGCCCCTGCCC CTTGGAGTGCCTGATGCTGGGATGAAGCCCAGTTAA. Human TRADD CDS (SEQ ID NO: 4) ATGGCAGCTGGGCAAAATGGGCACGAAGAGTGGGTGGGCAGCGCATACC TGTTTGTGGAGTCCTCGCTGGACAAGGTGGTCCTGTCGGATGCCTACGC GCACCCCCAGCAGAAGGTGGCAGTGTACAGGGCTCTGCAGGCTGCCTTG GCAGAGAGCGGCGGGAGCCCGGACGTGCTGCAGATGCTGAAGATCCACC GCAGCGACCCGCAGCTGATCGTGCAGCTGCGATTCTGCGGGCGGCAGCC CTGTGGCCGCTTCCTCCGCGCCTACCGCGAGGGGGCGCTGCGCGCCGCG CTGCAGAGGAGCCTGGCGGCCGCGCTCGCCCAGCACTCGGTGCCGCTGC AACTGGAGCTGCGCGCCGGCGCCGAGCGGCTGGACGCTTTGCTGGCGGA CGAGGAGCGCTGTTTGAGTTGCATCCTAGCCCAGCAGCCCGACCGGCTC CGGGATGAAGAACTGGCTGAGCTGGAGGATGCGCTGCGAAATCTGAAGT GCGGCTCGGGGGCCCGGGGTGGCGACGGGGAGGTCGCTTCGGCCCCCTT GCAGCCCCCGGTGCCCTCTCTGTCGGAGGTGAAGCCGCCGCCGCCGCCG CCACCTGCCCAGACTTTTCTGTTCCAGGGTCAGCCTGTAGTGAATCGGC CGCTGAGCCTGAAGGACCAACAGACGTTCGCGCGCTCTGTGGGTCTCAA ATGGCGCAAGGTGGGGCGCTCACTGCAGCGAGGCTGCCGGGCGCTGCGG GACCCGGCGCTGGACTCGCTGGCCTACGAGTACGAGCGCGAGGGACTGT ACGAGCAGGCCTTCCAGCTGCTGCGGCGCTTCGTGCAGGCCGAGGGCCG CCGCGCCACGCTGCAGCGCCTGGTGGAGGCACTCGAGGAGAACGAGCTC ACCAGCCTGGCAGAGGACTTGCTGGGCCTGACCGATCCCAATGGCGGCC TGGCCTAG. Human TRAF2 CDS (SEQ ID NO: 5) ATGGCTGCAGCTAGCGTGACCCCCCCTGGCTCCCTGGAGTTGCTACAGC CCGGCTTCTCCAAGACCCTCCTGGGGACCAAGCTGGAAGCCAAGTACCT GTGCTCCGCCTGCAGAAACGTCCTCCGCAGGCCCTTCCAGGCGCAGTGT GGCCACCGGTACTGCTCCTTCTGCCTGGCCAGCATCCTCAGCTCTGGGC CTCAGAACTGTGCTGCCTGTGTTCACGAGGGCATATATGAAGAAGGCAT TTCTATTTTAGAAAGCAGTTCGGCCTTCCCAGATAATGCTGCCCGCAGG GAGGTGGAGAGCCTGCCGGCCGTCTGTCCCAGTGATGGATGCACCTGGA AGGGGACCCTGAAAGAATACGAGAGCTGCCACGAAGGCCGCTGCCCGCT CATGCTGACCGAATGTCCCGCGTGCAAAGGCCTGGTCCGCCTTGGTGAA AAGGAGCGCCACCTGGAGCACGAGTGCCCGGAGAGAAGCCTGAGCTGCC GGCATTGCCGGGCACCCTGCTGCGGAGCAGACGTGAAGGCGCACCACGA GGTCTGCCCCAAGTTCCCCTTAACTTGTGACGGCTGCGGCAAGAAGAAG ATCCCCCGGGAGAAGTTTCAGGACCACGTCAAGACTTGTGGCAAGTGTC GAGTCCCTTGCAGATTCCACGCCATCGGCTGCCTCGAGACGGTAGAGGG TGAGAAACAGCAGGAGCACGAGGTGCAGTGGCTGCGGGAGCACCTGGCC ATGCTACTGAGCTCGGTGCTGGAGGCAAAGCCCCTCTTGGGAGACCAGA GCCACGCGGGGTCAGAGCTCCTGCAGAGGTGCGAGAGCCTGGAGAAGAA GACGGCCACTTTTGAGAACATTGTCTGCGTCCTGAACCGGGAGGTGGAG AGGGTGGCCATGACTGCCGAGGCCTGCAGCCGGCAGCACCGGCTGGACC AAGACAAGATTGAAGCCCTGAGTAGCAAGGTGCAGCAGCTGGAGAGGAG CATTGGCCTCAAGGACCTGGCGATGGCTGACTTGGAGCAGAAGGTCTTG GAGATGGAGGCATCCACCTACGATGGGGTCTTCATCTGGAAGATCTCAG ACTTCGCCAGGAAGCGCCAGGAAGCTGTGGCTGGCCGCATACCCGCCAT CTTCTCCCCAGCCTTCTACACCAGCAGGTACGGCTACAAGATGTGTCTG CGTATCTACCTGAACGGCGACGGCACCGGGCGAGGAACACACCTGTCCC TCTTCTTTGTGGTGATGAAGGGCCCGAATGACGCCCTGCTGCGGTGGCC CTTCAACCAGAAGGTGACCTTAATGCTGCTCGACCAGAATAACCGGGAG CACGTGATTGACGCCTTCAGGCCCGACGTGACTTCATCCTCTTTTCAGA GGCCAGTCAACGACATGAACATCGCAAGCGGCTGCCCCCTCTTCTGCCC CGTCTCCAAGATGGAGGCAAAGAATTCCTACGTGCGGGACGATGCCATC TTCATCAAGGCCATTGTGGACCTGACAGGGCTCTAA. Human AP-1 CDS (SEQ ID NO: 6) ATGGAAACACCCTTCTACGGCGATGAGGCGCTGAGCGGCCTGGGCGGCG GCGCCAGTGGCAGCGGCGGCAGCTTCGCGTCCCCGGGCCGCTTGTTCCC CGGGGCGCCCCCGACGGCCGCGGCCGGCAGCATGATGAAGAAGGACGCG CTGACGCTGAGCCTGAGTGAGCAGGTGGCGGCAGCGCTCAAGCCTGCGG CCGCGCCGCCTCCTACCCCCCTGCGCGCCGACGGCGCCCCCAGCGCGGC ACCCCCCGACGGCCTGCTCGCCTCTCCCGACCTGGGGCTGCTGAAGCTG GCCTCCCCCGAGCTCGAGCGCCTCATCATCCAGTCCAACGGGCTGGTCA CCACCACGCCGACGAGCTCACAGTTCCTCTACCCCAAGGTGGCGGCCAG CGAGGAGCAGGAGTTCGCCGAGGGCTTCGTCAAGGCCCTGGAGGATTTA CACAAGCAGAACCAGCTCGGCGCGGGCGCGGCCGCTGCCGCCGCCGCCG CCGCCGCCGGGGGGCCCTCGGGCACGGCCACGGGCTCCGCGCCCCCCGG CGAGCTGGCCCCGGCGGCGGCCGCGCCCGAAGCGCCTGTCTACGCGAAC CTGAGCAGCTACGCGGGCGGCGCCGGGGGCGCGGGGGGCGCCGCGACGG TCGCCTTCGCTGCCGAACCTGTGCCCTTCCCGCCGCCGCCACCCCCAGG CGCGTTGGGGCCGCCGCGCCTGGCTGCGCTCAAGGACGAGCCACAGACG GTGCCCGACGTGCCGAGCTTCGGCGAGAGCCCGCCGTTGTCGCCCATCG ACATGGACACGCAGGAGCGCATCAAGGCGGAGCGCAAGCGGCTGCGCAA CCGCATCGCCGCCTCCAAGTGCCGCAAGCGCAAGCTGGAGCGCATCTCG CGCCTGGAAGAGAAAGTGAAGACCCTCAAGAGTCAGAACACGGAGCTGG CGTCCACGGCGAGCCTGCTGCGCGAGCAGGTGGCGCAGCTCAAGCAGAA AGTCCTCAGCCACGTCAACAGCGGCTGCCAGCTGCTGCCCCAGCACCAG GTGCCCGCGTACTGA. Human ASK1 CDS (SEQ ID NO: 7) ATGAGCACGGAGGCGGACGAGGGCATCACTTTCTCTGTGCCACCCTTCG CCCCCTCGGGCTTCTGCACCATCCCCGAGGGCGGCATCTGCAGGAGGGG AGGAGCGGCGGCGGTGGGCGAGGGCGAGGAGCACCAGCTGCCACCGCCG CCGCCGGGCAGTTTCTGGAACGTGGAGAGCGCCGCTGCCCCTGGCATCG GTTGTCCGGCGGCCACCTCCTCGAGCAGTGCCACCCGAGGCCGGGGCAG CTCTGTTGGCGGGGGCAGCCGACGGACCACGGTGGCATATGTGATCAAC GAAGCGAGCCAAGGGCAACTGGTGGTGGCCGAGAGCGAGGCCCTGCAGA GCTTGCGGGAGGCGTGCGAGACAGTGGGCGCCACCCTGGAACCCTGCAT TTTGGGAAACTCGACTTTGGAGAAACCACCGTGCTGGACCGCTTTTACA ATGCAGATATTGCGGTGGTGGAGATGAGCGATGCCTTCCGGCAGCCGTC CTTGTTTTACCACCTTGGGGTGAGAGAAAGTTTCAGCATGGCCAACAAC ATCATCCTCTACTGCGATACTAACTCGGACTCTCTGCAGTCACTGAAGG AAATCATTTGCCAGAAGAATACTATGTGCACTGGGAACTACACCTTTGT TCCTTACATGATAACTCCACATAACAAAGTCTACTGCTGTGACAGCAGC TTCATGAAGGGGTTGACAGAGCTCATGCAACCGAACTTCGAGCTGCTTC TTGGACCCATCTGCTTACCTCTTGTGGATCGTTTTATTCAACTTTTGAA GGTGGCACAAGCAAGTTCTAGCCAGTACTTCCGGGAATCTATACTCAAT GACATCAGGAAAGCTCGTAATTTATACACTGGTAAAGAATTGGCAGCTG AGTTGGCAAGAATTCGGCAGCGAGTAGATAATATCGAAGTCTTGACAGC AGATATTGTCATAAATCTGTTACTTTCCTACAGAGATATCCAGGACTAT GATTCTATTGTGAAGCTGGTAGAGACTTTAGAAAAACTGCCAACCTTTG ATTTGGCCTCCCATCACCATGTGAAGTTTCATTATGCATTTGCACTGAA TAGGAGAAATCTCCCTGGTGACAGAGCAAAAGCTCTTGATATTATGATT CCCATGGTGCAAAGCGAAGGACAAGTTGCTTCAGATATGTATTGCCTAG TTGGTCGAATCTACAAAGATATGTTTTTGGACTCTAATTTCACGGACAC TGAAAGCAGAGACCATGGAGCTTCTTGGTTCAAAAAGGCATTTGAATCT GAGCCAACACTACAGTCAGGAATTAATTATGCGGTCCTCCTCCTGGCAG CTGGACACCAGTTTGAATCTTCCTTTGAGCTCCGGAAAGTTGGGGTGAA GCTAAGTAGTCTTCTTGGTAAAAAGGGAAACTTGGAAAAACTCCAGAGC TACTGGGAAGTTGGATTTTTTCTGGGGGCCAGCGTCCTAGCCAATGACC ACATGAGAGTCATTCAAGCATCTGAAAAGCTTTTTAAACTGAAGACACC AGCATGGTACCTCAAGTCTATTGTAGAGACAATTTTGATATATAAGCAT TTTGTGAAACTGACCACAGAACAGCCTGTGGCCAAGCAAGAACTTGTGG ACTTTTGGATGGATTTCCTGGTCGAGGCCACAAAGACAGATGTTACTGT GGTTAGGTTTCCAGTATTAATATTAGAACCAACCAAAATCTATCAACCT TCTTATTTGTCTATCAACAATGAAGTTGAGGAAAAGACAATCTCTATTT GGCACGTGCTTCCTGATGACAAGAAAGGTATACATGAGTGGAATTTTAG TGCCTCTTCTGTCAGGGGAGTGAGTATTTCTAAATTTGAAGAAAGATGC TGCTTTCTTTATGTGCTTCACAATTCTGATGATTTCCAAATCTATTTCT GTACAGAACTTCATTGTAAAAAGTTTTTTGAGATGGTGAACACCATTAC CGAAGAGAAGGGGAGAAGCACAGAGGAAGGAGACTGTGAAAGTGACTTG CTGGAGTATGACTATGAATATGATGAAAATGGTGACAGAGTCGTTTTAG GAAAAGGCACTTATGGGATAGTCTACGCAGGTCGGGACTTGAGCAACCA AGTCAGAATTGCTATTAAGGAAATCCCAGAGAGAGACAGCAGATACTCT CAGCCCCTGCATGAAGAAATAGCATTGCATAAACACCTGAAGCACAAAA ATATTGTCCAGTATCTGGGCTCTTTCAGTGAGAATGGTTTCATTAAAAT CTTCATGGAGCAGGTCCCTGGAGGAAGTCTTTCTGCTCTCCTTCGTTCC AAATGGGGTCCATTAAAAGACAATGAGCAAACAATTGGCTTTTATACAA AGCAAATACTGGAAGGATTAAAATATCTCCATGACAATCAGATAGTTCA CCGGGACATAAAGGGTGACAATGTGTTGATTAATACCTACAGTGGTGTT CTCAAGATCTCTGACTTCGGAACATCAAAGAGGCTTGCTGGCATAAACC CCTGTACTGAAACTTTTACTGGTACCCTCCAGTATATGGCACCAGAAAT AATAGATAAAGGACCAAGAGGCTACGGAAAAGCAGCAGACATCTGGTCT CTGGGCTGTACAATCATTGAAATGGCCACAGGAAAACCCCCATTTTATG AACTGGGAGAACCACAAGCAGCTATGTTCAAGGTGGGAATGTTTAAAGT CCACCCTGAGATCCCAGAGTCCATGTCTGCAGAGGCCAAGGCATTCATA CTGAAATGTTTTGAACCAGATCCTGACAAGAGAGCCTGTGCTAACGACT TGCTTGTTGATGAGTTTTTAAAAGTTTCAAGCAAAAAGAAAAAGACACA ACCTAAGCTTTCAGCTCTTTCAGCTGGATCAAATGAATATCTCAGGAGT ATATCCTTGCCGGTACCTGTGCTGGTGGAGGACACCAGCAGCAGCAGTG AGTACGGCTCAGTTTCACCCGACACGGAGTTGAAAGTGGACCCCTTCTC TTTCAAAACAAGAGCCAAGTCCTGCGGAGAAAGAGATGTCAAGGGAATT CGGACACTCTTTTTGGGCATTCCAGATGAGAATTTTGAAGATCACAGTG CTCCTCCTTCCCCTGAAGAAAAAGATTCTGGATTCTTCATGCTGAGGAA GGACAGTGAGAGGCGAGCTACCCTTCACAGGATCCTGACGGAAGACCAA GACAAAATTGTGAGAAACCTAATGGAATCTTTAGCTCAGGGGGCTGAAG AACCGAAACTAAAATGGGAACACATCACAACCCTCATTGCAAGCCTCAG AGAATTTGTGAGATCCACTGACCGAAAAATCATAGCCACCACACTGTCA AAGCTGAAACTGGAGCTGGACTTCGACAGCCATGGCATTAGCCAAGTCC AGGTGGTACTCTTTGGTTTTCAAGATGCTGTCAATAAAGTTCTTCGGAA TCATAACATCAAGCCGCACTGGATGTTTGCCTTAGACAGTATCATTCGG AAGGCGGTACAGACAGCCATTACCATCCTGGTTCCAGAACTAAGGCCAC ATTTCAGCCTTGCATCTGAGAGTGATACTGCTGATCAAGAAGACTTGGA TGTAGAAGATGACCATGAGGAACAGCCTTCAAATCAAACTGTCCGAAGA CCTCAGGCTGTCATTGAAGATGCTGTGGCTACCTCAGGCGTGAGCACGC TCAGTTCTACTGTGTCTCATGATTCCCAGAGTGCTCACCGGTCACTGAA TGTACAGCTTGGAAGGATGAAAATAGAAACCAATAGATTACTGGAAGAA TTGGTTCGGAAAGAGAAAGAATTACAAGCACTCCTTCATCGAGCTATTG AAGAAAAAGACCAAGAAATTAAACACCTGAAGCTTAAGTCCCAACCCAT AGAAATTCCTGAATTGCCTGTATTTCATCTAAATTCTTCTGGCACAAAT ACTGAAGATTCTGAACTTACCGACTGGCTGAGAGTGAATGGAGCTGATG AAGACACTATAAGCCGGTTTTTGGCTGAAGATTATACACTATTGGATGT TCTCTACTATGTTACACGTGATGACTTAAAATGCTTGAGACTAAGGGGA GGGATGCTGTGCACACTGTGGAAGGCTATCATTGACTTTCGAAACAAAC AGACTTGA. Human CD14 CDS (SEQ ID NO: 8) ATGGAGCGCGCGTCCTGCTTGTTGCTGCTGCTGCTGCCGCTGGTGCACG TCTCTGCGACCACGCCAGAACCTTGTGAGCTGGACGATGAAGATTTCCG CTGCGTCTGCAACTTCTCCGAACCTCAGCCCGACTGGTCCGAAGCCTTC CAGTGTGTGTCTGCAGTAGAGGTGGAGATCCATGCCGGCGGTCTCAACC TAGAGCCGTTTCTAAAGCGCGTCGATGCGGACGCCGACCCGCGGCAGTA TGCTGACACGGTCAAGGCTCTCCGCGTGCGGCGGCTCACAGTGGGAGCC GCACAGGTTCCTGCTCAGCTACTGGTAGGCGCCCTGCGTGTGCTAGCGT ACTCCCGCCTCAAGGAACTGACGCTCGAGGACCTAAAGATAACCGGCAC CATGCCTCCGCTGCCTCTGGAAGCCACAGGACTTGCACTTTCCAGCTTG CGCCTACGCAACGTGTCGTGGGCGACAGGGCGTTCTTGGCTCGCCGAGC TGCAGCAGTGGCTCAAGCCAGGCCTCAAGGTACTGAGCATTGCCCAAGC ACACTCGCCTGCCTTTTCCTGCGAACAGGTTCGCGCCTTCCCGGCCCTT ACCAGCCTAGACCTGTCTGACAATCCTGGACTGGGCGAACGCGGACTGA TGGCGGCTCTCTGTCCCCACAAGTTCCCGGCCATCCAGAATCTAGCGCT GCGCAACACAGGAATGGAGACGCCCACAGGCGTGTGCGCCGCACTGGCG GCGGCAGGTGTGCAGCCCCACAGCCTAGACCTCAGCCACAACTCGCTGC GCGCCACCGTAAACCCTAGCGCTCCGAGATGCATGTGGTCCAGCGCCCT GAACTCCCTCAATCTGTCGTTCGCTGGGCTGGAACAGGTGCCTAAAGGA CTGCCAGCCAAGCTCAGAGTGCTCGATCTCAGCTGCAACAGACTGAACA GGGCGCCGCAGCCTGACGAGCTGCCCGAGGTGGATAACCTGACACTGGA CGGGAATCCCTTCCTGGTCCCTGGAACTGCCCTCCCCCACGAGGGCTCA ATGAACTCCGGCGTGGTCCCAGCCTGTGCACGTTCGACCCTGTCGGTGG GGGTGTCGGGAACCCTGGTGCTGCTCCAAGGGGCCCGGGGCTTTGCCTA A. Human ERK1 CDS (SEQ ID NO: 9) ATGGCGGCGGCGGCGGCTCAGGGGGGCGGGGGCGGGGAGCCCCGTAGAA CCGAGGGGGTCGGCCCGGGGGTCCCGGGGGAGGTGGAGATGGTGAAGGG GCAGCCGTTCGACGTGGGCCCGCGCTACACGCAGTTGCAGTACATCGGC GAGGGCGCGTACGGCATGGTCAGCTCGGCCTATGACCACGTGCGCAAGA CTCGCGTGGCCATCAAGAAGATCAGCCCCTTCGAACATCAGACCTACTG CCAGCGCACGCTCCGGGAGATCCAGATCCTGCTGCGCTTCCGCCATGAG AATGTCATCGGCATCCGAGACATTCTGCGGGCGTCCACCCTGGAAGCCA TGAGAGATGTCTACATTGTGCAGGACCTGATGGAGACTGACCTGTACAA GTTGCTGAAAAGCCAGCAGCTGAGCAATGACCATATCTGCTACTTCCTC TACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCCAACGTGCTCC ACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCT TAAGATTTGTGATTTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGAC CACACCGGCTTCCTGACGGAGTATGTGGCTACGCGCTGGTACCGGGCCC CAGAGATCATGCTGAACTCCAAGGGCTATACCAAGTCCATCGACATCTG GTCTGTGGGCTGCATTCTGGCTGAGATGCTCTCTAACCGGCCCATCTTC CCTGGCAAGCACTACCTGGATCAGCTCAACCACATTCTGGGCATCCTGG GCTCCCCATCCCAGGAGGACCTGAATTGTATCATCAACATGAAGGCCCG AAACTACCTACAGTCTCTGCCCTCCAAGACCAAGGTGGCTTGGGCCAAG CTTTTCCCCAAGTCAGACTCCAAAGCCCTTGACCTGCTGGACCGGATGT TAACCTTTAACCCCAATAAACGGATCACAGTGGAGGAAGCGCTGGCTCA CCCCTACCTGGAGCAGTACTATGACCCGACGGATGAGCCAGTGGCCGAG GAGCCCTTCACCTTCGCCATGGAGCTGGATGACCTACCTAAGGAGCGGC TGAAGGAGCTCATCTTCCAGGAGACAGCACGCTTCCAGCCCGGAGTGCT GGAGGCCCCCTAG. Human ERK2 CDS (SEQ ID NO: 10) ATGGCGGCGGCGGCGGCGGCGGGCGCGGGCCCGGAGATGGTCCGCGGGC AGGTGTTCGACGTGGGGCCGCGCTACACCAACCTCTCGTACATCGGCGA GGGCGCCTACGGCATGGTGTGCTCTGCTTATGATAATGTCAACAAAGTT CGAGTAGCTATCAAGAAAATCAGCCCCTTTGAGCACCAGACCTACTGCC AGAGAACCCTGAGGGAGATAAAAATCTTACTGCGCTTCAGACATGAGAA CATCATTGGAATCAATGACATTATTCGAGCACCAACCATCGAGCAAATG AAAGATGTATATATAGTACAGGACCTCATGGAAACAGATCTTTACAAGC TCTTGAAGACACAACACCTCAGCAATGACCATATCTGCTATTTTCTCTA CCAGATCCTCAGAGGGTTAAAATATATCCATTCAGCTAACGTTCTGCAC CGTGACCTCAAGCCTTCCAACCTGCTGCTCAACACCACCTGTGATCTCA AGATCTGTGACTTTGGCCTGGCCCGTGTTGCAGATCCAGACCATGATCA CACAGGGTTCCTGACAGAATATGTGGCCACACGTTGGTACAGGGCTCCA GAAATTATGTTGAATTCCAAGGGCTACACCAAGTCCATTGATATTTGGT CTGTAGGCTGCATTCTGGCAGAAATGCTTTCTAACAGGCCCATCTTTCC AGGGAAGCATTATCTTGACCAGCTGAACCACATTTTGGGTATTCTTGGA TCCCCATCACAAGAAGACCTGAATTGTATAATAAATTTAAAAGCTAGGA ACTATTTGCTTTCTCTTCCACACAAAAATAAGGTGCCATGGAACAGGCT GTTCCCAAATGCTGACTCCAAAGCTCTGGACTTATTGGACAAAATGTTG ACATTCAACCCACACAAGAGGATTGAAGTAGAACAGGCTCTGGCCCACC CATATCTGGAGCAGTATTACGACCCGAGTGACGAGCCCATCGCCGAAGC ACCATTCAAGTTCGACATGGAATTGGATGACTTGCCTAAGGAAAAGCTC AAAGAACTAATTTTTGAAGAGACTGCTAGATTCCAGCCAGGATACAGAT CTTAA. Human IKK CDS (SEQ ID NO: 11) ATGTTTTCAGGGGGGTGTCATAGCCCCGGGTTTGGCCGCCCCAGCCCCG CCTTCCCCGCCCCGGGGAGCCCGCCCCCTGCCCCGCGTCCCTGCCGACA GGAAACAGGTGAGCAGATTGCCATCAAGCAGTGCCGGCAGGAGCTCAGC CCCCGGAACCGAGAGCGGTGGTGCCTGGAGATCCAGATCATGAGAAGGC TGACCCACCCCAATGTGGTGGCTGCCCGAGATGTCCCTGAGGGGATGCA GAACTTGGCGCCCAATGACCTGCCCCTGCTGGCCATGGAGTACTGCCAA GGAGGAGATCTCCGGAAGTACCTGAACCAGTTTGAGAACTGCTGTGGTC TGCGGGAAGGTGCCATCCTCACCTTGCTGAGTGACATTGCCTCTGCGCT TAGATACCTTCATGAAAACAGAATCATCCATCGGGATCTAAAGCCAGAA AACATCGTCCTGCAGCAAGGAGAACAGAGGTTAATACACAAAATTATTG ACCTAGGATATGCCAAGGAGCTGGATCAGGGCAGTCTTTGCACATCATT CGTGGGGACCCTGCAGTACCTGGCCCCAGAGCTACTGGAGCAGCAGAAG TACACAGTGACCGTCGACTACTGGAGCTTCGGCACCCTGGCCTTTGAGT GCATCACGGGCTTCCGGCCCTTCCTCCCCAACTGGCAGCCCGTGCAGTG GCATTCAAAAGTGCGGCAGAAGAGTGAGGTGGACATTGTTGTTAGCGAA GACTTGAATGGAACGGTGAAGTTTTCAAGCTCTTTACCCTACCCCAATA ATCTTAACAGTGTCCTGGCTGAGCGACTGGAGAAGTGGCTGCAACTGAT GCTGATGTGGCACCCCCGACAGAGGGGCACGGATCCCACGTATGGGCCC AATGGCTGCTTCAAGGCCCTGGATGACATCTTAAACTTAAAGCTGGTTC ATATCTTGAACATGGTCACGGGCACCATCCACACCTACCCTGTGACAGA GGATGAGAGTCTGCAGAGCTTGAAGGCCAGAATCCAACAGGACACGGGC ATCCCAGAGGAGGACCAGGAGCTGCTGCAGGAAGCGGGCCTGGCGTTGA TCCCCGATAAGCCTGCCACTCAGTGTATTTCAGACGGCAAGTTAAATGA GGGCCACACATTGGACATGGATCTTGTTTTTCTCTTTGACAACAGTAAA ATCACCTATGAGACTCAGATCTCCCCACGGCCCCAACCTGAAAGTGTCA GCTGTATCCTTCAAGAGCCCAAGAGGAATCTCGCCTTCTTCCAGCTGAG GAAGGTGTGGGGCCAGGTCTGGCACAGCATCCAGACCCTGAAGGAAGAT TGCAACCGGCTGCAGCAGGGACAGCGAGCCGCCATGATGAATCTCCTCC GAAACAACAGCTGCCTCTCCAAAATGAAGAATTCCATGGCTTCCATGTC TCAGCAGCTCAAGGCCAAGTTGGATTTCTTCAAAACCAGCATCCAGATT GACCTGGAGAAGTACAGCGAGCAAACCGAGTTTGGGATCACATCAGATA AACTGCTGCTGGCCTGGAGGGAAATGGAGCAGGCTGTGGAGCTCTGTGG GCGGGAGAACGAAGTGAAACTCCTGGTAGAACGGATGATGGCTCTGCAG ACCGACATTGTGGACTTACAGAGGAGCCCCATGGGCCGGAAGCAGGGGG GAACGCTGGACGACCTAGAGGAGCAAGCAAGGGAGCTGTACAGGAGACT AAGGGAAAAACCTCGAGACCAGCGAACTGAGGGTGACAGTCAGGAAATG GTACGGCTGCTGCTTCAGGCAATTCAGAGCTTCGAGAAGAAAGTGCGAG TGATCTATACGCAGCTCAGTAAAACTGTGGTTTGCAAGCAGAAGGCGCT GGAACTGTTGCCCAAGGTGGAAGAGGTGGTGAGCTTAATGAATGAGGAT GAGAAGACTGTTGTCCGGCTGCAGGAGAAGCGGCAGAAGGAGCTCTGGA ATCTCCTGAAGATTGCTTGTAGCAAGGTCCGTGGTCCTGTCAGTGGAAG CCCGGATAGCATGAATGCCTCTCGACTTAGCCAGCCTGGGCAGCTGATG TCTCAGCCCTCCACGGCCTCCAACAGCTTACCTGAGCCAGCCAAGAAGA GTGAAGAACTGGTGGCTGAAGCACATAACCTCTGCACCCTGCTAGAAAA TGCCATACAGGACACTGTGAGGGAACAAGACCAGAGTTTCACGGCCCTA GACTGGAGCTGGTTACAGACGGAAGAAGAAGAGCACAGCTGCCTGGAGC AGGCCTCATGA. Human IκB CDS (SEQ ID NO: 12) ATGTTCCAGGCGGCCGAGCGCCCCCAGGAGTGGGCCATGGAGGGCCCCC GCGACGGGCTGAAGAAGGAGCGGCTACTGGACGACCGCCACGACAGCGG CCTGGACTCCATGAAAGACGAGGAGTACGAGCAGATGGTCAAGGAGCTG CAGGAGATCCGCCTCGAGCCGCAGGAGGTGCCGCGCGGCTCGGAGCCCT GGAAGCAGCAGCTCACCGAGGACGGGGACTCGTTCCTGCACTTGGCCAT CATCCATGAAGAAAAGGCACTGACCATGGAAGTGATCCGCCAGGTGAAG GGAGACCTGGCCTTCCTCAACTTCCAGAACAACCTGCAGCAGACTCCAC TCCACTTGGCTGTGATCACCAACCAGCCAGAAATTGCTGAGGCACTTCT GGGAGCTGGCTGTGATCCTGAGCTCCGAGACTTTCGAGGAAATACCCCC CTACACCTTGCCTGTGAGCAGGGCTGCCTGGCCAGCGTGGGAGTCCTGA CTCAGTCCTGCACCACCCCGCACCTCCACTCCATCCTGAAGGCTACCAA CTACAATGGCCACACGTGTCTACACTTAGCCTCTATCCATGGCTACCTG GGCATCGTGGAGCTTTTGGTGTCCTTGGGTGCTGATGTCAATGCTCAGG AGCCCTGTAATGGCCGGACTGCCCTTCACCTCGCAGTGGACCTGCAAAA TCCTGACCTGGTGTCACTCCTGTTGAAGTGTGGGGCTGATGTCAACAGA GTTACCTACCAGGGCTATTCTCCCTACCAGCTCACCTGGGGCCGCCCAA GCACCCGGATACAGCAGCAGCTGGGCCAGCTGACACTAGAAAACCTTCA GATGCTGCCAGAGAGTGAGGATGAGGAGAGCTATGACACAGAGTCAGAG TTCACGGAGTTCACAGAGGACGAGCTGCCCTATGATGACTGTGTGTTTG GAGGCCAGCGTCTGACGTTATGA Human IRAK CDS (SEQ ID NO: 13) ATGGCCGGGGGGCCGGGCCCGGGGGAGCCCGCAGCCCCCGGCGCCCAGC ACTTCTTGTACGAGGTGCCGCCCTGGGTCATGTGCCGCTTCTACAAAGT GATGGACGCCCTGGAGCCCGCCGACTGGTGCCAGTTCGCCGCCCTGATC GTGCGCGACCAGACCGAGCTGCGGCTGTGCGAGCGCTCCGGGCAGCGCA CGGCCAGCGTCCTGTGGCCCTGGATCAACCGCAACGCCCGTGTGGCCGA CCTCGTGCACATCCTCACGCACCTGCAGCTGCTCCGTGCGCGGGACATC ATCACAGCCTGGCACCCTCCCGCCCCGCTTCCGTCCCCAGGCACCACTG CCCCGAGGCCCAGCAGCATCCCTGCACCCGCCGAGGCCGAGGCCTGGAG CCCCCGGAAGTTGCCATCCTCAGCCTCCACCTTCCTCTCCCCAGCTTTT CCAGGCTCCCAGACCCATTCAGGGCCTGAGCTCGGCCTGGTCCCAAGCC CTGCTTCCCTGTGGCCTCCACCGCCATCTCCAGCCCCTTCTTCTACCAA GCCAGGCCCAGAGAGCTCAGTGTCCCTCCTGCAGGGAGCCCGCCCCTTT CCGTTTTGCTGGCCCCTCTGTGAGATTTCCCGGGGCACCCACAACTTCT CGGAGGAGCTCAAGATCGGGGAGGGTGGCTTTGGGTGCGTGTACCGGGC GGTGATGAGGAACACGGTGTATGCTGTGAAGAGGCTGAAGGAGAACGCT GACCTGGAGTGGACTGCAGTGAAGCAGAGCTTCCTGACCGAGGTGGAGC AGCTGTCCAGGTTTCGTCACCCAAACATTGTGGACTTTGCTGGCTACTG TGCTCAGAACGGCTTCTACTGCCTGGTGTACGGCTTCCTGCCCAACGGC TCCCTGGAGGACCGTCTCCACTGCCAGACCCAGGCCTGCCCACCTCTCT CCTGGCCTCAGCGACTGGACATCCTTCTGGGTACAGCCCGGGCAATTCA GTTTCTACATCAGGACAGCCCCAGCCTCATCCATGGAGACATCAAGAGT TCCAACGTCCTTCTGGATGAGAGGCTGACACCCAAGCTGGGAGACTTTG GCCTGGCCCGGTTCAGCCGCTTTGCCGGGTCCAGCCCCAGCCAGAGCAG CATGGTGGCCCGGACACAGACAGTGCGGGGCACCCTGGCCTACCTGCCC GAGGAGTACATCAAGACGGGAAGGCTGGCTGTGGACACGGACACCTTCA GCTTTGGGGTGGTAGTGCTAGAGACCTTGGCTGGTCAGAGGGCTGTGAA GACGCACGGTGCCAGGACCAAGTATCTGAAAGACCTGGTGGAAGAGGAG GCTGAGGAGGCTGGAGTGGCTTTGAGAAGCACCCAGAGCACACTGCAAG CAGGTCTGGCTGCAGATGCCTGGGCTGCTCCCATCGCCATGCAGATCTA CAAGAAGCACCTGGACCCCAGGCCCGGGCCCTGCCCACCTGAGCTGGGC CTGGGCCTGGGCCAGCTGGCCTGCTGCTGCCTGCACCGCCGGGCCAAAA GGAGGCCTCCTATGACCCAGGTGTACGAGAGGCTAGAGAAGCTGCAGGC AGTGGTGGCGGGGGTGCCCGGGCATTCGGAGGCCGCCAGCTGCATCCCC CCTTCCCCGCAGGAGAACTCCTACGTGTCCAGCACTGGCAGAGCCCACA GTGGGGCTGCTCCATGGCAGCCCCTGGCAGCGCCATCAGGAGCCAGTGC CCAGGCAGCAGAGCAGCTGCAGAGAGGCCCCAACCAGCCCGTGGAGAGT GACGAGAGCCTAGGCGGCCTCTCTGCTGCCCTGCGCTCCTGGCACTTGA CTCCAAGCTGCCCTCTGGACCCAGCACCCCTCAGGGAGGCCGGCTGTCC TCAGGGGGACACGGCAGGAGAATCGAGCTGGGGGAGTGGCCCAGGATCC CGGCCCACAGCCGTGGAAGGACTGGCCCTTGGCAGCTCTGCATCATCGT CGTCAGAGCCACCGCAGATTATCATCAACCCTGCCCGACAGAAGATGGT CCAGAAGCTGGCCCTGTACGAGGATGGGGCCCTGGACAGCCTGCAGCTG CTGTCGTCCAGCTCCCTCCCAGGCTTGGGCCTGGAACAGGACAGGCAGG GGCCCGAAGAAAGTGATGAATTTCAGAGCTGA. Human JNK CDS (SEQ ID NO: 14) ATGAGCAGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAG ATTCTACATTCACAGTCCTGAAACGATATCAGAATTTAAAACCTATAGG CTCAGGAGCTCAAGGAATAGTATGCGCAGCTTATGATGCCATTCTTGAA AGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAGAATCAGACTC ATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCA CAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTA GAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATC TTTGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGTCCTACCT TCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCATTCTGCTGGAATT ATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCA CTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTT TATGATGACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTC ATCCTTGGCATGGGCTACAAGGAAAACGTTGACATTTGGTCAGTTGGGT GCATCATGGGAGAAATGATCAAAGGTGGTGTTTTGTTCCCAGGTACAGA TCATATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGAACACCATGT CCTGAATTCATGAAGAAACTGCAACCAACAGTAAGGACTTACGTTGAAA ACAGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGT CCTTTTCCCAGCTGACTCAGAACACAACAAACTTAAAGCCAGTCAGGCA AGGGATTTGTTATCCAAAATGCTGGTAATAGATGCATCTAAAAGGATCT CTGTAGATGAAGCTCTCCAACACCCGTACATCAATGTCTGGTATGATCC TTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTAGAT GAAAGGGAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAAG TTATGGACTTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAGCC CTCTCCTTTAGGTGCAGCAGTGATCAATGGCTCTCAGCATCCATCATCA TCGTCGTCTGTCAATGATGTGTCTTCAATGTCAACAGATCCGACTTTGG CCTCTGATACAGACAGCAGTCTAGAAGCAGCAGCTGGGCCTCTGGGCTG CTGTAGATGA. Human LBP CDS (SEQ ID NO: 15) ATGGGGGCCTTGGCCAGAGCCCTGCCGTCCATACTGCTGGCATTGCTGC TTACGTCCACCCCAGAGGCTCTGGGTGCCAACCCCGGCTTGGTCGCCAG GATCACCGACAAGGGACTGCAGTATGCGGCCCAGGAGGGGCTATTAGCT CTGCAGAGTGAGCTGCTCAGGATCACGCTGCCTGACTTCACCGGGGACT TGAGGATCCCCCACGTCGGCCGTGGGCGCTATGAGTTCCACAGCCTGAA CATCCACAGCTGTGAGCTGCTTCACTCTGCGCTGAGGCCTGTCCCTGGC CAGGGCCTGAGTCTCAGCATCTCCGACTCCTCCATCCGGGTCCAGGGCA GGTGGAAGGTGCGCAAGTCATTCTTCAAACTACAGGGCTCCTTTGATGT CAGTGTCAAGGGCATCAGCATTTCGGTCAACCTCCTGTTGGGCAGCGAG TCCTCCGGGAGGCCCACAGTTACTGCCTCCAGCTGCAGCAGTGACATCG CTGACGTGGAGGTGGACATGTCGGGAGACTTGGGGTGGCTGTTGAACCT CTTCCACAACCAGATTGAGTCCAAGTTCCAGAAAGTACTGGAGAGCAGG ATTTGCGAAATGATCCAGAAATCGGTGTCCTCCGATCTACAGCCTTATC TCCAAACTCTGCCAGTTACAACAGAGATTGACAGTTTCGCCGACATTGA TTATAGCTTAGTGGAAGCCCCTCGGGCAACAGCCCAGATGCTGGAGGTG ATGTTTAAGGGTGAAATCTTTCATCGTAACCACCGTTCTCCAGTTACCC TCCTTGCTGCAGTCATGAGCCTTCCTGAGGAACACAACAAAATGGTCTA CTTTGCCATCTCGGATTATGTCTTCAACACGGCCAGCCTGGTTTATCAT GAGGAAGGATATCTGAACTTCTCCATCACAGATGACATGATACCGCCTG ACTCTAATATCCGACTGACCACCAAGTCCTTCCGACCCTTCGTCCCACG GTTAGCCAGGCTCTACCCCAACATGAACCTGGAACTCCAGGGATCAGTG CCCTCTGCTCCGCTCCTGAACTTCAGCCCTGGGAATCTGTCTGTGGACC CCTATATGGAGATAGATGCCTTTGTGCTCCTGCCCAGCTCCAGCAAGGA GCCTGTCTTCCGGCTCAGTGTGGCCACTAATGTGTCCGCCACCTTGACC TTCAATACCAGCAAGATCACTGGGTTCCTGAAGCCAGGAAAGGTAAAAG TGGAACTGAAAGAATCCAAAGTTGGACTATTCAATGCAGAGCTGTTGGA AGCGCTCCTCAACTATTACATCCTTAACACCCTCTACCCCAAGTTCAAT GATAAGTTGGCCGAAGGCTTCCCCCTTCCTCTGCTGAAGCGTGTTCAGC TCTACGACCTTGGGCTGCAGATCCATAAGGACTTCCTGTTCTTGGGTGC CAATGTCCAATACATGAGAGTTTGA. Human MEK1 CDS (SEQ ID NO: 16) ATGCCCAAGAAGAAGCCGACGCCCATCCAGCTGAACCCGGCCCCCGACG GCTCTGCAGTTAACGGGACCAGCTCTGCGGAGACCAACTTGGAGGCCTT GCAGAAGAAGCTGGAGGAGCTAGAGCTTGATGAGCAGCAGCGAAAGCGC CTTGAGGCCTTTCTTACCCAGAAGCAGAAGGTGGGAGAACTGAAGGATG ACGACTTTGAGAAGATCAGTGAGCTGGGGGCTGGCAATGGCGGTGTGGT GTTCAAGGTCTCCCACAAGCCTTCTGGCCTGGTCATGGCCAGAAAGCTA ATTCATCTGGAGATCAAACCCGCAATCCGGAACCAGATCATAAGGGAGC TGCAGGTTCTGCATGAGTGCAACTCTCCGTACATCGTGGGCTTCTATGG TGCGTTCTACAGCGATGGCGAGATCAGTATCTGCATGGAGCACATGGAT GGAGGTTCTCTGGATCAAGTCCTGAAGAAAGCTGGAAGAATTCCTGAAC AAATTTTAGGAAAAGTTAGCATTGCTGTAATAAAAGGCCTGACATATCT GAGGGAGAAGCACAAGATCATGCACAGAGATGTCAAGCCCTCCAACATC CTAGTCAACTCCCGTGGGGAGATCAAGCTCTGTGACTTTGGGGTCAGCG GGCAGCTCATCGACTCCATGGCCAACTCCTTCGTGGGCACAAGGTCCTA CATGTCGCCAGAAAGACTCCAGGGGACTCATTACTCTGTGCAGTCAGAC ATCTGGAGCATGGGACTGTCTCTGGTAGAGATGGCGGTTGGGAGGTATC CCATCCCTCCTCCAGATGCCAAGGAGCTGGAGCTGATGTTTGGGTGCCA GGTGGAAGGAGATGCGGCTGAGACCCCACCCAGGCCAAGGACCCCCGGG AGGCCCCTTAGCTCATACGGAATGGACAGCCGACCTCCCATGGCAATTT TTGAGTTGTTGGATTACATAGTCAACGAGCCTCCTCCAAAACTGCCCAG TGGAGTGTTCAGTCTGGAATTTCAAGATTTTGTGAATAAATGCTTAATA AAAAACCCCGCAGAGAGAGCAGATTTGAAGCAACTCATGGTTCATGCTT TTATCAAGAGATCTGATGCTGAGGAAGTGGATTTTGCAGGTTGGCTCTG CTCCACCATCGGCCTTAACCAGCCCAGCACACCAACCCATGCTGCTGGC GTCTAA. Human MEK2 CDS (SEQ ID NO: 17) ATGCTGGCCCGGAGGAAGCCGGTGCTGCCGGCGCTCACCATCAACCCTA CCATCGCCGAGGGCCCATCCCCTACCAGCGAGGGCGCCTCCGAGGCAAA CCTGGTGGACCTGCAGAAGAAGCTGGAGGAGCTGGAACTTGACGAGCAG CAGAAGAAGCGGCTGGAAGCCTTTCTCACCCAGAAAGCCAAGGTCGGCG AACTCAAAGACGATGACTTCGAAAGGATCTCAGAGCTGGGCGCGGGCAA CGGCGGGGTGGTCACCAAAGTCCAGCACAGACCCTCGGGCCTCATCATG GCCAGGAAGCTGATCCACCTTGAGATCAAGCCGGCCATCCGGAACCAGA TCATCCGCGAGCTGCAGGTCCTGCACGAATGCAACTCGCCGTACATCGT GGGCTTCTACGGGGCCTTCTACAGTGACGGGGAGATCAGCATTTGCATG GAACACATGGACGGCGGCTCCCTGGACCAGGTGCTGAAAGAGGCCAAGA GGATTCCCGAGGAGATCCTGGGGAAAGTCAGCATCGCGGTTCTCCGGGG CTTGGCGTACCTCCGAGAGAAGCACCAGATCATGCACCGAGATGTGAAG CCCTCCAACATCCTCGTGAACTCTAGAGGGGAGATCAAGCTGTGTGACT TCGGGGTGAGCGGCCAGCTCATCGACTCCATGGCCAACTCCTTCGTGGG CACGCGCTCCTACATGGCTCCGGAGCGGTTGCAGGGCACACATTACTCG GTGCAGTCGGACATCTGGAGCATGGGCCTGTCCCTGGTGGAGCTGGCCG TCGGAAGGTACCCCATCCCCCCGCCCGACGCCAAAGAGCTGGAGGCCAT CTTTGGCCGGCCCGTGGTCGACGGGGAAGAAGGAGAGCCTCACAGCATC TCGCCTCGGCCGAGGCCCCCCGGGCGCCCCGTCAGCGGTCACGGGATGG ATAGCCGGCCTGCCATGGCCATCTTTGAACTCCTGGACTATATTGTGAA CGAGCCACCTCCTAAGCTGCCCAACGGTGTGTTCACCCCCGACTTCCAG GAGTTTGTCAATAAATGCCTCATCAAGAACCCAGCGGAGCGGGCGGACC TGAAGATGCTCACAAACCACACCTTCATCAAGCGGTCCGAGGTGGAAGA AGTGGATTTTGCCGGCTGGTTGTGTAAAACCCTGCGGCTGAACCAGCCC GGCACACCCACGCGCACCGCCGTGTGA. Human MEK3 CDS (SEQ ID NO: 18) ATGTCCAAGCCACCCGCACCCAACCCCACACCCCCCCGGAACCTGGACT CCCGGACCTTCATCACCATTGGAGACAGAAACTTTGAGGTGGAGGCTGA TGACTTGGTGACCATCTCAGAACTGGGCCGTGGAGCCTATGGGGTGGTA GAGAAGGTGCGGCACGCCCAGAGCGGCACCATCATGGCCGTGAAGCGGA TCCGGGCCACCGTGAACTCACAGGAGCAGAAGCGGCTGCTCATGGACCT GGACATCAACATGCGCACGGTCGACTGTTTCTACACTGTCACCTTCTAC GGGGCACTATTCAGAGAGGGAGACGTGTGGATCTGCATGGAGCTCATGG ACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGATAAAAACATGAC AATTCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGCGGGCC CTGGAGCATCTGCACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGC CCTCCAATGTCCTTATCAACAAGGAGGGCCATGTGAAGATGTGTGACTT TGGCATCAGTGGCTACTTGGTGGACTCTGTGGCCAAGACGATGGATGCC GGCTGCAAGCCCTACATGGCCCCTGAGAGGATCAACCCAGAGCTGAACC AGAAGGGCTACAATGTCAAGTCCGACGTCTGGAGCCTGGGCATCACCAT GATTGAGATGGCCATCCTGCGGTTCCCTTACGAGTCCTGGGGGACCCCG TTCCAGCAGCTGAAGCAGGTGGTGGAGGAGCCGTCCCCCCAGCTCCCAG CCGACCGTTTCTCCCCCGAGTTTGTGGACTTCACTGCTCAGTGCCTGAG GAAGAACCCCGCAGAGCGTATGAGCTACCTGGAGCTGATGGAGCACCCC TTCTTCACCTTGCACAAAACCAAGAAGACGGACATTGCTGCCTTCGTGA AGGAGATCCTGGGAGAAGACTCATAG. Human MEK6 CDS (SEQ ID NO: 19) ATGTCTCAGTCGAAAGGCAAGAAGCGAAACCCTGGCCTTAAAATTCCAA AAGAAGCATTTGAACAACCTCAGACCAGTTCCACACCACCTCGAGATTT AGACTCCAAGGCTTGCATTTCTATTGGAAATCAGAACTTTGAGGTGAAG GCAGATGACCTGGAGCCTATAATGGAACTGGGACGAGGTGCGTACGGGG TGGTGGAGAAGATGCGGCACGTGCCCAGCGGGCAGATCATGGCAGTGAA GCGGATCCGAGCCACAGTAAATAGCCAGGAACAGAAACGGCTACTGATG GATTTGGATATTTCCATGAGGACGGTGGACTGTCCATTCACTGTCACCT TTTATGGCGCACTGTTTCGGGAGGGTGATGTGTGGATCTGCATGGAGCT CATGGATACATCACTAGATAAATTCTACAAACAAGTTATTGATAAAGGC CAGACAATTCCAGAGGACATCTTAGGGAAAATAGCAGTTTCTATTGTAA AAGCATTAGAACATTTACATAGTAAGCTGTCTGTCATTCACAGAGACGT CAAGCCTTCTAATGTACTCATCAATGCTCTCGGTCAAGTGAAGATGTGC GATTTTGGAATCAGTGGCTACTTGGTGGACTCTGTTGCTAAAACAATTG ATGCAGGTTGCAAACCATACATGGCCCCTGAAAGAATAAACCCAGAGCT CAACCAGAAGGGATACAGTGTGAAGTCTGACATTTGGAGTCTGGGCATC ACGATGATTGAGTTGGCCATCCTTCGATTTCCCTATGATTCATGGGGAA CTCCATTTCAGCAGCTCAAACAGGTGGTAGAGGAGCCATCGCCACAACT CCCAGCAGACAAGTTCTCTGCAGAGTTTGTTGACTTTACCTCACAGTGC TTAAAGAAGAATTCCAAAGAACGGCCTACATACCCAGAGCTAATGCAAC ATCCATTTTTCACCCTACATGAATCCAAAGGAACAGATGTGGCATCTTT TGTAAAACTGATTCTTGGAGACTAA. Human MEKK1 CDS (SEQ ID NO: 20) ATGGCGGCGGCGGCGGGGAATCGCGCCTCGTCGTCGGGATTCCCGGGCG CCAGGGCTACGAGCCCTGAGGCAGGCGGCGGCGGAGGAGCCCTCAAGGC GAGCAGCGCGCCCGCGGCTGCCGCGGGACTGCTGCGGGAGGCGGGCAGC GGGGGCCGCGAGCGGGCGGACTGGCGGCGGCGGCAGCTGCGCAAAGTGC GGAGTGTGGAGCTGGACCAGCTGCCTGAGCAGCCGCTCTTCCTTGCCGC CTCACCGCCGGCCTCCTCGACTTCCCCGTCGCCGGAGCCCGCGGACGCA GCGGGGAGTGGGACCGGCTTCCAGCCTGTGGCGGTGCCGCCGCCCCACG GAGCCGCGAGCCGCGGCGGCGCCCACCTTACCGAGTCGGTGGCGGCGCC GGACAGCGGCGCCTCGAGTCCCGCAGCGGCCGAGCCCGGGGAGAAGCGG GCGCCCGCCGCCGAGCCGTCTCCTGCAGCGGCCCCCGCCGGTCGTGAGA TGGAGAATAAAGAAACTCTCAAAGGGTTGCACAAGATGGATGATCGTCC AGAGGAACGAATGATCAGGGAGAAACTGAAGGCAACCTGTATGCCAGCC TGGAAGCACGAATGGTTGGAAAGGAGAAATAGGCGAGGGCCTGTGGTGG TAAAACCAATCCCAGTTAAAGGAGATGGATCTGAAATGAATCACTTAGC AGCTGAGTCTCCAGGAGAGGTCCAGGCAAGTGCGGCTTCACCAGCTTCC AAAGGCCGACGCAGTCCTTCTCCTGGCAACTCCCCATCAGGTCGCACAG TGAAATCAGAATCTCCAGGAGTAAGGAGAAAAAGAGTTTCCCCAGTGCC TTTTCAGAGTGGCAGAATCACACCACCCCGAAGAGCCCCTTCACCAGAT GGCTTCTCACCATATAGCCCTGAGGAAACAAACCGCCGTGTTAACAAAG TGATGCGGGCCAGACTGTACTTACTGCAGCAGATAGGGCCTAACTCTTT CCTGATTGGAGGAGACAGCCCAGACAATAAATACCGGGTGTTTATTGGG CCTCAGAACTGCAGCTGTGCACGTGGAACATTCTGTATTCATCTGCTAT TTGTGATGCTCCGGGTGTTTCAACTAGAACCTTCAGACCCAATGTTATG GAGAAAAACTTTAAAGAATTTTGAGGTTGAGAGTTTGTTCCAGAAATAT CACAGTAGGCGTAGCTCAAGGATCAAAGCTCCATCTCGTAACACCATCC AGAAGTTTGTTTCACGCATGTCAAATTCTCATACATTGTCATCATCTAG TACTTCTACGTCTAGTTCAGAAAACAGCATAAAGGATGAAGAGGAACAG ATGTGTCCTATTTGCTTGTTGGGCATGCTTGATGAAGAAAGTCTTACAG TGTGTGAAGACGGCTGCAGGAACAAGCTGCACCACCACTGCATGTCAAT TTGGGCAGAAGAGTGTAGAAGAAATAGAGAACCTTTAATATGTCCCCTT TGTAGATCTAAGTGGAGATCTCATGATTTCTACAGCCACGAGTTGTCAA GTCCTGTGGATTCCCCTTCTTCCCTCAGAGCTGCACAGCAGCAAACCGT ACAGCAGCAGCCTTTGGCTGGATCACGAAGGAATCAAGAGAGCAATTTT AACCTTACTCATTATGGAACTCAGCAAATCCCTCCTGCTTACAAAGATT TAGCTGAGCCATGGATTCAGGTGTTTGGAATGGAACTCGTTGGCTGCTT ATTTTCTAGAAACTGGAATGTGAGAGAGATGGCCCTCAGGCGTCTTTCC CATGATGTCAGTGGGGCCCTGCTGTTGGCAAATGGGGAGAGCACTGGAA ATTCTGGGGGCAGCAGTGGAAGCAGCCCGAGTGGGGGAGCCACCAGTGG GTCTTCCCAGACCAGTATCTCAGGAGATGTGGTGGAGGCATGCTGCAGC GTTCTGTCAATGGTCTGTGCTGACCCTGTCTACAAAGTGTACGTTGCTG CTTTAAAAACATTGAGAGCCATGCTGGTATATACTCCTTGCCACAGTTT AGCGGAAAGAATCAAACTTCAGAGACTTCTCCAGCCAGTTGTAGACACC ATCCTAGTCAAATGTGCAGATGCCAATAGCCGCACAAGTCAGCTGTCCA TATCAACACTGTTGGAACTGTGCAAAGGCCAAGCAGGAGAGTTGGCAGT TGGCAGAGAAATACTAAAAGCTGGATCCATTGGTATTGGTGGTGTTGAT TATGTCTTAAATTGTATTCTTGGAAACCAAACTGAATCAAACAATTGGC AAGAACTTCTTGGCCGCCTTTGTCTTATAGATAGACTGTTGTTGGAATT TCCTGCTGAATTTTATCCTCATATTGTCAGTACTGATGTTTCACAAGCT GAGCCTGTTGAAATCAGGTATAAGAAGCTGCTGTCCCTCTTAACCTTTG CTTTGCAGTCCATTGATAATTCCCACTCAATGGTTGGCAAACTTTCCAG AAGGATCTACTTGAGTTCTGCAAGAATGGTTACTACAGTACCCCATGTG TTTTCAAAACTGTTAGAAATGCTGAGTGTTTCCAGTTCCACTCACTTCA CCAGGATGCGTCGCCGTTTGATGGCTATTGCAGATGAGGTGGAAATTGC CGAAGCCATCCAGTTGGGCGTAGAAGACACTTTGGATGGTCAACAGGAC AGCTTCTTGCAGGCATCTGTTCCCAACAACTATCTGGAAACCACAGAGA ACAGTTCCCCTGAGTGCACAGTCCATTTAGAGAAAACTGGAAAAGGATT ATGTGCTACAAAATTGAGTGCCAGTTCAGAGGACATTTCTGAGAGACTG GCCAGCATTTCAGTAGGACCTTCTAGTTCAACAACAACAACAACAACAA CAACAGAGCAACCAAAGCCAATGGTTCAAACAAAAGGCAGACCCCACAG TCAGTGTTTGAACTCCTCTCCTTTATCTCATCATTCCCAATTAATGTTT CCAGCCTTGTCAACCCCTTCTTCTTCTACCCCATCTGTACCAGCTGGCA CTGCAACAGATGTCTCTAAGCATAGACTTCAGGGATTCATTCCCTGCAG AATACCTTCTGCATCTCCTCAAACACAGCGCAAGTTTTCTCTACAATTC CACAGAAACTGTCCTGAAAACAAAGACTCAGATAAACTTTCCCCAGTCT TTACTCAGTCAAGACCCTTGCCCTCCAGTAACATACACAGGCCAAAGCC ATCTAGACCTACCCCAGGTAATACAAGTAAACAGGGAGATCCCTCAAAA AATAGCATGACACTTGATCTGAACAGTAGTTCCAAATGTGATGACAGCT TTGGCTGTAGCAGCAATAGTAGTAATGCTGTTATACCCAGTGACGAGAC AGTGTTCACCCCAGTAGAGGAGAAATGCAGATTAGATGTCAATACAGAG CTCAACTCCAGTATTGAGGACCTTCTTGAAGCATCTATGCCTTCAAGTG ATACAACAGTAACTTTTAAGTCAGAAGTTGCTGTCCTGTCTCCTGAAAA GGCTGAAAATGATGATACCTACAAAGATGATGTGAATCATAATCAAAAG TGCAAAGAGAAGATGGAAGCTGAAGAAGAAGAAGCTTTAGCAATTGCCA TGGCAATGTCAGCGTCTCAGGATGCCCTCCCCATAGTTCCTCAGCTGCA GGTTGAAAATGGAGAAGATATCATCATTATTCAACAGGATACACCAGAG ACTCTACCAGGACATACCAAAGCAAAACAACCGTATAGAGAAGACACTG AATGGCTGAAAGGTCAACAGATAGGCCTTGGAGCATTTTCTTCTTGTTA TCAGGCTCAAGATGTGGGAACTGGAACTTTAATGGCTGTTAAACAGGTG ACTTATGTCAGAAACACATCTTCTGAGCAAGAAGAAGTAGTAGAAGCAC TAAGAGAAGAGATAAGAATGATGAGCCATCTGAATCATCCAAACATCAT TAGGATGTTGGGAGCCACGTGTGAGAAGAGCAATTACAATCTCTTCATT GAATGGATGGCAGGGGGATCGGTGGCTCATTTGCTGAGTAAATATGGAG CCTTCAAAGAATCAGTAGTTATTAACTACACTGAACAGTTACTCCGTGG CCTTTCGTATCTCCATGAAAACCAAATCATTCACAGAGATGTCAAAGGT GCCAATTTGCTAATTGACAGCACTGGTCAGAGACTAAGAATTGCAGATT TTGGAGCTGCAGCCAGGTTGGCATCAAAAGGAACTGGTGCAGGAGAGTT TCAGGGACAATTACTGGGGACAATTGCATTTATGGCACCTGAGGTACTA AGAGGTCAACAGTATGGAAGGAGCTGTGATGTATGGAGTGTTGGCTGTG CTATTATAGAAATGGCTTGTGCAAAACCACCATGGAATGCAGAAAAACA CTCCAATCATCTTGCTTTGATATTTAAGATTGCTAGTGCAACTACTGCT CCATCGATCCCTTCACATTTGTCTCCTGGTTTACGAGATGTGGCTCTTC GTTGTTTAGAACTTCAACCTCAGGACAGACCTCCATCAAGAGAGCTACT GAAGCATCCAGTCTTTCGTACTACATGGTAG. Human MEKK 3 CDS (SEQ ID NO: 21) ATGGACGAACAGGAGGCATTGAACTCAATCATGAACGATCTGGTGGCCC TCCAGATGAACCGACGTCACCGGATGCCTGGATATGAGACCATGAAGAA CAAAGACACAGGTCACTCAAATAGGCAGAAAAAACACAACAGCAGCAGC TCAGCCCTTCTGAACAGCCCCACAGTAACAACAAGCTCATGTGCAGGGG CCAGTGAGAAAAAGAAATTTTTGAGTGACGTCAGAATCAAGTTCGAGCA CAACGGGGAGAGGCGAATTATAGCGTTCAGCCGGCCTGTGAAATATGAA GATGTGGAGCACAAGGTGACAACAGTATTTGGACAACCTCTTGATCTAC ATTACATGAACAATGAGCTCTCCATCCTGCTGAAAAACCAAGATGATCT TGATAAAGCAATTGACATTTTAGATAGAAGCTCAAGCATGAAAAGCCTT AGGATATTGCTGTTGTCCCAGGACAGAAACCATAACAGTTCCTCTCCCC ACTCTGGGGTGTCCAGACAGGTGCGGATCAAGGCTTCCCAGTCCGCAGG GGATATAAATACTATCTACCAGCCCCCCGAGCCCAGAAGCAGGCACCTC TCTGTCAGCTCCCAGAACCCTGGCCGAAGCTCACCTCCCCCTGGCTATG TTCCTGAGCGGCAGCAGCACATTGCCCGGCAGGGGTCCTACACCAGCAT CAACAGTGAGGGGGAGTTCATCCCAGAGACCAGCGAGCAGTGCATGCTG GATCCCCTGAGCAGTGCAGAAAATTCCTTGTCTGGAAGCTGCCAATCCT TGGACAGGTCAGCAGACAGCCCATCCTTCCGGAAATCACGAATGTCCCG TGCCCAGAGCTTCCCTGACAACAGACAGGAATACTCAGATCGGGAAACT CAGCTTTATGACAAAGGGGTCAAAGGTGGAACCTACCCCCGGCGCTACC ACGTGTCTGTGCACCACAAGGACTACAGTGATGGCAGAAGAACATTTCC CCGAATACGGCGTCATCAAGGCAACTTGTTCACCCTGGTGCCCTCCAGC CGCTCCCTGAGCACAAATGGCGAGAACATGGGTCTGGCTGTGCAATACC TGGACCCCCGTGGGCGCCTGCGGAGTGCGGACAGCGAGAATGCCCTCTC TGTGCAGGAGAGGAATGTGCCAACCAAGTCTCCCAGTGCCCCCATCAAC TGGCGCCGGGGAAAGCTCCTGGGCCAGGGTGCCTTCGGCAGGGTCTATT TGTGCTATGACGTGGACACGGGACGTGAACTTGCTTCCAAGCAGGTCCA ATTTGATCCAGACAGTCCTGAGACAAGCAAGGAGGTGAGTGCTCTGGAG TGCGAGATCCAGTTGCTAAAGAACTTGCAGCATGAGCGCATCGTGCAGT ACTATGGCTGTCTGCGGGACCGCGCTGAGAAGACCCTGACCATCTTCAT GGAGTACATGCCAGGGGGCTCGGTGAAAGACCAGTTGAAGGCTTACGGT GCTCTGACAGAGAGCGTGACCCGAAAGTACACGCGGCAGATCCTGGAGG GCATGTCCTACCTGCACAGCAACATGATTGTTCACCGGGACATTAAGGG AGCCAACATCCTCCGAGACTCTGCTGGGAATGTAAAGCTGGGGGACTTT GGGGCCAGCAAACGCCTGCAGACGATCTGTATGTCGGGGACGGGCATGC GCTCCGTCACTGGCACACCCTACTGGATGAGCCCTGAGGTGATCAGCGG CGAGGGCTATGGAAGGAAAGCAGACGTGTGGAGCCTGGGCTGCACTGTG GTGGAGATGCTGACAGAGAAACCACCGTGGGCAGAGTATGAAGCTATGG CCGCCATCTTCAAGATTGCCACCCAGCCCACCAATCCTCAGCTGCCCTC CCACATCTCTGAACATGGCCGGGACTTCCTGAGGCGCATTTTTGTGGAG GCTCGCCAGAGACCTTCAGCTGAGGAGCTGCTCACACACCACTTTGCAC AGCTCATGTACTGA. Human MEKK4 CDS (SEQ ID NO: 22) ATGAGAGAAGCCGCTGCCGCGCTGGTCCCTCCTCCCGCCTTTGCCGTCA CGCCTGCCGCCGCCATGGAGGAGCCGCCGCCACCGCCGCCGCCGCCACC ACCGCCACCGGAACCCGAGACCGAGTCAGAACCCGAGTGCTGCTTGGCG GCGAGGCAAGAGGGCACATTGGGAGATTCAGCTTGCAAGAGTCCTGAAT CTGATCTAGAAGACTTCTCCGATGAAACAAATACAGAGAATCTTTATGG TACCTCTCCCCCCAGCACACCTCGACAGATGAAACGCATGTCAACCAAA CATCAGAGGAATAATGTGGGGAGGCCAGCCAGTCGGTCTAATTTGAAAG AAAAAATGAATGCACCAAATCAGCCTCCACATAAAGACACTGGAAAAAC AGTGGAGAATGTGGAAGAATACAGCTATAAGCAGGAGAAAAAGATCCGA GCAGCTCTTAGAACAACAGAGCGTGATCATAAAAAAAATGTACAGTGCT CATTCATGTTAGACTCAGTGGGTGGATCTTTGCCAAAAAAATCAATTCC AGATGTGGATCTCAATAAGCCTTACCTCAGCCTTGGCTGTAGCAATGCT AAGCTTCCAGTATCTGTGCCCATGCCTATAGCCAGACCTGCACGCCAGA CTTCTAGGACTGACTGTCCAGCAGATCGTTTAAAGTTTTTTGAAACTTT ACGACTTTTGCTAAAGCTTACCTCAGTCTCAAAGAAAAAAGACAGGGAG CAAAGAGGACAAGAAAATACGTCTGGTTTCTGGCTTAACCGATCTAACG AACTGATCTGGTTAGAGCTACAAGCCTGGCATGCAGGACGGACAATTAA CGACCAGGACTTCTTTTTATATACAGCCCGTCAAGCCATCCCAGATATT ATTAATGAAATCCTTACTTTCAAAGTCGACTATGGGAGCTTCGCCTTTG TTAGAGATAGAGCTGGTTTTAATGGTACTTCAGTAGAAGGGCAGTGCAA AGCCACTCCTGGAACAAAGATTGTAGGTTACTCAACACATCATGAGCAT CTCCAACGCCAGAGGGTCTCATTTGAGCAGGTAAAACGGATAATGGAGC TGCTAGAGTACATAGAAGCACTTTATCCATCATTGCAGGCTCTTCAGAA GGACTATGAAAAATATGCTGCAAAAGACTTCCAGGACAGGGTGCAGGCA CTCTGTTTGTGGTTAAACATCACAAAAGACTTAAATCAGAAATTAAGGA TTATGGGCACTGTTTTGGGCATCAAGAATTTATCAGACATTGGCTGGCC AGTGTTTGAAATCCCTTCCCCTCGACCATCCAAAGGTAATGAGCCGGAG TATGAGGGTGATGACACAGAAGGAGAATTAAAGGAGTTGGAAAGTAGTA CGGATGAGAGTGAAGAAGAACAAATCTCTGATCCTAGGGTACCGGAAAT CAGACAGCCCATAGATAACAGCTTCGACATCCAGTCGCGGGACTGCATA TCCAAGAAGCTTGAGAGGCTCGAATCTGAGGATGATTCTCTTGGCTGGG GAGCACCAGACTGGAGCACAGAAGCAGGCTTTAGTAGACATTGTCTGAC TTCTATTTATAGACCATTTGTAGACAAAGCACTGAAGCAGATGGGGTTA AGAAAGTTAATTTTAAGACTTCACAAGCTAATGGATGGTTCCTTGCAAA GGGCACGTATAGCATTGGTAAAGAACGATCGTCCAGTGGAGTTTTCTGA ATTTCCAGATCCCATGTGGGGTTCAGATTATGTGCAGTTGTCAAGGACA CCACCTTCATCTGAGGAGAAATGCAGTGCTGTGTCGTGGGAGGAGCTGA AGGCCATGGATTTACCTTCATTCGAACCTGCCTTCCTAGTTCTCTGCCG AGTCCTTCTGAATGTCATACATGAGTGTCTGAAGTTAAGATTGGAGCAG AGACCTGCTGGAGAACCATCTCTCTTGAGTATTAAGCAGCTGGTGAGAG AGTGTAAGGAGGTCCTGAAGGGCGGCCTGCTGATGAAGCAGTACTACCA GTTCATGCTGCAGGAGGTTCTGGAGGACTTGGAGAAGCCCGACTGCAAC ATTGACGCTTTTGAAGAGGATCTACATAAAATGCTTATGGTGTATTTTG ATTACATGAGAAGCTGGATCCAAATGCTACAGCAATTACCTCAAGCATC GCATAGTTTAAAAAATCTGTTAGAAGAAGAATGGAATTTCACCAAAGAA ATAACTCATTACATACGGGGAGGAGAAGCACAGGCCGGGAAGCTTTTCT GTGACATTGCAGGAATGCTGCTGAAATCTACAGGAAGTTTTTTAGAATT TGGCTTACAGGAGAGCTGTGCTGAATTTTGGACTAGTGCGGATGACAGC AGTGCTTCCGACGAAATCAGGAGGTCTGTTATAGAGATCAGTCGAGCCC TGAAGGAGCTCTTCCATGAAGCCAGAGAAAGGGCTTCCAAAGCACTTGG ATTTGCTAAAATGTTGAGAAAGGACCTGGAAATAGCAGCAGAATTCAGG CTTTCAGCCCCAGTTAGAGACCTCCTGGATGTTCTGAAATCAAAACAGT ATGTCAAGGTGCAAATTCCTGGGTTAGAAAACTTGCAAATGTTTGTTCC AGACACTCTTGCTGAGGAGAAGAGTATTATTTTGCAGTTACTCAATGCA GCTGCAGGAAAGGACTGTTCAAAAGATTCAGATGACGTACTCATCGATG CCTATCTGCTTCTGACCAAGCACGGTGATCGAGCCCGTGATTCAGAGGA CAGCTGGGGCACCTGGGAGGCACAGCCTGTCAAAGTCGTGCCTCAGGTG GAGACTGTTGACACCCTGAGAAGCATGCAGGTGGATAATCTTTTACTAG TTGTCATGCAGTCTGCGCATCTCACAATTCAGAGAAAAGCTTTCCAGCA GTCCATTGAGGGACTTATGACTCTGTGCCAGGAGCAGACATCCAGTCAG CCGGTCATCGCCAAAGCTTTGCAGCAGCTGAAGAATGATGCATTGGAGC TATGCAACAGGATAAGCAATGCCATTGACCGCGTGGACCACATGTTCAC ATCAGAATTTGATGCTGAGGTTGATGAATCTGAATCTGTCACCTTGCAA CAGTACTACCGAGAAGCAATGATTCAGGGGTACAATTTTGGATTTGAGT ATCATAAAGAAGTTGTTCGTTTGATGTCTGGGGAGTTTAGACAGAAGAT AGGAGACAAATATATAAGCTTTGCCCGGAAGTGGATGAATTATGTCCTG ACTAAATGTGAGAGTGGTAGAGGTACAAGACCCAGGTGGGCGACTCAAG GATTTGATTTTCTACAAGCAATTGAACCTGCCTTTATTTCAGCTTTACC AGAAGATGACTTCTTGAGTTTACAAGCCTTGATGAATGAATGCATTGGC CATGTCATAGGAAAACCACACAGTCCTGTTACAGGTTTGTACCTTGCCA TTCATCGGAACAGCCCCCGTCCTATGAAGGTACCTCGATGCCATAGTGA CCCTCCTAACCCACACCTCATTATCCCCACTCCAGAGGGATTCAGCACT CGGAGCATGCCTTCCGACGCGCGGAGCCATGGCAGCCCTGCTGCTGCTG CTGCTGCTGCTGCTGCTGCTGTTGCTGCCAGTCGGCCCAGCCCCTCTGG TGGTGACTCTGTGCTGCCCAAATCCATCAGCAGTGCCCATGATACCAGG GGTTCCAGCGTTCCTGAAAATGATCGATTGGCTTCCATAGCTGCTGAAT TGCAGTTTAGGTCCCTGAGTCGTCACTCAAGCCCCACGGAGGAGCGAGA TGAACCAGCATATCCAAGAGGAGATTCAAGTGGGTCCACAAGAAGAAGT TGGGAACTTCGGACACTAATCAGCCAGAGTAAAGATACTGCTTCTAAAC TAGGACCCATAGAAGCTATCCAGAAGTCAGTCCGATTGTTTGAAGAAAA GAGGTACCGAGAAATGAGGAGAAAGAATATCATTGGTCAAGTTTGTGAT ACGCCTAAGTCCTATGATAATGTTATGCACGTTGGCTTGAGGAAGGTGA CCTTCAAATGGCAAAGAGGAAACAAAATTGGAGAAGGCCAGTATGGGAA GGTGTACACCTGCATCAGCGTCGACACCGGGGAGCTGATGGCCATGAAA GAGATTCGATTTCAACCTAATGACCATAAGACTATCAAGGAAACTGCAG ACGAATTGAAAATATTCGAAGGCATCAAACACCCCAATCTGGTTCGGTA TTTTGGTGTGGAGCTCCATAGAGAAGAAATGTACATCTTCATGGAGTAC TGCGATGAGGGGACTTTAGAAGAGGTGTCAAGGCTGGGACTTCAGGAAC ATGTGATTAGGCTGTATTCAAAGCAGATCACCATTGCGATCAACGTCCT CCATGAGCATGGCATAGTCCACCGTGACATTAAAGGTGCCAATATCTTC CTTACCTCATCTGGATTAATCAAACTGGGAGATTTTGGATGTTCAGTAA AGCTCAAAAACAATGCCCAGACCATGCCTGGTGAAGTGAACAGCACCCT GGGGACAGCAGCATACATGGCACCTGAAGTCATCACTCGTGCCAAAGGA GAGGGCCATGGGCGTGCGGCCGACATCTGGAGTCTGGGGTGTGTTGTCA TAGAGATGGTGACTGGCAAGAGGCCTTGGCATGAGTATGAGCACAACTT TCAAATTATGTATAAAGTGGGGATGGGACATAAGCCACCAATCCCTGAA AGATTAAGCCCTGAAGGAAAGGACTTCCTTTCTCACTGCCTTGAGAGTG ACCCAAAGATGAGATGGACCGCCAGCCAGCTCCTCGACCATTCGTTTGT CAAGGTTTGCACAGATGAAGAATG. Human MEKK 6 CDS (SEQ ID NO: 23) ATGGCGGGGCCGTGTCCCCGGTCCGGGGCGGAGCGCGCCGGCAGCTGCT GGCAGGACCCGCTGGCCGTGGCGCTGAGCCGGGGCCGGCAGCTCGCGGC GCCCCCGGGCCGGGGCTGCGCGCGGAGCCGGCCGCTCAGCGTGGTCTAC GTGCTGACCCGGGAGCCGCAGCCCGGGCTCGAGCCTCGGGAGGGAACCG AGGCGGAGCCGCTGCCCCTGCGCTGCCTGCGCGAGGCTTGCGCGCAGGT CCCCCGGCCGCGGCCGCCCCCGCAGCTGCGCAGCCTGCCCTTCGGGACG CTGGAGCTAGGCGACACCGCGGCTCTGGATGCCTTCTACAACGCGGATG TGGTGGTGCTGGAGGTGAGCAGCTCGCTGGTACAGCCCTCCCTGTTCTA CCACCTTGGTGTGCGTGAGAGCTTCAGCATGACCAACAATGTGCTCCTC TGCTCCCAGGCCGACCTCCCTGACCTGCAGGCCCTGCGGGAGGATGTTT TCCAGAAGAACTCGGATTGCGTTGGCAGCTACACACTGATCCCCTATGT GGTGACGGCCACTGGTCGGGTGCTGTGTGGTGATGCAGGCCTTCTGCGG GGCCTGGCTGATGGGCTGGTACAGGCTGGAGTGGGGACCGAGGCCCTGC TCACTCCCCTGGTGGGCCGGCTTGCCCGCCTGCTGGAGGCCACACCCAC AGACTCTTGTGGCTATTTCCGGGAGACCATTCGGCGGGACATCCGGCAG GCGCGGGAGCGGTTCAGTGGGCCACAGCTGCGGCAGGAGCTGGCTCGCC TGCAGCGGAGACTGGACAGCGTGGAGCTGCTGAGCCCCGACATCATCAT GAACTTGCTGCTCTCCTACCGCGATGTGCAGGACTACTCGGCCATCATT GAGCTGGTGGAGACGCTGCAGGCCTTGCCCACCTGTGATGTGGCCGAGC AGCATAATGTCTGCTTCCACTACACTTTTGCCCTCAACCGGAGGAACAG GCCTGGGGACCGGGCGAAGGCCCTGTCTGTGCTGCTGCCGCTGGTACAG CTTGAGGGCTCTGTGGCGCCCGATCTGTACTGCATGTGTGGCCGTATCT ACAAGGACATGTTCTTCAGCTCGGGTTTCCAGGATGCTGGGCACCGGGA GCAGGCCTATCACTGGTATCGCAAGGCTTTTGACGTAGAGCCCAGCCTT CACTCAGGCATCAATGCAGCTGTGCTCCTCATTGCTGCCGGGCAGCACT TTGAGGATTCCAAAGAGCTCCGGCTAATAGGCATGAAGCTGGGCTGCCT GCTGGCCCGCAAAGGCTGCGTGGAGAAGATGCAGTATTACTGGGATGTG GGTTTCTACCTGGGAGCCCAGATCCTCGCCAATGACCCCACCCAGGTGG TGCTGGCTGCAGAGCAGCTGTATAAGCTCAATGCCCCCATATGGTACCT GGTGTCCGTGATGGAGACCTTCCTGCTCTACCAGCACTTCAGGCCCACG CCAGAGCCCCCTGGAGGGCCACCACGCCGTGCCCACTTCTGGCTCCACT TCTTGCTACAGTCCTGCCAACCATTCAAGACAGCCTGTGCCCAGGGCGA CCAGTGCTTGGTGCTGGTCCTGGAGATGAACAAGGTGCTGCTGCCTGCA AAGCTCGAGGTTCGGGGTACTGACCCAGTAAGCACAGTGACCCTGAGCC TGCTGGAGCCTGAGACCCAGGACATTCCCTCCAGCTGGACCTTCCCAGT CGCCTCCATATGCGGAGTCAGCGCCTCAAAGCGCGACGAGCGCTGCTGC TTCCTCTATGCACTCCCCCCGGCTCAGGACGTCCAGCTGTGCTTCCCCA GCGTAGGGCACTGCCAGTGGTTCTGCGGCCTGATCCAGGCCTGGGTGAC GAACCCGGATTCCACGGCGCCCGCGGAGGAGGCGGAGGGCGCGGGGGAG ATGTTGGAGTTTGATTATGAGTACACGGAGACGGGCGAGCGGCTGGTGC TGGGCAAGGGCACGTATGGGGTGGTGTACGCGGGCCGCGATCGCCACAC GAGGGTGCGCATCGCCATCAAGGAGATCCCGGAGCGGGACAGCAGGTTC TCTCAGCCCCTGCATGAAGAGATCGCTCTTCACAGACGCCTGCGCCACA AGAACATAGTGCGCTATCTGGGCTCAGCTAGCCAGGGCGGCTACCTTAA GATCTTCATGGAGGAAGTGCCTGGAGGCAGCCTGTCCTCCTTGCTGCGG TCGGTGTGGGGACCCCTGAAGGACAACGAGAGCACCATCAGTTTCTACA CCCGCCAGATCCTGCAGGGACTTGGCTACTTGCACGACAACCACATCGT GCACAGGGACATAAAAGGGGACAATGTGCTGATCAACACCTTCAGTGGG CTGCTCAAGATTTCTGACTTCGGCACCTCCAAGCGGCTGGCAGGCATCA CACCTTGCACTGAGACCTTCACAGGAACTCTGCAGTATATGGCCCCAGA AATCATTGACCAGGGCCCACGCGGGTATGGGAAAGCAGCTGACATCTGG TCACTGGGCTGCACTGTCATTGAGATGGCCACAGGTCGCCCCCCCTTCC ACGAGCTCGGGAGCCCACAGGCTGCCATGTTTCAGGTGGGTATGTACAA GGTCCATCCGCCAATGCCCAGCTCTCTGTCGGCCGAGGCCCAAGCCTTT CTCCTCCGAACTTTTGAGCCAGACCCCCGCCTCCGAGCCAGCGCCCAGA CACTGCTGGGGGACCCCTTCCTGCAGCCTGGGAAAAGGAGCCGCAGCCC CAGCTCCCCACGACATGCTCCACGGCCCTCAGATGCCCCTTCTGCCAGT CCCACTCCTTCAGCCAACTCAACCACCCAGTCTCAGACATTCCCGTGCC CTCAGGCACCCTCTCAGCACCCACCCAGCCCCCCGAAGCGCTGCCTCAG TTATGGGGGCACCAGCCAGCTCCGGGTGCCCGAGGAGCCTGCGGCCGAG GAGCCTGCGTCTCCGGAGGAGAGTTCGGGGCTGAGCCTGCTGCACCAGG AGAGCAAGCGTCGGGCCATGCTGGCCGCAGTATTGGAGCAGGAGCTGCC AGCGCTGGCGGAGAATCTGCACCAGGAGCAGAAGCAAGAGCAGGGGGCC CGTCTGGGCAGAAACCATGTGGAAGAGCTGCTGCGCTGCCTCGGGGCAC ACATCCACACTCCCAACCGCCGGCAGCTCGCCCAGGAGCTGCGGGCGCT GCAAGGACGGCTGAGGGCCCAGGGCCTTGGGCCTGCGCTTCTGCACAGA CCGCTGTTTGCCTTCCCGGATGCGGTGAAGCAGATCCTCCGCAAGCGCC AGATCCGTCCACACTGGATGTTCGTTCTGGACTCACTGCTCAGCCGTGC TGTGCGGGCAGCCCTGGGTGTGCTAGGACCGGAGGTGGAGAAGGAGGCG GTCTCACCGAGGTCAGAGGAGCTGAGTAATGAAGGGGACTCCCAGCAGA GCCCAGGCCAGCAGAGCCCGCTTCCGGTGGAGCCCGAGCAGGGCCCCGC TCCTCTGATGGTGCAGCTGAGCCTCTTGAGGGCAGAGACTGATCGGCTG CGCGAAATCCTGGCGGGGAAGGAACGGGAGTACCAGGCCCTGGTGCAGC GGGCTCTACAGCGGCTGAATGAGGAAGCCCGGACCTATGTCCTGGCCCC AGAGCCTCCAACTGCTCTTTCAACGGACCAGGGCCTGGTGCAGTGGCTA CAGGAACTGAATGTGGATTCAGGCACCATCCAAATGCTGTTGAACCATA GCTTCACCCTCCACACTCTGCTCACCTATGCCACTCGAGATGACCTCAT CTACACCCGCATCAGGGGAGGGATGGTATGCCGCATCTGGAGGGCCATC TTGGCACAGCGAGCAGGATCCACACCAGTCACCTCTGGACCCTGA. Human MEKK7 CDS (SEQ ID NO: 24) ATGTCTACAGCCTCTGCCGCCTCCTCCTCCTCCTCGTCTTCGGCCGGTG AGATGATCGAAGCCCCTTCCCAGGTCCTCAACTTTGAAGAGATCGACTA CAAGGAGATCGAGGTGGAAGAGGTTGTTGGAAGAGGAGCCTTTGGAGTT GTTTGCAAAGCTAAGTGGAGAGCAAAAGATGTTGCTATTAAACAAATAG AAAGTGAATCTGAGAGGAAAGCGTTTATTGTAGAGCTTCGGCAGTTATC CCGTGTGAACCATCCTAATATTGTAAAGCTTTATGGAGCCTGCTTGAAT CCAGTGTGTCTTGTGATGGAATATGCTGAAGGGGGCTCTTTATATAATG TGCTGCATGGTGCTGAACCATTGCCATATTATACTGCTGCCCACGCAAT GAGTTGGTGTTTACAGTGTTCCCAAGGAGTGGCTTATCTTCACAGCATG CAACCCAAAGCGCTAATTCACAGGGACCTGAAACCACCAAACTTACTGC TGGTTGCAGGGGGGACAGTTCTAAAAATTTGTGATTTTGGTACAGCCTG TGACATTCAGACACACATGACCAATAACAAGGGGAGTGCTGCTTGGATG GCACCTGAAGTTTTTGAAGGTAGTAATTACAGTGAAAAATGTGACGTCT TCAGCTGGGGTATTATTCTTTGGGAAGTGATAACGCGTCGGAAACCCTT TGATGAGATTGGTGGCCCAGCTTTCCGAATCATGTGGGCTGTTCATAAT GGTACTCGACCACCACTGATAAAAAATTTACCTAAGCCCATTGAGAGCC TGATGACTCGTTGTTGGTCTAAAGATCCTTCCCAGCGCCCTTCAATGGA GGAAATTGTGAAAATAATGACTCACTTGATGCGGTACTTTCCAGGAGCA GATGAGCCATTACAGTATCCTTGTCAGTATTCAGATGAAGGACAGAGCA ACTCTGCCACCAGTACAGGCTCATTCATGGACATTGCTTCTACAAATAC GAGTAACAAAAGTGACACTAATATGGAGCAAGTTCCTGCCACAAATGAT ACTATTAAGCGCTTAGAATCAAAATTGTTGAAAAATCAGGCAAAGCAAC AGAGTGAATCTGGACGTTTAAGCTTGGGAGCCTCCCGTGGGAGCAGTGT GGAGAGCTTGCCCCCAACCTCTGAGGGCAAGAGGATGAGTGCTGACATG TCTGAAATAGAAGCTAGGATCGCCGCAACCACAGGCAACGGACAGCCAA GACGTAGATCCATCCAAGACTTGACTGTAACTGGAACAGAACCTGGTCA GGTGAGCAGTAGGTCATCCAGTCCCAGTGTCAGAATGATTACTACCTCA GGACCAACCTCAGAAAAGCCAACTCGAAGTCATCCATGGACCCCTGATG ATTCCACAGATACCAATGGATCAGATAACTCCATCCCAATGGCTTATCT TACACTGGATCACCAACTACAGCCTCTAGCACCGTGCCCAAACTCCAAA GAATCTATGGCAGTGTTTGAACAGCATTGTAAAATGGCACAAGAATATA TGAAAGTTCAAACAGAAATTGCATTGTTATTACAGAGAAAGCAAGAACT AGTTGCAGAACTGGACCAGGATGAAAAGGACCAGCAAAATACATCTCGC CTGGTACAGGAACATAAAAAGCTTTAGATGAAAACAAAAGCCTTTCTAC TTACTACCAGCAATGCAAAAAACAACTAGAGGTCATCAGAAGTCAGCAG CAGAAACGACAAGGCACTTCATGA. Human MK2 CDS (SEQ ID NO: 25) ATGCTGTCCAACTCCCAGGGCCAGAGCCCGCCGGTGCCGTTCCCCGCCC CGGCCCCGCCGCCGCAGCCCCCCACCCCTGCCCTGCCGCACCCCCCGGC GCAGCCGCCGCCGCCGCCCCCGCAGCAGTTCCCGCAGTTCCACGTCAAG TCCGGCCTGCAGATCAAGAAGAACGCCATCATCGATGACTACAAGGTCA CCAGCCAGGTCCTGGGGCTGGGCATCAACGGCAAAGTTTTGCAGATCTT CAACAAGAGGACCCAGGAGAAATTCGCCCTCAAAATGCTTCAGGACTGC CCCAAGGCCCGCAGGGAGGTGGAGCTGCACTGGCGGGCCTCCCAGTGCC CGCACATCGTACGGATCGTGGATGTGTACGAGAATCTGTACGCAGGGAG GAAGTGCCTGCTGATTGTCATGGAATGTTTGGACGGTGGAGAACTCTTT AGCCGAATCCAGGATCGAGGAGACCAGGCATTCACAGAAAGAGAAGCAT CCGAAATCATGAAGAGCATCGGTGAGGCCATCCAGTATCTGCATTCAAT CAACATTGCCCATCGGGATGTCAAGCCTGAGAATCTCTTATACACCTCC AAAAGGCCCAACGCCATCCTGAAACTCACTGACTTTGGCTTTGCCAAGG AAACCACCAGCCACAACTCTTTGACCACTCCTTGTTATACACCGTACTA TGTGGCTCCAGAAGTGCTGGGTCCAGAGAAGTATGACAAGTCCTGTGAC ATGTGGTCCCTGGGTGTCATCATGTACATCCTGCTGTGTGGGTATCCCC CCTTCTACTCCAACCACGGCCTTGCCATCTCTCCGGGCATGAAGACTCG CATCCGAATGGGCCAGTATGAATTTCCCAACCCAGAATGGTCAGAAGTA TCAGAGGAAGTGAAGATGCTCATTCGGAATCTGCTGAAAACAGAGCCCA CCCAGAGAATGACCATCACCGAGTTTATGAACCACCCTTGGATCATGCA ATCAACAAAGGTCCCTCAAACCCCACTGCACACCAGCCGGGTCCTGAAG GAGGACAAGGAGCGGTGGGAGGATGTCAAGGGGTGTCTTCATGACAAGA ACAGCGACCAGGCCACTTGGCTGACCAGGTTGTGA. Human MyD88 CDS (SEQ ID NO: 26) ATGCGACCCGACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAG GAGGTCCCGGCGCGGGGTCTGCGGCCCCGGTCTCCTCCACATCCTCCCT TCCCCTGGCTGCTCTCAACATGCGAGTGCGGCGCCGCCTGTCTCTGTTC TTGAACGTGCGGACACAGGTGGCGGCCGACTGGACCGCGCTGGCGGAGG AGATGGACTTTGAGTACTTGGAGATCCGGCAACTGGAGACACAAGCGGA CCCCACTGGCAGGCTGCTGGACGCCTGGCAGGGACGCCCTGGCGCCTCT GTAGGCCGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGACGTGC TGCTGGAGCTGGGACCCAGCATTGAGGAGGATTGCCAAAAGTATATCTT GAAGCAGCAGCAGGAGGAGGCTGAGAAGCCTTTACAGGTGGCCGCTGTA GACAGCAGTGTCCCACGGACAGCAGAGCTGGCGGGCATCACCACACTTG ATGACCCCCTGGGGCATATGCCTGAGCGTTTCGATGCCTTCATCTGCTA TTGCCCCAGCGACATCCAGTTTGTGCAGGAGATGATCCGGCAACTGGAA CAGACAAACTATCGACTGAAGTTGTGTGTGTCTGACCGCGATGTCCTGC CTGGCACCTGTGTCTGGTCTATTGCTAGTGAGCTCATCGAAAAGAGGTT GGCTAGAAGGCCACGGGGTGGGTGCCGCCGGATGGTGGTGGTTGTCTCT GATGATTACCTGCAGAGCAAGGAATGTGACTTCCAGACCAAATTTGCAC TCAGCCTCTCTCCAGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTA CAAGGCAATGAAGAAAGAGTTCCCCAGCATCCTGAGGTTCATCACTGTC TGCGACTACACCAACCCCTGCACCAAATCTTGGTTCTGGACTCGCCTTG CCAAGGCCTTGTCCCTGCCCTGA. Human NF-κB CDS (SEQ ID NO: 27) ATGGCAGAAGATGATCCATATTTGGGAAGGCCTGAACAAATGTTTCATT TGGATCCTTCTTTGACTCATACAATATTTAATCCAGAAGTATTTCAACC ACAGATGGCACTGCCAACAGATGGCCCATACCTTCAAATATTAGAGCAA CCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTGAAGGCCCATCCC ATGGTGGACTACCTGGTGCCTCTAGTGAAAAGAACAAGAAGTCTTACCC TCAGGTCAAAATCTGCAACTATGTGGGACCAGCAAAGGTTATTGTTCAG TTGGTCACAAATGGAAAAAATATCCACCTGCATGCCCACAGCCTGGTGG GAAAACACTGTGAGGATGGGATCTGCACTGTAACTGCTGGACCCAAGGA CATGGTGGTCGGCTTCGCAAACCTGGGTATACTTCATGTGACAAAGAAA AAAGTATTTGAAACACTGGAAGCACGAATGACAGAGGCGTGTATAAGGG GCTATAATCCTGGACTCTTGGTGCACCCTGACCTTGCCTATTTGCAAGC AGAAGGTGGAGGGGACCGGCAGCTGGGAGATCGGGAAAAAGAGCTAATC CGCCAAGCAGCTCTGCAGCAGACCAAGGAGATGGACCTCAGCGTGGTGC GGCTCATGTTTACAGCTTTTCTTCCGGATAGCACTGGCAGCTTCACAAG GCGCCTGGAACCCGTGGTATCAGACGCCATCTATGACAGTAAAGCCCCC AATGCATCCAACTTGAAAATTGTAAGAATGGACAGGACAGCTGGATGTG TGACTGGAGGGGAGGAAATTTATCTTCTTTGTGACAAAGTTCAGAAAGA TGACATCCAGATTCGATTTTATGAAGAGGAAGAAAATGGTGGAGTCTGG GAAGGATTTGGAGATTTTTCCCCCACAGATGTTCATAGACAATTTGCCA TTGTCTTCAAAACTCCAAAGTATAAAGATATTAATATTACAAAACCAGC CTCTGTGTTTGTCCAGCTTCGGAGGAAATCTGACTTGGAAACTAGTGAA CCAAAACCTTTCCTCTACTATCCTGAAATCAAAGATAAAGAAGAAGTGC AGAGGAAACGTCAGAAGCTCATGCCCAATTTTTCGGATAGTTTCGGCGG TGGTAGTGGTGCTGGAGCTGGAGGCGGAGGCATGTTTGGTAGTGGCGGT GGAGGAGGGGGCACTGGAAGTACAGGTCCAGGGTATAGCTTCCCACACT ATGGATTTCCTACTTATGGTGGGATTACTTTCCATCCTGGAACTACTAA ATCTAATGCTGGGATGAAGCATGGAACCATGGACACTGAATCTAAAAAG GACCCTGAAGGTTGTGACAAAAGTGATGACAAAAACACTGTAAACCTCT TTGGGAAAGTTATTGAAACCACAGAGCAAGATCAGGAGCCCAGCGAGGC CACCGTTGGGAATGGTGAGGTCACTCTAACGTATGCAACAGGAACAAAA GAAGAGAGTGCTGGAGTTCAGGATAACCTCTTTCTAGAGAAGGCTATGC AGCTTGCAAAGAGGCATGCCAATGCCCTTTTCGACTACGCGGTGACAGG AGACGTGAAGATGCTGCTGGCCGTCCAGCGCCATCTCACTGCTGTGCAG GATGAGAATGGGGACAGTGTCTTACACTTAGCAATCATCCACCTTCATT CTCAACTTGTGAGGGATCTACTAGAAGTCACATCTGGTTTGATTTCTGA TGACATTATCAACATGAGAAATGATCTGTACCAGACGCCCTTGCACTTG GCAGTGATCACTAAGCAGGAAGATGTGGTGGAGGATTTGCTGAGGGCTG GGGCCGACCTGAGCCTTCTGGACCGCTTGGGTAACTCTGTTTTGCACCT AGCTGCCAAAGAAGGACATGATAAAGTTCTCAGTATCTTACTCAAGCAC AAAAAGGCAGCACTACTTCTTGACCACCCCAACGGGGACGGTCTGAATG CCATTCATCTAGCCATGATGAGCAATAGCCTGCCATGTTTGCTGCTGCT GGTGGCCGCTGGGGCTGACGTCAATGCTCAGGAGCAGAAGTCCGGGCGC ACAGCACTGCACCTGGCTGTGGAGCACGACAACATCTCATTGGCAGGCT GCCTGCTCCTGGAGGGTGATGCCCATGTGGACAGTACTACCTACGATGG AACCACACCCCTGCATATAGCAGCTGGGAGAGGGTCCACCAGGCTGGCA GCTCTTCTCAAAGCAGCAGGAGCAGATCCCCTGGTGGAGAACTTTGAGC CTCTCTATGACCTGGATGACTCTTGGGAAAATGCAGGAGAGGATGAAGG AGTTGTGCCTGGAACCACGCCTCTAGATATGGCCACCAGCTGGCAGGTA TTTGACATATTAAATGGGAAACCATATGAGCCAGAGTTTACATCTGATG ATTTACTAGCACAAGGAGACATGAAACAGCTGGCTGAAGATGTGAAGCT GCAGCTGTATAAGTTACTAGAAATTCCTGATCCAGACAAAAACTGGGCT ACTCTGGCGCAGAAATTAGGTCTGGGGATACTTAATAATGCCTTCCGGC TGAGTCCTGCTCCTTCCAAAACACTTATGGACAACTATGAGGTCTCTGG GGGTACAGTCAGAGAGCTGGTGGAGGCCCTGAGACAAATGGGCTACACC GAAGCAATTGAAGTGATCCAGGCAGCCTCCAGCCCAGTGAAGACCACCT CTCAGGCCCACTCGCTGCCTCTCTCGCCTGCCTCCACAAGGCAGCAAAT AGACGAGCTCCGAGACAGTGACAGTGTCTGCGACAGCGGCGTGGAGACA TCCTTCCGCAAACTCAGCTTTACCGAGTCTCTGACCAGTGGTGCCTCAC TGCTAACTCTCAACAAAATGCCCCATGATTATGGGCAGGAAGGACCTCT AGAAGGCAAAATTTAG. Human NIK CDS (SEQ ID NO: 28) ATGGCAGTGATGGAAATGGCCTGCCCAGGTGCCCCTGGCTCAGCAGTGG GGCAGCAGAAGGAACTCCCCAAAGCCAAGGAGAAGACGCCGCCACTGGG GAAGAAACAGAGCTCCGTCTACAAGCTTGAGGCCGTGGAGAAGAGCCCT GTGTTCTGCGGAAAGTGGGAGATCCTGAATGACGTGATTACCAAGGGCA CAGCCAAGGAAGGCTCCGAGGCAGGGCCAGCTGCCATCTCTATCATCGC CCAGGCTGAGTGTGAGAATAGCCAAGAGTTCAGCCCCACCTTTTCAGAA CGCATTTTCATCGCTGGGTCCAAACAGTACAGCCAGTCCGAGAGTCTTG ATCAGATCCCCAACAATGTGGCCCATGCTACAGAGGGCAAAATGGCCCG TGTGTGTTGGAAGGGAAAGCGTCGCAGCAAAGCCCGGAAGAAACGGAAG AAGAAGAGCTCAAAGTCCCTGGCTCATGCAGGAGTGGCCTTGGCCAAAC CCCTCCCCAGGACCCCTGAGCAGGAGAGCTGCACCATCCCAGTGCAGGA GGATGAGTCTCCACTCGGCGCCCCATATGTTAGAAACACCCCGCAGTTC ACCAAGCCTCTGAAGGAACCAGGCCTTGGGCAACTCTGTTTTAAGCAGC TTGGCGAGGGCCTACGGCCGGCTCTGCCTCGATCAGAACTCCACAAACT GATCAGCCCCTTGCAATGTCTGAACCACGTGTGGAAACTGCACCACCCC CAGGACGGAGGCCCCCTGCCCCTGCCCACGCACCCCTTCCCCTATAGCA GACTGCCTCATCCCTTCCCATTCCACCCTCTCCAGCCCTGGAAACCTCA CCCTCTGGAGTCCTTCCTGGGCAAACTGGCCTGTGTAGACAGCCAGAAA CCCTTGCCTGACCCACACCTGAGCAAACTGGCCTGTGTAGACAGTCCAA AGCCCCTGCCTGGCCCACACCTGGAGCCCAGCTGCCTGTCTCGTGGTGC CCATGAGAAGTTTTCTGTGGAGGAATACCTAGTGCATGCTCTGCAAGGC AGCGTGAGCTCAGGCCAGGCCCACAGCCTGACCAGCCTGGCCAAGACCT GGGCAGCAAGGGGCTCCAGATCCCGGGAGCCCAGCCCCAAAACTGAGGA CAACGAGGGTGTCCTGCTCACTGAGAAACTCAAGCCAGTGGATTATGAG TACCGAGAAGAAGTCCACTGGGCCACGCACCAGCTCCGCCTGGGCAGAG GCTCCTTCGGAGAGGTGCACAGGATGGAGGACAAGCAGACTGGCTTCCA GTGCGCTGTCAAAAAGGTGCGGCTGGAAGTATTTCGGGCAGAGGAGCTG ATGGCATGTGCAGGATTGACCTCACCCAGAATTGTCCCTTTGTATGGAG CTGTGAGAGAAGGGCCTTGGGTCAACATCTTCATGGAGCTGCTGGAAGG TGGCTCCCTGGGCCAGCTGGTCAAGGAGCAGGGCTGTCTCCCAGAGGAC CGGGCCCTGTACTACCTGGGCCAGGCCCTGGAGGGTCTGGAATACCTCC ACTCACGAAGGATTCTGCATGGGGACGTCAAAGCTGACAACGTGCTCCT GTCCAGCGATGGGAGCCACGCAGCCCTCTGTGACTTTGGCCATGCTGTG TGTCTTCAACCTGATGGCCTGGGAAAGTCCTTGCTCACAGGGGACTACA TCCCTGGCACAGAGACCCACATGGCTCCGGAGGTGGTGCTGGGCAGGAG CTGCGACGCCAAGGTGGATGTCTGGAGCAGCTGCTGTATGATGCTGCAC ATGCTCAACGGCTGCCACCCCTGGACTCAGTTCTTCCGAGGGCCGCTCT GCCTCAAGATTGCCAGCGAGCCTCCGCCTGTGAGGGAGATCCCACCCTC CTGCGCCCCTCTCACAGCCCAGGCCATCCAAGAGGGGCTGAGGAAAGAG CCCATCCACCGCGTGTCTGCAGCGGAGCTGGGAGGGAAGGTGAACCGGG CACTACAGCAAGTGGGAGGTCTGAAGAGCCCTTGGAGGGGAGAATATAA AGAACCAAGACATCCACCGCCAAATCAAGCCAATTACCACCAGACCCTC CATGCCCAGCCGAGAGAGCTTTCGCCAAGGGCCCCAGGGCCCCGGCCAG CTGAGGAGACAACAGGCAGAGCCCCTAAGCTCCAGCCTCCTCTCCCACC AGAGCCCCCAGAGCCAAACAAGTCTCCTCCCTTGACTTTGAGCAAGGAG GAGTCTGGGATGTGGGAACCCTTACCTCTGTCCTCCCTGGAGCCAGCCC CTGCCAGAAACCCCAGCTCACCAGAGCGGAAAGCAACCGTCCCGGAGCA GGAACTGCAGCAGCTGGAAATAGAATTATTCCTCAACAGCCTGTCCCAG CCATTTTCTCTGGAGGAGCAGGAGCAAATTCTCTCGTGCCTCAGCATCG ACAGCCTCTCCCTGTCGGATGACAGTGAGAAGAACCCATCAAAGGCCTC TCAAAGCTCGCGGGACACCCTGAGCTCAGGCGTACACTCCTGGAGCAGC CAGGCCGAGGCTCGAAGCTCCAGCTGGAACATGGTGCTGGCCCGGGGGC GGCCCACCGACACCCCAAGCTATTTCAATGGTGTGAAAGTCCAAATACA GTCTCTTAATGGTGAACACCTGCACATCCGGGAGTTCCACCGGGTCAAA GTGGGAGACATCGCCACTGGCATCAGCAGCCAGATCCCAGCTGCAGCCT TCAGCTTGGTCACCAAAGACGGGCAGCCTGTTCGCTACGACATGGAGGT GCCAGACTCGGGCATCGACCTGCAGTGCACACTGGCCCCTGATGGCAGC TTCGCCTGGAGCTGGAGGGTCAAGCATGGCCAGCTGGAGAACAGGCCCT AA. Human p38 CDS (SEQ ID NO: 29) ATGTCTCAGGAGAGGCCCACGTTCTACCGGCAGGAGCTGAACAAGACAA TCTGGGAGGTGCCCGAGCGTTACCAGAACCTGTCTCCAGTGGGCTCTGG CGCCTATGGCTCTGTGTGTGCTGCTTTTGACACAAAAACGGGGTTACGT GTGGCAGTGAAGAAGCTCTCCAGACCATTTCAGTCCATCATTCATGCGA AAAGAACCTACAGAGAACTGCGGTTACTTAAACATATGAAACATGAAAA TGTGATTGGTCTGTTGGACGTTTTTACACCTGCAAGGTCTCTGGAGGAA TTCAATGATGTGTATCTGGTGACCCATCTCATGGGGGCAGATCTGAACA ACATTGTGAAATGTCAGAAGCTTACAGATGACCATGTTCAGTTCCTTAT CTACCAAATTCTCCGAGGTCTAAAGTATATACATTCAGCTGACATAATT CACAGGGACCTAAAACCTAGTAATCTAGCTGTGAATGAAGACTGTGAGC TGAAGATTCTGGATTTTGGACTGGCTCGGCACACAGATGATGAAATGAC AGGCTACGTGGCCACTAGGTGGTACAGGGCTCCTGAGATCATGCTGAAC TGGATGCATTACAACCAGACAGTTGATATTTGGTCAGTGGGATGCATAA TGGCCGAGCTGTTGACTGGAAGAACATTGTTTCCTGGTACAGACCATAT TAACCAGCTTCAGCAGATTATGCGTCTGACAGGAACACCCCCCGCTTAT CTCATTAACAGGATGCCAAGCCATGAGGCAAGAAACTATATTCAGTCTT TGACTCAGATGCCGAAGATGAACTTTGCGAATGTATTTATTGGTGCCAA TCCCCTGGCTGTCGACTTGCTGGAGAAGATGCTTGTATTGGACTCAGAT AAGAGAATTACAGCGGCCCAAGCCCTTGCACATGCCTACTTTGCTCAGT ACCACGATCCTGATGATGAACCAGTGGCCGATCCTTATGATCAGTCCTT TGAAAGCAGGGACCTCCTTATAGATGAGTGGAAAAGCCTGACCTATGAT GAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGAGT CCTGA. Human PKR CDS (SEQ ID NO: 30) ATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACAT ACCGTCAGAAGCAGGGAGTAGTACTTAAATATCAAGAACTGCCTAATTC AGGACCTCCACATGATAGGAGGTTTACATTTCAAGTTATAATAGATGGA AGAGAATTTCCAGAAGGTGAAGGTAGATCAAAGAAGGAAGCAAAAAATG CCGCAGCCAAATTAGCTGTTGAGATACTTAATAAGGAAAAGAAGGCAGT TAGTCCTTTATTATTGACAACAACGAATTCTTCAGAAGGATTATCCATG GGGAATTACATAGGCCTTATCAATAGAATTGCCCAGAAGAAAAGACTAA CTGTAAATTATGAACAGTGTGCATCGGGGGTGCATGGGCCAGAAGGATT TCATTATAAATGCAAAATGGGACAGAAAGAATATAGTATTGGTACAGGT TCTACTAAACAGGAAGCAAAACAATTGGCCGCTAAACTTGCATATCTTC AGATATTATCAGAAGAAACCTCAGTGAAATCTGACTACCTGTCCTCTGG TTCTTTTGCTACTACGTGTGAGTCCCAAAGCAACTCTTTAGTGACCAGC ACACTCGCTTCTGAATCATCATCTGAAGGTGACTTCTCAGCAGATACAT CAGAGATAAATTCTAACAGTGACAGTTTAAACAGTTCTTCGTTGCTTAT GAATGGTCTCAGAAATAATCAAAGGAAGGCAAAAAGATCTTTGGCACCC AGATTTGACCTTCCTGACATGAAAGAAACAAAGTATACTGTGGACAAGA GGTTTGGCATGGATTTTAAAGAAATAGAATTAATTGGCTCAGGTGGATT TGGCCAAGTTTTCAAAGCAAAACACAGAATTGACGGAAAGACTTACGTT ATTAAACGTGTTAAATATAATAACGAGAAGGCGGAGCGTGAAGTAAAAG CATTGGCAAAACTTGATCATGTAAATATTGTTCACTACAATGGCTGTTG GGATGGATTTGATTATGATCCTGAGACCAGTGATGATTCTCTTGAGAGC AGTGATTATGATCCTGAGAACAGCAAAAATAGTTCAAGGTCAAAGACTA AGTGCCTTTTCATCCAAATGGAATTCTGTGATAAAGGGACCTTGGAACA ATGGATTGAAAAAAGAAGAGGCGAGAAACTAGACAAAGTTTTGGCTTTG GAACTCTTTGAACAAATAACAAAAGGGGTGGATTATATACATTCAAAAA AATTAATTCATAGAGATCTTAAGCCAAGTAATATATTCTTAGTAGATAC AAAACAAGTAAAGATTGGAGACTTTGGACTTGTAACATCTCTGAAAAAT GATGGAAAGCGAACAAGGAGTAAGGGAACTTTGCGATACATGAGCCCAG AACAGATTTCTTCGCAAGACTATGGAAAGGAAGTGGACCTCTACGCTTT GGGGCTAATTCTTGCTGAACTTCTTCATGTATGTGACACTGCTTTTGAA ACATCAAAGTTTTTCACAGACCTACGGGATGGCATCATCTCAGATATAT TTGATAAAAAAGAAAAAACTCTTCTACAGAAATTACTCTCAAAGAAACC TGAGGATCGACCTAACACATCTGAAATACTAAGGACCTTGACTGTGTGG AAGAAAAGCCCAGAGAAAAATGAACGACACACATGTTAG. Human Rae CDS (SEQ ID NO: 31) ATGAGCGACGTGGCTATTGTGAAGGAGGGTTGGCTGCACAAACGAGGGG AGTACATCAAGACCTGGCGGCCACGCTACTTCCTCCTCAAGAATGATGG CACCTTCATTGGCTACAAGGAGCGGCCGCAGGATGTGGACCAACGTGAG GCTCCCCTCAACAACTTCTCTGTGGCGCAGTGCCAGCTGATGAAGACGG AGCGGCCCCGGCCCAACACCTTCATCATCCGCTGCCTGCAGTGGACCAC TGTCATCGAACGCACCTTCCATGTGGAGACTCCTGAGGAGCGGGAGGAG TGGACAACCGCCATCCAGACTGTGGCTGACGGCCTCAAGAAGCAGGAGG AGGAGGAGATGGACTTCCGGTCGGGCTCACCCAGTGACAACTCAGGGGC TGAAGAGATGGAGGTGTCCCTGGCCAAGCCCAAGCACCGCGTGACCATG AACGAGTTTGAGTACCTGAAGCTGCTGGGCAAGGGCACTTTCGGCAAGG TGATCCTGGTGAAGGAGAAGGCCACAGGCCGCTACTACGCCATGAAGAT CCTCAAGAAGGAAGTCATCGTGGCCAAGGACGAGGTGGCCCACACACTC ACCGAGAACCGCGTCCTGCAGAACTCCAGGCACCCCTTCCTCACAGCCC TGAAGTACTCTTTCCAGACCCACGACCGCCTCTGCTTTGTCATGGAGTA CGCCAACGGGGGCGAGCTGTTCTTCCACCTGTCCCGGGAGCGTGTGTTC TCCGAGGACCGGGCCCGCTTCTATGGCGCTGAGATTGTGTCAGCCCTGG ACTACCTGCACTCGGAGAAGAACGTGGTGTACCGGGACCTCAAGCTGGA GAACCTCATGCTGGACAAGGACGGGCACATTAAGATCACAGACTTCGGG CTGTGCAAGGAGGGGATCAAGGACGGTGCCACCATGAAGACCTTTTGCG GCACACCTGAGTACCTGGCCCCCGAGGTGCTGGAGGACAATGACTACGG CCGTGCAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTACGAGATGATG TGCGGTCGCCTGCCCTTCTACAACCAGGACCATGAGAAGCTTTTTGAGC TCATCCTCATGGAGGAGATCCGCTTCCCGCGCACGCTTGGTCCCGAGGC CAAGTCCTTGCTTTCAGGGCTGCTCAAGAAGGACCCCAAGCAGAGGCTT GGCGGGGGCTCCGAGGACGCCAAGGAGATCATGCAGCATCGCTTCTTTG CCGGTATCGTGTGGCAGCACGTGTACGAGAAGAAGCTCAGCCCACCCTT CAAGCCCCAGGTCACGTCGGAGACTGACACCAGGTATTTTGATGAGGAG TTCACGGCCCAGATGATCACCATCACACCACCTGACCAAGATGACAGCA TGGAGTGTGTGGACAGCGAGCGCAGGCCCCACTTCCCCCAGTTCTCCTA CTCGGCCAGCGGCACGGCCTGA. Human Raf CDS (SEQ ID NO: 32) ATGGCTAGCAAACGAAAATCTACAACTCCATGCATGGTTCGGACATCAC AAGTAGTAGAACAAGATGTGCCCGAGGAAGTAGACAGGGCCAAAGAGAA AGGAATCGGCACACCACAGCCTGACGTGGCCAAGGACAGTTGGGCAGCA GAACTTGAAAACTCTTCCAAAGAAAACGAAGTGATAGAGGTGAAATCTA TGGGGGAAAGCCAGTCCAAAAAACTCCAAGGTGGTTATGAGTGCAAATA CTGCCCCTACTCCACGCAAAACCTGAACGAGTTCACGGAGCATGTCGAC ATGCAGCATCCCAACGTGATTCTCAACCCCCTCTACGTGTGTGCAGAAT GTAACTTCACAACCAAAAAGTACGACTCCCTATCCGACCACAACTCCAA GTTCCATCCCGGGGAGGCCAACTTCAAGCTGAAGTTAATTAAACGCAAT AATCAAACTGTCTTGGAACAGTCCATCGAAACCACCAACCATGTCGTGT CCATCACCACCAGTGGCCCTGGAACTGGTGACAGTGATTCTGGGATCTC GGTGAGTAAAACCCCCATCATGAAGCCTGGAAAACCAAAAGCGGATGCC AAGAAGGTGCCCAAGAAGCCCGAGGAGATCACCCCCGAGAACCACGTGG AAGGGACCGCCCGCCTGGTGACAGACACAGCTGAGATCCTCTCGAGACT CGGCGGGGTGGAGCTCCTCCAAGACACATTAGGACACGTCATGCCTTCT GTACAGCTGCCACCAAATATCAACCTTGTGCCCAAGGTCCCTGTCCCAC TAAATACTACCAAATACAACTCTGCCCTGGATACAAATGCCACGATGAT CAACTCTTTCAACAAGTTTCCTTACCCGACCCAGGCTGAGTTGTCCTGG CTGACAGCTGCCTCCAAACACCCAGAGGAGCACATCAGAATCTGGTTTG CCACCCAGCGCTTAAAGCATGGCATCAGCTGGTCCCCAGAAGAGGTGGA GGAGGCCCGGAAGAAGATGTTCAACGGCACCATCCAGTCAGTACCCCCG ACCATCACTGTGCTGCCCGCCCAGTTGGCCCCCACAAAGGTGACGCAGC CCATCCTCCAGACGGCTCTACCGTGCCAGATCCTCGGCCAGACTAGCCT GGTGCTGACTCAGGTGACCAGCGGGTCAACAACCGTCTCTTGCTCCCCC ATCACACTTGCCGTGGCAGGAGTCACCAACCATGGCCAGAAGAGACCCT TGGTGACTCCCCAAGCTGCCCCCGAACCCAAGCGTCCACACATCGCTCA GGTGCCAGAGCCCCCACCCAAGGTGGCCAACCCCCCGCTCACACCAGCC AGTGACCGCAAGAAGACAAAGGAGCAGATAGCACATCTCAAGGCCAGCT TTCTCCAGAGCCAGTTCCCTGACGATGCCGAGGTTTACCGGCTCATCGA GGTGACTGGCCTTGCCAGGAGCGAGATCAAGAAGTGGTTCAGTGACCAC CGATATCGGTGTCAAAGGGGCATCGTCCACATCACCAGCGAATCCCTTG CCAAAGACCAGTTGGCCATCGCGGCCTCCCGACACGGTCGCACGTATCA TGCGTACCCAGACTTTGCCCCCCAGAAGTTCAAAGAGAAAACACAGGGT CAGGTTAAAATCTTGGAAGACAGCTTTTTGAAAAGTTCTTTTCCTACCC AAGCAGAACTGGATCGGCTAAGGGTGGAGACCAAGCTGAGCAGGAGAGA GATCGACTCCTGGTTCTCGGAGAGGCGGAAGCTTCGAGACAGCATGGAA CAAGCTGTCTTGGATTCCATGGGGTCTGGCAAAAAAGGCCAAGATGTGG GAGCCCCCAATGGTGCTCTGTCTCGACTCGACCAGCTCTCCGGTGCCCA GTTAACAAGTTCTCTGCCCAGCCCTTCGCCAGCAATTGCAAAAAGTCAA GAACAGGTTCATCTCCTGAGGAGCACGTTTGCAAGAACCCAGTGGCCTA CTCCCCAGGAGTACGACCAGTTAGCGGCCAAGACTGGCCTGGTCCGAAC TGAGATTGTGCGTTGGTTCAAGGAGAACAGATGCTTGCTGAAAACGGGA ACCGTGAAGTGGATGGAGCAGTACCAGCACCAGCCCATGGCAGATGATC ACGGCTACGATGCCGTAGCAAGGAAAGCAACAAAACCCATGGCCGAGAG CCCAAAGAACGGGGGTGATGTGGTTCCACAATATTACAAGGACCCCAAA AAGCTCTGCGAAGAGGACTTGGAGAAGTTGGTGACCAGGGTAAAAGTAG GCAGCGAGCCAGCAAAAGACTGTTTGCCAGCAAAGCCCTCAGAGGCCAC CTCAGACCGGTCAGAGGGCAGCAGCCGGGACGGCCAGGGTAGCGACGAG AACGAGGAGTCGAGCGTTGTGGATTACGTGGAGGTGACGGTCGGGGAGG AGGATGCGATCTCAGATAGATCAGATAGCTGGAGTCAGGCTGCGGCAGA GGTGTGTCGGAACTGGCTGAATCAGACTCCGACTGCGTCCCTGCAGAGG CTGGCCAGGCCTAG. Human K-Ras CDS (SEQ ID NO: 33) ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGA GTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGA TCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAA ACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTG CAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATT TGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAA CAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAG GAAATAAATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCA GGACTTAGCAAGAAGTTATGGAATTCCTTTTATTGAAACATCAGCAAAG ACAAGACAGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTC GAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAAAGAAGAAAAAGAA GTCAAAGACAAAGTGTGTAATTATGTAA. Human N-Ras CDS (SEQ ID NO: 34) ATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGGTGGTGTTGGGAAAA GCGCACTGACAATCCAGCTAATCCAGAACCACTTTGTAGATGAATATGA TCCCACCATAGAGGATTCTTACAGAAAACAAGTGGTTATAGATGGTGAA ACCTGTTTGTTGGACATACTGGATACAGCTGGACAAGAAGAGTACAGTG CCATGAGAGACCAATACATGAGGACAGGCGAAGGCTTCCTCTGTGTATT TGCCATCAATAATAGCAAGTCATTTGCGGATATTAACCTCTACAGGGAG CAGATTAAGCGAGTAAAAGACTCGGATGATGTACCTATGGTGCTAGTGG GAAACAAGTGTGATTTGCCAACAAGGACAGTTGATACAAAACAAGCCCA CGAACTGGCCAAGAGTTACGGGATTCCATTCATTGAAACCTCAGCCAAG ACCAGACAGGGTGTTGAAGATGCTTTTTACACACTGGTAAGAGAAATAC GCCAGTACCGAATGAAAAAACTCAACAGCAGTGATGATGGGACTCAGGG TTGTATGGGATTGCCATGTGTGGTGATGTAA. Human RIP CDS (SEQ ID NO: 35) ATGCAACCAGACATGTCCTTGAATGTCATTAAGATGAAATCCAGTGACT TCCTGGAGAGTGCAGAACTGGACAGCGGAGGCTTTGGGAAGGTGTCTCT GTGTTTCCACAGAACCCAGGGACTCATGATCATGAAAACAGTGTACAAG GGGCCCAACTGCATTGAGCACAACGAGGCCCTCTTGGAGGAGGCGAAGA TGATGAACAGACTGAGACACAGCCGGGTGGTGAAGCTCCTGGGCGTCAT CATAGAGGAAGGGAAGTACTCCCTGGTGATGGAGTACATGGAGAAGGGC AACCTGATGCACGTGCTGAAAGCCGAGATGAGTACTCCGCTTTCTGTAA AAGGAAGGATAATTTTGGAAATCATTGAAGGAATGTGCTACTTACATGG AAAAGGCGTGATACACAAGGACCTGAAGCCTGAAAATATCCTTGTTGAT AATGACTTCCACATTAAGATCGCAGACCTCGGCCTTGCCTCCTTTAAGA TGTGGAGCAAACTGAATAATGAAGAGCACAATGAGCTGAGGGAAGTGGA CGGCACCGCTAAGAAGAATGGCGGCACCCTCTACTACATGGCGCCCGAG CACCTGAATGACGTCAACGCAAAGCCCACAGAGAAGTCGGATGTGTACA GCTTTGCTGTAGTACTCTGGGCGATATTTGCAAATAAGGAGCCATATGA AAATGCTATCTGTGAGCAGCAGTTGATAATGTGCATAAAATCTGGGAAC AGGCCAGATGTGGATGACATCACTGAGTACTGCCCAAGAGAAATTATCA GTCTCATGAAGCTCTGCTGGGAAGCGAATCCGGAAGCTCGGCCGACATT TCCTGGCATTGAAGAAAAATTTAGGCCTTTTTATTTAAGTCAATTAGAA GAAAGTGTAGAAGAGGACGTGAAGAGTTTAAAGAAAGAGTATTCAAACG AAAATGCAGTTGTGAAGAGAATGCAGTCTCTTCAACTTGATTGTGTGGC AGTACCTTCAAGCCGGTCAAATTCAGCCACAGAACAGCCTGGTTCACTG CACAGTTCCCAGGGACTTGGGATGGGTCCTGTGGAGGAGTCCTGGTTTG CTCCTTCCCTGGAGCACCCACAAGAAGAGAATGAGCCCAGCCTGCAGAG TAAACTCCAAGACGAAGCCAACTACCATCTTTATGGCAGCCGCATGGAC AGGCAGACGAAACAGCAGCCCAGACAGAATGTGGCTTACAACAGAGAGG AGGAAAGGAGACGCAGGGTCTCCCATGACCCTTTTGCACAGCAAAGACC TTACGAGAATTTTCAGAATACAGAGGGAAAAGGCACTGCTTATTCCAGT GCAGCCAGTCATGGTAATGCAGTGCACCAGCCCTCAGGGCTCACCAGCC AACCTCAAGTACTGTATCAGAACAATGGATTATATAGCTCACATGGCTT TGGAACAAGACCACTGGATCCAGGAACAGCAGGTCCCAGAGTTTGGTAC AGGCCAATTCCAAGTCATATGCCTAGTCTGCATAATATCCCAGTGCCTG AGACCAACTATCTAGGAAATACACCCACCATGCCATTCAGCTCCTTGCC ACCAACAGATGAATCTATAAAATATACCATATACAATAGTACTGGCATT CAGATTGGAGCCTACAATTATATGGAGATTGGTGGGACGAGTTCATCAC TACTAGACAGCACAAATACGAACTTCAAAGAAGAGCCAGCTGCTAAGTA CCAAGCTATCTTTGATAATACCACTAGTCTGACGGATAAACACCTGGAC CCAATCAGGGAAAATCTGGGAAAGCACTGGAAAAACTGTGCCCGTAAAC TGGGCTTCACACAGTCTCAGATTGATGAAATTGACCATGACTATGAGCG AGATGGACTGAAAGAAAAGGTTTACCAGATGCTCCAAAAGTGGGTGATG AGGGAAGGCATAAAGGGAGCCACGGTGGGGAAGCTGGCCCAGGCGCTCC ACCAGTGTTCCAGGATCGACCTTCTGAGCAGCTTGATTTACGTCAGCCA GAACTAA. Human TRAF6 CDS (SEQ ID NO: 36) ATGAGTCTGCTAAACTGTGAAAACAGCTGTGGATCCAGCCAGTCTGAAA GTGACTGCTGTGTGGCCATGGCCAGCTCCTGTAGCGCTGTAACAAAAGA TGATAGTGTGGGTGGAACTGCCAGCACGGGGAACCTCTCCAGCTCATTT ATGGAGGAGATCCAGGGATATGATGTAGAGTTTGACCCACCCCTGGAAA GCAAGTATGAATGCCCCATCTGCTTGATGGCATTACGAGAAGCAGTGCA AACGCCATGCGGCCATAGGTTCTGCAAAGCCTGCATCATAAAATCAATA AGGGATGCAGGTCACAAATGTCCAGTTGACAATGAAATACTGCTGGAAA ATCAACTATTTCCAGACAATTTTGCAAAACGTGAGATTCTTTCTCTGAT GGTGAAATGTCCAAATGAAGGTTGTTTGCACAAGATGGAACTGAGACAT CTTGAGGATCATCAAGCACATTGTGAGTTTGCTCTTATGGATTGTCCCC AATGCCAGCGTCCCTTCCAAAAATTCCATATTAATATTCACATTCTGAA GGATTGTCCAAGGAGACAGGTTTCTTGTGACAACTGTGCTGCATCAATG GCATTTGAAGATAAAGAGATCCATGACCAGAACTGTCCTTTGGCAAATG TCATCTGTGAATACTGCAATACTATACTCATCAGAGAACAGATGCCTAA TCATTATGATCTAGACTGCCCTACAGCCCCAATTCCATGCACATTCAGT ACTTTTGGTTGCCATGAAAAGATGCAGAGGAATCACTTGGCACGCCACC TACAAGAGAACACCCAGTCACACATGAGAATGTTGGCCCAGGCTGTTCA TAGTTTGAGCGTTATACCCGACTCTGGGTATATCTCAGAGGTCCGGAAT TTCCAGGAAACTATTCACCAGTTAGAGGGTCGCCTTGTAAGACAAGACC ATCAAATCCGGGAGCTGACTGCTAAAATGGAAACTCAGAGTATGTATGT AAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAAGTTGCTGAA ATCGAAGCACAGCAGTGCAATGGAATTTATATTTGGAAGATTGGCAACT TTGGAATGCATTTGAAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCA TAGCCCTGGATTCTACACTGGCAAACCCGGGTACAAACTGTGCATGCGC TTGCACCTTCAGTTACCGACTGCTCAGCGCTGTGCAAACTATATATCCC TTTTTGTCCACACAATGCAAGGAGAATATGACAGCCACCTCCCTTGGCC CTTCCAGGGTACAATACGCCTTACAATTCTTGATCAGTCTGAAGCACCT GTAAGGCAAAACCACGAAGAGATAATGGATGCCAAACCAGAGCTGCTTG CTTTCCAGCGACCCACAATCCCACGGAACCCAAAAGGTTTTGGCTATGT AACTTTTATGCATCTGGAAGCCCTAAGACAAAGAACTTTCATTAAGGAT GACACATTATTAGTGCGCTGTGAGGTCTCCACCCGCTTTGACATGGGTA GCCTTCGGAGGGAGGGTTTTCAGCCACGAAGTACTGATGCAGGGGTATA G. Human TTP CDS (SEQ ID NO: 37) ATGGCCAACCGTTACACCATGGATCTGACTGCCATCTACGAGAGCCTCC TGTCGCTGAGCCCTGACGTGCCCGTGCCATCCGACCATGGAGGGACTGA GTCCAGCCCAGGCTGGGGCTCCTCGGGACCCTGGAGCCTGAGCCCCTCC GACTCCAGCCCGTCTGGGGTCACCTCCCGCCTGCCTGGCCGCTCCACCA GCCTAGTGGAGGGCCGCAGCTGTGGCTGGGTGCCCCCACCCCCTGGCTT CGCACCGCTGGCTCCCCGCCTGGGCCCTGAGCTGTCACCCTCACCCACT TCGCCCACTGCAACCTCCACCACCCCCTCGCGCTACAAGACTGAGCTAT GTCGGACCTTCTCAGAGAGTGGGCGCTGCCGCTACGGGGCCAAGTGCCA GTTTGCCCATGGCCTGGGCGAGCTGCGCCAGGCCAATCGCCACCCCAAA TACAAGACGGAACTCTGTCACAAGTTCTACCTCCAGGGCCGCTGCCCCT ACGGCTCTCGCTGCCACTTCATCCACAACCCTAGCGAAGACCTGGCGGC CCCGGGCCACCCTCCTGTGCTTCGCCAGAGCATCAGCTTCTCCGGCCTG CCCTCTGGCCGCCGGACCTCACCACCACCACCAGGCCTGGCCGGCCCTT CCCTGTCCTCCAGCTCCTTCTCGCCCTCCAGCTCCCCACCACCACCTGG GGACCTTCCACTGTCACCCTCTGCCTTCTCTGCTGCCCCTGGCACCCCC CTGGCTCGAAGAGACCCCACCCCAGTCTGTTGCCCCTCCTGCCGAAGGG CCACTCCTATCAGCGTCTGGGGGCCCTTGGGTGGCCTGGTTCGGACCCC CTCTGTACAGTCCCTGGGATCCGACCCTGATGAATATGCCAGCAGCGGC AGCAGCCTGGGGGGCTCTGACTCTCCCGTCTTCGAGGCGGGAGTTTTTG CACCACCCCAGCCCGTGGCAGCCCCCCGGCGACTCCCCATCTTCAATCG CATCTCTGTTTCTGAGTGA.

(1525) An antisense nucleic acid molecule can be complementary to all or part of a non-coding region of the coding strand of a nucleotide sequence encoding an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTPMEKK1protein. Non-coding regions (5′ and 3′ untranslated regions) are the 5′ and 3′ sequences that flank the coding region in a gene and are not translated into amino acids.

(1526) Based upon the sequences disclosed herein, one of skill in the art can easily choose and synthesize any of a number of appropriate antisense nucleic acids to target a nucleic acid encoding an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP protein described herein. Antisense nucleic acids targeting a nucleic acid encoding an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTPMEKK1protein can be designed using the software available at the Integrated DNA Technologies website.

(1527) An antisense nucleic acid can be, for example, about 5, 10, 15, 18, 20, 22, 24, 25, 26, 28, 30, 32, 35, 36, 38, 40, 42, 44, 45, 46, 48, or 50 nucleotides or more in length. An antisense oligonucleotide can be constructed using enzymatic ligation reactions and chemical synthesis using procedures known in the art. For example, an antisense nucleic acid can be chemically synthesized using variously modified nucleotides or naturally occurring nucleotides designed to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides or to increase the biological stability of the molecules.

(1528) Examples of modified nucleotides which can be used to generate an antisense nucleic acid include 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).

(1529) The antisense nucleic acid molecules described herein can be prepared in vitro and administered to a subject, e.g., a human subject. Alternatively, they can be generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP protein to thereby inhibit expression, e.g., by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarities to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix. The antisense nucleic acid molecules can be delivered to a mammalian cell using a vector (e.g., an adenovirus vector, a lentivirus, or a retrovirus).

(1530) An antisense nucleic acid can be an α-anomeric nucleic acid molecule. An α-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual, (3-units, the strands run parallel to each other (Gaultier et al., Nucleic Acids Res. 15:6625-6641, 1987). The antisense nucleic acid can also comprise a chimeric RNA-DNA analog (Inoue et al., FEBS Lett. 215:327-330, 1987) or a 2′-O-methylribonucleotide (Inoue et al., Nucleic Acids Res. 15:6131-6148, 1987).

(1531) Another example of an inhibitory nucleic acid is a ribozyme that has specificity for a nucleic acid encoding an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA, e.g., specificity for any one of SEQ ID NOs: 1-37). Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described in Haselhoff and Gerlach, Nature 334:585-591, 1988)) can be used to catalytically cleave mRNA transcripts to thereby inhibit translation of the protein encoded by the mRNA. An AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel et al., Science 261:1411-1418, 1993.

(1532) Alternatively, a ribozyme having specificity for an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA can be designed based upon the nucleotide sequence of any of the AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA sequences disclosed herein. For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP mRNA (see, e.g., U.S. Pat. Nos. 4,987,071 and 5,116,742).

(1533) An inhibitory nucleic acid can also be a nucleic acid molecule that forms triple helical structures. For example, expression of an AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP polypeptide can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the gene encoding the AP-1, ASK1, CD14, c-jun, ERK1/2, IκB, IKK, IRAK, JNK, LBP, MAPK, MEK1/2, MEKK1/4, MEKK4/7, MEKK 3/6, MK2, MyD88, NF-κB, NIK, p38, PKR, rac, ras, raf, RIP, TNFα, TNFR1, TNFR2, TRADD, TRAF2, TRAF6, or TTP polypeptide (e.g., the promoter and/or enhancer, e.g., a sequence that is at least 1 kb, 2 kb, 3 kb, 4 kb, or 5 kb upstream of the transcription initiation start state) to form triple helical structures that prevent transcription of the gene in target cells. See generally Maher, Bioassays 14(12):807-15, 1992; Helene, Anticancer Drug Des. 6(6):569-84, 1991; and Helene, Ann. N.Y. Acad. Sci. 660:27-36, 1992.

(1534) In various embodiments, inhibitory nucleic acids can be modified at the sugar moiety, the base moiety, or phosphate backbone to improve, e.g., the solubility, stability, or hybridization, of the molecule. For example, the deoxyribose phosphate backbone of the nucleic acids can be modified to generate peptide nucleic acids (see, e.g., Hyrup et al., Bioorganic Medicinal Chem. 4(1):5-23, 1996). Peptide nucleic acids (PNAs) are nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs allows for specific hybridization to RNA and DNA under conditions of low ionic strength. PNA oligomers can be synthesized using standard solid phase peptide synthesis protocols (see, e.g., Perry-O'Keefe et al., Proc. Natl. Acad. Sci. U.S.A. 93:14670-675, 1996). PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication.

(1535) Small Molecules

(1536) In some embodiments, the anti-TNFα agent is a small molecule. In some embodiments, the small molecule is a tumor necrosis factor-converting enzyme (TACE) inhibitor (e.g., Moss et al., Nature Clinical Practice Rheumatology 4: 300-309, 2008). In some embodiments, the anti-TNFα agent is C87 (Ma et al., J. Biol. Chem. 289(18):12457-66, 2014). In some embodiments, the small molecule is LMP-420 (e.g., Haraguchi et al., AIDS Res. Ther. 3:8, 2006). In some embodiments, the TACE inhibitor is TMI-005 and BMS-561392. Additional examples of small molecule inhibitors are described in, e.g., He et al., Science 310(5750):1022-1025, 2005.

(1537) In some examples, the anti-TNFα agent is a small molecule that inhibits the activity of one of AP-1, ASK1, IKK, JNK, MAPK, MEKK 1/4, MEKK4/7, MEKK 3/6, NIK, TRADD, RIP, NF-κB, and TRADD in a cell (e.g., in a cell obtained from a subject, a mammalian cell).

(1538) In some examples, the anti-TNFα agent is a small molecule that inhibits the activity of one of CD14, MyD88 (see, e.g., Olson et al., Scientific Reports 5:14246, 2015), ras (e.g., Baker et al., Nature 497:577-578, 2013), raf (e.g., vemurafenib (PLX4032, RG7204), sorafenib tosylate, PLX-4720, dabrafenib (GSK2118436), GDC-0879, RAF265 (CHIR-265), AZ 628, NVP-BHG712, 5B590885, ZM 336372, sorafenib, GW5074, TAK-632, CEP-32496, encorafenib (LGX818), CCT196969, LY3009120, R05126766 (CH5126766), PLX7904, and MLN2480).

(1539) In some examples, the anti-TNFα agent TNFα inhibitor is a small molecule that inhibits the activity of one of MK2 (PF 3644022 and PHA 767491), JNK (e.g., AEG 3482, BI 78D3, CEP 1347, c-JUN peptide, IQ 15, JIP-1 (153-163), SP600125, SU 3327, and TCS JNK6o), c-jun (e.g., AEG 3482, BI 78D3, CEP 1347, c-JUN peptide, IQ 15, JIP-1 (153-163), SP600125, SU 3327, and TCS JNK6o), MEK3/6 (e.g., Akinleye et al., J. Hematol. Oncol. 6:27, 2013), p38 (e.g., AL 8697, AMG 548, BIRB 796, CMPD-1, DBM 1285 dihydrochloride, EO 1428, JX 401, ML 3403, Org 48762-0, PH 797804, RWJ 67657, SB 202190, SB 203580, SB 239063, SB 706504, SCIO 469, SKF 86002, SX 011, TA 01, TA 02, TAK 715, VX 702, and VX 745), PKR (e.g., 2-aminopurine or CAS 608512-97-6), TTP (e.g., CAS 329907-28-0), MEK1/2 (e.g., Facciorusso et al., Expert Review Gastroentrol. Hepatol. 9:993-1003, 2015), ERK1/2 (e.g., Mandal et al., Oncogene 35:2547-2561, 2016), NIK (e.g., Mortier et al., Bioorg. Med. Chem. Lett. 20:4515-4520, 2010), IKK (e.g., Reilly et al., Nature Med. 19:313-321, 2013), IκB (e.g., Suzuki et al., Expert. Opin. Invest. Drugs 20:395-405, 2011), NF-κB (e.g., Gupta et al., Biochim. Biophys. Acta 1799(10-12):775-787, 2010), rac (e.g., U.S. Pat. No. 9,278,956), MEK4/7, IRAK (Chaudhary et al., J. Med. Chem. 58(1):96-110, 2015), LBP (see, e.g., U.S. Pat. No. 5,705,398), and TRAF6 (e.g., 3-[(2,5-Dimethylphenyl)amino]-1-phenyl-2-propen-1-one).

(1540) In some embodiments of any of the methods described herein, the inhibitory nucleic acid can be about 10 nucleotides to about 50 nucleotides (e.g., about 10 nucleotides to about 45 nucleotides, about 10 nucleotides to about 40 nucleotides, about 10 nucleotides to about 35 nucleotides, about 10 nucleotides to about 30 nucleotides, about 10 nucleotides to about 28 nucleotides, about 10 nucleotides to about 26 nucleotides, about 10 nucleotides to about 25 nucleotides, about 10 nucleotides to about 24 nucleotides, about 10 nucleotides to about 22 nucleotides, about 10 nucleotides to about 20 nucleotides, about 10 nucleotides to about 18 nucleotides, about 10 nucleotides to about 16 nucleotides, about 10 nucleotides to about 14 nucleotides, about 10 nucleotides to about 12 nucleotides, about 12 nucleotides to about 50 nucleotides, about 12 nucleotides to about 45 nucleotides, about 12 nucleotides to about 40 nucleotides, about 12 nucleotides to about 35 nucleotides, about 12 nucleotides to about 30 nucleotides, about 12 nucleotides to about 28 nucleotides, about 12 nucleotides to about 26 nucleotides, about 12 nucleotides to about 25 nucleotides, about 12 nucleotides to about 24 nucleotides, about 12 nucleotides to about 22 nucleotides, about 12 nucleotides to about 20 nucleotides, about 12 nucleotides to about 18 nucleotides, about 12 nucleotides to about 16 nucleotides, about 12 nucleotides to about 14 nucleotides, about 15 nucleotides to about 50 nucleotides, about 15 nucleotides to about 45 nucleotides, about 15 nucleotides to about 40 nucleotides, about 15 nucleotides to about 35 nucleotides, about 15 nucleotides to about 30 nucleotides, about 15 nucleotides to about 28 nucleotides, about 15 nucleotides to about 26 nucleotides, about 15 nucleotides to about 25 nucleotides, about 15 nucleotides to about 24 nucleotides, about 15 nucleotides to about 22 nucleotides, about 15 nucleotides to about 20 nucleotides, about 15 nucleotides to about 18 nucleotides, about 15 nucleotides to about 16 nucleotides, about 16 nucleotides to about 50 nucleotides, about 16 nucleotides to about 45 nucleotides, about 16 nucleotides to about 40 nucleotides, about 16 nucleotides to about 35 nucleotides, about 16 nucleotides to about 30 nucleotides, about 16 nucleotides to about 28 nucleotides, about 16 nucleotides to about 26 nucleotides, about 16 nucleotides to about 25 nucleotides, about 16 nucleotides to about 24 nucleotides, about 16 nucleotides to about 22 nucleotides, about 16 nucleotides to about 20 nucleotides, about 16 nucleotides to about 18 nucleotides, about 18 nucleotides to about 20 nucleotides, about 20 nucleotides to about 50 nucleotides, about 20 nucleotides to about 45 nucleotides, about 20 nucleotides to about 40 nucleotides, about 20 nucleotides to about 35 nucleotides, about 20 nucleotides to about 30 nucleotides, about 20 nucleotides to about 28 nucleotides, about 20 nucleotides to about 26 nucleotides, about 20 nucleotides to about 25 nucleotides, about 20 nucleotides to about 24 nucleotides, about 20 nucleotides to about 22 nucleotides, about 24 nucleotides to about 50 nucleotides, about 24 nucleotides to about 45 nucleotides, about 24 nucleotides to about 40 nucleotides, about 24 nucleotides to about 35 nucleotides, about 24 nucleotides to about 30 nucleotides, about 24 nucleotides to about 28 nucleotides, about 24 nucleotides to about 26 nucleotides, about 24 nucleotides to about 25 nucleotides, about 26 nucleotides to about 50 nucleotides, about 26 nucleotides to about 45 nucleotides, about 26 nucleotides to about 40 nucleotides, about 26 nucleotides to about 35 nucleotides, about 26 nucleotides to about 30 nucleotides, about 26 nucleotides to about 28 nucleotides, about 28 nucleotides to about 50 nucleotides, about 28 nucleotides to about 45 nucleotides, about 28 nucleotides to about 40 nucleotides, about 28 nucleotides to about 35 nucleotides, about 28 nucleotides to about 30 nucleotides, about 30 nucleotides to about 50 nucleotides, about 30 nucleotides to about 45 nucleotides, about 30 nucleotides to about 40 nucleotides, about 30 nucleotides to about 38 nucleotides, about 30 nucleotides to about 36 nucleotides, about 30 nucleotides to about 34 nucleotides, about 30 nucleotides to about 32 nucleotides, about 32 nucleotides to about 50 nucleotides, about 32 nucleotides to about 45 nucleotides, about 32 nucleotides to about 40 nucleotides, about 32 nucleotides to about 35 nucleotides, about 35 nucleotides to about 50 nucleotides, about 35 nucleotides to about 45 nucleotides, about 35 nucleotides to about 40 nucleotides, about 40 nucleotides to about 50 nucleotides, about 40 nucleotides to about 45 nucleotides, about 42 nucleotides to about 50 nucleotides, about 42 nucleotides to about 45 nucleotides, or about 45 nucleotides to about 50 nucleotides) in length. One skilled in the art will appreciate that inhibitory nucleic acids may comprises at least one modified nucleic acid at either the 5′ or 3′ end of DNA or RNA.

(1541) In some embodiments, the inhibitory nucleic acid can be formulated in a liposome, a micelle (e.g., a mixed micelle), a nanoemulsion, or a microemulsion, a solid nanoparticle, or a nanoparticle (e.g., a nanoparticle including one or more synthetic polymers). Additional exemplary structural features of inhibitory nucleic acids and formulations of inhibitory nucleic acids are described in US 2016/0090598.

(1542) In some embodiments, the inhibitory nucleic acid (e.g., any of the inhibitory nucleic acid described herein) can include a sterile saline solution (e.g., phosphate-buffered saline (PBS)). In some embodiments, the inhibitory nucleic acid (e.g., any of the inhibitory nucleic acid described herein) can include a tissue-specific delivery molecule (e.g., a tissue-specific antibody).

(1543) Compound Preparation and Biological Assays

(1544) As can be appreciated by the skilled artisan, methods of synthesizing the compounds of the formulae herein will be evident to those of ordinary skill in the art. Synthetic chemistry transformations and protecting group methodologies (protection and deprotection) useful in synthesizing the compounds described herein are known in the art and include, for example, those such as described in R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); T. W. Greene and RGM. Wuts, Protective Groups in Organic Synthesis, 2d. Ed., John Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and subsequent editions thereof.

PREPARATIVE EXAMPLES

(1545) The following abbreviations have the indicated meanings: ACN=acetonitrile AcOH=acetic acid AIBN=Azodiisobutyronitrile 9-BBN=9-borabicyclo[3.3.1]nonane Boc.sub.2O=Di-tert-butyl dicarbonate (Bpin).sub.2=4,4,4′,4′,5,5,5′,5′-octamethyl-2,2′-bi(1,3,2-dioxaborolane) CAN=Diammonium cerium(IV) nitrate CCl.sub.4=Perchloromethane CHCl.sub.3=Chloroform ClSO.sub.2OH=Chlorosulfonic acid Conc.=Concentrated Cs.sub.2CO.sub.3=Cesium carbonate DAST=diethylaminosulfur trifluoride DBU=1,8-diazabicycloundec-7-ene DCM=dichloromethane DEA=diethylamine DMF=N,N-dimethylformamide DMSO=dimethyl sulfoxide DIEA=N,N-diisopropylethylamine EtOH=ethanol FA=formic acid HCHO=Formaldehyde Hex=hexane HPLC=high performance liquid chromatography IPA=propan-2-ol LC-MS=liquid chromatography-mass spectrometry LDA=Lithium diisopropylamide Me=methyl MeOH=methanol NaBH.sub.3CN=Sodium cyanoborohydride NaSH=Sodium hydrosulfide NBS=N-bromosuccinimide n-BuLi=n-Butyllithium NMR=nuclear magnetic resonance PCl.sub.5=Phosphorus pentachloride Pd.sub.2(dba).sub.3=tris(dibenzylideneacetone)dipalladium Pd(dppf)Cl.sub.2=dichloro[1,1′-bis(diphenylphosphino)ferrocene]palladium Pd(PPh.sub.3).sub.2Cl.sub.2=Bis(triphenylphosphine)palladium(II) chloride Ph=phenyl PMB=p-methoxybenzyl PPh.sub.3Cl.sub.2=dichlorotriphenylphosphorane Rt=Retention time RT=room temperature SFC=supercritical fluid chromatogram Sat.=saturated TBAF=tetra-n-butylammonium fluoride TBS=tert-butyldimethylsilyl TBDPSCl=tert-butyldiphenylsilyl chloride TBSCl=tert-butyldimethylsilyl chloride t-BuOK=Potassium t-butoxide t-BuONO=tert-Butyl nitrite TEA=triethylamine TFA=trifluoroacetic acid THF=tetrahydrofuran TLC=thin layer chromatography UV=ultraviolet X-phos=2-(Dicyclohexylphosphino)-2′,4′,6′-triisopropylbiphenyl

General

(1546) The progress of reactions was often monitored by TLC or LC-MS. The identity of the products was often confirmed by LC-MS. The LC-MS was recorded using one of the following methods.

(1547) Method A: Shim-pack XR-ODS, C18, 3×50 mm, 2.5 um column, 1.0 uL injection, 1.5 mL/min flow rate, 90-900 amu scan range, 190-400 nm UV range, 5-100% (1.1 min), 100% (0.6 min) gradient with ACN (0.05% TFA) and water (0.05% TFA), 2 minute total run time.

(1548) Method B: Kinetex EVO, C18, 3×50 mm, 2.2 um column, 1.0 uL injection, 1.5 mL/min flow rate, 90-900 amu scan range, 190-400 nm UV range, 10-95% (1.1 min), 95% (0.6 min) gradient with ACN and water (0.5% NH.sub.4HCO.sub.3), 2 minute total run time.

(1549) Method C: Shim-pack XR-ODS, C18, 3×50 mm, 2.5 um column, 1.0 uL injection, 1.5 mL/min flow rate, 90-900 amu scan range, 190-400 nm UV range, 5-100% (2.1 min), 100% (0.6 min) gradient with ACN (0.05% TFA) and water (0.05% TFA), 3 minute total run time.

(1550) Method D: Kinetex EVO, C18, 3×50 mm, 2.2 um column, 1.0 uL injection, 1.5 mL/min flow rate, 90-900 amu scan range, 190-400 nm UV range, 10-95% (2.1 min), 95% (0.6 min) gradient with ACN and water (0.5% NH.sub.4HCO.sub.3), 3 minute total run time.

(1551) The final targets were purified by Prep-HPLC. The Prep-HPLC was carried out using the following method.

(1552) Method E: Pre-HPLC: Column, XBridge Shield RP18 OBD (19×250 mm, 10 um); mobile phase, Water (10 mmol/L NH.sub.4HCO.sub.3) and ACN, UV detection 254/210 nm.

(1553) NMR was recorded on BRUKER NMR 300.03 MHz, DUL-C-H, ULTRASHIELD™300, AVANCE II 300 B-ACS™120 or BRUKER NMR 400.13 MHz, BBFO, ULTRASHIELD™400, AVANCE III 400, B-ACS™120.

(1554) Racemic compounds of this invention can be resolved to give individual enantiomers using a variety of known methods. For example, chiral stationary phases can be used and the elution conditions can include normal phase or super-critical fluid with or without acidic or basic additives. Enantiomerically pure acids or bases can be used to form diatereomeric salts with the racemic compounds whereby pure enantiomers can be obtained by fractional crystallization. The racemates can also be derivatized with enantiomerically pure auxiliary reagents to form diastereomeric mixtures that can be separated. The auxiliary is then removed to give pure enantiomers.

(1555) Scheme of final targets: Schemes 1-6 illustrate several conditions used for coupling of acid 1 and sulfonimidoylamide 2 to afford acyl sulfonimidoylamide 3. As used in the schemes, rings “A” and “B” may be substituted as disclosed herein.

(1556) ##STR00555##

(1557) ##STR00556##

(1558) ##STR00557##

(1559) ##STR00558##

(1560) ##STR00559##

(1561) ##STR00560##

(1562) ##STR00561##

(1563) ##STR00562##

(1564) ##STR00563##

(1565) Schemes of Sulfonimidoylamide Intermediates: Schemes 7-12 illustrate the preparation of sulfonimidoylamide intermediates.

(1566) ##STR00564##

(1567) ##STR00565##

N′-(tert-butyl dimethylsilyl)-5-(2-hydroxypropan-2-yl)thiazole-2-sulfonimidamide

Step 1: Methyl 2-mercaptothiazole-5-carboxylate

(1568) Into a 2000-mL round-bottom flask was placed methyl 2-bromothiazole-5-carboxylate (100 g, 450 mmol), EtOH (1000 mL), and sodium hydrogensulfide (50 g, 890 mmol). The resulting solution was stirred for 2 h at 80° C. and then was cooled to 0° C. with a water/ice bath. The pH value of the solution was adjusted to 3 with hydrogen chloride (1 N). The solids were collected by filtration. This resulted in 63.2 g (80%) of the title compound as a light yellow solid. MS-ESI: 176.0 (M+1).

Step 2: Methyl 2-(chlorosulfonyl)thiazole-5-carboxylate

(1569) Into a 1000-mL round-bottom flask was placed methyl 2-mercaptothiazole-5-carboxylate (30 g, 170 mmol) and acetic acid (300 mL). This was followed by the addition of sodium hypochlorite (300 mL, 8%-10% wt.) in portions at 0° C. The resulting solution was stirred for 2 h at RT and then was diluted with 500 mL of water. The solution was extracted with 3×300 mL of DCM; and the combined organic layers were washed with 2×300 mL of brine, and dried over anhydrous Na.sub.2SO.sub.4. The crude product as a yellow solution in DCM was used in the next step.

Step 3: Methyl 2-sulfamoylthiazole-5-carboxylate

(1570) Into a 2000-mL round-bottom flask was placed methyl 2-(chlorosulfonyl)thiazole-5-carboxylate as a crude solution in DCM (900 mL). To the solution was introduced NH.sub.3 (g) below 0° C. for 20 minutes. The resulting solution was stirred for 1 h at RT and was then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 23 g (75%, 2 steps) of the title compound as a white solid. MS-ESI: 223.0 (M+1).

Step 4: 5-(2-Hydroxypropan-2-yl)thiazole-2-sulfonamide

(1571) Into a 500-mL round-bottom flask purged with and maintained under nitrogen was placed a solution of methyl 2-sulfamoylthiazole-5-carboxylate (15 g, 67.5 mmol) in THF (150 mL). This was followed by the addition of MeMgBr/THF (3 M, 90 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 14 h at RT and then was quenched by the addition of 100 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×150 mL of DCM; the organic layers were combined, dried over anhydrous Na.sub.2SO.sub.4, and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 11.5 g (78%) of the title compound as a white solid. MS-ESI: 223.0 (M+1), 221.0 (M−1) in positive and negative ion mode, respectively.

Step 5: N-(tert-butyldimethylsilyl)-5-(2-hydroxypropan-2-yl)thiazole-2-sulfonamide

(1572) Into a 250-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of 5-(2-hydroxypropan-2-yl)thiazole-2-sulfonamide (5 g, 22.5 mmol) in THF (100 mL). Then to the above was added NaH (60% wt, 1.8 g, 45.0 mmol) in portions in an ice/water bath. After stirring for 20 minutes in an ice/water bath, this was followed by the addition of a solution of TBSCl (4.1 g, 27.2 mmol) in THF (10 mL) dropwise with stirring over 2 min at 0° C. The resulting solution was stirred for 4 h at RT. The reaction was quenched with sat. NH.sub.4Cl (100 mL) and extracted with 3×100 mL of ethyl acetate. The combined organic layers were dried over Na.sub.2SO.sub.4 and concentrated under vacuum. The crude solid was washed with ethyl acetate/hexane (1:5) (2×100 mL). This resulted in 6.81 g (90%) of the title compound as a yellow solid. MS-ESI: 337.1 (M+1), 335.1 (M−1) in positive and negative ion mode, respectively.

Step 6: N′-(tert-butyldimethylsilyl)-5-(2-hydroxypropan-2-yl)thiazole-2-sulfonimidamide

(1573) Into a 100-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of PPh.sub.3Cl.sub.2 (3 g, 9.0 mmol) in CHCl.sub.3 (100 mL). This was followed by the addition of DIEA (1.54 g, 11.9 mmol) dropwise with stirring at RT. The resulting solution was stirred for 10 min at RT. This was followed by the addition of a solution of N-(tert-butyldimethylsilyl)-5-(2-hydroxypropan-2-yl)thiazole-2-sulfonamide (2.0 g, 5.9 mmol) in CHCl.sub.3 (30 mL) dropwise with stirring in an ice/water bath. The resulting solution was stirred for 30 min in an ice/water bath. To the above was introduced NH.sub.3 (g) below 0° C. for 15 minutes. The resulting solution was stirred for 20 minutes at RT. The solids were filtered out and the filtrate was concentrated and the residue was dissolved in 300 mL of ethyl acetate. The solution was washed with brine (2×100 mL), dried over Na.sub.2SO.sub.4, and concentrated under vacuum. The crude solid was washed with CHCl.sub.3 (100 mL). Then the filtrate was concentrated under vacuum, and the residue was further purified by a silica gel column with ethyl acetate/petroleum ether (1:10 to 1:3). The original washed solid and solid from silica gel purification were combined. This resulted in 1.2 g (60%) of the title compound as a white solid. MS-ESI: 336.1 (M+1). .sup.1H-NMR (300 MHz, DMSO-d.sub.6) δ7.66 (s, 1H), 7.12 (s, 2H), 5.78 (s, 1H), 1.51 (s, 6H), 0.86 (s, 9H), 0.02 (s, 3H), 0.01 (s, 3H).

(1574) ##STR00566##

5-(2-Hydroxypropan-2-yl)thiazole-2-sulfonimidamide

Step 7: 5-(2-Hydroxypropan-2-yl)thiazole-2-sulfonimidamide

(1575) Into a 50-mL round-bottom flask was placed a solution of N′-(tert-butyldimethylsilyl)-5-(2-hydroxypropan-2-yl)thiazole-2-sulfonimidamide (200 mg, 0.60 mmol), DCM (3 mL), and TFA (0.3 mL). The resulting solution was stirred for 30 min at RT and then was concentrated under vacuum. The crude product was purified by Prep-HPLC using Method E with the following conditions: Column, C.sub.18 silica gel, mobile phase, Water (10 mmol/L NH.sub.4HCO.sub.3) and ACN (10% to 50% in 20 min), Detector, UV detection 254/210 nm. This resulted in 100 mg (76%) of the title compound as a light yellow solid. MS-ESI: 222.0 (M+1).

(1576) TABLE-US-00008 TABLE 2 The Intermediates in the following Table were prepared using similar procedures for converting compound 6 to Intermediate 2 shown in Scheme 7 by substituting ammonia with appropriated amine in Step 6. Exact Mass Intermediate # Structure IUPAC Name [M + H].sup.+ Intermediate 3 embedded image 5-(2-hydroxypropan-2-yl)-N′-(4- methoxybenzyl)thiazole-2- sulfonimidamide 342.1 Intermediate 4 embedded image 5-(2-hydroxypropan-2-yl)-N′- methylthiazole-2-sulfonimidamide 236.0

(1577) ##STR00569##

(1578) ##STR00570##

N′-(tert-butyldimethylsilyl)-2-fluoro-4-(2-hydroxypropan-2-yl)benzenesulfonimidamide

Step 1: Methyl 4-(chlorosulfonyl)-3-fluorobenzoate

(1579) Into a 100-mL round-bottom flask was placed a solution of methyl 4-amino-3-fluorobenzoate (1.0 g, 5.91 mmol) in aq. HCl (6 N, 20 mL). This was followed by the addition of a solution of NaNO.sub.2 (612.4 mg, 8.88 mmol) in water (2 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 30 min at 0° C. The above mixture was added to a saturated solution of SO.sub.2 in AcOH (20 mL) dropwise with stirring at 0° C. Then to the above was added CuCl.sub.2 (0.799 g, 5.96 mmol). The resulting solution was stirred for 1 h at RT and then was quenched by the addition of 20 mL of water. The resulting solution was extracted with 3×20 mL of DCM. The organic layers were combined, dried over anhydrous Na.sub.2SO.sub.4, and then concentrated under vacuum. This resulted in 1 g (crude, 67%) of the title compound as yellow oil. The crude product was used in the next step.

(1580) Steps 2-5 used similar procedures for converting compound 3 to Intermediate 1 shown in Scheme 7 to afford Intermediate 5. MS-ESI: 347.2 (M+1).

(1581) TABLE-US-00009 TABLE 3 The Intermediates in the following Table were prepared using similar procedures for converting compound 7 to Intermediate 5 shown in Scheme 8 from appropriate starting materials. Exact Mass Intermediate # Structure IUPAC Name [M + H].sup.+ Intermediate 6 embedded image N′-(tert-butyldimethylsilyl)-2- chloro-4-(2-hydroxypropan-2- yl)benzenesulfonimidamide 363.1 Intermediate 7 embedded image N′-(tert-butyldimethylsilyl)-4-(2- hydroxypropan-2- yl)benzenesulfonimidamide 329.1

(1582) ##STR00573##

(1583) ##STR00574##

N′-(tert-butyl dimethyl silyl)-3-fluoro-5-(2-hydroxypropan-2-yl)thiophene-2-sulfonimidamide

Step 1: Methyl 5-(chlorosulfonyl)-4-fluorothiophene-2-carboxylate

(1584) Into a 50-mL round-bottom flask was placed a solution of methyl 4-fluorothiophene-2-carboxylate (1.0 g, 6.24 mmol) in CHCl.sub.3 (10 mL). Then to the above was added ClSO.sub.3H (2.18 g, 18.7 mmol). The resulting solution was stirred for 12 h at RT. Then to the above was added PCl.sub.5 (6.5 g, 31.2 mmol). The resulting solution was stirred for 2 h at 50° C. and then was quenched by the addition of 30 mL of water. The resulting solution was extracted with 3×30 mL of ethyl acetate; the organic layers were combined, dried over anhydrous Na.sub.2O.sub.4, and then concentrated under vacuum. This resulted in 1.2 g (crude, 74%) of the title compound as dark red oil. The crude product was used in the next step.

Step 2: Methyl 4-fluoro-5-sulfamoylthiophene-2-carboxylate

(1585) Into a 50-mL round-bottom flask was placed a solution of methyl 5-(chlorosulfonyl)-4-fluorothiophene-2-carboxylate (600 mg, 2.32 mmol) in acetone (6 mL). Then to the above was added aq. NH.sub.4OH (25% wt., 2 mL). The mixture was stirred for 1 h at RT and then diluted with 10 mL of water. The resulting solution was extracted with 3×10 mL of ethyl acetate; the organic layers were combined, dried over anhydrous Na.sub.2O.sub.4, and then concentrated under vacuum. This resulted in 500 mg (crude, 90%) of the title compound as yellow oil. MS-ESI: 238.0 (M−1). Step 3-5 used similar procedures for converting compound 4 to Intermediate 1 shown in Scheme 7 to afford Intermediate 8. MS-ESI: 353.1 (M+1).

(1586) ##STR00575##

(1587) ##STR00576##

N′-(tert-butyldimethylsilyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

Step 1: 1-(Thiazol-2-yl)ethanol

(1588) Into a 500-mL round-bottom flask was placed 1-(thiazol-2-yl)ethanone (20 g, 157 mmol) in EtOH (200 mL). This was followed by the addition of NaBH.sub.4 (3 g, 81.3 mmol) in portions at 0° C. The resulting solution was stirred for 2 h at RT and was then quenched by the addition of 10 mL of NH.sub.4Cl (sat.). The resulting solution was diluted with 200 mL of water and extracted with 2×200 mL of DCM. The organic layers were combined, dried over anhydrous Na.sub.2O.sub.4, and then concentrated under vacuum. This resulted in 20 g (98%) of the title compound as light yellow oil. MS-ESI: 130.0 (M+1).

Step 2: 2-(1-(Tert-butyldiphenylsilyloxy)ethyl)thiazole

(1589) Into a 500-mL round-bottom flask was placed 1-(thiazol-2-yl)ethanol (20 g, 154.8 mmol), DMF (150 mL), and imidazole (20.5 g, 301 mmol). This was followed by the addition of TBDPSCl (46 g, 167 mmol) dropwise with stirring at 0° C. The mixture was stirred for 2 h at RT and then was diluted with 300 mL of water. The resulting solution was extracted with 3×200 mL of DCM. The organic layers were combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:100 to 1:80). This resulted in 55 g (97%) of the title compound as a colorless oil. MS-ESI: 368.1 (M+1).

Step 3: 2-(1-(Tert-butyldiphenylsilyloxy)ethyl)thiazole-5-sulfonyl chloride

(1590) Into a 500-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed 2-(1-(tert-butyldiphenylsilyloxy)ethyl)thiazole (30 g, 81.6 mmol) and THF (200 mL). This was followed by the addition of n-BuLi/THF (2.5 M, 35.2 mL) dropwise with stirring at −78° C. The resulting solution was stirred for 0.5 h at −78° C., and then SO.sub.2 was introduced into the above reaction mixture. The reaction was slowly warmed to RT, and then NCS (12.8 g, 95.86 mmol) was added. The resulting solution was stirred for 1 h at RT. The solids were filtered out. The resulting filtrate was concentrated under vacuum. This resulted in 30 g (crude, 79%) of the title compound as brown oil. The crude product was used in the next step directly.

Step 4: N-tert-butyl-2-(1-(tert-butyldiphenylsilyloxy)ethyl)thiazole-5-sulfonamide

(1591) Into a 500-mL round-bottom flask was placed 2-(1-(tert-butyldiphenylsilyloxy)ethyl)thiazole-5-sulfonyl chloride (crude, 30 g, 64.4 mmol), DCM (200 mL), and TEA (13 g, 128 mmol). This was followed by the addition of 2-methylpropan-2-amine (5.6 g, 76.6 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 2 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:30 to 1:20). This resulted in 25 g (77%) of the title compound as brown oil. MS-ESI: 503.2 (M+1).

Step 5: N-tert-butyl-2-(1-hydroxyethyl)thiazole-5-sulfonamide

(1592) Into a 500-mL round-bottom flask was placed N-tert-butyl-2-(1-(tert-butyldiphenylsilyloxy)ethyl)thiazole-5-sulfonamide (25 g, 49.7 mmol), THF (200 mL), and TBAF (30 g, 99.67 mmol). The resulting solution was stirred for 2 h at RT and then was diluted with 200 mL of water. The resulting solution was extracted with 3×200 mL of DCM. The organic layers were combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:20 to 1:10). This resulted in 12 g (91%) of the title compound as light yellow oil. MS-ESI: 265.1 (M+1).

Step 6: 2-Acetyl-N-tert-butylthiazole-5-sulfonamide

(1593) Into a 500-mL round-bottom flask was placed a solution of N-tert-butyl-2-(1-hydroxyethyl)thiazole-5-sulfonamide (12 g, 45.4 mmol) in DCM (200 mL). To this solution was added Dess-Martin reagent (20 g, 47.2 mmol) in portions at RT. The resulting solution was stirred for 2 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:20 to 1:10). This resulted in 9 g (76%) of the title compound as a light yellow solid. MS-ESI: 263.0 (M+1).

Step 7: 2-Acetylthiazole-5-sulfonamide

(1594) Into a 100-mL round-bottom flask was placed a solution of 2-acetyl-N-tert-butylthiazole-5-sulfonamide (7 g, 26.7 mmol) in DCM (20 mL). To the solution was added TFA (20 mL) at RT. The resulting solution was stirred for 14 h at 70° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 5 g (91%) of the title compound as a yellow solid. MS-ESI: 207.0 (M+1).

Step 8: 2-(2-Hydroxypropan-2-yl)thiazole-5-sulfonamide

(1595) Into a 500-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed 2-acetylthiazole-5-sulfonamide (5 g, 4.85 mmol) in THF (100 mL). This was followed by the addition of MeMgBr (3 M in THF, 8.1 mL, 24.3 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 14 h at RT and then was quenched by the addition of 100 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 2×150 mL of DCM. The organic layers were combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 2.9 g (54%) of the title compound as a light yellow solid. MS-ESI: 223.0 (M+1).

Step 9: N-(tert-butyldimethylsilyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonamide

(1596) Into a 100-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of 2-(2-hydroxypropan-2-yl)thiazole-5-sulfonamide (1.5 g, 6.75 mmol) in THF (20 mL). Then to the above was added imidazole (0.92 g, 13.5 mmol). This was followed by the addition of a solution of TBSCl (5.1 g, 34 mmol) in THF (5 mL) dropwise with stirring over 2 min at 0° C. The resulting solution was stirred for 16 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:3 to 1:2). This resulted in 1.13 g (50%) of the title compound as a yellow solid. MS-ESI: 337.1 (M+1).

(1597) Steps 10 used similar procedures employed for converting compound 6 to Intermediate 1 shown in Scheme 7 to afford Intermediate 9. MS-ESI: 336.1 (M+1).

(1598) ##STR00577##

(1599) ##STR00578##

N′-(tert-butyldimethylsilyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

Step 1: 2-(2-Methyl-1,3-dioxolan-2-yl)thiazole

(1600) Into a 500-mL round-bottom flask was placed a solution of 1-(thiazol-2-yl)ethanone (20 g, 157 mmol) in toluene (300 mL). To the solution was added TsOH (2.7 g, 15.7 mmol)) and ethane-1,2-diol (19.5 g, 314 mmol). The resulting solution was refluxed overnight, and water was separated from the solution during refluxing. The resulting solution was diluted with 200 mL of water and extracted with 2×100 mL of ethyl acetate. The organic layers were combined and dried over anhydrous Na.sub.2O.sub.4, then concentrated under vacuum. This resulted in 26.6 g (99%) of the title compound as light yellow oil. MS-ESI: 172.0 (M+1).

Step 2: 2-(2-Methyl-1,3-dioxolan-2-yl)thiazole-5-sulfonamide

(1601) Into a 500-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of 2-(2-methyl-1,3-dioxolan-2-yl)thiazole (14 g, 81.6 mmol) in THF (200 mL). This was followed by the addition of n-BuLi (2.5 M in THF, 35.2 mL) dropwise with stirring at −78° C. The resulting solution was stirred for 0.5 h at −78° C. and then SO.sub.2 gas was introduced into the above reaction mixture. The reaction was slowly warmed to RT and then NCS (12.8 g, 95.86 mmol) was added. The resulting solution was stirred for 1 h at RT. The solids were filtered out. The resulting filtrate was concentrated under vacuum and was then diluted with DCM (160 mL). To the above was added a saturated solution of ammonia in DCM (300 mL). The resulting solution was stirred for 3 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:20 to 1:5). This resulted in 12.5 g (61%) of the title compound as a yellow solid. MS-ESI: 251.0 (M+1).

Step 3: 2-Acetylthiazole-5-sulfonamide

(1602) Into a 250-mL round-bottom flask was placed a solution of 2-(2-methyl-1,3-dioxolan-2-yl)thiazole-5-sulfonamide (12.5 g, 50 mmol) in THF (125 mL). To the above was added aq. HCl (4 N, 50 mL). The resulting solution was stirred for 6 h at 70° C. The resulting solution was diluted with 100 mL of water and extracted with 2×200 mL of ethyl acetate. The organic layers were combined, dried over anhydrous Na.sub.2O.sub.4, and then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:2 to 1:1). This resulted in 9.3 g (90%) of the title compound as a yellow solid. MS-ESI: 207.0 (M+1). Steps 4-6 used the same procedures for converting compound 24 to Intermediate 9 shown in Scheme 10A to afford Intermediate 9. MS-ESI: 336.1 (M+1).

(1603) TABLE-US-00010 TABLE 4 The Intermediates in the following Table were prepared using the similar procedures for converting compound 17 to Intermediate 9 shown in Scheme 10B from appropriate starting materials. Exact Mass Intermediate # Structure IUPAC Name [M + H].sup.+ Intermediate 10 embedded image N′-(tert-butyldimethylsilyl)-2-(2- hydroxypropan-2-yl)-4- methylthiazole-5-sulfonimidamide 350.2

(1604) ##STR00580##

(1605) ##STR00581##

N′-(tert-butyldimethylsilyl)-4-((dimethylamino)methyl)benzenesulfonimidamide

Step 1: 4-Nitrobenzoyl chloride

(1606) Into a 500-mL round-bottom flask was placed 4-nitrobenzoic acid (20 g, 120 mmol), DCM (200 mL), and DMF (0.2 mL). This was followed by the addition of oxalyl chloride (15 mL, 135 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 4 h at RT and then was concentrated under vacuum. This resulted in 22 g (crude) of the title compound as yellow oil. The crude product was used in the next step.

Step 2: N,N-dimethyl-4-nitrobenzamide

(1607) Into a 500-mL round-bottom flask was placed dimethylamine hydrochloride (9.8 g, 120 mmol), DCM (200 mL), and TEA (41.5 mL, 300 mmol). This was followed by the addition of 4-nitrobenzoyl chloride (22 g, crude) dropwise with stirring at 0° C. The resulting solution was stirred for 6 h at RT and then was concentrated under vacuum. The resulting mixture was washed with 2×50 mL of water. The solids were collected by filtration. This resulted in 16 g (69%, 2 steps) of the title compound as a white solid. MS-ESI: 195.1 (M+1).

Step 3: 4-Amino-N,N-dimethylbenzamide

(1608) Into a 250-mL round-bottom flask was placed N,N-dimethyl-4-nitrobenzamide (16 g, 82.4 mmol), MeOH (100 mL), and Pd/C (10% wt., 1 g). The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 12 h at RT under an atmosphere of hydrogen. The Pd/C catalysts were filtered out, and the filtrate was concentrated under vacuum. This resulted in 13 g (96%) of the title compound as a white solid. MS-ESI: 165.1 (M+1).

Step 4: 4-(Dimethylcarbamoyl)benzene-1-sulfonyl chloride

(1609) Into a 50-mL round-bottom flask was placed 4-amino-N,N-dimethylbenzamide (3 g, 18.3 mmol) and HCl (6 M, 12 mL). This was followed by the addition of a solution of NaNO.sub.2 (1.5 g, 21.7 mmol) in water (3 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 30 min at 0° C. The above mixture was added to a saturated solution of SO.sub.2 in AcOH (100 mL) dropwise with stirring at 0° C. To the above was added CuCl.sub.2 (4.8 g, 35.7 mmol). The resulting solution was stirred for 2 h at RT and then was quenched by the addition of 100 mL of water. The resulting solution was extracted with 2×100 mL of DCM. The organic layers were combined, dried over anhydrous Na.sub.2O.sub.4, and then concentrated under vacuum. This resulted in 5 g (crude) of the title compound as yellow oil. The crude product was used in the next step.

Step 5: N,N-dimethyl-4-sulfamoylbenzamide

(1610) Into a 250-mL round-bottom flask was placed 4-(dimethylcarbamoyl)benzene-1-sulfonyl chloride (5 g, 20.2 mmol) in DCM (20 mL). To the above was added a saturated solution of ammonia in DCM (80 mL). The resulting solution was stirred for 2 h at RT and then was concentrated under vacuum. The resulting mixture was washed with 3×100 mL of ethyl acetate. The solids were filtered out. The resulting filtrate was concentrated under vacuum. This resulted in 3.1 g (67%) of the title compound as a white solid. MS-ESI: 229.1 (M+1).

Step 6: 4-((Dimethylamino)methyl)benzenesulfonamide

(1611) Into a 100-mL round-bottom flask purged with and maintained under nitrogen was placed a solution of N,N-dimethyl-4-sulfamoylbenzamide (1.8 g, 7.9 mmol) in THF (50 mL). This was followed by the addition of 9-BBN (5.8 g, 47.5 mmol) in portions at 0° C. The resulting solution was stirred for 12 h at 70° C. and then was quenched by the addition of 20 mL of water/ice. The resulting solution was extracted with 3×100 mL of ethyl acetate and the organic layers were combined. The resulting mixture was washed with 200 mL of water and then the organic layer was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with DCM/MeOH (20:1 to 15:1). This resulted in 1 g (59%) of the title compound as a white solid. MS-ESI: 215.1 (M+1).

Step 7: N-(tert-butyldimethylsilyl)-4-((dimethylamino)methyl)benzenesulfonamide

(1612) Into a 250-mL round-bottom flask was placed a solution of 4-((dimethylamino)methyl)benzenesulfonamide (500 mg, 2.33 mmol) in THF (40 mL). This was followed by the addition NaH (60% wt., 170 mg) in portions at 0° C. Then TBSCl (1.75 g, 11.6 mmol) was added. The resulting solution was stirred for 2 h at RT and then was quenched by the addition of 30 mL of water. The resulting solution was extracted with 3×40 mL of ethyl acetate and the organic layers combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with DCM/MeOH (30:1 to 20:1). This resulted in 540 mg (70%) of the title compound as a yellow solid. MS-ESI: 329.2 (M+1).

(1613) Step 8 used similar procedures for converting compound 6 to Intermediate 1 shown in Scheme 7 to afford Intermediate 11. MS-ESI: 328.2 (M+1).

(1614) TABLE-US-00011 TABLE 4 The Intermediates in the following Table were prepared using the similar procedures for converting compound 29 to Intermediate 11 shown in Scheme 11 from appropriate starting materials. Exact Mass Intermediate # Structure IUPAC Name [M + H].sup.+ Intermediate 12 embedded image N′-(tert-butyldimethylsilyl)-4- ((dimethylamino)methyl)-2- fluorobenzenesulfonimidamide 346.2

(1615) ##STR00583##

(1616) ##STR00584##

N′-(tert-butyldimethyl silyl)-4-((tert-butyldimethyl silyloxy)methyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

Step 1: (2-Bromothiazol-4-yl)methanol

(1617) Into a 100-mL round-bottom flask was placed a solution of ethyl 2-bromo-1,3-thiazole-4-carboxylate (3 g, 12.71 mmol) in EtOH (30 mL). NaBH.sub.4 (1.0 g, 25.41 mmol) was added in portions with an ice/water bath. The resulting solution was stirred for 3 hr at room temperature. The reaction was then quenched by the addition of 100 mL of water in an ice/water bath. The resulting solution was extracted with 3×100 ml of ethyl acetate, and the combined organic layers were concentrated. This resulted in 2 g (81%) of the title compound as yellow oil. MS-ESI: 196.2, 194.2 (M+1).

Step 2: 2-Bromo-4-((tert-butyldimethylsilyloxy)methyl)thiazole

(1618) Into a 100-mL round-bottom flask was placed a solution of (2-bromo-1,3-thiazol-4-yl)methanol (2.0 g, 10.31 mmol) in THF (20 mL). To the solution was added NaH (60% wt., 1.2 g, 30.92 mmol) in portions with an ice/water bath. After stirring for 15 minutes at RT, a solution of TBSCl (4.7 g, 30.92 mmol) in THF (5 mL) was added dropwise in an ice/water bath. The resulting solution was stirred for 2 hr at RT. The reaction was then quenched by the addition of 50 mL of water. The resulting solution was extracted with 3×100 ml of ethyl acetate, the organic layers were combined, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:30). This resulted in 2.5 g (79%) of the title compound as yellow oil. MS-ESI: 310.2, 308.2 (M+1).

Step 3: 2-(4-((Tert-butyldimethylsilyloxy)methyl)thiazol-2-yl)propan-2-ol

(1619) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen was placed a solution of 2-bromo-4-[[(tert-butyldimethylsilyl)oxy]methyl]-1,3-thiazole (2.5 g, 8.11 mmol) in THF (30 mL). To this solution was added n-BuLi (2.5 M in hexane, 4.86 mL, 12.16 mmol) dropwise at −78° C.; and the resulting mixture was stirred for 30 min at −78° C. To the above was added acetone (0.9 g, 16.22 mmol) dropwise at −78° C. The ensuing solution was then stirred for 1 hr at RT, after which the reaction was quenched by the addition of 100 mL of water. The resulting solution was extracted with 3×100 ml of ethyl acetate; the organic layers were combined, dried over anhydrous Na.sub.2O.sub.4, and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:10). This resulted in 2 g (86%) of the title compound as yellow oil. MS-ESI: 288.2 (M+1).

Step 4: 4-((Tert-butyldimethylsilyloxy)methyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonyl chloride

(1620) Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen was placed a solution of 2-(4-[[(tert-butyldimethylsilyl)oxy]methyl]-1,3-thiazol-2-yl)propan-2-ol (2 g, 6.96 mmol) in THF (20 mL). To this solution was added n-BuLi (2.5 M in hexane, 8.4 mL, 20.9 mmol) dropwise at −78° C.; the mixture was stirred for 30 min at −78° C. Then SO.sub.2 was introduced in this solution for 10 minutes below −30° C. and stirred for 30 min at RT. The resulting solution was concentrated under vacuum. The crude solid was dissolved in DCM (30ml), followed by the addition of NCS (1.4 g, 10.4 mmol) in portions in an ice/water bath. The solution was stirred for 2 hr at RT. The resulting mixture was concentrated under vacuum. This resulted in 2.5 g (crude) of the title compound as a yellow solid.

Step 5: 4-((Tert-butyldimethylsilyloxy)methyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonamide

(1621) Into a 100-mL round-bottom flask was placed a solution of 4-[[(tert-butyldimethylsilyl)oxy]methyl]-2-(2-hydroxypropan-2-yl)-1,3-thiazole-5-sulfonyl chloride (2.5 g, 6.48 mmol) in DCM (30 mL). To the above was added a saturated solution of ammonia in DCM (10 mL) in an ice/water bath. The resulting solution was stirred for 1 hr at room temperature. The resulting mixture was concentrated. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5). This resulted in 1.2 g (51%) of the title compound as yellow oil. MS-ESI: 367.2 (M+1).

Step 6: N-(tert-butyldimethylsilyl)-4-((tert-butyldimethylsilyloxy)methyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonamide

(1622) To a solution of 2-(2-hydroxypropan-2-yl)-1,3-thiazole-5-sulfonamide (1.2 g, 3.27 mmol) in THF (20 mL), NaH (60% wt., 0.4 g, 9.82 mmol) was added in portions with an ice/water bath. After stirring for 15 minutes at RT, a solution of TBSCl (1.5 g, 9.82 mmol) in THF (5 mL) was added dropwise in an ice/water bath. The resulting solution was stirred for 2 hr at RT. The reaction was quenched by the addition of 100 mL of water. The resulting solution was extracted with 3×100 ml of ethyl acetate, the organic layers were combined, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under vacuum. This resulted in 1.3 g (83%) of the title compound as yellow oil. MS-ESI: 481.2 (M+.sup.1).

Step 7: N′-(tert-butyldimethylsilyl)-4-((tert-butyldimethylsilyloxy)methyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

(1623) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen was placed a solution of PPh.sub.3Cl.sub.2 (1.4 g, 4.06 mmol) in CHCl.sub.3 (10 mL), TEA (0.8 g, 8.11 mmol) was added dropwise in an ice/water bath. The solution was stirred at RT for 20 minutes. To this solution was added N-(tert-butyldimethylsilyl)-4-[[(tert-butyldimethylsilyl)oxy]methyl]-2-(2-hydroxypropan-2-yl)-1,3-thiazole-5-sulfonamide (1.3 g, 2.70 mmol) in CHCl.sub.3 (10 mL) dropwise in ice/water bath, the solution was stirred for 0.5 hr at RT. A saturated solution of ammonia in DCM (20 mL) was poured into this solution at 0° C. The solution was stirred for 1 hr at RT. The resulting solution was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:5). This resulted in 600 mg (46%) of the title compound as a yellow solid. MS-ESI: 480.2 (M+1).

(1624) Schemes for phenylacetic acids Intermediates: Schemes 13-22 illustrate the preparation of phenylacetic acid intermediates.

(1625) ##STR00585##

(1626) ##STR00586##

2-(4-Fluoro-2,6-diisopropylphenyl)acetic acid

Step 1: 4-Fluoro-2,6-di(prop-1-en-2-yl)aniline

(1627) Into a 500-mL round-bottom flask purged with and maintained under nitrogen was placed 2,6-dibromo-4-fluoroaniline (15 g, 55.8 mmol), dioxane (150 mL), water (15 mL), Cs.sub.2CO.sub.3 (55 g, 169 mmol), 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (25 g, 149 mmol), and Pd(dppf)Cl.sub.2 (4 g, 5.47 mmol). The resulting solution was stirred for 15 h at 100° C. and then was concentrated under vacuum. The mixture was diluted with 300 mL water, and extracted with ethyl acetate (3×300 mL). The organic layers were combined, dried over anhydrous Na.sub.2O.sub.4, and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:10 to 1:8). This resulted in 9.2 g (86%) of the title compound as brown oil. MS-ESI: 192.1 (M+1).

Step 2: 4-Fluoro-2,6-bis(propan-2-yl)aniline

(1628) Into a 500-mL round-bottom flask was placed 4-fluoro-2,6-bis(prop-1-en-2-yl)aniline (9.2 g, 48.1 mmol) in MeOH (200 mL). Then Pd/C (10% wt, 900 mg) was added. The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 12 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting mixture was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:10 to 1:8). This resulted in 7.2 g (77%) of the title compound as brown oil. MS-ESI: 196.1 (M+1).

Step 3: 2-Bromo-5-fluoro-1,3-bis(propan-2-yl)benzene

(1629) Into a 500-mL round-bottom flask purged with and maintained under nitrogen was placed 4-fluoro-2,6-bis(propan-2-yl)aniline (7 g, 35.9 mmol), ACN (300 mL), and CuBr (7.71 g, 53.9 mmol). This was followed by the addition of tert-butyl nitrite (5.55 g, 53.8 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 3 h at 60° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column eluted with petroleum ether. This resulted in 3.0 g (32%) of the title compound as yellow oil. 41 NMR (400 MHz, DMSO-d.sub.6): δ 7.09 (d, J=9.8 Hz, 2H), 3.40 (hept, J=6.9 Hz, 2H), 1.20 (d, J=6.8 Hz, 12H).

Step 4: Tert-butyl 2-[4-fluoro-2,6-bis(propan-2-yl)phenyl]acetate

(1630) Into a 250-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed 2-bromo-5-fluoro-1,3-bis(propan-2-yl)benzene (3.0 g, 11.6 mmol), THF (150 mL), X-phos (553 mg, 1.16 mmol), and Pd.sub.2(dba).sub.3CHCl.sub.3 (600 mg, 0.58 mmol). The resulting solution was stirred for 0.5 h at RT. Then, to the above, tert-butyl 2-(bromozincio)acetate (6.0 g, 23.04 mmol) was added. The resulting solution was stirred for 5 h at 70° C., after which it was quenched by the addition of 100 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×100 mL of ethyl acetate, and the organic layers combined and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:100 to 3:97). This resulted in 3.14 g (92%) of the title compound as yellow oil. .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 6.93 (d, J=10.4 Hz, 2H), 3.67 (s, 2H), 3.19-3.07 (m, 2H), 1.39 (s, 9H), 1.15 (d, J=6.7 Hz, 12H).

Step 5: 2-(4-Fluoro-2,6-diisopropylphenyl)acetic acid

(1631) Into a 50-mL round-bottom flask was placed tert-butyl 2-[4-fluoro-2,6-bis(propan-2-yl)phenyl]acetate (1.56 g, 5.30 mmol), DCM (10 mL), and TFA (10 mL). The resulting solution was stirred for 3 h at RT and was then concentrated under vacuum. The crude product was dissolved in 100 mL of NaOH (4 N) and washed with 3×50 mL of DCM to remove impurities. The pH value of aqueous phase was adjusted to 2 with HCl (4 N); the aqueous phase was then extracted with 3×100 mL of DCM. The organic layers were combined, dried over anhydrous Na.sub.2O.sub.4, and concentrated under vacuum. This resulted in 1.09 g (86%) of the title compound as a light yellow solid. MS-ESI: 237.1 (M−1).

(1632) ##STR00587##

(1633) ##STR00588##

2-(4-Cyano-3-fluoro-2,6-diisopropylphenyl)acetic acid

Step 1: 4-amino-3,5-dibromo-2-fluorobenzonitrile

(1634) Into a 1000-mL round-bottom flask was placed 4-amino-2-fluorobenzonitrile (25 g, 184 mmol), ACN (500 mL), and NB S (81.7 g, 459 mmol). The resulting solution was stirred overnight at 75° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:100 to 1:98). This resulted in 50 g (93%) of the title compound as brown oil. MS-ESI: 294.9/292.9/296.9 (M+1).

(1635) Steps 2-6 used similar procedures for converting compound 44 to Intermediate 14 shown in Scheme 13 to afford Intermediate 15. MS-ESI: 262.1 (M−1).

(1636) TABLE-US-00012 TABLE 5 The Intermediate in the following Table was prepared using the similar procedures for converting compound 49 to Intermediate 15 shown in Scheme 14 from appropriated starting materials. Exact Mass Intermediate # Structure IUPAC Name [M − H].sup.+ Intermediate 16 embedded image 2-(4-(Difluoromethoxy)-2,6- diisopropylphenyl)acetic acid 285.1

(1637) ##STR00590##

(1638) ##STR00591##

2-(2-Cyclopropyl-4-fluoro-6-isopropylphenyl)acetic acid

Step 1: 2-Bromo-6-cyclopropyl-4-fluorobenzenamine

(1639) Into a 500-mL round-bottom flask purged with and maintained under nitrogen was placed 2,6-dibromo-4-fluorobenzenamine (10 g, 37.2 mmol), 1,4-dioxane (200 mL), water (10 mL), K.sub.3PO.sub.4 (23.6 g, 111 mmol), cyclopropylboronic acid (9.59 g, 112 mmol), and Pd(dppf)Cl.sub.2 (1.36 g, 1.86 mmol). The resulting solution was stirred overnight at 90° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:40 to 1:20). This resulted in 3.4 g (40%) of the title compound as light yellow oil. MS-ESI: 230.0 (M+1).

Step 2: 2-Cyclopropyl-4-fluoro-6-(prop-1-en-2-yl)benzenamine

(1640) Into a 250-mL round-bottom flask purged with and maintained under nitrogen was placed 2-bromo-6-cyclopropyl-4-fluorobenzenamine (3.4 g, 14.8 mmol), dioxane (100 mL), water (10 mL), Cs.sub.2CO.sub.3 (14.5 g, 44.5 mmol), 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (3.75 g, 22.3 mmol), and Pd(dppf)Cl.sub.2 (1.1 g, 1.50 mmol). The resulting solution was stirred overnight at 110° C. and then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:40 to 1:20). This resulted in 1.7 g (60%) of the title compound as light yellow oil. MS-ESI: 192.1 (M+1).

Step 3: 2-Cyclopropyl-4-fluoro-6-isopropylbenzenamine

(1641) Into a 250-mL round-bottom flask was placed 2-cyclopropyl-4-fluoro-6-(prop-1-en-2-yl)benzenamine (1.7 g, 8.89 mmol), and MeOH (100 mL). Then Pd/C (10% wt, 100 mg) was added. The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 3 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting mixture was concentrated under vacuum. This resulted in 1.53 g (89%) of the title compound as yellow oil. MS-ESI: 194.1 (M+1).

(1642) Steps 4-6 used similar procedures for converting compound 46 to Intermediate 14 shown in Scheme 13 to afford Intermediate 17. MS-ESI: 235.1 (M−1).

(1643) TABLE-US-00013 TABLE 7 The Intermediates in the following Table were prepared using the similar procedures for converting compound 44 to Intermediate 17 shown in Scheme 15 from appropriate starting materials. Exact Mass Intermediate # Structure IUPAC Name [M − H].sup.+ Intermediate 18 embedded image 2-(4-cyano-2-cyclopropyl-6- isopropylphenyl)acetic acid 242.1 Intermediate 19 embedded image 2-(2-cyclopropyl-4- (difluoromethoxy)-6- isopropylphenyl)acetic acid 283.1

(1644) ##STR00594##

(1645) ##STR00595##

2-(1,2,3,5,6,7-Hexahydro-s-indacen-4-yl)acetic acid

Step 1: 3-Chloro-1-(2,3-dihydro-1H-inden-5-yl)propan-1-one

(1646) Into a 1000-mL round-bottom flask was placed a solution of AlCl.sub.3 (37 g, 278 mmol) in DCM (400 mL). This was followed by the addition of a solution of 2,3-dihydro-1H-indene (30 g, 254 mmol) and 3-chloropropanoyl chloride (32.1 g, 253 mmol) in DCM (100 mL) dropwise with stirring at −10° C. in 30 min. The resulting solution was stirred for 16 h at RT. Then the reaction mixture was added dropwise to cold HCl (3 N, 400 mL) over 45 min at −10° C. The resulting solution was extracted with 3×200 mL of DCM; the organic layers combined, dried over anhydrous Na.sub.2O.sub.4, and concentrated under vacuum. This resulted in 53.5 g (crude) of the title compound as a yellow solid. The crude product was used in the next step.

Step 2: 1,2,3,5,6,7-Hexahydro-s-indacen-1-one

(1647) Into a 1000-mL round-bottom flask was placed a solution of 3-chloro-1-(2,3-dihydro-1H-inden-5-yl)propan-1-one (53.5 g, 253 mmol) in conc. H.sub.2SO.sub.4 (300 mL). The resulting solution was stirred for 16 h at 55° C. and was then quenched by adding the reaction mixture carefully to 1500 mL of water/ice. The solids were collected by filtration and then was dried over infrared lamp for 24 h. This resulted in 37.4 g (85%) of the title compound as a yellow solid.

Step 3: 1,2,3,5,6,7-Hexahydro-s-indacene

(1648) Into a 1000-mL round-bottom flask was placed a solution of 1,2,3,5,6,7-hexahydros-indacen-1-one (37.2 g, 216 mmol), MeOH (300 mL), and CH.sub.3SO.sub.3H (42 g, 437.5 mmol). Then Pd(OH).sub.2/C (20% wt., 8 g) was added. The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 16 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting mixture was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:150 to 1:100). This resulted in 27.1 g (79%) of the title compound as a white solid.

Step 4: 4-Bromo-1,2,3,5,6,7-hexahydro-s-indacene

(1649) Into a 500-mL 3-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of 1,2,3,5,6,7-hexahydro-s-indacene (15 g, 94.8 mmol) in CCl.sub.4 (200 mL). Then 12 (1.2 g, 4.72 mmol) was added. This was followed by the addition of a solution of Br.sub.2 (16 g, 100 mmol) in CCl.sub.4 (50 mL) dropwise with stirring at 0° C. in 10 min. The resulting solution was stirred for 2 h at 0° C. The reaction was then quenched by the addition of 150 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×150 mL of DCM and the organic layers combined and dried over anhydrous Na.sub.2O.sub.4, then concentrated under vacuum. The crude product was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether. This resulted in 18.0 g (80%) of the title compound as yellow oil. .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 7.02 (s, 1H), 2.95-2.75 (m, 8H), 2.03-2.01 (m, 4H).

Step 5: Tert-butyl 2-(1,2,3,5,6,7-hexahydro-s-indacen-4-yl)acetate

(1650) Into a 100-mL round-bottom flask purged with and maintained under nitrogen was placed a solution of 4-bromo-1,2,3,5,6,7-hexahydro-s-indacene (1 g, 4.2 mmol) in THF (20 mL). Then X-phos (200 mg, 0.42 mmol) and Pd.sub.2(dba).sub.3CHCl.sub.3 (220 mg, 0.21 mmol) were added. The resulting solution was stirred for 10 min at RT. This was followed by the addition of tert-butyl 2-(bromozincio)acetate (2.2 g, 8.45 mmol). The resulting solution was stirred for 4 h at 80° C. and was then quenched by the addition of 50 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×100 mL of DCM. The organic layers were combined, dried over anhydrous Na.sub.2O.sub.4, and concentrated under vacuum. This resulted in 1.4 g (crude) of the title compound as brown oil. .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 6.96 (s, 1H), 3.47 (s, 2H), 2.80-2.78 (m, 8H), 2.01-1.99 (m, 4H), 1.39 (s, 9H).

Step 6: 2-(1,2,3,5,6,7-hexahydro-s-indacen-4-yl)acetic acid

(1651) Into a 40-mL sealed tube was placed a solution of tert-butyl 2-(1,2,3,5,6,7-hexahydro-s-indacen-4-yl)acetate (1.4 g, 5.14 mmol) in 6 M sodium hydroxide/MeOH (4/6 mL). The resulting solution was stirred for 16 h at 100° C. The reaction was then quenched by the addition of 20 mL of water. The resulting solution was extracted with 2×30 mL of DCM and the aqueous layers combined. The pH value of the solution was adjusted to 2 with hydrogen chloride (1 N). The resulting solution was extracted with 3×50 mL of ethyl acetate and the organic layers combined and dried over anhydrous Na.sub.2O.sub.4, then concentrated under vacuum. This resulted in 180 mg (19.8%, 2 steps) of the title compound as a yellow solid. MS-ESI: 215.1 (M−1).

(1652) ##STR00596## ##STR00597##

(1653) ##STR00598##

2-(4-Cyano-6-cyclopropyl-3-fluoro-2-isopropylphenyl)acetic acid

Step 1: 4-Amino-5-bromo-2-fluorobenzonitrile

(1654) Into a 250-mL round-bottom flask was placed a solution of 4-amino-2-fluorobenzonitrile (9 g, 66.1 mmol) in ACN (120 mL). Then NBS (12.4 g, 69.7 mmol) was added. The resulting solution was stirred overnight at 80° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:20 to 1:10). This resulted in 10.9 g (77%) of the title compound as a yellow solid. MS-ESI: 215.0/217.0 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 7.89 (d, J=6.0 Hz, 1H), 6.69 (br s, 2H), 6.63 (d, J=12.0 Hz, 1H).

Step 2: 4-Amino-5-cyclopropyl-2-fluorobenzonitrile

(1655) Into a 250-mL round-bottom flask purged with and maintained under nitrogen was placed 4-amino-5-bromo-2-fluorobenzonitrile (6.37 g, 29.6 mmol), 1,4-dioxane (70 mL), water (10 mL), Cs.sub.2CO.sub.3 (9.7 g, 29.8 mmol), cyclopropylboronic acid (3.8 g, 44.2 mmol), and Pd(dppf)Cl.sub.2 (1.08 g, 1.48 mmol). The resulting solution was stirred overnight at 90° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:10 to 1:5). This resulted in 5.03 g (96%) of the title compound as a yellow solid. MS-ESI: 177.1 (M+1).

Step 3: 4-Amino-3-bromo-5-cyclopropyl-2-fluorobenzonitrile

(1656) Into a 250-mL round-bottom flask was placed 4-amino-5-cyclopropyl-2-fluorobenzonitrile (5.03 g, 28.7 mmol), ACN (50 mL), and NBS (5.6 g, 31.5 mmol). The resulting solution was stirred overnight at 80° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:10 to 1:5). This resulted in 6.972 g (96%) of the title compound as a yellow solid. MS-ESI: 255.0/257.0 (M+1).

Step 4: 4-Amino-5-cyclopropyl-2-fluoro-3-(prop-1-en-2-yl)benzonitrile

(1657) Into a 250-mL round-bottom flask purged with and maintained under nitrogen was placed 4-amino-3-bromo-5-cyclopropyl-2-fluorobenzonitrile (6.972 g, 27.33 mmol), 1,4-dioxane (120 mL), water (20 mL), 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (6.9 g, 41.0 mmol), Cs.sub.2CO.sub.3 (13.4 g, 41.0 mmol), and Pd(dppf)Cl.sub.2 (0.4 g, 0.55 mmol). The resulting solution was stirred overnight at 80° C. and was then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:10 to 1:5). This resulted in 4.73 g (80%) of the title compound as a yellow solid. MS-ESI: 217.1 (M+1).

Step 5: 4-Amino-5-cyclopropyl-2-fluoro-3-isopropylbenzonitrile

(1658) Into a 250-mL round-bottom flask was placed 4-amino-5-cyclopropyl-2-fluoro-3-(prop-1-en-2-yl)benzonitrile (4.73 g, 21.97 mmol), MeOH (100 mL), and AcOH (0.5 mL). Then Pd/C (10% wt, 500 mg) was added. The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 4 h at 40° C. under an atmosphere of hydrogen. The solids were filtered out. The filtrate was concentrated under vacuum. This resulted in 4.71 g (99%) of the title compound as a light yellow solid. MS-ESI: 219.1 (M+1).

(1659) Steps 6-8 used similar procedures for converting compound 46 to Intermediate 14 shown in Scheme 13 to afford Intermediate 21. MS-ESI: 260.1 (M−1).

(1660) ##STR00599## ##STR00600##

(1661) ##STR00601##

2-(4-Chloro-2-cyclopropyl-3-fluoro-6-isopropylphenyl)acetic acid

Step 1: 2-Bromo-4-chloro-5-fluorobenzenamine

(1662) Into a 1000-mL round-bottom flask was placed 4-chloro-3-fluorobenzenamine (20 g, 137 mmol, ACN (500 mL), and NBS (21.9 g, 123 mmol). The resulting solution was stirred overnight at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:150 to 1:100). This resulted in 26.3 g (85%) of the title compound as a white solid. MS-ESI: 225.9/223.9/227.9 (M+1). .sup.1H NMR (300 MHz, CDCl.sub.3-d) δ 7.44 (d, J=8.0 Hz, 1H), 6.59 (d, J=8.8 Hz, 1H), 4.21 (s, 2H).

Step 2: 4-Chloro-5-fluoro-2-(prop-1-en-2-yl)benzenamine

(1663) Into a 1000-mL round-bottom flask purged with and maintained under nitrogen was placed 2-bromo-4-chloro-5-fluorobenzenamine (26.3 g, 117 mmol), 1,4-dioxane (500 mL), water (50 mL), 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (23.7 g, 141 mmol), Cs.sub.2CO.sub.3 (76.6 g, 235 mmol), and Pd(dppf)Cl.sub.2 (1.71 g, 2.34 mmol). The resulting solution was stirred overnight at 90° C. and was then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:150 to 1:100). This resulted in 12.6 g (58%) of the title compound as brown oil. MS-ESI: 186.0/188.0 (M+1).

Step 3: 4-Chloro-5-fluoro-2-isopropylbenzenamine

(1664) Into a 500-mL round-bottom flask was placed 4-chloro-5-fluoro-2-(prop-1-en-2-yl)benzenamine (12.6 g, 67.88 mmol) in MeOH (250 mL). Then Pd/C (10% wt, 1.2 g) was added. The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred for 3 h at RT under an atmosphere of hydrogen. The solids were filtered out. The filtrate was concentrated under vacuum. This resulted in 12.5 g (98%) of the title compound as light yellow oil. MS-ESI: 188.1/190.1 (M+1).

Step 4: 2-Bromo-4-chloro-3-fluoro-6-isopropylbenzenamine

(1665) Into a 500-mL round-bottom flask was placed 4-chloro-5-fluoro-2-isopropylbenzenamine (6 g, 32.0 mmol), ACN (200 mL), and NBS (6.25 g, 35.1 mmol). The resulting solution was stirred for 3 h at RT and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:150 to 1:100). This resulted in 8 g (94%) of the title compound as brown oil. MS-ESI: 268.0/266.0/270.0 (M+1).

Step 5: 4-Chloro-2-cyclopropyl-3-fluoro-6-isopropylbenzenamine

(1666) Into a 100-mL round-bottom flask purged with and maintained under nitrogen was placed 2-bromo-4-chloro-3-fluoro-6-isopropylbenzenamine (2.9 g, 10.9 mmol), 1,4-dioxane (40 mL), water (8 mL), cyclopropylboronic acid (1.12 g, 13.0 mmol), Cs.sub.2CO.sub.3 (7.08 g, 21.7 mmol), and Pd(dppf)Cl.sub.2 (795 mg, 1.09 mmol). The resulting solution was stirred for 3 h at 90° C. and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:80 to 1:50). This resulted in 1.1 g (44%) of the title compound as light brown oil. MS-ESI: 228.1/230.1 (M+1).

(1667) Steps 6-8 used similar procedures for converting compound 46 to Intermediate 14 shown in Scheme 13 to afford Intermediate 22. MS-ESI: 271.1/273.1 (M−1).

(1668) ##STR00602## ##STR00603##

(1669) ##STR00604##

2-(4-(Difluoromethoxy)-2-ethyl-6-isopropylphenyl)acetic acid

(1670) Steps 1-3 used similar procedures for converting compound 80 to compound 83 shown in Scheme 18 to afford compound 91. MS-ESI: 202.1 (M+1).

Step 4: 2-Bromo-4-(difluoromethoxy)-6-isopropylbenzenamine

(1671) Into a 250-mL round-bottom flask was placed a mixture of 4-(difluoromethoxy)-2-isopropylbenzenamine (2.01 g, 10 mmol) and iron powder (1.12 g, 20 mmol) in CHCl.sub.3 (50 mL). To this was added bromine (1.23 mL, 24 mmol). The resulting solution was stirred for 6 h at RT and diluted with water (200 mL). The mixture was extracted with 3×50 mL of ethyl acetate. The organic layers were combined, dried over Na.sub.2O.sub.4, and then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:100 to 1:10). This resulted in 2.24 g (80%) of the title compound as a yellow solid. MS-ESI: 280.0/282.0 (M+1).

(1672) Steps 5-9 used similar procedures for converting compound 44 to Intermediate 14 shown in Scheme 13 to afford Intermediate 23. MS-ESI: 271.1 (M−1).

(1673) ##STR00605##

(1674) ##STR00606##

2-(4-Cyano-2,6-diisopropylphenyl)acetic acid

Step 1: 4-Amino-3,5-diisopropylbenzonitrile

(1675) Into a 100-mL round-bottom flask purged with and maintained under nitrogen was placed a solution of 4-bromo-2,6-diisopropylbenzenamine (commercially available, 5.1 g, 19.9 mmol) in DMF (30 mL). To the solution were added Zn(CN).sub.2 (2.80 g, 23.9 mmol), CuI (380 mg, 2.00 mmol), and TEA (3.0 g, 29.9 mmol). The resulting solution was stirred for 16 h at 120° C. and then was diluted with 30 mL of water. The solution was extracted with 3×30 mL of ethyl acetate and the combined organic layers were concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:30 to 1:20). This resulted in 2.4 g (60%) of the title compound as a yellow solid. MS-ESI: 203.1 (M+1).

(1676) Steps 2-4 used similar procedures for converting compound 46 to Intermediate 14 shown in Scheme 13 to afford Intermediate 24. MS-ESI: 244.1 (M−1).

(1677) ##STR00607## ##STR00608##

(1678) ##STR00609##

2-(2,6-diisopropyl-4-(methoxymethyl)phenyl)acetic acid

Step 1: Methyl 4-amino-3,5-diisopropylbenzoate

(1679) Into a 1-L autoclave was placed a solution of 4-bromo-2,6-diisopropylbenzenamine (10 g, 39 mmol) in MeOH (300 mL). To the solution were added Pd(OAc).sub.2 (1.75 g, 7.8 mmol), dppf (4.3 g, 7.8 mmol), and TEA (20 g, 195 mmol). After sealing the autoclave, the gas was exchanged with CO for 3 times. The reaction was stirred at 120° C. for overnight. After cooling the reaction mixture, the gas was exchanged with N.sub.2, the reaction was concentrated and diluted with water (300 mL). The resulting solution was extracted with EtOAc (3×200 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4 and concentrated. The residue was purified on SiO.sub.2-gel column and eluted with ethyl acetate/petroleum ether (1:10 to 1:5). This resulted in 5.6 g (62%) of the title compound as a brown oil. MS-ESI: 236.2 (M+1)

(1680) Steps 2 and 3 used similar procedures for converting compound 46 to 48, shown in Scheme 13 to afford compound 103″ as colorless oil. 335.2 (M+1)

Step 4: Tert-butyl 2-(4-(hydroxymethyl)-2,6-diisopropylphenyl)acetate

(1681) Into a 100 mL round bottom flask was placed a solution of methyl 4-(2-tert-butoxy-2-oxoethyl)-3,5-diisopropylbenzoate (2 g, 6.0 mmol) in THF (25 mL). LiBH.sub.4 (264 mg, 12.0 mmol) was added to the mixture at 0° C. in portions, and the mixture was stirred at 0° C. for 1 h. The reaction was quenched with ice-water (20 mL). The solution was extracted with EtOAc (3×100 mL); the combined organic layers were dried over anhydrous Na.sub.2SO.sub.4 and concentrated under vacuum. The residue was purified with SiO.sub.2-gel column and eluted with ethyl acetate/petroleum ether (1:5 to 1:2). This resulted in 1.1 g (60%) of the title compound as a white solid. MS-ESI: 307.2 (M+1).

Step 5: Tert-butyl 2-(2,6-diisopropyl-4-(methoxymethyl)phenyl)acetate

(1682) Into a 100 mL round bottom flask was placed a solution of tert-butyl 2-(4-(hydroxymethyl)-2,6-diisopropylphenyl)acetate (1.1 g, 3.6 mmol) in THF (20 mL). NaH (60% wt., 173 mg, 4.3 mmol) was added to the mixture at 0° C. in portions, and the mixture was stirred at 0° C. for 30 min. MeI (1.0 g, 7.2 mmol) was added to the mixture dropwise at 0° C.; the resulting mixture was stirred at RT for overnight. The reaction was quenched with ice-water (20 mL) and extracted with EtOAc (3×100 mL). The combined organic layer were dried over Na.sub.2SO.sub.4 and concentrated under vacuum. The residue was purified with SiO.sub.2-gel column and eluted with ethyl acetate/petroleum ether (1:10-1:5). This resulted in 1.1 g (95%) of title compound as a colorless oil. MS-ESI: 321.2 (M+1).

Step 6: 2-(2,6-Diisopropyl-4-(methoxymethyl)phenyl)acetic acid

(1683) Into a 50-mL round-bottom flask was placed a solution of tert-butyl 2-[4-fluoro-2,6-bis(propan-2-yl)phenyl]acetate (1.1 g, 3.4 mmol) in DCM (10 mL) and TFA (10 mL). The resulting solution was stirred for 3 h at RT and then was concentrated under vacuum. This resulted in 1.0 g (crude) of the title compound as a light yellow solid. MS-ESI: 263.2 (M−1).

(1684) ##STR00610##

(1685) ##STR00611##

2-(4-(Difluoromethyl)-2,6-diisopropylphenyl)acetic acid

Step 1: Tert-butyl 2-(4-formyl-2,6-diisopropylphenyl)acetate

(1686) Into a 100 mL round bottom flask was placed a solution of tert-butyl 2-(4-(hydroxymethyl)-2,6-diisopropylphenyl)acetate (1.1 g, 3.6 mmol) in DCM (20 mL). Dess-Martin Periodinane (2.29 g, 5.4 mmol) was added to the mixture at 0° C. in portions. The mixture was stirred at RT overnight, after which the reaction was quenched with ice-water (20 mL) and extracted with DCM (3×50 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4 and concentrated under vacuum. The residue was purified on a SiO.sub.2-gel column and eluted with ethyl acetate/petroleum ether (1:20-1:10). This resulted in 0.98 g (90%) of title compound as a yellow solid. MS-ESI: 305.2 (M+1).

Step 2: Tert-butyl 2-(4-(difluoromethyl)-2,6-diisopropylphenyl)acetate

(1687) Into a 100 mL round bottom flask was placed a solution of tert-butyl 2-(4-formyl-2,6-diisopropylphenyl)acetate (912 mg, 3.0 mmol) in DCM (15 mL). DAST (2.41 g, 15 mmol) was added to the mixture at 0° C. in portions. The mixture was stirred at RT overnight, after which the reaction was quenched with water (10 mL) and extracted with DCM (3×30 mL). The combined organic layers were dried over Na.sub.2SO.sub.4 and concentrated under vacuum. The residue was purified with SiO.sub.2-gel column and eluted with ethyl acetate/petroleum ether (1:20-1:15). This resulted in 586 mg (60%) of title compound as a yellow solid. MS-ESI: 327.2 (M+1).

(1688) Steps 3 used similar procedures for converting compound 105″ to Intermediate 25 shown in Scheme 21 to afford Intermediate 26. MS-ESI: 269.1 (M−1).

(1689) Schemes of Sulfonimidoylamide Intermediates: Schemes 23-30 illustrate the preparation of sulfonimidoylamide intermediates.

(1690) ##STR00612##

(1691) ##STR00613##

N′-(tert-butyl dim ethyl silyl)-4-(2-hydroxypropan-2-yl)-5-methylthiophene-2-sulfonimidamide

Step 1: Methyl 5-(chlorosulfonyl)-2-methylthiophene-3-carboxylate

(1692) Into a 250-mL round-bottom flask, was placed methyl 2-methylthiophene-3-carboxylate (5.0 g, 32.0 mmol), CHCl.sub.3 (70 mL). This was followed by the addition of ClSO.sub.2OH (5.6 g, 48.0 mmol) dropwise with stirring. To this was added PCl.sub.5 (13.3 g, 64.0 mmol) with stirring. The resulting solution was stirred for 2 h at 60° C. in an oil bath. The reaction was then quenched by the addition of 150 mL of water/ice. The resulting solution was extracted with 3×80 ml of dichloromethane, dried over anhydrous sodium sulfate, and concentrated. This resulted in 5.2 g (63.8%) of the title compound as a yellow solid.

Step 2: Methyl 2-methyl-5-sulfamoylthiophene-3-carboxylate

(1693) Into a 250-mL round-bottom flask, was placed methyl 5-(chlorosulfonyl)-2-methylthiophene-3-carboxylate (5.2 g, 20.4 mmol) in DCM (50 mL), to this solution was added NH.sub.3/DCM (50 mL, sat.) dropwise with stirring. The resulting solution was stirred for 2 h at 40° C. in an oil bath. The resulting mixture was concentrated. The residue was eluted from a silica gel with ethyl acetate/petroleum ether (2:3). This resulted in 4.6 g (95.8%) of the title compound as a yellow solid. MS-ESI: 236 [M+1].

Step 3: 4-(2-Hydroxypropan-2-yl)-5-methylthiophene-2-sulfonamide

(1694) Into a 250-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed methyl 2-methyl-5-sulfamoylthiophene-3-carboxylate (4.6 g, 19.5 mmol) in THF (100 mL). This was followed by the addition of MeMgBr (29 mL, 87 mmol, 3M) dropwise with stirring at 0° C. in an ice bath. The resulting solution was stirred for 2 h at RT. The pH value of the solution was adjusted to 5 with HCl (2 M). The resulting solution was extracted with 3×100 ml of ethyl acetate, dried over anhydrous sodium sulfate, and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:2). This resulted in 1.3 g (28.2%) of the title compound as a light yellow solid. MS-ESI: 236 [M+1].

Step 4: N-(tert-butyldimethylsilyl)-4-(2-hydroxypropan-2-yl)-5-methylthiophene-2-sulfonamide

(1695) Into a 100-mL round-bottom flask, was placed 4-(2-hydroxypropan-2-yl)-5-methylthiophene-2-sulfonamide (1.3 g, 5.52 mmol) in THF (40 mL). To this solution was added NaH (60% wt. oil dispersion, 442 mg, 11.1 mmol) in portions with stirring at 0° C. This was followed by the addition of TBSCl (1.25 g, 8.29 mmol). The resulting solution was stirred for 1 h at RT. The reaction was then quenched by the addition of 50 mL of NH.sub.4Cl solution. The resulting solution was extracted with 3×50 ml of ethyl acetate, dried over anhydrous sodium sulfate, and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:2). This resulted in 1.2 g (62.1%) of the title compound as a white solid. MS-ESI:350[M+1].

Steps 5 and 6: N′-(tert-butyldimethylsilyl)-4-(2-hydroxypropan-2-yl)-5-methylthiophene-2-sulfonimidamide

(1696) Into a 100-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of PPh.sub.3Cl.sub.2 (3.51 g, 10.5 mmol) in CHCl.sub.3 (40 mL). This was followed by the addition of DIEA (1.77 g, 13.7 mmol) dropwise with stirring at RT. The resulting solution was stirred for 10 min at RT and the reaction mixture was cooled to 0° C. To this was added a solution of N-(tert-butyldimethyl silyl)-4-(2-hydroxypropan-2-yl)-5-methylthiophene-2-sulfonamide (1.2 g, 3.43 mmol) in CHCl.sub.3 (5 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 30 min at 0° C. To the mixture was introduced NH.sub.3 gas bubble for 15 min at 0° C. The resulting solution was stirred for 2 h at RT. The resulting solution was diluted with 50 mL of H.sub.2O. The resulting solution was extracted with 3×100 ml of DCM and dried over anhydrous sodium sulfate and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:1). This resulted in 930 mg (77.7%) of the title compound as a yellow solid. MS-ESI: 349 [M+1].

(1697) TABLE-US-00014 TABLE 12 The Intermediates in the following Table were prepared using similar procedure as shown in Scheme 23 above for converting compound 108″ to Intermediate 27 starting from methyl thiophene-3-carboxylate. Exact Mass Intermediate # Structure IUPAC Name [M + H].sup.+ Intermediate 28 embedded image N′-(tert-butyldimethylsilyl)-4-(2-hydroxypropan- 2-yl)thiophene-2-sulfonimidamide 335

(1698) ##STR00615##

(1699) ##STR00616##

N′-(tert-butyldimethylsilyl)-4-(2-(dimethylamino)propan-2-yl)benzenesulfonimidamide

Step 1: 4-(Prop-1-en-2-yl)benzenesulfonamide

(1700) Into a 500-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of 4-bromobenzene-1-sulfonamide (5.0 g, 21.2 mmol) in dioxane (75 mL) and H.sub.2O (7.5 mL). To this solution was added 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (7.83 g, 46.59 mmol), Pd(dppf)Cl.sub.2 (1.5 g, 2.12 mmol) and Cs.sub.2CO.sub.3 (27.6 g, 84.7 mmol). The resulting solution was stirred for 2 h at 85° C. The resulting solution was diluted with 400 mL of water. The resulting solution was extracted with 2×500 mL of ethyl acetate and dried over anhydrous sodium sulfate and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:3). This resulted in 4.7 g (98.1%) of the title compound as a yellow solid. MS-ESI: 198.1 [M+1].

Step 2: 2-Chloro-N-(2-(4-sulfamoylphenyl)propan-2-yl)acetamide

(1701) Into a 1 L round-bottom flask, was placed a solution of 4-(prop-1-en-2-yl)benzene-1-sulfonamide (2.2 g, 11.2 mmol) in AcOH (280 mL). To the solution was added 2-chloroacetonitrile (16.8 g, 224 mmol). This was followed by the addition of H.sub.2SO.sub.4 (70 mL, 0.7 mmol) dropwise with stirring at 0° C. The resulting solution was stirred overnight at RT. The resulting solution was diluted with 500 mL of water/ice. The pH value of the solution was adjusted to 7 with a saturated solution of Na.sub.2CO.sub.3. The resulting solution was extracted with 3×1000 mL of DCM, dried over anhydrous sodium sulfate and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (3:2). This resulted in 2.7 g (83.2%) of the crude title compound as a white solid. MS-ESI: 291.0 [M+1].

Step 3: 4-(2-Aminopropan-2-yl)benzenesulfonamide

(1702) Into a 100-mL round-bottom flask, was placed a solution of 2-chloro-N-[2-(4-sulfamoylphenyl)propan-2-yl] acetamide (1.0 g, 3.44 mmol) in ethanol (30 mL) and AcOH (6.0 mL, 99.93 mmol). To the solution was added thiourea (314.2 mg, 4.13 mmol). The resulting solution was stirred for overnight at 85° C. The resulting mixture was concentrated. The resulting mixture was washed with 50 mL of ethanol. The solids were collected by filtration. The solid was dried under infra-red for 16 h. This resulted in 520 mg (70.56%) of the crude title compound as a white solid. MS-ESI: 215.1 [M+1].

Step 4: 4-(2-(Dimethylamino)propan-2-yl)benzenesulfonamide

(1703) Into a 50-mL round-bottom flask, was placed a solution of 4-(2-aminopropan-2-yl)benzene-1-sulfonamide (500 mg, 2.33 mmol) in methanol (20 mL). This was followed by the addition of HCHO (140 mg, 4.67 mmol). The resulting solution was stirred for 30 min at RT. To this was added NaBH.sub.3CN (439 mg, 7.0 mmol) in several batches at 0° C. The resulting solution was stirred for 1 h at RT. The reaction was then quenched by the addition of 50 mL of water. The resulting mixture was concentrated and washed with 20 mL of H.sub.2O. The solids were collected by filtration and dried in an oven under reduced pressure at 50° C. This resulted in 300 mg (53.1%) of the crude title compound as a white solid. MS-ESI: 243.1[M+1].

Step 5: N-(tert-butyldimethylsilyl)-4-(2-(dimethylamino)propan-2-yl)benzenesulfonamide

(1704) Into a 50-mL round-bottom flask, was placed a solution of 4-[2-(dimethylamino)propan-2-yl]benzene-1-sulfonamide (200 mg, 0.83 mmol) in THF (15 mL). This was followed by the addition of NaH (60% wt. oil dispersion, 66 mg, 1.65 mmol) at 0° C. The resulting solution was stirred for 10 min at RT. To this was added TBSCl (497 mg, 3.3 mmol). The resulting solution was stirred for 1 h at RT. The reaction was then quenched by the addition of 60 mL of water/ice. The resulting solution was extracted with 2×60 mL of ethyl acetate and dried over anhydrous sodium sulfate and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:1). This resulted in 243 mg (82.5%) of the title compound as a white solid. MS-ESI: 357.2 [M+1].

Step 6: N′-(tert-butyldimethylsilyl)-4-(2-(dimethylamino)propan-2-yl)benzenesulfonimidamide

(1705) Into a 250-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of dichlorotriphenyl-λ5-phosphane (467 mg, 1.4 mmol) in CHCl.sub.3 (30 mL). This was followed by the addition of DIEA (261 mg, 2.02 mmol) dropwise with stirring. The resulting solution was stirred for 15 min at RT, and the reaction system was cooled to 0° C. To this was added a solution of N-(tert-butyldimethylsilyl)-4-[2-(dimethylamino)propan-2-yl]benzene-1-sulfonamide (200 mg, 0.56 mmol) in CHCl.sub.3 (10 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 30 min at 0° C. To the mixture was added a solution of NH.sub.3 in DCM (60 mL, sat.). The resulting solution was stirred for 2 h at RT. The resulting mixture was diluted with 80 mL of H.sub.2O. The resulting solution was extracted with 2×100 mL of DCM and dried over anhydrous sodium sulfate and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1.4:1). This resulted in 140 mg (70.1%) of the title compound as a white solid. MS-ESI: 356.2 [M+1].

(1706) ##STR00617## ##STR00618##

(1707) ##STR00619##

Tert-butyl 2-(2-(N′-(tert-butyldimethyl silyl)sulfamidimidoyl)thiazol-5-yl)-2-methylpropanoate

Step 1: Tert-butyl 2-(thiazol-5-yl)acetate

(1708) Into a 250-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of 5-bromo-1,3-thiazole (3.0 g, 18.3 mmol) in THF (100 mL). This was followed by the addition of Pd.sub.2(dba).sub.3 (947 mg, 0.91 mmol) and Xphos (1.05 g, 1.83 mmol). The resulting solution was stirred for 10 min at RT. To this was added tert-butyl 2-(bromozincio)acetate (9.5 g, 36.5 mmol). The resulting solution was stirred for 1.5 h at 60° C. The resulting mixture was diluted with 150 mL of H.sub.2O. The resulting solution was extracted with 2×200 mL of ethyl acetate, dried over anhydrous sodium sulfate and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:5). This resulted in 1.0 g (27.4%) of the title compound as a yellow liquid. MS-ESI: 200.1[M+1].

Step 2: Tert-butyl 2-methyl-2-(thiazol-5-yl)propanoate

(1709) Into a 250-mL round-bottom flask, was placed a solution of tert-butyl 2-(1,3-thiazol-5-yl)acetate (1.0 g, 5.02 mmol) in THF (50 mL). To the solution were added t-BuOK (2.30 g, 20.4 mmol) and MeI (2.91 g, 20.4 mmol). The resulting solution was stirred for 1 h at RT. The reaction was then quenched by the addition of 200 mL of water. The resulting solution was extracted with 3×200 mL of ethyl acetate dried over anhydrous sodium sulfate and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:5). This resulted in 1.05 g (92.0%) of the title compound as brown yellow oil. MS-ESI: 228.1 [M+1].

Step 3: Tert-butyl 2-(2-bromothiazol-5-yl)-2-methylpropanoate

(1710) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of tert-butyl 2-methyl-2-(1,3-thiazol-5-yl)propanoate (500 mg, 2.2 mmol) in CCl.sub.4 (30 mL). To the solution were added NBS (783 mg, 4.4 mmol) and AIBN (72.2 mg, 0.44 mmol). The resulting solution was stirred for 5 h at 70° C. The reaction was then quenched by the addition of 60 mL of water. The resulting solution was extracted with 2×100 mL of DCM, dried over anhydrous sodium sulfate, and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:6). This resulted in 450 mg (66.9%) of the title compound as yellow oil. MS-ESI: 306.0 [M+1].

Step 4: Tert-butyl 2-(2-mercaptothiazol-5-yl)-2-methylpropanoate

(1711) Into a 50-mL round-bottom flask, was placed a solution of tert-butyl 2-(2-bromo-1,3-thiazol-5-yl)-2-methylpropanoate (450 mg, 1.5 mmol) in DMF (10 mL). To the solution was added NaSH (2.97 g, 30 mmol). The resulting solution was stirred overnight at 100° C. The pH value was adjusted to 6 with 1M HCl. The resulting solution was washed with 2×25 mL of H.sub.2O and extracted with 2×50 mL of ethyl acetate. The organic layers were combined and dried over anhydrous sodium sulfate. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:1). This resulted in 350 mg (91.6%) of the title compound as yellow oil. MS-ESI: 260.1 [M+1].

Step 5: Tert-butyl 2-(2-(chlorosulfonyl)thiazol-5-yl)-2-methylpropanoate

(1712) Into a 25-mL round-bottom flask, was placed a solution of tert-butyl 2-methyl-2-(2-sulfanyl-1,3-thiazol-5-yl)propanoate (350 mg, 1.35 mmol) in AcOH (10 mL) at 0° C. To this was added NaClO (10% wt., 5.03 g, 67.4 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 90 min at RT. The resulting mixture was diluted with 2×100 mL of H.sub.2O. The resulting solution was extracted with 150 mL of DCM, the combined organic layer was dried over anhydrous sodium sulfate and concentrated. This resulted in 100 mg (56.8%) of the title compound as yellow oil.

Step 6: Tert-butyl 2-methyl-2-(2-sulfamoylthiazol-5-yl)propanoate

(1713) Into a 50-mL round-bottom flask, was placed a solution of tert-butyl 2-[2-(chlorosulfonyl)-1,3-thiazol-5-yl]-2-methylpropanoate (100 mg, 0.31 mmol) in DCM (5 mL). To the above solution NH.sub.3 (g) was introduced. The resulting solution was stirred for 20 min at RT. The resulting mixture was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (3:4). This resulted in 90 mg (95.7%) of the title compound as a white solid. MS-ESI: 307.1 [M+1].

Step 7: Tert-butyl 2-(2-(N-(tert-butyldimethylsilyl)sulfamoyl)thiazol-5-yl)-2-methylpropanoate

(1714) Into a 25-mL round-bottom flask, was placed a solution of tert-butyl 2-methyl-2-(2-sulfamoyl-1,3-thiazol-5-yl)propanoate (50 mg, 0.16 mmol) in THF (5 mL). This was followed by the addition of NaH (60% wt. oil dispersion, 9.6 mg, 0.24 mmol) at 0° C. To this was added TBSCl (49.2 mg, 0.33 mmol). The resulting solution was stirred for 40 min at RT. The reaction was then quenched by the addition of 30 mL of water/ice. The resulting solution was extracted with 2×50 mL of ethyl acetate, dried over anhydrous sodium sulfate and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:3). This resulted in 120 mg (97.1%) of the title compound as a white solid. MS-ESI: 421.2 [M+1].

Step 8: Tert-butyl 2-(2-(N′-(tert-butyldimethylsilyl)sulfamidimidoyl)thiazol-5-yl)-2-methylpropanoate

(1715) Into a 50-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of PPh.sub.3Cl.sub.2 (236 mg, 0.71 mmol) in CHCl.sub.3 (15 mL). This was followed by the addition of DIEA (147 mg, 1.14 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 15 min at RT. To this was added a solution of tert-butyl 2-[2-[(tert-butyldimethylsilyl)sulfamoyl]-1,3-thiazol-5-yl]-2-methylpropanoate (120 mg, 0.29 mmol) in CHCl.sub.3 (4 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 30 min at 0° C. To the above solution was introduced NH.sub.3(g). The resulting solution was stirred for 1 h at RT. The resulting mixture was diluted with 50 mL of H.sub.2O. The resulting solution was extracted with 2×75 mL of DCM, the combined organic layer was dried over anhydrous sodium sulfate and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:6). This resulted in 80 mg (66.6%) of the title compound as a white solid. MS-ESI: 420.2 [M+1].

(1716) ##STR00620##

(1717) ##STR00621##

N′-(tert-butyldimethyl silyl)-5-((dimethyl amino)methyl)-3-fluorothiophene-2-sulfonimidamide

Step 1: (4-Fluorothiophen-2-yl)methanol

(1718) Into a 1000-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed methyl 4-fluorothiophene-2-carboxylate (10 g, 62.4 mmol) in EtOH (300 mL). To the above solution was added NaBH.sub.4 (4.74 g, 124.8 mmol) with stirring at 0° C. The resulting solution was stirred for 30 min at 0° C. The resulting solution was allowed to react for an additional 16 h at RT. The reaction was then quenched by the addition of 10 mL of water. The resulting mixture was extracted with 3×1000 mL of ethyl acetate. Evaporation of combined ethyl acetate solution resulted in 6.4 g (77.5%) of the title compound as white oil.

Step 2: 2-(Bromomethyl)-4-fluorothiophene

(1719) Into a 250-mL round-bottom flask, was placed (4-fluorothiophen-2-yl)methanol (8.5 g, 64.32 mmol) in DCM (70 mL). To the stirred solution was added PBr.sub.3 (19.15 g, 70.75 mmol) at 0° C. The resulting solution was stirred for 30 min at 0° C., after which it was allowed to react for an additional 12 h at RT. The reaction was quenched with 20 mL of water and extracted with ethyl acetate 3×50 mL. The combined organic layer was dried over Na.sub.2SO.sub.4 and concentrated under vacuum. The residue was eluted from silica gel with ethyl acetate/petroleum ether (15/85). This resulted in 7.0 g (55.8%) of the title compound as yellow oil.

Step 3: 1-(4-Fluorothiophen-2-yl)-N,N-dimethylmethanamine

(1720) Into a 250-mL round-bottom flask, was placed 2-(bromomethyl)-4-fluorothiophene (7.4 g, 37.9 mmol). To the solution was added dimethylamine in THF (2M, 37.9 mmol). The resulting solution was stirred for 16 h at RT. The reaction mixture was concentrated under vacuum. The residue was eluted from silica gel with ethyl acetate/petroleum ether (17/83). This resulted in 5.62 g (92.6%) of the title compound as a solid. MS-ESI: 160 [M+1].

Step 4: Lithium 5-((dimethylamino)methyl)-3-fluorothiophene-2-sulfinate

(1721) Into a 250-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of [(4-fluorothiophen-2-yl)methyl] dimethylamine (6.2 g, 38.9 mmol) in THF (60 mL), to the above solution was added n-BuLi (18.7 mL, 46.7 mmol, 2.5 M) dropwise at −78° C. in a liquid nitrogen/ethanol bath. The resulting solution was stirred for 30 min at −78° C. To the stirred solution, SO.sub.2(g) (4.99 g, 78 mmol) was introduced in at −78° C. The resulting solution was allowed to react for an additional 120 min at RT. The resulting mixture was concentrated. This resulted in 10 g (crude) of the title compound as a yellow solid. MS-ESI: 228 [M−1].

Step 5: 5-((Dimethylamino)methyl)-3-fluorothiophene-2-sulfonyl chloride

(1722) Into a 500-mL round-bottom flask, was placed a solution of 5-[(dimethylamino)methyl]-3-fluorothiophene-2-sulfinic acid (10 g, 44.7 mmol) in THF (100 mL), to the above solution was added NCS (7.18 g, 54 mmol) at 0° C. The resulting solution was stirred for 30 min at 0° C. The resulting solution was allowed to react for an additional 100 min at RT. The reaction solution was used for next step without any purification.

Step 6: 5-((Dimethylamino)methyl)-3-fluorothiophene-2-sulfonamide

(1723) Into a 500-mL round-bottom flask, was placed a solution of 5-[(dimethylamino)methyl]-3-fluorothiophene-2-sulfonyl chloride (10 g, 38.8 mmol) in THF (100 mL). To the above NH.sub.3 (g) was introduced for 15 min at 0° C. The resulting solution was allowed to react for an additional 100 min at RT. Then the reaction solution was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (60/40). This resulted in 2.1 g (22.7%) of the title compound as yellow oil. MS-ESI: 239 [M+1].

Step 7: N-(tert-butyldimethylsilyl)-5-((dimethylamino)methyl)-3-fluorothiophene-2-sulfonamide

(1724) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of 5-[(dimethylamino)methyl]-3-fluorothiophene-2-sulfonamide (1.8 g, 7.55 mmol) in THF (30 mL). To the above solution was added NaH (60% wt. oil dispersion, 600 mg, 15 mmol) with stirring at 0° C. The resulting solution was stirred for 30 min at 0° C. This was followed by the addition of TBSCl (1.37 g, 9.09 mmol) at 0° C. The resulting solution was allowed to react for an additional 15 h at RT. The reaction solution was concentrated. The residue was eluted from silica gel with ethyl acetate. This resulted in 2 g (75.1%) of the title compound as yellow oil. MS-ESI: 353 [M+1].

Step 8-1: N-(tert-butyldimethylsilyl)-5-((dimethylamino)methyl)-3-fluorothiophene-2-sulfonimidoyl chloride

(1725) Into a 500-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of PPh.sub.3Cl.sub.2 (59.2 g, 178 mmol) in CHCl.sub.3 (100 mL). This was followed by the addition of DIEA (45.9 g, 355 mmol) dropwise with stirring at 0° C. The resulting solution was stirred for 15 min at RT. To this was added a solution of N-(tert-butyldimethylsilyl)-5-((dimethylamino)methyl)-3-fluorothiophene-2-sulfonamide (15.6 g, 44.4 mmol) in CHCl.sub.3 (30 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 30 min at 0° C. The reaction solution was used in the next step with no workup.

Step 8-2: N′-(tert-butyldimethylsilyl)-5-((dimethylamino)methyl)-3-fluorothiophene-2-sulfonimidamide

(1726) Into a 250-mL 3-necked round-bottom flask, was placed N-(tert-butyldimethylsilyl)-5-((dimethylamino)methyl)-3-fluorothiophene-2-sulfonimidoyl chloride (2.8 g, 0.27 mmol) in CHCl.sub.3 (20 mL). To the above NH.sub.3(g) was introduced for 15 min at 0° C. The resulting solution was stirred for 15 min at 0° C. The resulting solution was stirred for 1 h at RT. The resulting mixture was diluted with 50 mL of H.sub.2O. The resulting solution was extracted with 2×75 mL of DCM, the combined organic layer was dried over anhydrous sodium sulfate and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:6). This resulted in 250 mg (9.4%) of the title compound as a yellow solid. MS-ESI: 352 [M+1].

(1727) ##STR00622##

(1728) ##STR00623##

Step 1: 1-Methyl-1H-indazole-5-sulfinic acid

(1729) Into a 100-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 5-bromo-1-methyl-1H-indazole (700 mg, 3.32 mmol) in THF (5 mL). To the above solution was added n-BuLi (1.6 mL, 3.98 mmol, 2.5 M) dropwise at −78° C. in a liquid nitrogen/ethanol bath. Then the solution was stirred for 30 min at −78° C. To the stirred solution, SO.sub.2 (g) was introduced at −78° C. for 15 min. The resulting solution was allowed to react for an additional 120 min at RT. The resulting mixture was concentrated. This resulted 500 mg (76.8%) of the title compound as a yellow solid.

(1730) Steps 2-6 used similar procedures for converting compound 132″ to Intermediate 31 shown in Scheme 26 to afford Intermediate 32 from compound 138″. MS-ESI: 325 (M+1).

(1731) ##STR00624##

(1732) ##STR00625##

N′-(tert-butyldimethylsilyl)-5-((dimethylamino)methyl)pyridine-2-sulfonimidamide

Step 1: 1-(6-Bromopyridin-3-yl)-N,N-dimethylmethanamine

(1733) Into a 500 mL round-bottom flask, were added Ti(OEt).sub.4 (12.2 g, 53.7 mmol) and dimethylamine (4.85 g, 107 mmol) in methanol (50 mL) at RT. To this stirred solution was added 6-bromopyridine-3-carbaldehyde (5 g, 26.9 mmol) in methanol (30 mL) dropwise at 0° C. After stirring at RT for 3 h, NaBH.sub.4 (1.02 g, 26.9 mmol) was added and the resulting mixture was stirred overnight. The reaction was quenched by the addition of water/ice (30 mL) at 0° C. The resulting mixture was extracted with ethyl acetate (3×50 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel chromatography, eluted with ethyl acetate/petroleum ether (5:1) to afford the title compound (3.5 g, 60.5%) as yellow oil. MS-ESI: 215 (M+1).

Step 2: 5-((Dimethylamino)methyl)pyridine-2-sulfinic acid

(1734) Into a 250-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed [(6-bromopyridin-3-yl)methyl]dimethylamine (3.5 g, 16.27 mmol) in THF (30 mL). This was followed by the addition of n-BuLi (7.2 mL, 17.9 mmol, 2.5 M) dropwise with stirring at −78° C. in 30 min. To this was bubbled SO.sub.2 at −78° C. for 15 min. The resulting solution was stirred for 1 h at −78° C. The resulting mixture was concentrated under vacuum. The crude product the title compound (4.0 g) was used in the next step directly without further purification.

Step 3: 5-((Dimethylamino)methyl)pyridine-2-sulfonyl chloride

(1735) Into a 250 mL round-bottom flask, was placed 5-[(dimethylamino)methyl]pyridine-2-sulfinic acid (4.0 g crude) and THF (25 mL) at RT. To a stirred solution was added NCS (4 g, 0.03 mmol) in portions at 0° C. The resulting solution was stirred for 1.5 h at RT. The resulting mixture was used in the next step with no workup.

Step 4: 5-((Dimethylamino)methyl)pyridine-2-sulfonamide

(1736) Into a 250 mL round-bottom flask, were added 5-[(dimethylamino)methyl]pyridine-2-sulfonyl chloride (crude from previous step) at RT. To this was bubbled NH.sub.3 (g) for 10 min at 0° C. The resulting mixture was stirred for 1 h at 0° C. The residue was purified by reverse-phase flash chromatography with the following conditions (column, C.sub.18 silica gel; mobile phase, MeCN in water, 10% to 50% gradient in 10 min; detector, UV 254 nm.) to afford the title compound (1.2 g, 32.7%) as a yellow solid. MS-ESI: 216 [M+1]

Step 5: N-(tert-butyldimethylsilyl)-5-((dimethylamino)methyl)pyridine-2-sulfonamide

(1737) Into a 100 mL round-bottom flask, were added 5-[(dimethylamino)methyl]pyridine-2-sulfonamide (700 mg, 3.25 mmol) in THF (15 mL) at 0° C. To this stirred solution was added NaH (60% wt. oil dispersion, 260 mg, 6.5 mmol) in portions at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 15 min at 0° C. under nitrogen atmosphere. Then TBSCl (980 mg, 6.5 mmol) was added to the above reaction mixture. After the addition was complete, the resulting mixture was stirred for 2 h at RT. The reaction was quenched by the addition of water/ice (10 mL) at 0° C. The resulting mixture was extracted with ethyl acetate (3×20 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The crude title compound (1.15 g) was used in the next step directly without further purification. MS-ESI: 330 [M+1].

Step 6: N′-(tert-butyldimethylsilyl)-5-((dimethylamino)methyl)pyridine-2-sulfonimidamide

(1738) Into a 250 mL 3-necked round-bottom flask, was added PPh.sub.3Cl.sub.2 (5.89 g, 13.9 mmol) in CHCl.sub.3 (18 mL). To this stirred solution was added DIEA (3.61 g, 27.9 mmol) dropwise at 0° C. under nitrogen atmosphere. The resulting mixture was stirred for 15 min at 0° C. under nitrogen atmosphere. Then N-(tert-butyldimethylsilyl)-5-[(dimethylamino)methyl]pyridine-2-sulfonamide (1.15 g, 3.49 mmol) in CHCl.sub.3 (3 mL) was added to the above resulting mixture dropwise at 0° C. under nitrogen atmosphere. After the addition was complete the resulting mixture was stirred for 30 min. Then NH.sub.3 (g) in DCM (40 mL) was added to the resulting mixture. The resulting mixture was stirred overnight. The resulting mixture was filtered, the filter cake was washed with ethyl acetate (3×20 mL). The filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (ethyl acetate/methanol 100:1) to afford the title compound (600 mg, 52.3%) as a yellow solid. MS-ESI: 329 (M+1).

(1739) ##STR00626##

(1740) ##STR00627##

N′-(tert-butoxycarbonyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

Step 1: 2-(Thiazol-2-yl)propan-2-ol

(1741) Into a 10-L 4-necked round-bottom flask purged with and maintained under nitrogen was placed a solution of 1-(thiazol-2-yl)ethanone (200 g, 1.6 mol) in THF (4 L). This was followed by the addition of MeMgBr (3 M in THF, 942 mL) dropwise with stirring at 0° C. The mixture was stirred at 0° C. for 2 h. After warmed the mixture to RT, the solution was stirred for an additional 16 h. Then the reaction was quenched by the addition of 3 L of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×1 L of ethyl acetate. The organic layers were combined and dried over anhydrous Na.sub.2O.sub.4, then concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:3 to 1:1). This resulted in 210 g (93%) of the title compound as brown oil. MS-ESI: 144.0 (M+1). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 7.68 (d, J=3.2 Hz, 1H), 7.54 (d, J=3.2 Hz, 1H), 5.94 (s, 1H), 1.51 (s, 6H).

Step 2: Lithium 2-(2-hydroxypropan-2-yl)thiazole-5-sulfinate

(1742) Into a 10-L 4-necked round-bottom flask purged with and maintained under nitrogen, was placed a solution of 2-(thiazol-2-yl)propan-2-ol (50 g, 349 mmol) in THF (1.5 L). This was followed by the addition of n-BuLi (2.5 M in hexane, 350 mL) dropwise with stirring at −78° C. The mixture was stirred at −78° C. for 1 h. Then SO.sub.2 was bubbled into the mixture for 15 min below −30° C. The mixture was stirred for an additional 1 h at RT and then was concentrated under vacuum. This resulted in 87 g (crude) of the title compound as a light yellow solid. The crude product was used directly in the next step.

Step 3: Methyl 2-(2-hydroxypropan-2-yl)thiazole-5-sulfinate

(1743) Into a 2-L 3-necked round-bottom flask, lithium 2-(2-hydroxypropan-2-yl)thiazole-5-sulfinate (87 g, crude) was dissolved in anhydrous MeOH (500 mL). Then SOCl.sub.2 (43 g, 360 mmol) was added to the mixture dropwise with stirring at 0° C. The mixture was stirred overnight at RT and then was concentrated under vacuum. The residue was diluted with 500 mL of ethyl acetate. The resulting solution was washed with 2×200 mL of water and 2×200 mL of brine. The organic phase was dried over anhydrous Na.sub.2O.sub.4, then concentrated under vacuum. This resulted in 72 g (crude) title compound as light yellow oil. The crude product was used directly in the next step. MS-ESI: 222[M+1]. .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.15 (s, 1H), 6.32 (s, 1H), 3.65 (s, 3H), 1.53 (d, J=2.0 Hz, 6H).

Step 4: 2-(2-Hydroxypropan-2-yl)thiazole-5-sulfinamide

(1744) Into a 10-L 4-necked round-bottom flask purged with and maintained under nitrogen, was placed a solution of methyl 2-(2-hydroxypropan-2-yl)thiazole-5-sulfinate (72 g, 326 mmol) in THF (500 mL). Then to the above NH.sub.3 (0.5 M in THF, 2.0 L) was added. After cooling to −78° C., LiHMDS (1 M in THF, 2.0 L) was added to the mixture dropwise with stirring. Then the mixture was stirred at −78° C. for 2 h. The reaction was quenched by the addition of 500 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×300 mL of ethyl acetate. The organic layers were combined, dried over anhydrous Na.sub.2O.sub.4, then concentrated under vacuum. This resulted in 32 g (crude) title compound as brown oil. The crude product was used directly in the next step. MS-ESI: 207 [M+1]. .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 7.77 (s, 1H), 6.73 (s, 2H), 6.17 (s, 1H), 1.51 (d, J=1.4 Hz, 6H).

Step 5: Tert-butyl 2-(2-hydroxypropan-2-yl)thiazol-5-ylsulfinylcarbamate

(1745) Into a 1-L 3-necked round-bottom flask purged with and maintained under nitrogen, was placed a solution of 2-(2-hydroxypropan-2-yl)thiazole-5-sulfinamide (32 g, crude) in THF (300 mL). This was followed by the addition of LDA (2 M in THF, 116 mL) dropwise with string at 0° C. The mixture was stirred at 0° C. for 1 h, then (Boc).sub.2O (33.8 g, 155 mmol) was added in portions at 0° C. The mixture was warmed to RT and stirred for an additional 2 h. The reaction was quenched with 200 mL of ice-water (200 mL), and the pH value of the solution was adjusted to 6 with HCOOH. The resulting solution was extracted with 3×200 mL of ethyl acetate. The organic layers were combined, dried over anhydrous Na.sub.2O.sub.4, and then concentrated under vacuum. The residue was eluted from silica gel with a gradient of ethyl acetate/petroleum ether (1:2 to 1:1). This resulted in 19 g (18%, 4 steps) title compound as a white solid. MS-ESI: 307 [M+1].

Step 6: N-(tert-butyldimethylsilyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidamide

(1746) Into a 1-L 3-necked round-bottom flask purged with and maintained under nitrogen, tert-butyl 2-(2-hydroxypropan-2-yl)thiazol-5-ylsulfinylcarbamate (19 g, 62 mmol) was dissolved in freshly distilled ACN (200 mL). Then to the above solution was added NCS (9.8 g, 74 mmol) in portions. The mixture was stirred for 1 h at RT and then NH.sub.3 was bubbled in the mixture for 15 min. The mixture was stirred at RT for 2 h and then was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with a gradient of ethyl acetate/petroleum ether (1:2 to 1:1). This resulted in 13 g (65%) of the title compound as a white solid. MS-ESI: 322 [M+1]. .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 7.99 (s, 1H), 7.72 (s, 2H), 6.29 (s, 1H), 1.49 (d, J=2.0 Hz, 6H), 1.27 (s, 9H).

(1747) ##STR00628##

(1748) ##STR00629##

N′-(tert-butyldimethyl silyl)-1-isopropyl-1H-pyrazole-3-sulfonimidamide

Step 1: 1-Isopropyl-3-nitro-1H-pyrazole

(1749) Into a 250-mL round-bottom flask, was placed a solution of 3-nitro-1H-pyrazole (10 g, 88.4 mmol) in DMF (100 mL). This was followed by the addition of NaH (60% wt. oil dispersion, 3.9 g, 97.5 mmol) in portions at 0° C. The resulting solution was stirred for 0.5 h at 0° C. This was followed by the addition of 2-bromopropane (14.1 g, 114.6 mmol) dropwise with stirring at 0° C. in 10 min. The resulting solution was stirred for 16 h at RT and then was quenched by the addition of 100 mL of water. The resulting solution was extracted with 3×100 mL of ethyl acetate. The organic layers were combined and dried over anhydrous Na.sub.2O.sub.4, and then concentrated under vacuum. The residue was eluted from silica gel and eluted with a gradient of ethyl acetate/petroleum ether (1:5 to 1:3). This resulted in 11.8 g (86%) of the title compound as yellow oil. MS-ESI: 156.1 (M+1).

Step 2: 3-Amino-1-(propan-2-yl)-1H-pyrazole

(1750) Into a 250-mL round-bottom flask, was placed a solution of 1-isopropyl-3-nitro-1H-pyrazole (10.8 g, 69.6 mmol) in MeOH (100 mL). Then Pd/C (10% wt., 1.5 g) was added. The flask was evacuated and flushed three times with hydrogen. The mixture was stirred for 24 h at RT under an atmosphere of hydrogen. The solids were filtered out. The resulting filtrate was concentrated under vacuum. This resulted in 7.27 g (83%) of the title compound as yellow oil. MS-ESI: 126.1 (M+1).

Step 3: 1-isopropyl-1H-pyrazole-3-sulfonyl chloride

(1751) Into a 1 L round-bottom flask, was placed a solution of 3-amino-1-(propan-2-yl)-1H-pyrazole (10 g, 80 mmol) in aq. HCl (6 N, 200 mL). This was followed by the addition of a solution of NaNO.sub.2 (8.28 g, 120 mmol) in water (20 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 30 min at 0° C. The above mixture was added to a saturated solution of SO.sub.2 in AcOH (200 mL) dropwise with stirring at 0° C. Then to the above was added CuCl.sub.2 (10.8 g, 80.7 mmol). The resulting solution was stirred for 1 h at RT and was then quenched by the addition of 200 mL of water. The resulting solution was extracted with 3×200 mL of DCM. The organic layers were combined, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under vacuum. This resulted in 10 g (59.8%) of the title compound as yellow oil. The product was used in the next step without further purification.

Step 4: 1-isopropyl-1H-pyrazole-3-sulfonamide

(1752) Into a 1000 mL round bottom flask, was placed a solution of 1-isopropyl-1H-pyrazole-3-sulfonyl chloride (10 g, 47.8 mmol) in DCM (50 mL). This was followed by the addition of a saturated solution of ammonia in DCM (500 mL) in portions with stirring at 0° C. The resulting solution was stirred for 1 h at 0° C. The resulting solution was concentrated and the residue was purified with SiO.sub.2-gel column and eluted with ethyl acetate/petroleum ether (1:2 to 1:1). This resulted in 8.13 g (90%) of the title compound as yellow solid. MS-ESI: 190 [M+1].

(1753) Steps 5-6 used similar procedures for converting compound 147″ to Intermediate 33 shown in Scheme 28 to afford compound intermediate 35 from compound 159″. MS-ESI: 303 (M+1).

(1754) Schemes for phenylacetic acids Intermediates: Schemes 31-47 illustrate the preparation of phenylacetic acid intermediates.

(1755) ##STR00630##

(1756) ##STR00631##

2-(3-Cyano-2,6-diisopropylphenyl)acetic acid

Step 1: 3-Amino-2,4-dibromo-6-chlorobenzonitrile

(1757) Into a 500-mL round-bottom flask, was placed 5-amino-2-chlorobenzonitrile (10 g, 65.7 mmol) in ACN (200 mL). To the stirred solution was added NBS (29 g, 162 mmol) in portions. The resulting solution was stirred for 14 h at RT. The resulting mixture was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:15 to 1:5). This resulted in 18 g of the title compound as a yellow solid. MS-ESI: 308/310 (M+1).

Step 2: 3-Amino-6-chloro-2,4-di(prop-1-en-2-yl)benzonitrile

(1758) Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-amino-2,4-dibromo-6-chlorobenzonitrile (15 g, 48.0 mmol) in dioxane (200 mL) and H.sub.2O (20 mL), 2-(tetramethyl-1,3,2-dioxaborolan-2-yl)prop-2-en-1-ylium (18.5 g, 111 mmol), Cs.sub.2CO.sub.3 (47 g, 144 mmol) and Pd(dppf)Cl.sub.2 (1.5 g). The resulting solution was stirred for 14 h at 100° C. in an oil bath. The resulting mixture was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:0 to 1:25). This resulted in 10 g of the title compound as brown oil. MS-ESI: 233 (M+1).

Step 3: 3-Amino-2,4-diisopropylbenzonitrile

(1759) Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-amino-6-chloro-2,4-bis(prop-1-en-2-yl)benzonitrile (10 g, 43 mmol) in methanol (50 mL), to the stirred solution was added Pd/C (10% wt., 2 g). The flask was evacuated and filled three times with hydrogen. The resulting solution was stirred overnight at RT. The solids were filtered out. The resulting mixture was concentrated under vacuum. This resulted in 8 g of the title compound as brown oil. MS-ESI: 203 (M+1).

Step 4: 3-Bromo-2,4-diisopropylbenzonitrile

(1760) Into a 250-mL round-bottom flask, was placed 3-amino-2,4-bis(propan-2-yl)benzonitrile (8 g, 39.5 mmol) in ACN (150 mL), to the stirred solution was added CuBr (11.3 g, 79.1 mmol) and tert-butyl nitrite (8.2 g, 79.1 mmol). The resulting solution was stirred for 3 h at 60° C. in an oil bath. The resulting mixture was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:50). This resulted in 4.2 g (39.90%) of the title compound as purple oil. MS-ESI: 266/268[M+1]

Step 5: Tert-butyl 2-(3-cyano-2,6-diisopropylphenyl)acetate

(1761) Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-bromo-2,4-bis(propan-2-yl)benzonitrile (3.1 g, 11.6 mmol) in THF (100 mL), to the stirred solution was added Xphos (555.2 mg, 1.16 mmol), Pd.sub.2(dba).sub.3 (533.2 mg, 0.58 mmol) and tert-butyl 2-(bromozincio)acetate (7.6 g, 29.12 mmol). The resulting solution was stirred for 3 h at 65° C. in an oil bath. The resulting mixture was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:50). This resulted in 3.0 g (85.5%) of the title compound as purple oil. MS-ESI: 302 [M+1].

Step 6: 2-(3-Cyano-2,6-diisopropylphenyl)acetic acid

(1762) Into a 100-mL round-bottom flask, was placed tert-butyl 2-[3-cyano-2,6-bis(propan-2-yl)phenyl]acetate (3.4 g, 11.28 mmol) in DCM (15 mL), to the stirred solution was added TFA (15 mL). The resulting solution was stirred for 3 h at RT. The resulting mixture was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:3). This resulted in 2.6 g (93.9%) of the title compound as a light yellow solid. MS-ESI: 246 [M+1].

(1763) TABLE-US-00015 TABLE 13 The Intermediates in the following Table were prepared using the similar procedures for converting compound 161″ to Intermediate 36 shown in Scheme 31 from appropriated starting materials. Exact Mass Intermediate # Structure IUPAC Name [M − H].sup.− Intermediate 37 embedded image 2-(3-fluoro-2,6- diisopropylphenyl)acetic acid 237 Intermediate 38 embedded image 2-(6-cyano-2,4-diisopropylpyridin- 3-yl)acetic acid 247

(1764) ##STR00634## ##STR00635##

(1765) ##STR00636##

2-(3-Fluoro-2,6-diisopropyl-4-(methoxymethyl)phenyl)acetic acid

Step 1: (2-Fluoro-4-nitrophenyl)methanol

(1766) Into a 500-mL round-bottom flask, was placed methyl 2-fluoro-4-nitrobenzoate (10 g, 50.2 mmol) in methanol (100 mL). This was followed by the addition of NaBH.sub.4 (9.5 g, 251 mmol) in portions over 30 min. The resulting solution was stirred for 4 h at RT. The resulting solution was diluted with 400 mL of ethyl acetate. The resulting mixture was washed with 200 mL of water and 200 mL of brine. The organic layer was dried over anhydrous sodium sulfate and then concentrated. This resulted in 3.6 g of the title compound as an off white solid. MS-ESI: 172 (M+1).

Step 2: 2-Fluoro-1-(methoxymethyl)-4-nitrobenzene

(1767) Into a 50-mL round-bottom flask, was placed (2-fluoro-4-nitrophenyl)methanol (3.6 g, 21.0 mmol) in DMSO (10 mL). To the stirred solution was added KOH (4.72 g, 84.2 mmol) in portions and MeI (11.9 g, 84.1 mmol) dropwise at RT. The resulting solution was stirred for overnight at RT. The reaction was then quenched by the addition of water. The resulting solution was extracted with 200 mL of dichloromethane. The organic layers were combined and washed with 200 mL of brine. Then the organic layer was dried over anhydrous sodium sulfate and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:1) to give the title compound as 2.1 g yellow solid. MS-ESI: 186 (M+1).

Step 3: 3-Fluoro-4-(methoxymethyl)aniline

(1768) Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-fluoro-1-(methoxymethyl)-4-nitrobenzene (2.4 g, 12.9 mmol) in methanol (50 mL), to the stirred solution was added Pd/C (10% wt. oil dispersion, 240 mg). The flask was evacuated and filled three times with hydrogen. The resulting solution was stirred overnight at RT. The solids were filtered out. The resulting mixture was concentrated under vacuum. The resulting mixture was concentrated to give the title compound as 2.4 g yellow solid. MS-ESI: 156 (M+1).

Step 4: 2,6-Dibromo-3-fluoro-4-(methoxymethyl)aniline

(1769) Into a 100-mL round-bottom flask, was placed 3-fluoro-4-(methoxymethyl)aniline (1.7 g, 10.96 mmol) in DCM (50 mL). This was followed by the addition of NBS (4.3 g, 12.1 mmol) in portions. The resulting solution was stirred for 1 h at RT. The reaction was then quenched by the addition of water/ice. The resulting solution was extracted with 200 mL of ethyl acetate. The resulting mixture was washed with 200 mL of water and 200 mL of brine. The organic layer was dried over anhydrous sodium sulfate and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:3) to give 4 g title compound as a yellow solid. MS-ESI: 311/313 (M+1).

Step 5: 3-Fluoro-4-(methoxymethyl)-2,6-di(prop-1-en-2-yl)aniline

(1770) Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2,6-dibromo-3-fluoro-4-(methoxymethyl)aniline (14 g, 44.7 mmol) in dioxane (200 mL) and H.sub.2O (20 mL). To the stirred solution was added 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (18.8 g, 111 mmol), Pd(dppf)Cl.sub.2 (3.27 g, 4.47 mmol) and Cs.sub.2CO.sub.3 (29.2 g, 89.5 mmol). The resulting solution was stirred for 5 h at 65° C. in an oil bath. The reaction was then quenched by the addition of 10 mL of water. The resulting solution was extracted with 3×20 ml of ethyl acetate and dried over anhydrous sodium sulfate and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:5). This resulted in 2.0 g (19.0%) of the title compound as yellow oil. MS-ESI: 236 (M+1).

Step 6: 3-Fluoro-2,6-diisopropyl-4-(methoxymethyl)aniline

(1771) Into a 100-mL round-bottom flask, was placed 3-fluoro-4-(methoxymethyl)-2,6-bis(prop-1-en-2-yl) aniline (2.0 g, 8.50 mmol) in methanol (20 mL). To the stirred solution was added Pd/C (10% wt., 200 mg). The flask was evacuated and filled three times with hydrogen. The resulting solution was stirred 5 h at RT. The solids were filtered out. The resulting filtrate was concentrated under vacuum. This resulted in 1.8 g (88.5%) of the title compound as yellow oil. MS-ESI: 240 (M+1).

Step 7: 2-Bromo-4-fluoro-1,3-diisopropyl-5-(methoxymethyl)benzene

(1772) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-fluoro-4-(methoxymethyl)-2,6-bis(propan-2-yl)aniline (1.0 g, 4.18 mmol) in CH.sub.3CN (30 mL). To the above solution was added CuBr (2.4 g, 16.7 mmol) and t-BuONO (−1.72 g, 16.7 mmol) with stirring. The resulting solution was stirred for 3 h at 65° C. in an oil bath. The reaction was then quenched by the addition of 20 mL of water. The resulting solution was extracted with 3×20 ml of ethyl acetate and dried over anhydrous sodium sulfate and concentrated. The residue was eluted from silica gel with petroleum ether. This resulted in 500 mg (39.4%) of the title compound as a yellow solid. MS-ESI: 303/305 [M+1].

Step 8: Tert-butyl 2-(3-fluoro-2,6-diisopropyl-4-(methoxymethyl)phenyl)acetate

(1773) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of argon, was placed 2-bromo-4-fluoro-5-(methoxymethyl)-1,3-bis(propan-2-yl)benzene (1.0 g, 3.30 mmol) in THF (40 mL). To the stirred solution was added tert-butyl 2-(bromozincio)acetate (2.58 g, 9.89 mmol), Pd.sub.2(dba).sub.3CHCl.sub.3 (170 mg, 0.16 mmol), and Xphos (157 mg, 0.33 mmol). The resulting solution was stirred for 3 h at 65° C. in an oil bath. The reaction was then quenched by the addition of 20 mL of water. The resulting solution was extracted with 3×30 ml of DCM and dried over anhydrous sodium sulfate and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:20). This resulted in 200 mg (17.9%) of the title compound as yellow oil. MS-ESI: 339 [M+1].

Step 9: 2-(3-Fluoro-2,6-diisopropyl-4-(methoxymethyl)phenyl)acetic acid

(1774) Into a 50-mL round-bottom flask, was placed tert-butyl 3-fluoro-4-(methoxymethyl)-2,6-bis(propan-2-yl)benzoate (300 mg, 0.92 mmol) in DCM (6 mL), to the stirred solution was added TFA (2 mL). The resulting solution was stirred for 2 h at RT. The resulting mixture was concentrated. The residue was eluted from silica gel with DCM/methanol (1:20). This resulted in 170 mg of the title compound as yellow oil. MS-ESI: 281 (M−1).

(1775) TABLE-US-00016 TABLE 14 The Intermediates in the following Table were prepared using the similar procedures for converting compound 167″ to Intermediate 39 shown in Scheme 32 from appropriated starting materials. Exact Mass Intermediate # Structure IUPAC Name [M − H].sup.− Intermediate 40 embedded image 2-(4-cyano-3-fluoro-2,6- diisopropylphenyl)acetic acid 262 Intermediate 41 embedded image 2-(3,4-difluoro-2,6- diisopropylphenyl)acetic acid 255 Intermediate 42 embedded image 2-(4,6-diisopropyl-1,3- dihydroisobenzofuran-5-yl)acetic acid 261 Intermediate 43 0embedded image 2-(4,6-diisopropyl-2,3-dihydro-1H- inden-5-yl)acetic acid 259

(1776) ##STR00641##

(1777) ##STR00642##

Tert-butyl 2-(4-bromo-2,6-diisopropylphenyl)acetate

Step 1: 5-Bromo-2-iodo-1,3-diisopropylbenzene

(1778) Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 4-bromo-2,6-bis(propan-2-yl)aniline (5 g, 19.6 mmol) in HCl (6 M, 60 mL). This was followed by the addition of a solution of NaNO.sub.2 (2.5 g, 36.3 mmol) in water (5 mL) dropwise with stirring at −10° C. The resulting solution was stirred for 30 min at −10° C. Then to the above was added KI (11 g, 66.3 mmol). The resulting solution was stirred for 1 h at RT. The reaction was then quenched by the addition of 100 mL of water. The resulting solution was extracted with 2×200 mL of ethyl acetate and the organic layers combined. The residue was eluted from silica gel with ethyl acetate/petroleum ether (0/1). This resulted in 5.95 g (83.0%) of the title compound as a brown liquid. MS-ESI: 366/368 (M+1).

Step 2: Tert-butyl 2-(4-bromo-2,6-diisopropylphenyl)acetate

(1779) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 5-bromo-2-iodo-1,3-bis(propan-2-yl)benzene (2.0 g, 5.45 mmol) in THF (50 mL). To the stirred solution was added Pd.sub.2(dba).sub.3 (504 mg, 0.55 mmol), Xphos (262 mg, 0.55 mmol) and tert-butyl 2-(bromozincio)acetate (2.13 g, 8.66 mmol). The resulting solution was stirred for 30 min at RT. The resulting solution was allowed to react with stirring for an additional 3 h at 60° C. The resulting mixture was concentrated. The residue was eluted from silica gel with petroleum ether. This resulted in 360 mg (18.6%) of the title compound as a solid. MS-ESI: 355/357 (M+1).

(1780) ##STR00643##

2-(2,6-diisopropyl-4-(1H-pyrazol-1-yl)phenyl)acetic acid

Step 3: Tert-butyl 2-(2,6-diisopropyl-4-(1H-pyrazol-1-yl)phenyl)acetate

(1781) Into a 50-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a mixture of tert-butyl 2-(4-bromo-2,6-diisopropylphenyl)acetate (360 mg, 1.01 mmol) in dioxane (10 mL). To the stirred solution was added 1H-pyrazole (275 mg, 4.04 mmol), copper(I) iodide (76 mg, 0.40 mmol) and potassium phosphate (642 mg, 3.03 mmol). To the above (1R,2R)-cyclohexane-1,2-diamine (0.05 mL, 0.40 mmol) was added dropwise. The resulting solution was refluxed overnight. The reaction was then concentrated and the residue was eluted from silica gel with ethyl acetate/petroleum ether (1:20). This resulted in 120 mg (35%) of the title compound as a yellow oil. MS-ESI: 342.2 (M+1).

Step 4: 2-(2,6-Diisopropyl-4-(1H-pyrazol-1-yl)phenyl)acetic acid

(1782) Into a 50-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, was placed a solution of tert-butyl 2-(2,6-diisopropyl-4-(1H-pyrazol-1-yl)phenyl)acetate (120 mg, 0.35 mmol) in TFA (10 mL). The resulting solution was stirred overnight at RT. The reaction was then concentrated and used in the next step without purification. MS-ESI: 286.2 (M+1).

(1783) TABLE-US-00017 TABLE 15 The Intermediates in the following Table were prepared using the similar procedures for converting compound 176″ to Intermediate 44 shown in Scheme 33 from appropriated starting materials. Exact Mass Intermediate # Structure IUPAC Name [M + H].sup.+ Intermediate 46 embedded image tert-butyl 2-(4-chloro-2,6- diisopropylphenyl)acetate 311

(1784) ##STR00645##

(1785) ##STR00646##

2-(4-(Isochroman-7-yl)-2,6-diisopropylphenyl)acetic acid

Step 1: Tert-butyl 2-(2,6-diisopropyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)acetate

(1786) Into a 50-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed tert-butyl 2-[4-chloro-2,6-bis(propan-2-yl)phenyl]acetate (310 mg, 1.00 mmol) in dioxane (10 mL). To the stirred solution was added 4,4,4′,4′,5,5,5′,5′-octamethyl-2,2′-bi(1,3,2-dioxaborolane) (508 mg, 2.0 mmol). KOAc (195 mg, 1.99 mmol), Xphos (95.1 mg, 0.20 mmol) Pd.sub.2(dba).sub.3 (91.3 mg, 0.10 mmol). The resulting solution was stirred for 16 h at 90° C. in an oil bath under nitrogen. Then the mixture was concentrated and the residue was eluted from silica gel with ethyl acetate/petroleum ether (1:20). This resulted in 400 mg (99.7%) of the title compound as a crude solid. MS-ESI:403 (M+1).

Step 2: Tert-butyl 2-(4-(isochroman-7-yl)-2,6-diisopropylphenyl)acetate

(1787) Into a 50-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed tert-butyl 2-(2,6-diisopropyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)acetate (402 mg, 1.00 mmol) in dioxane (10 mL) and H.sub.2O (2.5 mL). To the stirred solution was added Cs.sub.2CO.sub.3 (652.0 mg, 2.00 mmol), 7-bromo-3,4-dihydro-1H-2-benzopyran (212.9 mg, 1.00 mmol) and Pd(dppf)Cl.sub.2 (73.1 mg, 0.10 mmol). The resulting solution was stirred for 4 h at 80° C. in an oil bath. The resulting solution was diluted with 20 mL of ethyl acetate. The resulting mixture was washed with 2×20 mL of H.sub.2O and 2×20 mL of brine. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:10). This resulted in 300 mg (73.4%) of the title compound as a light brown solid. MS-ESI: 409 (M+1).

Step 3: 2-(4-(Isochroman-7-yl)-2,6-diisopropylphenyl)acetic acid

(1788) Into a 25-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed tert-butyl 2-[4-(3,4-dihydro-1H-2-benzopyran-7-yl)-2,6-bis(propan-2-yl)phenyl]acetate (300 mg, 0.73 mmol) in DCM (4 mL) and TFA (1 mL). The resulting solution was stirred for 16 h at RT. The resulting mixture was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:2). This resulted in 80 mg (30.9%) of the title compound as a light brown solid. MS-ESI: 351(M−1).

(1789) ##STR00647##

(1790) ##STR00648##

2-(2,6-Diisopropyl-4-(6-methoxynaphthalen-2-yl)phenyl)acetic acid

Step 1: 2-(6-Methoxynaphthalen-2-yl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane

(1791) Into a 50-mL round-bottom flask, was placed 2-bromo-6-methoxynaphthalene (115 mg, 0.49 mmol) in dioxane (5 mL), to the stirred solution was added potassium acetate (175 mg, 1.27 mmol), 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2-dioxaborolane (113 mg, 0.45 mmol) and Pd(PPh.sub.3).sub.2Cl.sub.2 (9 mg). The resulting solution was stirred for 10 h at 110° C. The resulting solution was extracted with 3×20 mL of ethyl acetate and dried over anhydrous sodium sulfate. The solids were filtered out. The resulting mixture was concentrated under vacuum. This resulted in 120 mg of the title compound as an off-white solid. MS-ESI: 285 (M+1).

Step 2: 2-(2,6-Diisopropyl-4-(6-methoxynaphthalen-2-yl)phenyl)acetic acid

(1792) Into a 50-mL round-bottom flask, was placed 2-(6-methoxynaphthalen-2-yl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (100 mg) in dioxane (15 mL) and H.sub.2O (1.5 mL), to the stirred solution was added Cs.sub.2CO.sub.3 (344 mg), Pd(dppf)Cl.sub.2 (27.5 mg), 2-[4-bromo-2,6-bis(propan-2-yl)phenyl]acetic acid (125 mg). The resulting solution was stirred for 15 h at 80° C. The resulting mixture was concentrated under vacuum. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:3). This resulted in 90 mg (58.9%) of the title compound as a yellow solid. MS-ESI: 433 (M+1).

Step 3: 2-(2,6-Diisopropyl-4-(6-methoxynaphthalen-2-yl)phenyl)acetic acid

(1793) Into a 50-mL round-bottom flask, was placed tert-butyl 2-[4-(6-methoxynaphthalen-2-yl)-2,6-bis(propan-2-yl)phenyl]acetate (80 mg, 0.18 mmol) in DCM (5 mL) and TFA (2.0 mL). The resulting solution was stirred for 1 h at RT. The resulting mixture was concentrated. This resulted in 80 mg (crude) of the title compound as a light yellow solid. MS-ESI: 377 [M+1]

(1794) ##STR00649##

(1795) ##STR00650##

2-(2,6-Diisopropyl-4-(naphthalen-2-yl)phenyl)acetic acid

Step 1: 4-Bromo-2,6-diisopropylaniline

(1796) Into a 250-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2,6-bis(propan-2-yl)aniline (20 g, 56.4 mmol) in DMF (200 mL), to the stirred solution was added NBS (20.1 g, 112 mmol). The resulting solution was stirred for 6 h at RT. The resulting mixture was washed with 100 ml of water. The resulting solution was extracted with 3×100 ml of ethyl acetate dried over anhydrous sodium sulfate. The solids were filtered out. The resulting mixture was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:1). This resulted in 16 g (55.3%) of the title compound as a white solid. MS-ESI: 256/258 (M+1).

Step 2: 2,6-Biisopropyl-4-(naphthalen-2-yl)aniline

(1797) Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of 4-bromo-2,6-bis(propan-2-yl)aniline (10 g, 39.0 mmol) in dioxane (250 mL) and H.sub.2O (25 mL). To the stirred solution was added 4,4,5,5-tetramethyl-2-(naphthalen-2-yl)-1,3,2-dioxaborolane (11.9 g, 46.8 mmol), Pd(dppf)Cl.sub.2 (7.81 g, 7.8 mmol) and Cs.sub.2CO.sub.3 (25.4 g, 78.1 mmol). The resulting solution was stirred for 10 min at RT. The resulting solution was then allowed to react for an additional 19 h at 80° C. The resulting mixture was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:1). This resulted in 6.5 g (54.9%) of the title compound as a red solid. MS-ESI: 304 (M+1).

Step 3: 2-(4-Bromo-3,5-diisopropylphenyl)naphthalene

(1798) Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of 4-(naphthalen-2-yl)-2,6-bis(propan-2-yl)aniline (6.0 g, 19.8 mmol) in ACN (100 mL). To the stirred solution was added tert-butyl nitrite (4.08 g, 39.5 mmol) and CuBr (5.67 g, 39.5 mmol). The resulting solution was stirred for 30 min at RT. The resulting solution was allowed to react with stirring for an additional 180 min at 60° C. The mixture was concentrated and the residue was eluted from silica gel with PE. This resulted in 105 mg (17.3%) of the title compound as a red solid. MS-ESI: 367/369 (M+1).

Step 4: Tert-butyl 2-(2,6-diisopropyl-4-(naphthalen-2-yl)phenyl)acetate

(1799) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of 2-[4-bromo-3,5-bis(propan-2-yl)phenyl]naphthalene (2 g, 5.44 mmol) in THF (50 mL), to the above solution was added XPhos (0.3 g, 0.54 mmol), and Pd.sub.2(dba).sub.3CH.sub.2Cl.sub.2 (0.2 g, 0.27 mmol). The resulted solution was stirred for 15 min at RT. Then to the mixture was added tert-butyl 2-(bromozincio)acetate (2.8 g, 10.9 mmol) with stirring. The resulting solution was allowed to react for an additional 180 min at 65° C. The residue was eluted from silica gel with PE. This resulted in 1.0 g (45.6%) of the title compound as a yellow solid. MS-ESI: 403 (M+1).

Step 5: 2-(2,6-Diisopropyl-4-(naphthalen-2-yl)phenyl)acetic acid

(1800) Into a 250-mL round-bottom flask, was placed tert-butyl 2-[4-(naphthalen-2-yl)-2,6-bis(propan-2-yl)phenyl]acetate (2.48 g, 6.16 mmol) in TFA (20 mL) and DCM (20 mL). The resulting solution was stirred for 5 h at RT. Then the mixture was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (13/100). This resulted in 1.68 g (78.5%) of the title compound as a yellow solid. MS-ESI: 347 (M+1).

(1801) TABLE-US-00018 TABLE 16 The Intermediates in the following Table were prepared using the similar procedures for converting compound 184″ to Intermediate 49 shown in Scheme 36 from appropriated starting materials. Intermediate Exact Mass # Structure IUPAC Name [M − H].sup.− Intermediate 50 embedded image 2-(3′,4′-dichloro-3,5-diisopropyl- [1,1′-biphenyl]-4-yl)acetic acid 363 Intermediate 51 embedded image 2-(4-(2,2- difluorobenzo[d][1,3]dioxol-5-yl)- 2,6-diisopropylphenyl)acetic acid 375 Intermediate 52 embedded image 2-(3,5-diisopropyl-3′,4′-dimethyl- [1,1′-biphenyl]-4-yl)acetic acid 323 Intermediate 53 embedded image 2-(4-((cyclopentyloxy)methyl)-2,6- diisopropylphenyl)acetic acid 317

(1802) ##STR00655##

(1803) ##STR00656##

2-(4-Fluoro-2,6-dipropylphenyl)acetic acid

Step 1: 2,6-Diallyl-4-fluoroaniline

(1804) Into a 250-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-bromo-4-fluoro-6-(prop-2-en-1-yl)aniline (3.7 g, 16.1 mmol) in THF (100 mL), to the stirred solution was added 4,4,5,5-tetramethyl-2-(prop-2-en-1-yl)-1,3,2-dioxaborolane (8.1 g, 48.2 mmol), Cs.sub.2CO.sub.3 (15.7 g, 48.2 mmol) and Pd(dppf)Cl.sub.2 (588 mg, 0.80 mmol). The resulting solution was stirred overnight at 70° C. in an oil bath. The resulting mixture was concentrated under vacuum. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:10). This resulted in 2.6 g (84.5%) of the title compound as yellow oil. MS-ESI: 192 [M+1].

Step 2: 4-Fluoro-2,6-dipropylaniline

(1805) Into a 100-mL round-bottom flask, was placed 4-fluoro-2,6-bis(prop-2-en-1-yl)aniline (2.6 g, 13.59 mmol) in methanol (50 mL). To the stirred solution was added Pd/C (10% wt., 300 mg). The flask was evacuated and filled three times with hydrogen. The resulting solution was stirred 5 h at RT under hydrogen. The solids were filtered out. The resulting mixture was concentrated under vacuum. This resulted in 2.5 g (94.1%) of the title compound as light yellow oil. MS-ESI: 196 [M+1]

Step 3: 2-Bromo-5-fluoro-1,3-dipropylbenzene

(1806) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 4-fluoro-2,6-dipropylaniline (840 mg, 4.30 mmol) in ACN (20 mL). To the stirred solution was added CuBr (1.2 g, 8.60 mmol) and tert-butyl nitrite (888 mg, 8.61 mmol). The resulting solution was stirred for 3 h at 60° C. in an oil bath. The resulting mixture was concentrated under vacuum. The residue was eluted from silica gel with petroleum ether. This resulted in 640 mg (57.4%) of the title compound as light yellow oil. MS-ESI: [M+1].

Step 4: Tert-butyl 2-(4-fluoro-2,6-dipropylphenyl)acetate

(1807) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-bromo-5-fluoro-1,3-dipropylbenzene (460 mg, 1.77 mmol) in THF (10 mL). To the mixture was added Xphos (85 mg, 0.18 mmol) and Pd.sub.2(dba).sub.3 (82 mg, 0.09 mmol). The resulting solution was stirred for 30 min at RT. Then to the above was added tert-butyl 2-(bromozincio)acetate (1.4 g, 5.32 mmol). The resulting solution was stirred for 3 h at 65° C. in an oil bath. The reaction was then quenched by the addition of 10 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×10 mL of DCM. The organic layers were combined, dried over anhydrous sodium sulfate, and concentrated under vacuum. This resulted in 300 mg (57.4%) of the title compound as light yellow oil. MS-ESI: 295 [M+1].

Step 5: 2-(4-Fluoro-2,6-dipropylphenyl)acetic acid

(1808) Into a 50-mL round-bottom flask, was placed tert-butyl 2-(4-fluoro-2,6-dipropylphenyl)acetate (300 mg) in DCM (4 mL) and TFA (2 mL). The resulting solution was stirred for 2 h at RT. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-TLC with ethyl acetate/petroleum ether (1:3). This resulted in 165 mg (67.9%) of the title compound as a light yellow solid. MS-ESI: 239 [M+1]

(1809) TABLE-US-00019 TABLE 17 The Intermediates in the following Table were prepared using the similar procedures for converting compound 189″ to Intermediate 54 shown in Scheme 37 from appropriated starting materials. Intermediate Exact Mass # Structure IUPAC Name [M + H].sup.+ Intermediate 55 embedded image 2-(3,5-diisopropylpyridin-4- yl)acetic acid 222 Intermediate 56 embedded image 2-(5-fluoro-2,4-diisopropylpyridin- 3-yl)acetic acid 240 Intermediate 57 embedded image 2-(2-fluoro-3,5-diisopropylpyridin- 4-yl)acetic acid 240

(1810) ##STR00660##

(1811) ##STR00661##

2-(4-Fluoro-2,6-diisopropylphenyl)propanoic acid

Step 1: Methyl 2-(4-fluorophenyl)propanoate

(1812) Into a 100-mL round-bottom flask, was placed a solution of 2-(4-fluorophenyl)propanoic acid (2 g, 11.89 mmol) in methanol (20 mL). To the mixture conc. H.sub.2SO.sub.4 (0.05 mL) was added. The resulting solution was stirred for 16 h at 85° C. The reaction was then quenched by the addition of 100 mL of water. The resulting solution was extracted with 3×50 mL of dichloromethane and the organic layers combined. The solids were filtered out. The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. This resulted in 2.1 g (97%) of the title compound as yellow oil. MS-ESI: 183 [M+1].

Step 2: Methyl 2-(2,6-dibromo-4-fluorophenyl)propanoate

(1813) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of methyl 2-(4-fluorophenyl)propanoate (1.7 g, 9.33 mmol) in CHCl.sub.3 (20 mL). To the stirred solution was added Fe powder (0.21 g) and Br.sub.2 (1.92 mL). The resulting solution was stirred for 16 h at 50° C. The reaction was then quenched by the addition of 50 mL of saturated Na.sub.2S.sub.2O.sub.3 solution. The resulting solution was extracted with 3×50 mL of DCM and the organic layers were combined, dried over anhydrous sodium sulfate and concentrated under vacuum. This resulted in 1.03 g (32%) of the title compound as yellow crude oil. MS-ESI: 339/341 [M+1].

Step 3: Methyl 2-(4-fluoro-2,6-di(prop-1-en-2-yl)phenyl)propanoate

(1814) Into a 40-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, was placed a solution of methyl 2-(2,6-dibromo-4-fluorophenyl)propanoate (1.03 g, 3.03 mmol) in dioxane (10 mL) and H.sub.2O (1 mL). To the stirred solution was added Cs.sub.2CO.sub.3 (2 g, 6.14 mmol), Pd(dppf)Cl.sub.2 (230 mg, 0.31 mmol) and 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (1.07 g, 6.37 mmol). The resulting solution was stirred for 6 h at 110° C. The resulting mixture was concentrated under vacuum. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:6). This resulted in 754 mg (95%) of the title compound as yellow oil. MS-ESI: 263 [M+1].

Step 4: Methyl 2-(4-fluoro-2,6-diisopropylphenyl)propanoate

(1815) Into a 50-mL round-bottom flask purged and maintained with an inert atmosphere of H.sub.2, was placed a solution of methyl 2-[4-fluoro-2,6-bis(prop-1-en-2-yl)phenyl]propanoate (820 mg, 3.13 mmol) in methanol (20 mL). To the stirred solution was added Pd/C (10% wt., 0.2 g). The resulting solution was stirred for 4 h at RT. The solids were filtered out. The resulting mixture was concentrated under vacuum. This resulted in 700 mg (84%) of the title compound as yellow crude oil. MS-ESI: 267 [M+1].

Step 5: 2-(4-Fluoro-2,6-diisopropylphenyl)propanoic acid

(1816) Into a 40-mL sealed tube, was placed a solution of methyl 2-[4-fluoro-2,6-bis(propan-2-yl)phenyl]propanoate (300 mg, 1.13 mmol) in 6 M sodium hydroxide (3 mL) and MeOH (3 mL). The resulting solution was stirred for 3 h at 90° C. The reaction was then quenched by the addition of 50 mL of water. The pH value of the solution was adjusted to 2 with hydrogen chloride (1 M). The resulting solution was extracted with 2×50 mL of ethyl acetate and the organic layers combined. The solids were filtered out. The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. This resulted in 150 mg (53%) of the title compound as yellow oil. MS-ESI: 253 [M+1].

(1817) ##STR00662##

(1818) Steps 1-4 used similar procedures for converting compound 189″ to compound 193″ shown in Scheme 37 to afford compound 203″ from compound 199″. MS-ESI: 253 (M+1).

Step 5: 2-(2-bromo-4-fluoro-6-isopropylphenyl)acetic acid

(1819) Into a 100-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed tert-butyl 2-[4-fluoro-2-(propan-2-yl)phenyl]acetate (1.0 g, 3.96 mmol) in CHCl.sub.3 (25 mL). To the solution was added AcOH (0.01 mL), Fe powder (22.1 mg, 0.40 mmol) and Bra (3.17 g, 19.8 mmol). The resulting solution was stirred for 16 h at 50° C. in an oil bath. The reaction was then quenched by the addition of 20 mL of Na.sub.2S.sub.2O.sub.3. The resulting solution was extracted with 2×20 ml of ethyl acetate concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:2). This resulted in 700 mg (64.2%) of the title compound as a white solid. MS-ESI: 275 [M+1].

(1820) ##STR00663##

(1821) ##STR00664##

2-(4-(3-Fluorooxetan-3-yl)-2,6-diisopropylphenyl)acetic acid

Step 1: 4-Bromo-2,6-diisopropylaniline

(1822) Into a 500-mL round-bottom flask, was placed 2,6-bis(propan-2-yl)aniline (10 g, 56.4 mmol) in ACN (200 mL), to the stirred solution was added NBS (11.0 g, 62.0 mmol). The resulting solution was stirred overnight at RT. The resulting mixture was concentrated under vacuum. The residue was eluted from silica gel with petroleum ether. This resulted in 9.5 g (65.7%) of the title compound as brown oil. MS-ESI: 256/258 [M+1].

Step 2: 2, 5-Dibromo-1,3-diisopropylbenzene

(1823) Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 4-bromo-2,6-bis(propan-2-yl)aniline (6.4 g, 24.9 mmol) in ACN (200 mL). To the stirred solution was added CuBr (7.2 g, 50.2 mmol) and tert-butyl nitrite (5.2 g, 50.5 mmol). The resulting solution was stirred for 3 h at 65° C. in an oil bath. The resulting mixture was concentrated under vacuum. The residue was eluted from silica gel with petroleum ether. This resulted in 5 g (62.5%) of the title compound as light yellow oil. MS-ESI: 319/321/323 [M+1].

Step 3: 3-(4-Bromo-3,5-diisopropylphenyl)oxetan-3-ol

(1824) Into a 100-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2,5-dibromo-1,3-bis(propan-2-yl)benzene (5 g, 15.6 mmol) in THF (50 mL). This was followed by the addition of n-BuLi (2.5 M, 6.25 mL, 15.6 mmol) dropwise with stirring at −78° C. The resulting solution was stirred for 30 min at −78° C. To the above was added a solution of oxetan-3-one (1.13 g, 15.6 mmol) in THF (2 mL) dropwise with stirring at −78° C. The resulting solution was slowly warmed to RT and stirred for 2 h at RT. The reaction was then quenched by the addition of 100 mL of NH.sub.4Cl (sat.). The resulting solution was extracted with 3×100 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:3). The crude product was purified by Flash-Prep-HPLC with the following conditions: Column, C.sub.18 silica gel; mobile phase, H.sub.2O (0.1% FA) and ACN (40% to 70% ACN gradient in 30 min), Detector, UV 254/210 nm. This resulted in 1.25 g (25.5%) of the title compound as a white solid. MS-ESI: 313/315[M+1].

Step 4: 3-(4-Bromo-3,5-diisopropylphenyl)-3-fluorooxetane

(1825) Into a 50-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-[4-bromo-3,5-bis(propan-2-yl)phenyl]oxetan-3-ol (600 mg, 1.92 mmol) in DCM (10 mL). This was followed by the addition of DAST (618 mg, 3.83 mmol) dropwise with stirring at 0° C. The resulting solution was stirred overnight at RT. The reaction was then quenched by the addition of 5 mL of methanol. The resulting mixture was concentrated under vacuum. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:10). This resulted in 430 mg (71.2%) of the title compound as a white solid. MS-ESI: 315/317[M+1].

Step 5: Tert-butyl 2-(4-(3-fluorooxetan-3-yl)-2,6-diisopropylphenyl)acetate

(1826) Into a 100-mL round-bottom flask, was placed 3-[4-bromo-3,5-bis(propan-2-yl)phenyl]-3-fluorooxetane (420 mg, 1.33 mmol) in THF (20 mL), to the mixture was added Xphos (60 mg, 0.13 mmol) and Pd.sub.2(dba).sub.3 (61 mg, 0.07 mmol). The resulting solution was stirred for 30 min at RT. Then to the above was added tert-butyl 2-(bromozincio)acetate (694.0 mg, 2.66 mmol). The resulting solution was stirred for 3 h at 60° C. in an oil bath. The resulting mixture was concentrated under vacuum. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:10). resulted in 450 mg (96.3%) of the title compound as a light yellow solid. MS-ESI: 351 [M+1].

Step 6: 2-(4-(3-Fluorooxetan-3-yl)-2,6-diisopropylphenyl)acetic acid

(1827) Into a 50-mL round-bottom flask, was placed tert-butyl 2-[4-(3-fluorooxetan-3-yl)-2,6-bis(propan-2-yl) phenyl]acetate (450 mg, 1.28 mmol) in DCM (4 mL) and TFA (2 mL). The resulting solution was stirred overnight at RT. The resulting mixture was concentrated under vacuum. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:3). This resulted in 300 mg (79.3%) of the title compound as a light yellow solid. MS-ESI: 295[M+1].

(1828) ##STR00665## ##STR00666##

(1829) ##STR00667##

2-(5-Isopropyl-2,3-dihydro-1H-inden-4-yl)acetic acid

Step 1: N-(2,3-dihydro-1H-inden-4-yl)pivalamide

(1830) Into a 500-mL round-bottom flask, was placed 2,3-dihydro-1H-inden-4-amine (10 g, 75.1 mmol) in DCM (100 mL), to the stirred solution was added 2,2-dimethylpropanoyl chloride (9.05 g, 75.1 mmol) and TEA (11.4 g, 112 mmol). The resulting solution was stirred for 1 h at RT. The reaction was then quenched by the addition of 100 mL of water. The resulting solution was extracted with 3×100 ml of DCM and dried over anhydrous sodium sulfate and concentrated. This resulted in 15 g (91.9%) of the title compound as an off-white solid. MS-ESI: 218 [M+1].

Step 2: N-(5-bromo-2,3-dihydro-1H-inden-4-yl)pivalamide

(1831) Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of N-(2,3-dihydro-1H-inden-4-yl)-2,2-dimethylpropanamide (9 g, 41.5 mmol) in ACN (200 mL). To above solution was added NBS (8.86 g, 49.8 mmol). The resulting solution was stirred for 15 h at RT, after which it was extracted with 3×200 ml of DCM. The organic layers were combined, washed with 3×200 ml of aq. Na.sub.2CO.sub.3, dried over anhydrous sodium sulfate, and concentrated. This resulted in 12 g of the title compound as a brown solid. MS-ESI: 296/298 [M+1]

Step 3: 5-Bromo-2,3-dihydro-1H-inden-4-amine

(1832) Into a 500-mL round-bottom flask, was placed a solution of N-(5-bromo-2,3-dihydro-1H-inden-4-yl)-2,2-dimethylpropanamide (10 g, 33.8 mmol) in HCl (200 mL). The resulting solution was stirred for 15 h at 100° C. The reaction was then quenched by the addition of water. The resulting solution was extracted with 3×500 mL of ethyl acetate dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:10). This resulted in 7 g (97.7%) of the title compound as a brown solid. MS-ESI: 212/214[M+1].

Step 4: 5-(Prop-1-en-2-yl)-2,3-dihydro-1H-inden-4-amine

(1833) Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed a solution of 5-bromo-2,3-dihydro-1H-inden-4-amine (7 g, 33 mmol) in dioxane (250 mL) and H.sub.2O (25 mL). To the above was added 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (8.32 g, 49.5 mmol), Cs.sub.2CO.sub.3 (32.2 g, 99.0 mmol) and Pd(dppf)Cl.sub.2 (2.41 g, 3.3 mmol). The resulting solution was stirred for 15 h at 95° C. The reaction was then quenched by the addition of water. The resulting solution was extracted with 3×200 mL of DCM and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:10). This resulted in 4 g (69.9%) of the title compound as a brown solid. MS-ESI: 174 [M+1].

Step 5: 5-Isopropyl-2,3-dihydro-1H-inden-4-amine

(1834) Into a 250-mL round-bottom flask, was placed a solution of 5-(prop-1-en-2-yl)-2,3-dihydro-1H-inden-4-amine (4 g, 23.09 mmol) in methanol (100 mL), to the stirred solution was added Pd/C (10% wt., 400 mg). The flask was evacuated and flushed three times with hydrogen. The resulting solution was stirred overnight at RT under hydrogen. The solids were filtered out. The resulting mixture was concentrated under vacuum. This resulted in 4 g (98.8%) of the title compound as a brown solid. MS-ESI: 176 [M+1].

(1835) Steps 6-8 used similar procedures for converting compound 191″ to intermediate 54 shown in Scheme 37 to afford intermediate 61 from compound 215″. MS-ESI: 219 (M+1).

(1836) ##STR00668##

(1837) ##STR00669##

2-(2-Cyclopropyl-4-fluoro-6-(trifluoromethyl)phenyl)acetic acid

Step 1: 2-Bromo-4-fluoro-6-(trifluoromethyl)aniline

(1838) Into a 250-mL round-bottom flask, was placed 4-fluoro-2-(trifluoromethyl)aniline (11.6 g, 64.7 mmol) in ACN (100 mL). This was followed by the addition of NB S (12.6 mg, 71.2 mmol) in portions with stirring at 0° C. The resulting solution was stirred for 2 h at RT. The reaction was then quenched by the addition of water. The resulting solution was extracted with 3×100 mL of ethyl acetate. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:20). This resulted in 13 g (77.8%) of the title compound as a red solid. MS-ESI: 258/260 (M+1).

Step 2: 2-Cyclopropyl-4-fluoro-6-(trifluoromethyl)aniline

(1839) Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-bromo-4-fluoro-6-(trifluoromethyl)aniline (10 g, 38.7 mmol) in dioxane (200 mL) and H.sub.2O (10 mL). To the stirred solution was added K.sub.3PO.sub.4 (24.6 g, 116.2 mmol), Pd(dppf)Cl.sub.2 (2.84 g, 3.88 mmol) and cyclopropylboronic acid or ester (4.99 g, 58.1 mmol). The resulting solution was stirred for overnight at 90° C. in an oil bath. The solids were filtered out. The resulting mixture was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:20). This resulted in 7.5 g (88.2%) of the title compound as a yellow oil. MS-ESI: 220 (M+1).

Step 3: 2-Bromo-1-cyclopropyl-5-fluoro-3-(trifluoromethyl)benzene

(1840) Into a 100-mL round-bottom flask, was placed 2-cyclopropyl-4-fluoro-6-(trifluoromethyl)aniline (1.5 g, 6.85 mmol) in ACN (30 mL). To the above solution was added tert-butyl nitrite (1.41 g, 13.7 mmol) and CuBr (1.96 g, 13.7 mmol). The resulting solution was stirred for 3 h at 60° C. The resulting mixture was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:20). This resulted in 1 g (51.6%) of the title compound as a yellow liquid. MS-ESI:283/285 (M+1).

Step 4: Tert-butyl 2-[2-cyclopropyl-4-fluoro-6-(trifluoromethyl)phenyl]acetate

(1841) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-bromo-1-cyclopropyl-5-fluoro-3-(trifluoromethyl)benzene (360 mg, 1.27 mmol) in THF (10 mL), Xphos (121.26 mg, 0.25 mmol), Pd.sub.2(dba).sub.3.CHCl.sub.3 (131.6 mg, 0.13 mmol), and tert-butyl 2-(bromozincio)acetate (662.4 mg, 2.54 mmol). The resulting solution was stirred for 2 h at 65° C. The resulting mixture was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:20). This resulted in 300 mg (74.1%) of the title compound as yellow oil. MS-ESI: 319 (M+1).

Step 5: 2-[2-Cyclopropyl-4-fluoro-6-(trifluoromethyl)phenyl]acetic acid

(1842) Into a 50-mL round-bottom flask, was placed tert-butyl 2-[2-cyclopropyl-4-fluoro-6-(trifluoromethyl) phenyl]acetate (300 mg, 0.94 mmol) in TFA (2 mL) and DCM (2 mL). The resulting solution was stirred for 2 h at RT. The resulting mixture was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:5). This resulted in 230 mg (93.0%) of the title compound as a yellow solid. MS-ESI: 263 (M+1).

(1843) ##STR00670## ##STR00671##

(1844) ##STR00672##

2-(4,6-Diisopropyl-2-(trifluoromethyl)pyrimidin-5-yl)acetic acid

Step 1: 4-Bromo-2-(trifluoromethyl)pyrimidin-5-amine

(1845) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-(trifluoromethyl)pyrimidin-5-amine (2 g, 12.3 mmol) in acetonitrile (20 mL), to this stirred solution was added NB S (2.62 g, 14.7 mmol). The resulting solution was stirred for 12 h at RT. The resulting solution was diluted with 40 mL of water. The resulting solution was extracted with 2×30 mL of dichloromethane and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:50 to 1:20). This resulted in 1.6 g (53.9%) of the title compound as a brown solid. MS-ESI: 242/244 [M+1]

Step 2: 4-(Prop-1-en-2-yl)-2-(trifluoromethyl)pyrimidin-5-amine

(1846) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 4-bromo-2-(trifluoromethyl)pyrimidin-5-amine (1.6 g, 6.61 mmol) in dioxane (20 mL). This was followed by the addition of 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (1.44 g, 8.57 mmol), Pd(dppf)Cl.sub.2 (241 mg, 0.33 mmol), and Cs.sub.2CO.sub.3 (3.23 g, 9.92 mmol). The resulting solution was stirred for 14 h at 100° C. in an oil bath. The resulting solution was diluted with 40 mL of water. The resulting solution was extracted with 3×30 mL of DCM and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:5). This resulted in 1.1 g (81.8%) of the title compound as a brown solid. MS-ESI: 204 [M+1].

Step 3: 4-Isopropyl-2-(trifluoromethyl)pyrimidin-5-amine

(1847) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 4-(prop-1-en-2-yl)-2-(trifluoromethyl)pyrimidin-5-amine (1.2 g, 5.91 mmol) in methanol (20 mL), to the stirred solution was added Pd/C (10% wt., 200 mg). The flask was evacuated and filled three times with hydrogen. The resulting solution was stirred 16 h at RT under hydrogen. The solids were filtered out. The resulting mixture was concentrated under vacuum. This resulted in 1.1 g (90.8%) of the title compound as a brown solid. MS-ESI: 206 [M+1].

Step 4: 4-Bromo-6-isopropyl-2-(trifluoromethyl)pyrimidin-5-amine

(1848) Into a 50-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 4-(propan-2-yl)-2-(trifluoromethyl)pyrimidin-5-amine (1.1 g, 5.36 mmol) in acetonitrile (20 mL), to this solution was added NBS (1.15 g, 6.46 mmol) in portions with stirring. The resulting solution was stirred for 12 h at RT. The resulting solution was diluted with 40 mL of water. The resulting solution was extracted with 2×30 mL of DCM concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:40 to 1:30). This resulted in 1.0 g (65.6%) of the title compound as a brown solid. MS-ESI: 284/286 [M+1].

(1849) Steps 5-9 used similar procedures for converting compound 189″ to intermediate 54 shown in Scheme 37 to afford intermediate 63 from compound 227″. MS-ESI: 291 (M+1).

(1850) ##STR00673## ##STR00674##

(1851) ##STR00675##

2-(5-Fluoro-2,4-diisopropyl-6-(3-(trifluoromethyl)phenyl)pyri din-3-yl)acetic acid

Step 1: 6-Bromo-5-fluoropyridin-3-amine

(1852) Into a 100 mL round-bottom flask, was added 5-fluoropyridin-3-amine (2 g, 17.9 mmol) in DMF (15 mL) at RT. To the stirred solution was added NB S (3.19 g, 17.9 mmol) in DMF (5 mL) dropwise at RT. The resulting solution was stirred for 1 h at RT and diluted with water (75 mL). The resulting mixture was extracted with ethyl acetate (3×20 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel chromatography, eluted with EtOAc/petroleum ether (8:1) to afford the title compound (3 g, 79%) as a dark yellow solid. ME-ESI: 191/193 [M+1].

Step 2: s5-Fluoro-6-(3-(trifluoromethyl)phenyl)pyridin-3-amine

(1853) Into a 500-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was added 6-bromo-5-fluoropyridin-3-amine (3 g, 15.7 mmol) in dioxane (200 mL) and H.sub.2O (20 mL) at RT. To the stirred solution were added Pd(dppf)Cl.sub.2 (1.15 g, 1.57 mmol) and Cs.sub.2CO.sub.3 (10.2 g, 31.4 mmol) at RT under nitrogen atmosphere. Then 4,4,5,5-tetramethyl-2-[3-(trifluoromethyl)phenyl]-1,3,2-dioxaborolane (17.1 g, 62.8 mmol) was added to the above mixture. After the addition was complete and the resulting mixture was stirred at 80° C. in an oil bath overnight. The mixture was concentrated and applied into silica gel and eluted with ethyl acetate/petroleum ether (12:1) to afford the title compound (4.1 g, 94.7%) as a yellow oil. MS-ESI: 257 [M+1].

Step 3: 2,4-Dibromo-5-fluoro-6-(3-(trifluoromethyl)phenyl)pyridin-3-amine

(1854) Into a 250 mL round-bottom flask, were added 5-fluoro-6-[3-(trifluoromethyl)phenyl]pyridin-3-amine (4.1 g, 16.0 mmol) in THF (25 mL) at RT. To the stirred solution was added HCl (2 M, 13.5 mL) in one portion at RT. To this mixture was added Bra (2.4 mL) dropwise. After the addition was complete, the resulting mixture was stirred for 4 h at RT. The resulting mixture was extracted with ethyl acetate (3×90 mL). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel chromatography, eluted with EtOAc/petroleum ether (20:1) to afford the title compound (2.25 g, 33.9%) as a yellow solid. ME-ESI: 413/415/417 [M+1].

(1855) Steps 4-8 used procedures for converting compound 189″ to intermediate 54 shown in Scheme 37 to afford intermediate 64 from compound 235″. MS-ESI: 384 (M+1).

(1856) ##STR00676##

(1857) ##STR00677##

2-(2,4-Diisopropyl-6-methoxypyridin-3-yl)acetyl chloride

Step 1: 2,4-Dibromo-6-fluoropyridin-3-amine

(1858) Into a 1-L round-bottom flask, was placed a solution of 6-fluoropyridin-3-amine (4.05 g, 36.1 mmol) in AcOH (40 mL). This was followed by the addition of a solution of Bra (4.1 mL, 79.9 mmol) in AcOH (50 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 16 h at RT. The resulting mixture was washed with 150 ml of saturated solution of NaHCO.sub.3, extracted with 3×200 ml of dichloromethane, and dried over anhydrous sodium sulfate. This resulted in 5 g (51.2%) of the title compound as a yellow solid. MS-ESI: 269/271/273[M+1].

(1859) Steps 2-4 used similar procedures for converting compound 189 to compound 192 shown in Scheme 37 to afford compound 244 from compound 241. MS-ESI: 260/262 (M+1).

Step 5: 3-Bromo-2,4-diisopropyl-6-methoxypyridine

(1860) Into a 25-mL round-bottom flask, was placed a solution of 3-bromo-6-fluoro-2,4-bis(propan-2-yl)pyridine (130 mg, 0.50 mmol) in DMF (5 mL). To the solution was added CH.sub.3ONa (108 mg, 2.0 mmol). The resulting solution was stirred overnight at RT. The resulting mixture was washed with 20 ml of H.sub.2O. The resulting solution was extracted with 2×25 ml of ethyl acetate dried over anhydrous sodium sulfate and concentrated. The residue was eluted from silica gel with petroleum ether. This resulted in 100 mg (73.5%) of the title compound as yellow oil. MS-ESI: 272/274 [M+1].

(1861) Steps 6-7 used similar procedures for converting compound 192″ to intermediate 54 shown in Scheme 37 to afford intermediate 65 from compound 245″. MS-ESI: 252 (M+1).

(1862) ##STR00678##

(1863) ##STR00679##

2-(3,5-Diisopropyl-2-methylpyridin-4-yl)acetic acid

(1864) Steps 1-2 used similar procedures for converting compound 161″ to compound 163″ shown in Scheme 31 to afford compound 249″ from compound 247″. MS-ESI: 189 (M+1).

Step 3: 3,5-Diisopropyl-2-methylpyridin-4-amine

(1865) Into a 1-L pressure tank reactor purged and maintained with an inert atmosphere of nitrogen, was placed 2-methyl-3,5-bis(prop-1-en-2-yl)pyridin-4-amine (22.0 g, 117 mmol) in MeOH (400 mL). To the stirred solution was added Pd(OH).sub.2/C (10% wt., 2.0 g). The reaction solution was evacuated and filled three times with hydrogen. The resulting mixture was stirred for 3 days at 80° C. under hydrogen atmosphere. The solids were filtered out. The resulting mixture was concentrated under vacuum. This resulted in 17.5 g (77.7%) of the title compound as brown oil. MS-ESI: 193 [M+1].

(1866) Steps 4-6 used similar procedures for converting compound 164″ to Intermediate 36 shown in Scheme 31 to afford intermediate 66 from compound 250″. MS-ESI: 235 (M+1).

(1867) ##STR00680## ##STR00681##

(1868) ##STR00682##

2-(2,4-Diisopropyl-6-(methoxymethyl)pyri din-3-yl)acetic acid

(1869) Steps 1-4 used similar procedures for converting compound 161″ to compound 165″ shown in Scheme 31 to afford compound 257″ from compound 253″. MS-ESI: 300/302 (M+1).

Step 5: (5-Bromo-4,6-diisopropylpyridin-2-yl)methanol

(1870) Into a 50-mL round-bottom flask, was placed methyl 5-bromo-4,6-bis(propan-2-yl)pyridine-2-carboxylate (1.4 g, 4.66 mmol) in methanol (10 mL). This was followed by the addition of NaBH.sub.4 (532 mg, 13.9 mmol) in several batches at 0° C. The resulting solution was stirred for 1 h at RT. The reaction was then quenched by the addition of 20 mL of water. The resulting solution was extracted with 3×30 mL of ethyl acetate concentrated. This resulted in 1.2 g (94.5%) of the title compound as an off-white solid. MS-ESI: 272/274 [M+1].

Step 6: 3-Bromo-2,4-diisopropyl-6-(methoxymethyl)pyridine

(1871) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed [5-bromo-4,6-bis(propan-2-yl)pyridin-2-yl]methanol (800 mg, 2.94 mmol) in THF (10 mL). This was followed by the addition of NaH (60% wt. oil dispersion, 353 mg, 8.82 mmol) in several batches at 0° C. The resulting solution was stirred for 20 min at RT. To this was added CH.sub.3I (1.25 g, 8.82 mmol) dropwise with stirring at 0° C. The resulting solution was allowed to react, with stirring, overnight at RT. The reaction was then quenched by the addition of 20 mL of water. The resulting solution was extracted with 3×30 mL of dichloromethane and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:10). This resulted in 820 mg (97.4%) of the title compound as light yellow oil.

(1872) Steps 8-9 used similar procedures for converting compound 165″ to intermediate 36 shown in Scheme 31 to afford intermediate 67 from compound 259″. MS-ESI: 286/287 (M+1).

Example 1 (131)

(1873) ##STR00683##

2-(4-Fluoro-2,6-diisopropylphenyl)-N-(4-(2-hydroxypropan-2-yl)phenylsulfonimidoyl)acetamide (Scheme 1)

Examples 2 (131b) and 3 (131a)

(1874) ##STR00684##

(S)- and (R)-2-(4-Fluoro-2,6-diisopropylphenyl)-N-(4-(2-hydroxypropan-2-yl)phenylsulfonimidoyl)acetamide

(1875) ##STR00685##

Step 1: N-(tert-butyldimethylsilylamino-4-(2-hydroxypropan-2-yl)phenylhydrosulfonimidoyl)-2-(4-fluoro-2,6-diisopropylphenyl)acetamide

(1876) Into a 50-mL round-bottom flask was placed 2-(4-fluoro-2,6-diisopropylphenyl)acetic acid (73 mg, 0.31 mmol), DCM (2 mL), and DMF (0.05 mL). This was followed by the addition of oxalyl chloride (0.5 mL) dropwise with stirring at RT. The solution was stirred for 30 min at RT and then was concentrated under vacuum. Into a 50-mL round-bottom flask was placed a solution of N′-(tert-butyldimethylsilyl)-4-(2-hydroxypropan-2-yl)benzenesulfonimidamide (100 mg, 0.30 mmol) in THF (3 mL). This was followed by the addition of NaH (60% wt., 42 mg, 1.04 mmol) in portions at 0° C. The solution was stirred for 5 min at RT. Then to the above was added the solution of 2-(4-fluoro-2,6-diisopropylphenyl)acetyl chloride in THF (1 mL) prepared as shown above. The resulting solution was stirred for 1 h at RT, after which it was quenched by the addition of 5 mL of water and extracted with 2×5 mL of ethyl acetate. The combined organic layers were dried over anhydrous Na.sub.2O.sub.4, and concentrated under vacuum. This resulted in 159 mg (96%) of the title compound as yellow crude oil. MS-ESI: 547.3 (M−1).

Step 2: 2-(4-Fluoro-2,6-diisopropylphenyl)-N-(4-(2-hydroxypropan-2-yl)phenylsulfonimidoyl)acetamide

(1877) Into a 50-mL round-bottom flask was placed a solution of N-(tert-butyldimethylsilylamino-4-(2-hydroxylpropan-2-yl)phenylhydrosulfonimidoyl)-2-(4-fluoro-2,6-diisopropylphenyl)acetamide (159 mg, 0.29 mmol) in DCM (10 mL). Then TFA (0.2 mL) was added. The resulting solution was stirred for 1 h at RT and was concentrated under vacuum after that. The crude product was purified by Prep-HPLC using method E eluted with a gradient of 2650% ACN. This resulted in 13.0 mg (10%) of Example 1 as a white solid. MS-ESI: 435.3 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 7.75 (d, J=8.7 Hz, 2H), 7.61 (d, J=8.7 Hz, 2H), 7.57 (s, 2H), 6.82 (d, J=10.5 Hz, 2H), 5.21 (s, 1H), 3.62-3.54 (m, 2H) 3.07-2.98 (m, 2H), 1.41 (s, 6H), 1.13 (d, J=6.9 Hz, 6H), 1.08 (d, J=6.9 Hz, 6H).

Step 3: Chiral Separation

(1878) The product obtained as described in the previous step (90 mg) was resolved by Chiral-Prep-HPLC using the following conditions: Column, ChiralPak ID, 2*25 cm, 5 um; mobile phase, Hex and IPA (hold 40% IPA over 16 min); Flow rate, 20 mL/min; Detector, UV 254/220 nm. This resulted in 16.0 mg (front peak, enantiomer 1, 99% ee) of Example 2 as a white solid and 44.8 mg (second peak, enantiomer 2, 99% ee) of Example 3 as a light yellow solid. Absolute stereochemistry of these two isomers has not been assigned.

(1879) Example 2: MS-ESI: 435.1 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 7.75 (d, J=8.4 Hz, 2H), 7.61 (d, J=9.0 Hz, 4H), 6.82 (d, J=10.5 Hz, 2H), 5.18 (s, 1H), 3.62-3.58 (m, 2H), 3.07-2.98 (m, 2H), 1.41 (s, 6H), 1.08 (d, J=6.9 Hz, 6H), 1.00 (d, J=6.6 Hz, 6H).

(1880) Example 3: MS-ESI: 435.1 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 7.74 (d, J=8.7 Hz, 2H), 7.57 (d, J=8.4 Hz, 4H), 6.81 (d, J=10.5 Hz, 2H), 5.21 (s, 1H), 3.58-3.57 (m, 2H), 3.09-3.02 (m, 2H), 1.41 (s, 6H), 1.07 (d, J=6.6 Hz, 6H), 1.01 (d, J=6.6 Hz, 6H).

Example 4 (129)

(1881) ##STR00686##

2-(1,2,3,5,6,7-Hexahydro-s-indacen-4-yl)-N-(5-(2-hydroxypropan-2-yl)thiazol-2-ylsulfonimidoyl)acetamide (Scheme 2)

Examples 5 (129b) and 6 (129a)

(1882) ##STR00687##

(S)- and (R)-2-(1,2,3,5,6,7-Hexahydro-s-indacen-4-yl)-N-(5-(2-hydroxypropan-2-yl)thiazol-2-ylsulfonimidoyl)acetamide

(1883) ##STR00688##

Step 1: 2-(1,2,3,5,6,7-Hexahydro-s-indacen-4-yl)-N-(5-(2-hydroxypropan-2-yl)thiazol-2-ylsulfonimidoyl)acetamide

(1884) Into a 50-mL round-bottom flask was placed 2-(1,2,3,5,6,7-hexahydro-s-indacen-4-yl)acetic acid (100 mg, 0.46 mmol), DCM (2 mL), and DMF (0.05 mL). This was followed by the addition of oxalyl chloride (0.5 mL) dropwise with stirring at RT. The solution was stirred for 30 min at RT and then was concentrated under vacuum. The above mixture was diluted in ACN (3 mL). This was followed by the addition of a solution of pyridazine (37 mg, 0.46 mmol) in ACN (1 mL). The solution was stirred for 1 min at RT and then a solution of N′-(tert-butyldimethylsilyl)-5-(2-hydroxypropan-2-yl)thiazole-2-sulfonimidamide (154 mg, 0.46 mmol) in ACN (2 mL) was added. The resulting solution was stirred for 2 h at RT, after which it was concentrated under vacuum. The resulting residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:2 to 1:1). The crude product was purified by Prep-HPLC using method E eluted with a gradient of 2650% ACN. This resulted in 10 mg (5%) of Example 4 as a white solid. MS-ESI: 420.2 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 7.84 (br s, 2H), 7.72 (s, 1H), 6.89 (s, 1H), 5.85 (s, 1H), 3.48-3.37 (m, 2H), 2.80-2.70 (m, 8H), 1.99-1.90 (m, 4H), 1.52-1.51 (m, 6H).

Step 2: Chiral Separation

(1885) The product obtained as described in the previous step (40 mg) was resolved by Chiral-Prep-HPLC using the following conditions: ChiralPak IG, 2*25 cm, 5 um; mobile phase, Hex (0.1% TFA) and EtOH (hold 30% EtOH over 13.5 min); Flow rate, 20 mL/min; Detector, UV 254/220 nm. This resulted in 15.3 mg (front peak, enantiomer 1, 100% ee) of Example 5 as a white solid and 14.4 mg (second peak, enantiomer 2, 100% ee) of Example 6 as a white solid. Absolute stereochemistry of these two isomers has not been assigned.

(1886) Example 5: MS-ESI: 420.2 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 8.12 (s, 2H), 7.80 (s, 1H), 6.90 (s, 1H), 5.93 (s, 1H), 3.48-3.40 (m, 2H), 2.80-2.50 (m, 8H), 2.08-1.89 (m, 4H), 1.54-1.52 (m, 6H).

(1887) Example 6: MS-ESI: 420.2 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 8.12 (s, 2H), 7.80 (s, 1H), 6.91 (s, 1H), 5.93 (s, 1H), 3.48-3.40 (m, 2H), 2.80-2.69 (m, 8H), 1.99-1.90 (m, 4H), 1.54-1.52 (m, 6H).

Example 7 (132)

(1888) ##STR00689##

2-(4-Fluoro-2,6-diisopropylphenyl)-N-(5-(2-hydroxypropan-2-yl)thiazole-2-sulfonimidoyl)acetamide (Scheme 3)

Examples 8 (132b) and 9 (132a)

(1889) ##STR00690##

(S)- and (R)-2-(4-fluoro-2,6-diisopropyl phenyl)-N-(5-(2-hydroxypropan-2-yl)thiazole-2-sulfonimidoyl)acetamide

(1890) ##STR00691##

Step 1: 2-(4-Fluoro-2,6-diisopropylphenyl)-N-(5-(2-hydroxypropan-2-yl)thiazole-2-sulfonimidoyl)acetamide

(1891) Into a 50-mL round-bottom flask was placed 2-(4-fluoro-2,6-diisopropylphenyl)acetic acid (108 mg, 0.45 mmol), DCM (3 mL), and DMF (0.05 mL). This was followed by the addition of oxalyl chloride (0.5 mL) dropwise with stirring at RT. The solution was stirred for 30 min at RT and then was concentrated under vacuum. To the above mixture, diluted in DCM (1 mL), was added to a solution of 5-(2-hydroxypropan-2-yl)thiazole-2-sulfonimidamide (60 mg, 0.27 mmol) and TEA (150 mg, 1.48 mmol) in DCM (3 mL) dropwise with stirring at RT. The resulting solution was stirred for 1 h at RT and was then concentrated under vacuum. The crude product was purified by Prep-HPLC using method E eluted with a gradient of 2244% ACN. This resulted in 2.1 mg (1%) of Example 7 as a white solid. MS-ESI: 442.3 (M+1). .sup.1H NMR (300 MHz, CD.sub.3OD-d.sub.4) δ 7.67 (s, 1H), 6.75 (d, J=10.5 Hz, 2H), 3.74 (s, 2H), 3.17-3.03 (m, 2H), 1.58 (s, 6H), 1.12 (d, J=6.8 Hz, 6H), 1.10 (d, J=6.8 Hz, 6H).

Step 2: Chiral Separation

(1892) The product obtained in the previous step (10 mg) was resolved by Chiral-Prep-HPLC using following conditions: Column, ChiralPak ID, 2*25 cm, 5 um; mobile phase, Hex (0.1% FA) and EtOH (hold 20% EtOH in over 10 min); Flow rate, 20 mL/min; Detector, UV 254/220 nm. This resulted in 3.6 mg (front peak, enantiomer 1, 99% ee) of Example 8 as a yellow solid and 3.1 mg (second peak, enantiomer 2, 99% ee) of Example 9 as a yellow solid. Single crystal X-ray crystallographic analysis was performed on compound 132b. Table N below shows fractional atomic coordinates of compound 132b, and FIG. 1 shows ball and stick models of the asymmetrical unit containing two crystallographically independent molecules of compound 132b, with hydrogen atoms omitted for clarity. Based on these results, the absolute stereochemistry of compound 132b was assigned as (S) by single crystal X-ray structure determination. Therefore, compound 132a was assigned as the (R) isomer.

(1893) Example 8: MS-ESI: 442.2 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 8.21 (br s, 2H), 7.75 (s, 1H), 6.84 (d, J=10.5 Hz, 2H), 5.88 (s, 1H), 3.65-3.63 (m, 2H), 3.10-2.97 (m, 2H), 1.51 (s, 6H), 1.09 (d, J=6.9 Hz, 6H), 1.04 (d, J=6.9 Hz, 6H).

(1894) Example 9: MS-ESI: 442.2 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 7.73 (s, 1H), 6.83 (d, J=10.5 Hz, 2H), 5.87 (s, 1H), 3.63-3.59 (m, 2H), 3.10-3.03 (m, 2H), 1.51 (s, 6H), 1.09 (d, J=6.9 Hz, 6H), 1.04 (d, J=6.6 Hz, 6H).

(1895) TABLE-US-00020 TABLE N Fractional Atomic Coordinates (×10.sup.4) and Equivalent Isotropic Displacement Parameters (Å.sup.2 × 10.sup.3) for Example 8. U.sub.eq is defined as ⅓ of the trace of the orthogonalised U.sub.IJ tensor. Atom x y z U(eq) S3 6096 (2) 1631.9 (12) 6214.0 (7) 43.8 (3) S1 4186 (3) 6312.8 (13) 3775.3 (8) 49.4 (4) S4 7832 (3) 4132.7 (15) 5650.5 (8) 53.7 (4) S2 4909 (3) 9172.1 (15) 3606.7 (9) 64.2 (5) O4 7737 (8) 1198 (4) 5669 (2) 56.1 (11) O5 9907 (8) 1617 (5) 7085 (2) 62.4 (12) O1 2799 (9) 5566 (4) 4214 (2) 64.9 (13) F2 14863 (9) 1324 (5) 9826 (3) 88.3 (14) N4 6228 (9) 1015 (5) 6933 (2) 47.7 (11) O2 102 (9) 7078 (6) 2977 (2) 70.3 (14) F1 −4874 (11) 7107 (6) 161 (3) 100.7 (17) N5 3489 (10) 1470 (6) 6026 (3) 54.6 (13) O3 2378 (9) 12418 (4) 4594 (2) 60.3 (12) N3 1905 (9) 8406 (5) 4478 (2) 46.5 (11) N1 4115 (10) 6318 (5) 3000 (3) 55.1 (13) N2 6903 (11) 5865 (6) 3894 (3) 60.1 (15) N6 5327 (10) 4040 (5) 6756 (3) 58.1 (14) O6 8678 (13) 6628 (6) 5147 (3) 86.0 (18) C3 3284 (10) 10337 (6) 4107 (3) 45.2 (13) C27 8106 (11) 1236 (5) 7308 (3) 46.2 (14) C29 9664 (12) 1054 (6) 8500 (3) 50.9 (15) C32 13181 (13) 1229 (7) 9385 (3) 59.3 (17) C24 7970 (11) 6826 (6) 5836 (3) 50.5 (14) C6 6192 (12) 11937 (7) 4004 (4) 63.5 (18) C30 10056 (13) 2297 (6) 8708 (3) 55.4 (16) C22 5791 (13) 5307 (6) 6651 (3) 59.0 (17) C28 7637 (12) 955 (6) 8054 (3) 51.2 (15) C23 7090 (11) 5560 (6) 6085 (3) 46.0 (14) C1 3454 (11) 7995 (6) 4013 (3) 46.6 (13) C2 1819 (11) 9753 (6) 4535 (3) 48.0 (13) C34 11159 (13) −85 (6) 8717 (3) 55.8 (16) C9 415 (13) 7159 (7) 1501 (3) 57.2 (17) C31 11805 (14) 2368 (7) 9156 (4) 63.5 (18) C10 −915 (15) 8349 (7) 1276 (4) 65.2 (19) C33 12915 (14) 27 (7) 9168 (3) 60.3 (17) C4 3585 (11) 11787 (6) 4018 (3) 46.4 (14) C7 2090 (13) 6835 (7) 2692 (3) 55.1 (16) C8 2514 (14) 7140 (8) 1955 (3) 64.7 (19) C13 −1943 (16) 5980 (8) 843 (4) 71 (2) C12 −3143 (15) 7121 (8) 616 (4) 70 (2) C14 −148 (15) 5971 (7) 1295 (4) 67 (2) C38 8604 (16) 3579 (7) 8461 (4) 73 (2) C5 2485 (14) 12376 (7) 3372 (4) 64.0 (18) C35 10957 (16) −1446 (7) 8477 (4) 72 (2) C11 −2668 (16) 8307 (8) 821 (4) 76 (2) C21 6299 (10) 3342 (6) 6257 (3) 45.8 (14) C39 10220 (20) 4381 (9) 8022 (5) 99 (3) C40 7385 (19) 4354 (9) 9037 (6) 101 (3) C15 1040 (20) 4634 (9) 1552 (6) 95 (3) C26 9960 (20) 7080 (12) 6237 (6) 120 (5) C18 −480 (20) 9672 (9) 1490 (5) 98 (3) C37 10310 (40) −2330 (12) 9044 (6) 153 (6) C25 5915 (17) 7965 (8) 5857 (6) 92 (3) C17 −680 (30) 3869 (11) 1918 (6) 132 (5) C16 2410 (20) 3878 (10) 979 (8) 124 (5) C19 80 (40) 10550 (14) 950 (8) 198 (10) C36 13120 (30) −2025 (15) 8091 (10) 199 (10) C20 −2400 (50) 10316 (15) 1931 (10) 292 (18)

Example 10 (134)

(1896) ##STR00692##

N,N-(5-(2-hydroxypropan-2-yl)thiazol-2-ylsulfinyl)bis(2-(4-fluoro-2,6-diisopropylphenyl)acetamide) (Scheme 4)

(1897) Into a 50-mL round-bottom flask was placed 2-(4-fluoro-2,6-diisopropylphenyl)acetic acid (242 mg, 1.02 mmol), DCM (3 mL), and DMF (0.05 mL). This was followed by the addition of oxalyl chloride (0.5 mL) dropwise with stirring at RT. The solution was stirred for 30 min at RT and then was concentrated under vacuum. To the above mixture, diluted in DCM (2 mL), was added to a solution of 5-(2-hydroxypropan-2-yl)thiazole-2-sulfonimidamide (220 mg, 0.99 mmol) and TEA (400 mg, 3.95 mmol) in DCM (3 mL) dropwise with stirring at RT. The resulting solution was stirred for 1 h at RT and was then concentrated under vacuum. The crude product was purified by Prep-HPLC using method E eluted with a gradient of 6365% ACN. This resulted in 51.6 mg (8%) of Example 10 as a white solid. MS-ESI: 660.5 (M−1). .sup.1H NMR (300 MHz, CD.sub.3OD-d.sub.4) δ 7.59 (s, 1H), 5.75 (d, J=10.2 Hz, 4H), 3.82 (s, 4H), 3.16-3.06 (m, 4H), 1.59 (s, 6H), 1.32-1.13 (m, 24H).

Example 11 (137)

(1898) ##STR00693##

2-(4-Fluoro-2,6-diisopropylphenyl)-N-(5-(2-hydroxypropan-2-yl)-N-methylthiazole-2-sulfonimidoyl)acetamide (Scheme 5)

(1899) Into a 50-mL round-bottom flask was placed 2-(4-fluoro-2,6-diisopropylphenyl)acetic acid (233 mg, 0.98 mmol), DCM (3 mL), and DMF (0.05 mL). This was followed by the addition of oxalyl chloride (0.5 mL) dropwise with stirring at RT. The solution was stirred for 30 min at RT and then was concentrated under vacuum. To the above mixture, diluted in DCM (2 mL), was added to a solution of 5-(2-hydroxypropan-2-yl)-N′-methylthiazole-2-sulfonimidamide (230 mg, 0.98 mmol) and TEA (400 mg, 3.95 mmol) in DCM (3 mL) dropwise with stirring at RT. The resulting solution was stirred for 1 h at RT and then was concentrated under vacuum. The crude product was purified by Prep-HPLC using method E eluted with a gradient of 2080% ACN. This resulted in 17.7 mg (4%) of Example 11 as a light yellow solid. MS-ESI: 456.2 (M+1). .sup.1H NMR (300 MHz, DMSO-d.sub.6) major tautomer β 8.34 (s, 1H), 7.85 (s, 1H), 6.86 (d, J=10.5 Hz, 2H), 5.94 (s, 1H), 3.71 (d, J=3.6 Hz, 2H), 3.14-3.02 (m, 2H), 2.55 (s, 3H), 1.52 (s, 6H), 1.13 (d, J=4.5 Hz, 6H), 1.09 (d, J=4.5 Hz, 6H).

Example 12 (136)

(1900) ##STR00694##

2-(1,2,3,5,6,7-Hexahydro-s-indacen-4-yl)-N-(5-(2-hydroxypropan-2-yl)-N-methylthiazole-2-sulfonimidoyl)acetamide (Scheme 6)

(1901) Into a 50-mL round-bottom flask was placed 2-(1,2,3,5,6,7-hexahydro-s-indacen-4-yl)acetic acid (156 mg, 0.72 mmol), DCM (3 mL), and DMF (0.05 mL). This was followed by the addition of oxalyl chloride (0.5 mL) dropwise with stirring at RT. The solution was stirred for 30 min at RT and then was concentrated under vacuum. To the above mixture, diluted in DCM (2 mL), was added to a solution of 5-(2-hydroxypropan-2-yl)-N′-methylthiazole-2-sulfonimidamide (170 mg, 0.72 mmol) and DBU (370 mg, 2.43 mmol) in DCM (3 mL) dropwise with stirring at RT. The resulting solution was stirred for 2 h at RT and then was quenched by the addition of 10 mL of water. The resulting solution was extracted with 3×10 mL of ethyl acetate, dried over anhydrous Na.sub.2O.sub.4, and then concentrated under vacuum. The crude product was purified by Prep-HPLC using method E eluted with a gradient of 5˜15% ACN. This resulted in 11.3 mg (4%) of the title compound as a light yellow solid. MS-ESI: 434.3 (M+1). .sup.1H NMR (300 MHz, CD.sub.3OD-d.sub.4) major tautomer δ 7.75 (s, 1H), 6.89 (s, 1H), 3.56 (s, 2H), 2.83-2.73 (m, 8H), 2.61 (s, 3H), 2.06-1.95 (m, 4H), 1.59 (s, 6H).

(1902) TABLE-US-00021 TABLE 8 Example in the following table was prepared using similar conditions as described in Example 1 and Scheme 1 from appropriate starting materials. Example Compound LC-MS # Number Structure IUPAC Name [M + H].sup.+ 13 133 embedded image 2-(4-cyano-3-fluoro-2,6- diisopropylphenyl)-N-(5-(2- hydroxypropan-2-yl)thiazol-2- ylsulfonimidoyl)acetamide 467.2

(1903) TABLE-US-00022 TABLE 9 Examples in the following table were prepared using similar conditions as described in Example 4 and Scheme 2 from appropriate starting materials. Example Compound LC-MS # Number Structure IUPAC Name [M + H].sup.+ 14 141 embedded image 2-(4-cyano-3-fluoro-2,6- diisopropylphenyl)-N-(3-fluoro-5- (2-hydroxypropan-2-yl)thiophen- 2-ylsulfonimidoyl)acetamide 484.2 15 139 embedded image 2-(2-cyclopropyl-4-fluoro-6- isopropylphenyl)-N-(4- ((dimethylamino)methyl)phenyl- sulfonimidoyl)acetamide 432.2 16 138 embedded image 2-(4-(difluoromethoxy)-2,6- diisopropylphenyl)-N-(2-(2- hydroxypropan-2-yl)thiazol-5- ylsulfonimidoyl)acetamide 490.3 17 140 embedded image 2-(4-fluoro-2,6- diisopropylphenyl)-N-(3-fluoro-5- (2-hydroxypropan-2-yl)thiophen- 2-ylsulfonimidoyl)acetamide 459.2 18 142 00embedded image 2-(2-cyclopropyl-4-fluoro-6- isopropylphenyl)-N-(3-fluoro-5- (2-hydroxypropan-2-yl)thiophen- 2-ylsulfonimidoyl)acetamide 457.2 19 143 01embedded image 2-(4-cyano-6-cyclopropyl-3- fluoro-2-isopropylphenyl)-N-(3- fluoro-5-(2-hydroxypropan-2- yl)thiophen-2- ylsulfonimidoyl)acetamide 482.2 20 197 02embedded image 2-(4-chloro-2-cyclopropyl-3- fluoro-6-isopropylphenyl)-N-(3- fluoro-5-(2-hydroxypropan-2- yl)thiophen-2- ylsulfonimidoyl)acetamide 491.2 21 101 03embedded image 2-(4-(difluoromethoxy)-2,6- diisopropylphenyl)-N-(3-fluoro-5- (2-hydroxypropan-2-yl)thiophen- 2-ylsulfonimidoyl)acetamide 507.2 22 152 04embedded image 2-(4-cyano-2,6- diisopropylphenyl)-N-(4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazol-5- ylsulfonimidoyl)acetamide 479.2 23 150 05embedded image 2-(1,2,3,5,6,7-hexahydros- indacen-4-yl)-N-(4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazol-5- ylsulfonimidoyl)acetamide 450.2 24 148 06embedded image 2-(2,6-diisopropyl-4- (methoxymethyl)phenyl)-N-(4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidoyl)acetamide 498.2 25 147 07embedded image 2-(4-cyano-2-cyclopropyl-6- isopropylphenyl)-N-(4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazole-5- sulfonimidoyl)acetamide 477.2 26 113 08embedded image 2-(2-cyclopropyl-4- (difluoromethoxy)-6- isopropylphenyl)-N-(4- ((dimethylamino)methyl)-2- methylphenylsulfonimidoyl) acetamide 494.2 27 151 09embedded image 2-(4-(difluoromethoxy)-2,6- diisopropylphenyl)-N-(4- ((dimethylamino)methyl)phenyl- sulfonimidoyl)acetamide 482.2 28 114 0embedded image 2-(4-cyano-2,6- diisopropylphenyl)-N-(4- ((dimethylamino)methyl)phenyl- sulfonimidoyl)acetamide 441.2 29 112 embedded image 2-(4-cyano-2-cyclopropyl-6- isopropylphenyl)-N-(4- ((dimethylamino)methyl)phenyl- sulfonimidoyl)acetamide 439.2 30 116 embedded image 2-(4-cyano-2-ethyl-6- isopropylphenyl)-N-(4- ((dimethylamino)methyl)phenyl- sulfonimidoyl)acetamide 427.2 31 105 embedded image 2-(2-cyclopropyl-4-fluoro-6- isopropylphenyl)-N-(4- ((dimethylamino)methyl)-2- fluorophenylsulfonimidoyl) acetamide 450.2 32 117 embedded image 2-(4-cyano-2-cyclopropyl-6- isopropylphenyl)-N-(4- ((dimethylamino)methyl)-2- fluorophenylsulfonimidoyl) acetamide 457.2 33 109 embedded image 2-(4-(difluoromethyl)-2,6- diisopropylphenyl)-N-(2-fluoro-4- (2-hydroxypropan-2- yl)phenylsulfonimidoyl)acetamide 485.2 34 146 embedded image N-(2-chloro-4-(2-hydroxypropan- 2-yl)phenylsulfonimidoyl)-2-(4- cyano-2,6- diisopropylphenyl)acetamide 476.2 35 110 embedded image 2-(4-(difluoromethyl)-2,6- diisopropylphenyl)-N-(4- ((dimethylamino)methyl)-2- fluorophenylsulfonimidoyl) acetamide 484.2 36 126 embedded image 2-(4-(difluoromethoxy)-2-ethyl-6- isopropylphenyl)-N-(3-fluoro-5- (2-hydroxypropan-2-yl)thiophene- 2-sulfonimidoyl)acetamide 493.1 37 104 embedded image 2-(4-(difluoromethyl)-2,6- diisopropylphenyl)-N-(3-fluoro-5- (2-hydroxypropan-2-yl)thiophene- 2-sulfonimidoyl)acetamide 491.2 38 130 0embedded image 2-(4-cyano-2,6- diisopropylphenyl)-N-(5-(2- hydroxypropan-2-yl)thiazole-2- sulfonimidoyl)acetamide 449.2 39 107 embedded image 2-(4-(difluoromethoxy)-2,6- diisopropylphenyl)-N-(2-(2- hydroxypropan-2-yl)-4- methylthiazole-5- sulfonimidoyl)acetamide 504.2 40 106 embedded image 2-(4-cyano-2,6- diisopropylphenyl)-N-(2-(2- hydroxypropan-2-yl)-4- methylthiazole-5- sulfonimidoyl)acetamide 463.2

(1904) TABLE-US-00023 TABLE 10 Example in the following table was prepared using similar conditions as described in Example 11 and Scheme 5 from appropriate starting materials. Example Compound LC-MS # Number Structure IUPAC Name [M + H].sup.+ 41 135 embedded image 2-(4-fluoro-2,6- diisopropylphenyl)-N-(5-(2- hydroxypropan-2-yl)-N-(4- methoxybenzyl)thiazole-2- sulfonimidoyl)acetamide 562.5

(1905) TABLE-US-00024 TABLE 11 Examples in the following table were obtained from chiral HPLC resolutions of racemic examples described above. The chiral column and eluents are listed in the table. As a convention, the faster-eluting enantiomer is always listed first in the table followed by the slower-eluting enantiomer of the pair. The symbol * at a chiral center denotes that this chiral center has been resolved and the absolute stereochemistry at that center has not been determined. Com- Ex. pound LC-MS # Number Structure IUPAC Name Column Eluents [M + H].sup.+ 42 133b or 133a embedded image (S)-or (R)- 2-(4-cyano-3-fluoro-2,6- diisopropylphenyl)-N-(5-(2- hydroxypropan-2-yl)thiazol-2- ylsulfonimidoyl) acetamide ChiralPak IC, 2*25 cm, 5 um 50% IPA in CO.sub.2 467.2 43 133a or 133b embedded image (R)- or (S)- 2-(4-cyano-3-fluoro-2,6- diisopropylphenyl)-N-(5-(2- hydroxypropan-2-yl)thiazol-2- ylsulfonimidoyl) acetamide ChiralPak IC, 2*25 cm, 5 um 50% IPA in CO.sub.2 467.2 44 141b or 141a embedded image (S)- or (R)- 2-(4-cyano-3-fluoro-2,6- diisopropylphenyl)-N-(3-fluoro-5- (2-hydroxypropan-2-yl)thiophen- 2-ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex (1% TFA) 484.2 45 141a or 141b embedded image (R)- or (S)- 2-(4-cyano-3-fluoro-2,6- diisopropylphenyl)-N-(3-fluoro-5- (2-hydroxypropan-2-yl)thiophen- 2-ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 30% EtOH in Hex (1% TFA) 484.2 46 139b or 139a embedded image (S)- or (R)- 2-(2-cyclopropyl-4-fluoro-6- isopropylphenyl)-N-(4- ((dimethylamino)methyl)phenyl- sulfonimidoyl)acetamide ChiralPak IC, 2*25 cm, 5 um 15% EtOH in Hex 432.1 47 139a or 139b embedded image (R)- or (S)- 2-(2-cyclopropyl-4-fluoro-6- isopropylphenyl)-N-(4- ((dimethylamino)methyl)phenyl- sulfonimidoyl)acetamide ChiralPak IC, 2*25 cm, 5 um 15% EtOH in Hex 432.1 48 138b or 138a 0embedded image (S)- or (R)- 2-(4-(difluoromethoxy)-2,6- diisopropylphenyl)-N-(2-(2- hydroxypropan-2-yl)thiazol-5- ylsulfonimidoyl)acetamide ChiralPak IG, 2*25 cm, 5 um 8% IPA in Hex (1% TFA) 490.1 49 138a or 138b embedded image (R)- or (S)- 2-(4-(difluoromethoxy)-2,6- diisopropylphenyl)-N-(2-(2- hydroxypropan-2-yl)thiazol-5- ylsulfonimidoyl)acetamide ChiralPak IG, 2*25 cm, 5 um 8% IPA in Hex (1% TFA) 490.1 50 140b or 140a embedded image (S)- or (R)- 2-(4-fluoro-2,6- diisopropylphenyl)-N-(3-fluoro-5- (2-hydroxypropan-2-yl)thiophen- 2-ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex (0.1% DEA) 459.2 51 140a or 140b embedded image (R)- or (S)- 2-(4-fluoro-2,6- diisopropylphenyl)-N-(3-fluoro-5- (2-hydroxypropan-2-yl)thiophen- 2-ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex (0.1% DEA) 459.2 52 144b or 144a embedded image (S)- or (R)- 2-(2-cyclopropyl-4-fluoro-6- isopropylphenyl)-N-(3-fluoro-5-(2- hydroxypropan-2-yl)thiophen-2- ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex 457.2 53 144a or 144b embedded image (R)- or (S)- 2-(2-cyclopropyl-4-fluoro-6- isopropylphenyl)-N-(3-fluoro-5-(2- hydroxypropan-2-yl)thiophen-2- ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex 457.2 54 145b or 145a embedded image (S)- or (R)- 2-(4-cyano-6-cyclopropyl-3- fluoro-2-isopropylphenyl)-N-(3- fluoro-5-(2-hydroxypropan-2- yl)thiophen-2- ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex (0.1% FA) 482.2 55 145a or 145b embedded image (R)- or (S)- 2-(4-cyano-6-cyclopropyl-3- fluoro-2-isopropylphenyl)-N-(3- fluoro-5-(2-hydroxypropan-2- yl)thiophen-2- ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex (0.1% FA) 482.2 56 197b or 197a embedded image (S)- or (R)- 2-(4-chloro-2-cyclopropyl-3- fluoro-6-isopropylphenyl)-N-(3- fluoro-5-(2-hydroxypropan-2- yl)thiophen-2- ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex (0.1% DEA) 491.2 57 197a or 197b embedded image (R)- or (S)- 2-(4-chloro-2-cyclopropyl-3- fluoro-6-isopropylphenyl)-N-(3- fluoro-5-(2-hydroxypropan-2- yl)thiophen-2- ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex (0.1% DEA) 491.2 58 116 0embedded image (S)- or (R)- 2-(4-cyano-2-ethyl-6- isopropylphenyl)-N-(4- ((dimethylamino)methyl)phenyl- sulfonimidoyl)acetamide ChiralPak ADH, 2*25 cm, 5 um 30% EtOH in Hex (0.1% DEA) 427.2 59 116a or 116b embedded image (R)- or (S)- 2-(4-cyano-2-ethyl-6- isopropylphenyl)-N-(4- ((dimethylamino)methyl)phenyl- sulfonimidoyl)acetamide ChiralPak ADH, 2*25 cm, 5 um 30% EtOH in Hex (0.1% DEA) 427.2 60 106 embedded image (S)- or (R)- 2-(4-cyano-2,6- diisopropylphenyl)-N-(2-(2- hydroxypropan-2-yl)-4- methylthiazole-5- sulfonimidoyl)acetamide ChiralPak IC, 2*25 cm, 5 um 30% IPA in Hex (0.1% DEA) 463.2 61 106a or 106b embedded image (R)- or (S)- 2-(4-cyano-2,6- diisopropylphenyl)-N-(2-(2- hydroxypropan-2-yl)-4- methylthiazole-5- sulfonimidoyl)acetamide ChiralPak IC, 2*25 cm, 5 um 30% IPA in Hex (0.1% DEA) 463.2 62 117a or 117b embedded image (S)- or (R)- 2-(4-cyano-2-cyclopropyl-6- isopropylphenyl)-N-(4- ((dimethylamino)methyl)-2- fluorophenylsulfonimidoyl) acetamide ChiralCE L OD, 2*25 cm, 5 um 30% EtOH in Hex (0.1% FA) 457.2 63 117b or 117a embedded image (R)- or (S)- 2-(4-cyano-2-cyclopropyl-6- isopropylphenyl)-N-(4- ((dimethylamino)methyl)-2- fluorophenylsulfonimidoyl) acetamide ChiralCE L OD, 2*25 cm, 5 um 30% EtOH in Hex (0.1% FA) 457.2 64 152b or 152a embedded image (S)- or (R)- 2-(4-cyano-2,6- diisopropylphenyl)-N-(4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazol-5- ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 80% EtOH in Hex (0.1% FA) 480.2 65 152a or 152b embedded image (R)- or (S)- 2-(4-cyano-2,6- diisopropylphenyl)-N-(4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazol-5- ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 80% EtOH in Hex (0.1% FA) 480.2 66 150b or 150a embedded image (S)- or (R)- 2-(1,2,3,5,6,7-hexahydros-indacen- 4-yl)-N-(4-(hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazol-5- ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 88% IPA in Hex (0.1% FA) 450.2 67 150a or 150b embedded image (R)- or (S)- 2-(1,2,3,5,6,7-hexahydros-indacen- 4-yl)-N-(4-(hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazol-5- ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 88% IPA in Hex (0.1% FA) 450.2 68 148b or 148a 0embedded image (S)- or (R)- 2-(2,6-diisopropyl-4- (methoxymethyl)phenyl)-N-(4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazol-5- ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 75% IPA in Hex (0.1% FA) 498.2 69 148a or 148b embedded image (R)- or (S)- 2-(2,6-diisopropyl-4- (methoxymethyl)phenyl)-N-(4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazol-5- ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 75% IPA in Hex (0.1% FA) 498.2 70 147b or 147a embedded image (S)- or (R)- 2-(4-cyano-2-cyclopropyl-6- isopropylphenyl)-N-(4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazol-5- ylsulfonimidoyl)acetamide ChiralPak IC, 2*25 cm, 5 um 15% EtOH in Hex 477.2 71 147a or 147b embedded image (R)- or (S)- 2-(4-cyano-2-cyclopropyl-6- isopropylphenyl)-N-(4- (hydroxymethyl)-2-(2- hydroxypropan-2-yl)thiazol-5- ylsulfonimidoyl)acetamide ChiralPak IC, 2*25 cm, 5 um 15% EtOH in Hex 477.2 72 114b or 114a embedded image (S)- or (R)- 2-(4-cyano-2,6- diisopropylphenyl)-N-(4- ((dimethylamino)methyl)phenyl- sulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 50% IPA in Hex (0.1% DEA) 441.2 73 114a or 114b embedded image (R)- or (S)- 2-(4-cyano-2,6- diisopropylphenyl)-N-(4- ((dimethylamino)methyl)phenyl- sulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 50% IPA in Hex (0.1% DEA) 441.2 74 112b or 112a embedded image (S)- or (R)- 2-(4-cyano-2-cyclopropyl-6- isopropylphenyl)-N-(4- ((dimethylamino)methyl)phenyl- sulfonimidoyl)acetamide ChiralPak IG, 2*25 cm, 5 um 25% IPA in Hex (0.1% DEA) 439.2 75 112a or 112b embedded image (R)- or (S)- 2-(4-cyano-2-cyclopropyl-6- isopropylphenyl)-N-(4- ((dimethylamino)methyl)phenyl- sulfonimidoyl)acetamide ChiralPak IG, 2*25 cm, 5 um 25% EtOH in Hex (0.1% DEA) 439.2 76 101b or 101a embedded image (S)- or (R)- 2-(4-(difluoromethoxy)-2,6- diisopropylphenyl)-N-(3-fluoro-5- (2-hydroxypropan-2-yl)thiophen- 2-ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex (0.1% DEA) 507.2 77 101a or 101b embedded image (R)- or (S)- 2-(4-(difluoromethoxy)-2,6- diisopropylphenyl)-N-(3-fluoro-5- (2-hydroxypropan-2-yl)thiophen- 2-ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 30% IPA in Hex (0.1% DEA) 507.2 78 126b or 126a 0embedded image (S)- or (R)- 2-(4-(difluoromethoxy)-2-ethyl-6- isopropylphenyl)-N-(3-fluoro-5-(2- hydroxypropan-2-yl)thiophen-2- ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 25% IPA in Hex (0.1% DEA) 493.2 79 126a or 126b embedded image (R)- or (S)- 2-(4-(difluoromethoxy)-2-ethyl-6- isopropylphenyl)-N-(3-fluoro-5-(2- hydroxypropan-2-yl)thiophen-2- ylsulfonimidoyl)acetamide ChiralPak ID, 2*25 cm, 5 um 25% IPA in Hex (0.1% DEA) 493.2 80 104b or 104a embedded image (S)- or (R)- 2-(4-(difluoromethyl)-2,6- diisopropylphenyl)-N-(3-fluoro-5- (2-hydroxypropan-2-yl)thiophen- 2-ylsulfonimidoyl)acetamide ChiralPak IC, 2*25 cm, 5 um 15% IPA in Hex (0.1% FA) 491.2 81 104a or 104b embedded image (R)- or (S)- 2-(4-(difluoromethyl)-2,6- diisopropylphenyl)-N-(3-fluoro-5- (2-hydroxypropan-2-yl)thiophen- 2-ylsulfonimidoyl)acetamide ChiralPak IC, 2*25 cm, 5 um 15% IPA in Hex (0.1% FA) 491.2 82 130b or 130a embedded image (R)- or (S)- 2-(4-cyano-2,6- diisopropylphenyl)-N-(5-(2- hydroxypropan-2-yl)thiazol-2- ylsulfonimidoyl)acetamide ChiralPak IG, 2*25 cm, 5 um 15% IPA in Hex (0.1% FA) 449.2 83 130a or 130b embedded image (S)- or (R)- 2-(4-cyano-2,6- diisopropylphenyl)-N-(5-(2- hydroxypropan-2-yl)thiazol-2- ylsulfonimidoyl)acetamide ChiralPak IG, 2*25 cm, 5 um 15% IPA in Hex (0.1% FA) 449.2 84 107b or 107a embedded image (S)- or (R)- 2-(4-(difluoromethoxy)-2,6- diisopropylphenyl)-N-(2-(2- hydroxypropan-2-yl)-4- methylthiazol-5- ylsulfonimidoyl)acetamide ChiralPak IC, 2*25 cm, 5 um 10% IPA in Hex (0.1% FA) 504.2 85 107a or 107b embedded image (R)- or (S)- 2-(4-(difluoromethoxy)-2,6- diisopropylphenyl)-N-(2-(2- hydroxypropan-2-yl)-4- methylthiazol-5- ylsulfonimidoyl)acetamide ChiralPak IC, 2*25 cm, 5 um 10% IPA in Hex (0.1% FA) 504.2 86 109a or 109b embedded image (S)- or (R)- 2-(4-(difluoromethyl)-2,6- diisopropylphenyl)-N-(2-fluoro-4- (2-hydroxypropan-2- yl)phenylsulfonimidoyl)acetamide ChiralPak IF, 2*25 cm, 5 um 15% EtOH in Hex (0.1% DEA) 485.2 87 109b or 109a embedded image (R)- or (S)- 2-(4-(difluoromethyl)-2,6- diisopropylphenyl)-N-(2-fluoro-4- (2-hydroxypropan-2- yl)phenylsulfonimidoyl)acetamide ChiralPak IF, 2*25 cm, 5 um 15% EtOH in Hex (0.1% DEA) 485.2 88 201b 0embedded image (R)-N-(amino(4-(2- hydroxypropan-2-yl)thiophen-2- yl)oxo)-λ.sup.6-sulfanylidene)-2-(3- fluoro-2,6- diisopropylphenyl)acetamide ChiralPak IF, 2*25 cm, 5 um 15% EtOH in Hex (0.1% DEA) 440.59 89 301 embedded image (R)-N-(amino(2-(2- hydroxypropan-2-yl)thiazol-5- yl)oxo)-λ.sup.6-sulfanylidene)-2-(5- fluoro-2,4-diisopropyl-6-(3- (trifluoromethyl)phenyl)pyridin-3- yl)acetamide ChiralPak IF, 2*25 cm, 5 um 15% EtOH in Hex (0.1% DEA) 586.66

Example 88 (Compound 241)

(1906) ##STR00772##

N-(amino(4-(2-(dimethylamino)propan-2-yl)phenyl)(oxo)-λ.SUP.6.-sulfaneylidene)-2-(4-fluoro-2,6-diisopropylphenyl)acetamide (Scheme 1A)

(1907) ##STR00773##

Step 1: 2-(4-Fluoro-2,6-diisopropylphenyl)acetyl chloride

(1908) Into a 25-mL round-bottom flask, was placed a solution of 2-[4-fluoro-2,6-bis(propan-2-yl)phenyl] acetic acid (20 mg, 0.08 mmol) in DCM (2 mL). This was followed by the addition of DMF (0.005 mL) with stirring. To this was added oxalic dichloride (0.5 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 1 h at RT. The resulting mixture was concentrated. This resulted in 21 mg (97.4%) of the title compound as a yellow solid. This crude product was used in the next step.

Step 2: N-(((tert-butyldimethylsilyl)amino)(4-(2-(dimethylamino)propan-2-yl)phenyl)(oxo)-λ.SUP.6.-sulfaneylidene)-2-(4-fluoro-2,6-diisopropylphenyl)acetamide

(1909) Into a 25-mL round-bottom flask, was placed a solution of N-(tert-butyldimethylsilyl)-4-[2-(dimethylamino) propan-2-yl]benzene-1-sulfonoimidamide (20 mg, 0.06 mmol) in THF (3 mL). To this was added NaH (60% wt. oil dispersion, 12 mg, 0.3 mmol) at 0° C. To the mixture was added a solution of 2-[4-fluoro-2,6-bis(propan-2-yl) phenyl]acetyl chloride (14.4 mg, 0.06 mmol) in DCM (1 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 1 h at RT. The reaction was then quenched by the addition of 20 mL of water. The resulting solution was extracted with 2×25 mL of ethyl acetate, dried over anhydrous sodium sulfate, and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:1). This resulted in 20 mg (61.7%) of the title compound as a white solid. MS-ESI: 576 (M+1).

Step 3: N-(amino(4-(2-(dimethylamino)propan-2-yl)phenyl)(oxo)-λ.SUP.6.-sulfaneylidene)-2-(4-fluoro-2,6-diisopropylphenyl)acetamide

(1910) Into a 25-mL round-bottom flask, was placed a solution of N-[[(tert-butyldimethylsilyl)amino] ([4-[2-(dimethylamino)propan-2-yl]phenyl])oxo-λ.sup.6-sulfanylidene]-2-[4-fluoro-2,6-bis(propan-2-yl)phenyl]acetamide (20 mg, 0.03 mmol) in DCM (2 mL). This was followed by the addition of HF-Pyridine (70% wt., 1 mL) dropwise with stirring. The resulting solution was stirred for 30 min at RT. The resulting mixture was washed with 20 mL of H.sub.2O. The resulting solution was extracted with 2×25 mL of ethyl acetate dried over anhydrous sodium sulfate. The resulting mixture was concentrated. The crude product was purified by Prep-HPLC with the following conditions: Column, XBridge Shield RP18 OBD, 19*250 mm, 10 um; mobile phase, water (10 mM NH.sub.4HCO.sub.3) and ACN (30% to 50% ACN gradient in 10 min); Detector, UV220/254 nm. This resulted in 5.2 mg (32.4%) of Example 88 as a white solid. MS-ESI: 462.3 (M+1)..sup.1H-NMR (400 MHz, CD.sub.3OD-d.sub.4) δ 7.87 (d, J=8.4 Hz, 2H), 7.69 (d, J=8.4 Hz, 2H), 6.76 (d, J=10.4 Hz, 2H), 3.74 (s, 2H), 3.12-3.08 (m, 2H), 2.16 (s, 6H), 1.39 (s, 6H), 1.11 (dd, J=15.2, 6.8 Hz, 12H).

(1911) TABLE-US-00025 TABLE 18 Examples in the following table were prepared using similar conditions as described in Example 88 and Scheme 1A from appropriate starting materials. Example Compound Exact Mass # # Structure IUPAC Name [M + H].sup.+ 89 219 embedded image N-(amino(5- ((dimethylamino)methyl)-3- fluorothiophen-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3-fluoro-2,6- diisopropylphenyl)acetamide 458 90 218 embedded image N-(amino(1-methyl-1H- indazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3-fluoro-2,6- diisopropylphenyl)acetamide 431 91 217 embedded image N-(amino(5- ((dimethylamino)methyl) pyridin-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3-fluoro-2,6- diisopropylphenyl)acetamide 435 92 214 embedded image 2-(3,5-diisopropylpyridin-4- yl)-N-((4-(hydroxymethyl)-2- (2-hydroxypropan-2-yl)thiazol- 5-yl)sulfonyl)acetamide 456

Example 93 (Compound 235)

(1912) ##STR00778##

N-(amino(5-(2-hydroxypropan-2-yl)thiazol-2-yl)(oxo)-λ.SUP.6.-sulfaneylidene)-2-(4-(3-hydroxyoxetan-3-yl)-2,6-diisopropylphenyl)acetamide (Scheme 1B)

Example 94 (Compound 230)

(1913) ##STR00779##

N-(amino(5-(2-hydroxypropan-2-yl)thiazol-2-yl)(oxo)-λ.SUP.6.-sulfaneylidene)-2-(4-(3-fluorooxetan-3-yl)-2,6-diisopropylphenyl)acetamide (Scheme 1B)

(1914) ##STR00780##

Step 1: 2-(4-(3-fluorooxetan-3-yl)-2,6-diisopropylphenyl)acetyl chloride

(1915) Into a 50-mL round-bottom flask, was placed 2-[4-(3-fluorooxetan-3-yl)-2,6-bis(propan-2-yl)phenyl] acetic acid (150 mg, 0.51 mmol) in DCM (3 mL) and DMF (0.05 mL). This was followed by the addition of oxalic dichloride (0.5 mL) dropwise with stirring at RT. The resulting solution was stirred for 30 min at RT. The resulting mixture was concentrated under vacuum. This resulted in 159 mg (99.7%) of the title compound as a light yellow solid.

Step 2: N-(((tert-butyldimethylsilyl)amino)(5-(2-hydroxypropan-2-yl)thiazol-2-yl)(oxo)-λ.SUP.6.-sulfaneylidene)-2-(4-(3-hydroxyoxetan-3-yl)-2,6-diisopropylphenyl)acetamide

(1916) Into a 50-mL round-bottom flask, was placed N-(tert-butyldimethylsilyl)-5-(2-hydroxypropan-2-yl)-1,3-thiazole-2-sulfonoimidamide (173 mg, 0.52 mmol) in THF (5 mL). This was followed by the addition of NaH (60% wt. oil dispersion, 62.4 mg, 1.56 mmol) in portions at 0° C. The resulting solution was stirred for 10 min at RT. Then to the above was added a solution of 2-[4-(3-fluorooxetan-3-yl)-2,6-bis(propan-2-yl)phenyl]acetyl chloride (159 mg, 0.51 mmol) in THF (2 mL) dropwise with stirring at 0° C. The resulting solution was stirred for 2 h at RT. The reaction was then quenched by the addition of 5 mL of water. The resulting solution was extracted with 3×5 mL of ethyl acetate. The organic layers were combined, dried over anhydrous sodium sulfate, and concentrated under vacuum. This resulted in 200 mg (64.5%) of the title compound as an off-white solid. MS-ESI: 610 (M+1).

Step 3: N-(amino(5-(2-hydroxypropan-2-yl)thiazol-2-yl)(oxo)-λ.SUP.6.-sulfaneylidene)-2-(4-(3-hydroxyoxetan-3-yl)-2,6-diisopropylphenyl)acetamide

(1917) Into a 50-mL round-bottom flask, was placed N-[[(tert-butyldimethylsilyl)amino][5-(2-hydroxypropan-2-yl)-1,3-thiazol-2-yl]oxo-λ.sup.6-sulfanylidene]-2-[4-(3-hydroxyoxetan-3-yl)-2,6-bis(propan-2-yl)phenyl]acetamide (200 mg, 0.33 mmol) in THF (2 mL), to the stirred solution was added HCl/dioxane (4 M, 5 mL). The resulting solution was stirred overnight at RT. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC with the following conditions: Column, XBridge Prep C.sub.18 OBD, 5 um, 19*150 mm; mobile phase, water (10 mM NH.sub.4HCO.sub.3) and ACN (5% to 40% ACN gradient over 8 min); Detector, UV 254/210 nm. This resulted in 14.0 mg (8.61%) of Example 93 as a white solid. MS-ESI: 496.3 (M+1). 41-NMR: (DMSO-d.sub.6, 400 MHz): δ 7.40 (s, 1H), 7.23 (s, 2H), 6.14 (s, 1H), 5.54 (s, 1H), 4.73-4.66 (m, 4H), 3.92 (s, 1H), 3.49-3.46 (m, 2H), 3.31-3.22 (m, 2H), 1.47 (s, 6H), 1.12 (d, J=8.4 Hz, 6H), 1.10 (d, J=8.4 Hz, 6H).

Step 4: N-(amino(5-(2-hydroxypropan-2-yl)thiazol-2-yl)(oxo)-λ.SUP.6.-sulfaneylidene)-2-(4-(3-fluorooxetan-3-yl)-2,6-diisopropylphenyl)acetamide

(1918) Into a 50-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed N-[amino[5-(2-hydroxypropan-2-yl)-1,3-thiazol-2-yl]oxo-λ.sup.6-sulfanylidene]-2-[4-(3-hydroxyoxetan-3-yl)-2,6-bis(propan-2-yl)phenyl]acetamide (83 mg, 0.17 mmol) in THF (5 mL). This was followed by the addition of a solution of DAST (54.0 mg, 0.33 mmol) in DCM (1 mL) dropwise with stirring at 0° C. The resulting solution was stirred overnight at RT. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC with the following conditions: Column, XBridge BEH130 Prep C.sub.18 OBD, 19×150 mm, 5 um 13 nm; mobile phase, water (10 mM NH.sub.4HCO.sub.3) and ACN (30% to 60% ACN gradient in 7 min); Detector, UV 254/210 nm. This resulted in 15.1 mg (17.9%) of Example 94 as a white solid. MS-ESI: 498.2 (M+1). .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ 7.96 (s, 2H), 7.76 (s, 1H), 7.18 (s, 2H), 5.87 (s, 1H), 4.98-4.87 (m, 4H), 3.77-3.65 (m, 2H), 3.13-3.05 (m, 2H), 1.51 (s, 6H), 1.13 (d, J=8.4 Hz, 6H), 1.11 (d, J=8.4 Hz, 6H).

(1919) TABLE-US-00026 TABLE 19 Examples in the following table were prepared using similar conditions as described in Example 94 and Scheme 1B from appropriate materials Exact Example Compound Mass # # Structure IUPAC Name [M + H].sup.+ 95 245 embedded image N-(amino(2-(2-hydroxypropan- 2-yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4-fluoro-2,6- dipropylphenyl)acetamide 442

Example 96 (Compound 244)

(1920) ##STR00782##

N-(amino(2-(2-hydroxypropan-2-yl)thiazol-5-yl)(oxo)-λ.SUP.6.-sulfaneylidene)-2-(4-fluoro-2,6-diisopropylphenyl)propanamide (Scheme 1C)

(1921) ##STR00783##

Step 1: 2-(4-Fluoro-2,6-diisopropylphenyl)propanoyl chloride

(1922) Into a 50-mL round-bottom flask, was placed 2-[4-fluoro-2,6-bis(propan-2-yl)phenyl]propanoic acid (200 mg, 0.79 mmol) in DCM (20 mL), this was followed by the addition of oxalic dichloride (2 mL). The resulting solution was stirred for 15 min at RT. The resulting mixture was concentrated. This resulted in 200 mg (93.1%) of the title compound as off-white oil.

Step 2: Tert-butyl(N-(2-(4-fluoro-2,6-diisopropylphenyl)propanoyl)-2-(2-hydroxypropan-2-yl) thiazole-5-sulfonimidoyl)carbamate

(1923) Into a 50-mL round-bottom flask, was placed tert-butyl N-[amino[2-(2-hydroxypropan-2-yl)-1,3-thiazol-5-yl] methylidene-λ.sup.6-sulfanylidene]carbamate (235.9 mg, 0.74 mmol) in THF (20 mL). To the mixture was added 2-[4-fluoro-2,6-bis(propan-2-yl)phenyl]propanoyl chloride (200 mg, 0.74 mmol) and NaH (60% wt. oil dispersion, 59.2 mg, 1.48 mmol). The resulting solution was stirred for 16 h at RT. The reaction was then quenched by the addition of 20 mL of water. The resulting solution was extracted with 3×20 ml of ethyl acetate, dried over anhydrous sodium sulfate, and concentrated. The resulting mixture was concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:1). This resulted in 200 mg (48.9%) of the title compound as an off-white solid. MS-ESI: 556 (M+1).

Step 3: N-(amino(2-(2-hydroxypropan-2-yl)thiazol-5-yl)(oxo)-λ.SUP.6.-sulfaneylidene)-2-(4-fluoro-2,6-diisopropylphenyl)propanamide

(1924) Into a 50-mL round-bottom flask, was placed tert-butyl N-[([2-[4-fluoro-2,6-bis(propan-2-yl)phenyl]propanoyl]imino)[2-(2-hydroxypropan-2-yl)-1,3-thiazol-5-yl]methylidene-λ.sup.6-sulfanyl]carbamate (100 mg, 0.18 mmol) in THF (5 mL). To the stirred solution was added HCl/dioxane (10 mL, 4 M) dropwise. The resulting solution was stirred for 16 h at RT. The resulting mixture was concentrated. The crude product was purified by Prep-HPLC with the following conditions: Column: XBridge Shield RP18 OBD Column 19*250 mm, 10 um; Mobile Phase A: water (10 mM NH.sub.4HCO.sub.3), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 27% B to 45% B in 9 min; 254/210 nm; Rt: 7.77 min. This resulted in 20 mg (24.4%) of Example 96 as a white solid. MS-ESI: 456.2 (M+1). .sup.1H-NMR (400 MHz, DMSO-d.sub.6, ppm) δ: 8.00-7.92 (m, 3H), 7.05-6.91 (m, 2H), 6.25 (s, 1H), 3.87-3.81 (m, 1H), 3.16-2.98 (m, 2H), 1.49 (s, 6H), 1.27-1.24 (m, 3H), 1.19-1.13 (m, 12H).

(1925) TABLE-US-00027 TABLE 20 Examples in the following table were prepared using similar conditions as described in Example 96 and Scheme 1C from appropriate starting materials. Exact Example Compound Mass # # Structure IUPAC Name [M + H].sup.+ 97 221 embedded image N-(amino(2-(2- hydroxypropan-2-yl)thiazol- 5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4- (isochroman-7-yl)-2,6- diisopropylphenyl)acetamide 556 98 220 embedded image N-(amino(2-(2- hydroxypropan-2-yl)thiazol- 5-yl(oxo)-λ.sup.6- sulfaneylidene)-2-(2- cyclopropyl-4-fluoro-6- (trifluoromethyl)phenyl) acetamide 466 99 304 embedded image tert-butyl (N-(2-(5-fluoro- 2,4-diisopropyl-6-(3- (trifluoromethyl)phenyl) pyridin-3-yl)acetyl)-2-(2- hydroxypropan-2- yl)thiazole-5- sulfonimidoyl)carbamate 687 100 301 embedded image N-(amino(2-(2- hydroxypropan-2-yl)thiazol- 5-yl(oxo)-λ.sup.6- sulfaneylidene)-2-(5-fluoro- 2,4-diisopropyl-6-(3- (trifluoromethyl)phenyl) pyridin-3-yl)acetamide 587 101 212 embedded image N-(amino(4- ((dimethylamino)methyl) phenyl)(oxo)-λ.sup.6-sulfaneylidene)- 2-(5-fluoro-2,4- diisopropylpyridin-3- yl)acetamide 435

Example 102 (Compound 240)

(1926) ##STR00789##

N-(amino(2-(2-hydroxypropan-2-yl)thiazol-5-yl)(oxo)-λ.SUP.6.-sulfaneylidene)-2-(4-fluoro-2-isopropyl-6-(tetrahydrofuran-3-yl)phenyl)acetamide (Scheme 1C)

(1927) ##STR00790##

Step 1: 2-(2-Bromo-4-fluoro-6-isopropylphenyl)acetyl chloride

(1928) Into a 100-mL round-bottom flask, was placed 2-[2-bromo-4-fluoro-6-(propan-2-yl)phenyl]acetic acid (100 mg, 0.36 mmol) in DCM (25 mL) and DMF (0.01 mL). To the above solution was added oxalic dichloride (0.5 mL) dropwise. The resulting solution was stirred for 30 min at RT. The resulting mixture was concentrated. This resulted in 100 mg (93.7%) of the title compound as yellow oil.

Step 2: Tert-butyl (N-(2-(2-bromo-4-fluoro-6-isopropylphenyl)acetyl)-2-(2-hydroxypropan-2-yl) thiazole-5-sulfonimidoyl)carbamate

(1929) Into a 100-mL round-bottom flask, was placed tert-butyl N-[amino[2-(2-hydroxypropan-2-yl)-1,3-thiazol-5-yl]oxo-λ.sup.6-sulfanylidene]carbamate (116.7 mg, 0.36 mmol) in THF (25 mL). To the mixture was added NaH (60% wt. oil dispersion, 29.2 mg, 0.73 mmol) in portions with stirring. The resulting solution was stirred for 30 min at RT. 2-[2-bromo-4-fluoro-6-(propan-2-yl)phenyl]acetyl chloride (100 mg, 0.34 mmol) was added to the solution. The resulting solution was stirred for an additional 1 h at RT. The reaction was then quenched by the addition of 5 mL of water. The resulting solution was extracted with 2×10 ml of ethyl acetate and concentrated. This resulted in 219 mg (crude) title compound as a white solid. MS-ESI: 578 (M+1).

Step 3: Tert-butyl (N-(2-(2-(2,5-dihydrofuran-3-yl)-4-fluoro-6-isopropylphenyl)acetyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidoyl)carbamate

(1930) Into a 100-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed tert-butyl (N-(2-(2-bromo-4-fluoro-6-isopropylphenyl)acetyl)-2-(2-hydroxypropan-2-yl) thiazole-5-sulfonimidoyl)carbamate (395 mg, 0.68 mmol) in dioxane (60 mL) and H.sub.2O (12 mL). This was followed by the addition of Cs.sub.2CO.sub.3 (667.4 mg, 2.05 mmol), 2-(2,5-dihydrofuran-3-yl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (201 mg, 1.02 mmol) and Pd(dppf)Cl.sub.2 (50 mg, 0.07 mmol). The resulting solution was stirred for 16 h at 95′ C in an oil bath. The resulting solution was diluted with H.sub.2O (50 mL), extracted with 2×15 ml of ethyl acetate and concentrated. The residue was eluted from silica gel with ethyl acetate/petroleum ether (1:1). This resulted in 187 mg (50.9%) of the title compound as a dark orange solid. MS-ESI: 568 (M+1).

Step 4: Tert-butyl (N-(2-(4-fluoro-2-isopropyl-6-(tetrahydrofuran-3-yl)phenyl)acetyl)-2-(2-hydroxypropan-2-yl)thiazole-5-sulfonimidoyl)carbamate

(1931) Into a 100-mL round-bottom flask, was placed tert-butyl N-([2-[2-(2,5-dihydrofuran-3-yl)-4-fluoro-6-(propan-2-yl)phenyl]acetamido][2-(2-hydroxypropan-2-yl)-1,3-oxazol-5-yl]oxo-λ.sup.6-sulfanylidene)carbamate (237 mg, 0.43 mmol) in methanol (25 mL). To the above solution was added Pd/C (10% wt., 30 mg) with stirring. The solution was evacuated and filled three times with hydrogen. The resulting solution was stirred for 16 h at RT. The solids were filtered out. The resulting mixture was concentrated. The residue was eluted from silica gel with DCM/methanol (10:1). This resulted in 234 mg (98.3%) of the title compound as a white solid. MS-ESI: 570 (M+1).

Step 5: N-(amino(2-(2-hydroxypropan-2-yl)thiazol-5-yl)(oxo)-λ.SUP.6.-sulfaneylidene)-2-(4-fluoro-2-isopropyl-6-(tetrahydrofuran-3-yl)phenyl)acetamide

(1932) Into a 50-mL round-bottom flask, was placed tert-butyl N-[([2-[4-fluoro-2-(oxolan-3-yl)-6-(propan-2-yl)phenyl]acetyl]imino)[2-(2-hydroxypropan-2-yl)-1,3-thiazol-5-yl]oxo-λ.sup.6-sulfanyl]carbamate (200 mg, 0.35 mmol) in HCl/dioxane (4M, 10 mL). The resulting solution was stirred for 1 h at RT. The resulting mixture was concentrated. The crude product was purified by Prep-HPLC with the following conditions: Column, XBridge Prep C.sub.18 OBD, 5 um, 19*150 mm; mobile phase, water (10 mM NH.sub.4HCO.sub.3) and ACN (7% to 45% ACN gradient in 7 min); Detector, UV 254/210 nm. This resulted in 20 mg (12.13%) of Example 102 as a white solid. MS-ESI: 470 (M+1).

(1933) .sup.1H-NMR (400 MHz, DMSO-d.sub.6, ppm) δ: 8.06 (br s, 2H), 7.03 (d, J=8.0 Hz, 1H), 7.03 (d, J=12.4 Hz, 1H), 6.28 (s, 1H), 4.01-3.97 (m, 1H), 3.91-3.89 (m, 1H), 3.79-3.77 (m, 1H), 3.55 (s, 2 H), 3.55-3.45 (m, 3H), 2.91-2.86 (m, 1H), 2.25-2.23 (m, 1H), 1.48 (s, 6H), 1.06 (d, J=6.8 Hz, 3H), 1.01 (d, J=6.8 Hz, 3H).

(1934) TABLE-US-00028 TABLE 21 Examples in the following table were prepared using similar conditions as described in Example 4 and Scheme 2 from appropriate starting materials. Exact Example Compound Mass # # Structure IUPAC Name [M + H].sup.+ 103 258 embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3-fluoro- 2,6- diisopropylphenyl)acetamide 442 104 257 embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4- chloro-6-cyclopropyl-3- fluoro-2- isopropylphenyl)acetamide 474 105 256 embedded image N-(amino(4-(2- hydroxypropan-2- yl)thiophen-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(2,6- diisopropyl-4- (methoxymethyl)phenyl) acetamide 467 106 201 embedded image N-(amino(4-(2- hydroxypropan-2- yl)thiophen-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3-fluoro- 2,6- diisopropylphenyl)acetamide 441 107 255 embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(2,6- diisopropyl-4-(1H-pyrazol- 1-yl)phenyl)acetamide 490 108 254 embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(2,6- diisopropyl-4- (methoxymethyl)phenyl) acetamide 468 109 253 embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3-fluoro- 2,6-diisopropyl-4- (methoxymethyl)phenyl) acetamide 486 110 252 embedded image N-(amino(5-(2- hydroxypropan-2- yl)thiazol-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(2,6- diisopropyl-4-(naphthalen- 2-yl)phenyl)acetamide 550 111 251 embedded image N-(amino(5-(2- hydroxypropan-2- yl)thiazol-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(2,6- diisopropyl-4- (methoxymethyl)phenyl) acetamide 468 112 250 00embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3′,4′- dichloro-3,5-diisopropyl- [1,1′-biphenyl]-4- yl)acetamide 568 113 249 01embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(2,6- diisopropyl-4-(naphthalen- 2-yl)phenyl)acetamide 550 114 248 02embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3-cyano- 2,6- diisopropylphenyl)acetamide 449 115 247 03embedded image N-(amino(4- (hydroxymethyl)-2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4-cyano- 6-cyclopropyl-3-fluoro-2- isopropylphenyl)acetamide 495 116 246 04embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(2,6- diisopropyl-4-(6- methoxynaphthalen-2- yl)phenyl)acetamide 580 117 309 05embedded image N-(amino(5-(2- hydroxypropan-2- yl)thiazol-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4-(2,2- difluorobenzo[d][1,3]dioxol- 5-yl)-2,6- diisopropylphenyl)acetamide 580 118 310 06embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4-(2,2- difluorobenzo[d][1,3]dioxol- 5-yl)-2,6- diisopropylphenyl)acetamide 580 119 243 07embedded image N-(amino(4-(2- hydroxypropan-2- yl)thiazol-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3-fluoro- 2,6- diisopropylphenyl)acetamide 442 120 242 08embedded image N-(amino(4-(2- hydroxypropan-2- yl)thiazol-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3-cyano- 2,6- diisopropylphenyl)acetamide 449 121 239 09embedded image N-(amino(5-(2- hydroxypropan-2- yl)thiazol-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3,5- diisopropyl-3′,4′-dimethyl- [1,1′-biphenyl]-4- yl)acetamide 528 122 238 0embedded image N-(amino(5-(2- hydroxypropan-2- yl)thiazol-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3′,4′- dichloro-3,5-diisopropyl- [1,1′-biphenyl]-4- yl)acetamide 568 123 237 embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4-cyano- 3-fluoro-2,6- diisopropylphenyl)acetamide 467 124 236 embedded image N-(amino(4-(2- hydroxypropan-2- yl)thiazol-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3,4- difluoro-2,6- diisopropylphenyl)acetamide 460 125 234 embedded image N-(amino(5-(2- hydroxypropan-2- yl)thiophen-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3-fluoro- 2,6- diisopropylphenyl)acetamide 441 126 233 embedded image N-(amino(5-(2- hydroxypropan-2- yl)thiazol-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(2,6- diisopropyl-4-(6- methoxynaphthalen-2- yl)phenyl)acetamide 580 127 232 embedded image 2-(2-(N′-(2-(4-fluoro-2,6- diisopropylphenyl)acetyl) sulfamidimidoyl)thiazol-5- yl)-2-methylpropanoic acid 470 128 120 embedded image N-(amino(4- ((dimethylamino)methyl)-2- fluorophenyl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4-cyano- 6-cyclopropyl-3-fluoro-2- isopropylphenyl)acetamide 475 129 229 embedded image N-(amino(4-(2- hydroxypropan-2-yl)-5- methylthiophen-2-yl)(oxo)- λ.sup.6-sulfaneylidene)-2-(3- fluoro-2,6- diisopropylphenyl)acetamide 455 130 228 embedded image N-(amino(5-(2- hydroxypropan-2- yl)thiazol-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3-fluoro- 2,6- diisopropylphenyl)acetamide 442 132 227 embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4,6- diisopropyl-1,3- dihydroisobenzofuran-5- yl)acetamide 466 133 226 0embedded image N-(amino(4-(2- hydroxypropan-2- yl)thiazol-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4-cyano- 3-fluoro-2,6- diisopropylphenyl)acetamide 467 134 225 embedded image N-(amino(4- ((dimethylamino)methyl) phenyl(oxo)-λ.sup.6- sulfaneylidene)-2-(4,6- diisopropyl-1,3- dihydroisobenzofuran-5- yl)acetamide 458 135 224 embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(5- isopropyl-2,3-dihydro-1H- inden-4-yl)acetamide 422 136 191 embedded image N-(amino(4- ((dimethylamino)methyl) phenyl)(oxo)-λ.sup.6- sulfaneylidene)-2-(2,6- diisopropyl-4-(naphthalen- 2-yl)phenyl)acetamide 542 137 222 embedded image N-(amino(4- (hydroxymethyl)-2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4- (isochroman-6-yl)-2,6- diisopropylphenyl)acetamide 586 138 307 embedded image tert-butyl (2-(2- hydroxypropan-2-yl)-N-(2- (4-(isochroman-6-yl)-2,6- diisopropylphenyl)acetyl) thiazole-5- sulfonimidoyl)carbamate 656 139 231 embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4- (isochroman-6-yl)-2,6- diisopropylphenyl)acetamide 556 140 306 embedded image tert-butyl (N-(2-(4- ((cyclopentyloxy)methyl)- 2,6- diisopropylphenyl)acetyl)- 2-(2-hydroxypropan-2- yl)thiazole-5- sulfonimidoyl)carbamate 622 141 305 embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4- ((cyclopentyloxy)methyl)- 2,6- diisopropylphenyl)acetamide 522 142 216 embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4,6- diisopropyl-2,3-dihydro- 1H-inden-5-yl)acetamide 464 143 215 0embedded image 2-(2,4-diisopropyl-6- methoxypyridin-3-yl)-N- ((5-(2-hydroxypropan-2- yl)thiazol-2- yl)sulfonyl)acetamide 456 144 203 embedded image N-(amino(5-(2- hydroxypropan-2- yl)thiazol-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(5-fluoro- 2,4-diisopropylpyridin-3- yl)acetamide 443 145 213 embedded image N-(amino(4-(2- hydroxypropan-2- yl)thiophen-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(5-fluoro- 2,4-diisopropylpyridin-3- yl)acetamide 442 146 204 embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(5-fluoro- 2,4-diisopropylpyridin-3- yl)acetamide 443 147 202 embedded image N-(amino(4-(2- hydroxypropan-2- yl)thiazol-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(5-fluoro- 2,4-diisopropylpyridin-3- yl)acetamide 443 148 211 embedded image N-(amino(1-isopropyl-1H- pyrazol-3-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(5-fluoro- 2,4-diisopropylpyridin-3- yl)acetamide 410 149 210 embedded image N-(amino(3-fluoro-5-(2- hydroxypropan-2- yl)thiophen-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(5-fluoro- 2,4-diisopropylpyridin-3- yl)acetamide 460 150 209 embedded image N-(amino(3-fluoro-5-(2- hydroxypropan-2- yl)thiophen-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3,5- diisopropyl-2- methylpyridin-4- yl)acetamide 456 151 208 embedded image N-(amino(4-(2- hydroxypropan-2- yl)thiophen-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(6-cyano- 2,4-diisopropylpyridin-3- yl)acetamide 449 152 207 embedded image N-(amino(4-(2- hydroxypropan-2- yl)thiophen-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(2,4- diisopropyl-6- (methoxymethyl)pyridin-3- yl)acetamide 468 153 206 0embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4,6- diisopropyl-2- (trifluoromethyl)pyrimidin- 5-yl)acetamide 494 154 205 embedded image N-(amino(2-(2- hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(2-fluoro- 3,5-diisopropylpyridin-4- yl)acetamide 443 220 263 embedded image N-(amino(4-(2- hydroxypropan-2- yl)thiophen-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4,6- diisopropyl-1,3- dihydroisobenzofuran-5- yl)acetamide 465 221 264 embedded image N-(amino(1-isopropyl-1H- pyrazol-3-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4,6- diisopropyl-1,3- dihydroisobenzofuran-5- yl)acetamide 433

(1935) TABLE-US-00029 TABLE 22 Examples in the following table were obtained from chiral HPLC resolutions of racemic examples described above. The chiral column and eluents are listed in the table. As a convention, the faster-eluting enantiomer is always listed first in the table followed by the slower-eluting enantiomer of the pair. The symbol * at a chiral center denotes that this chiral center has been resolved and the absolute stereochemistry at that center has not been determined. Assigned stereochemistry in compound names are tentative. LC-MS Example # Compound # Structure IUPAC Name Column Eluents [M + H].sup.+ 155 261b embedded image (R) or (S)-N-(amino(2-chloro- 4-(2-hydroxypropan-2- yl)phenyl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4-cyano- 2,6- diisopropylphenyl)acetamide CHIRALPAK ID, 2*25 cm (5 um) IPA in Hex (0.1% FA) 476 156 261a embedded image (S) or (R)-N-(amino(2-chloro- 4-(2-hydroxypropan-2- yl)phenyl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4-cyano- 2,6- diisopropylphenyl)acetamide CHIRALPAK ID, 2*25 cm (5 um) IPA in Hex (0.1% FA) 476 157 256a embedded image (R) or (S)-N-(amino(4-(2- hydroxypropan-2-yl)thiophen- 2-yl)(oxo)-λ.sup.6-sulfaneylidene)- 2-(2,6-diisopropyl-4- (methoxymethyl)phenyl) acetamide CHIRALPAK ID, 2*25 cm (5 um) IPA in Hex:DC M = 5:1 465 ( M − 1) 158 256b embedded image (S) or (R)-N-(amino(4-(2- hydroxypropan-2-yl)thiophen- 2-yl)(oxo)-λ.sup.6-sulfaneylidene)- 2-(2,6-diisopropyl-4- (methoxymethyl)phenyl) acetamide CHIRALPAK ID, 2*25 cm (5 um) IPA in Hex:DC M = 5:1 465 (M − 1) 159 201b embedded image (R) or (S)-N-(amino(4-(2- hydroxypropan-2-yl)thiophen- 2-yl)(oxo)-λ.sup.6-sulfaneylidene)- 2-(3-fluoro-2,6- diisopropylphenyl)acetamide CHIRALPAK ID, 2*25 cm (5 um) IPA in Hex:DC M = 5:1 441 160 201a embedded image (S) or (R)-N-(amino(4-(2- hydroxypropan-2-yl)thiophen- 2-yl)(oxo)-λ.sup.6-sulfaneylidene)- 2-(3-fluoro-2,6- diisopropylphenyl)acetamide CHIRALPAK ID, 2*25 cm (5 um) IPA in Hex:DC M = 5:1 441 161 258a 0embedded image (R) or (S)-N-(amino(2-(2- hydroxypropan-2-yl)thiazol-5- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (3-fluoro-2,6- diisopropylphenyl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 440 (M − 1) 162 258b embedded image (S) or (R)-N-(amino(2-(2- hydroxypropan-2-yl)thiazol-5- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (3-fluoro-2,6- diisopropylphenyl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 440 (M − 1) 163 249a embedded image (R) or (S)-N-(amino(2-(2- hydroxypropan-2-yl)thiazol-5- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (2,6-diisopropyl-4- (naphthalen-2- yl)phenyl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 550 164 249b embedded image (S) or (R)-N-(amino(2-(2- hydroxypropan-2-yl)thiazol-5- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (2,6-diisopropyl-4- (naphthalen-2- yl)phenyl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 550 165 309b embedded image (S) or (R)-N-(amino(5-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (4-(2,2- difluorobenzo[d][1,3]dioxol- 5-yl)-2,6- diisopropylphenyl)acetamide CHIRALPAK IF, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 580 166 309a embedded image (R) or (S)-N-(amino(5-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (4-(2,2- difuorobenzo[d][1,3]dioxol- 5-yl)-2,6- diisopropylphenyl)acetamide CHIRALPAK IF, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 580 167 239a embedded image (S) or (R)-N-(amino(5-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (3,5-diisopropyl-3′,4′- dimethyl-[1,1′-biphenyl]-4- yl)acetamide CHIRALPAK IF, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 528 168 239b embedded image (R) or (S)-N-(amino(5-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (3,5-diisopropyl-3′,4′- dimethyl-[1,1′-biphenyl]-4- yl)acetamide CHIRALPAK IF, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 528 169 238a embedded image (S) or (R)-N-(amino(5-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (3′,4′-dichloro-3,5- diisopropyl-[1,1′-biphenyl]-4- yl)acetamide CHIRALPAK IF, 2*25 cm, 5 um IPA in Hex (0.1% FA) 568 170 238b embedded image (R) or (S)-N-(amino(5-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (3′,4′-dichloro-3,5- diisopropyl-[1,1′-biphenyl]-4- yl)acetamide CHIRALPAK IF, 2*25 cm, 5 um IPA in Hex (0.1% FA) 568 171 221a 0embedded image (R) or (S)-N-(amino(2-(2- hydroxypropan-2-yl)thiazol-5- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (4-(isochroman-7-yl)-2,6- diisopropylphenyl)acetamide CHIRALPAK IF, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 556 172 221b embedded image (S) or (R)-N-(amino(2-(2- hydroxypropan-2-yl)thiazol-5- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (4-(isochroman-7-yl)-2,6- diisopropylphenyl)acetamide CHIRALPAK IF, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 556 173 229a embedded image (R) or (S)-N-(amino(4-(2- hydroxypropan-2-yl)-5- methylthiophen-2-yl)(oxo)- λ.sup.6-sulfaneylidene)-2-(3- fluoro-2,6- diisopropylphenyl)acetamide CHIRALPAK IC, 2*25 cm, 5 um IPA in Hex (0.1% FA) 455 174 229b embedded image (S) or (R)-N-(amino(4-(2- hydroxypropan-2-yl)-5- methylthiophen-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3-fluoro- 2,6- diisopropylphenyl)acetamide CHIRALPAK IC, 2*25 cm, 5 um IPA in Hex (0.1% FA) 455 175 234b embedded image (S) or (R)-N-(amino(5-(2- hydroxypropan-2-yl)thiophen- 2-yl)(oxo)-λ.sup.6-sulfaneylidene)- 2-(3-fluoro-2,6- diisopropylphenyl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 441 176 234a embedded image (R) or (S)-N-(amino(5-(2- hydroxypropan-2-yl)thiophen- 2-yl)(oxo)-λ.sup.6-sulfaneylidene)- 2-(3-fluoro-2,6- diisopropylphenyl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 441 177 236a embedded image (R) or (S)-N-(amino(4-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (3,4-difluoro-2,6- diisopropylphenyl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 460 178 236b embedded image (S) or (R)-N-(amino(4-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (3,4-difluoro-2,6- diisopropyiphenyl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 460 179 242a embedded image (R) or (S)-N-(amino(4-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (3-cyano-2,6- diisopropylphenyl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 449 180 242b embedded image (S) or (R)-N-(amino(4-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (3-cyano-2,6- diisopropylphenyl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 449 181 243a 0embedded image (R) or (S)-N-(amino(4-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (3-fluoro-2,6- diisopropylphenyl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 442 182 243b embedded image (S) or (R)-N-(amino(4-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (3-fluoro-2,6- diisopropylphenyl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 442 183 227a embedded image (R) or (S)-N-(amino(2-(2- hydroxypropan-2-yl)thiazol-5- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (4,6-diisopropyl-1,3- dihydroisobenzofuran-5- yl)acetamide Chiralpak IA, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 466 184 227b embedded image (S) or (R)-N-(amino(2-(2- hydroxypropan-2-yl)thiazol-5- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (4,6-diisopropyl-1,3- dihydroisobenzofuran-5- yl)acetamide Chiralpak IA, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 466 185 251b embedded image (R) or (S)-N-(amino(5-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (2,6-diisopropyl-4- (methoxymethyl)phenyl) acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 468 186 251a embedded image (S) or (R)-N-(amino(5-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (2,6-diisopropyl-4- (methoxymethyl)phenyl) acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 468 187 228a embedded image (S) or (R)-N-(amino(5-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (3-fluoro-2,6- diisopropylphenyl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 442 188 228b embedded image (R) or (S)-N-(amino(5-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (3-fluoro-2,6- diisopropylphenyl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 442 189 226a embedded image (S) or (R)-N-(amino(4-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (4-cyano-3-fluoro-2,6- diisopropylphenyl)acetamide CHIRALPAK IG, 20*250 mm, 5 um IPA in Hex (0.1% FA) 467 190 226b embedded image (R) or (S)-N-(amino(4-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (4-cyano-3-fluoro-2,6- diisopropylphenyl)acetamide CHIRALPAK IG, 20*250 mm, 5 um IPA in Hex (0.1% FA) 467 191 225a 0embedded image (R) or (S)-N-(amino(4- ((dimethylamino)methyl)phenyl) (oxo)-λ.sup.6-sulfaneylidene)-2- (4,6-diisopropyl-1,3- dihydroisobenzofuran-5- yl)acetamide Chiralpak ID, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3•MeOH) 458 192 225b embedded image (S) or (R)-N-(amino(4- ((dimethylamino)methyl)phenyl) (oxo)-λ.sup.6-sulfaneylidene)-2- (4,6-diisopropyl-1,3- dihydroisobenzofuran-5- yl)acetamide Chiralpak ID, 2*25 cm, 5 um EtOH in Hex (8 mM NH.sub.3•MeOH) 458 193 224b embedded image (S, S) and (S, R)-N-(amino(2- (2-hydroxypropan-2- yl)thiazol-5-yl(oxo)-λ.sup.6- sulfaneylidene)-2-(4-fluoro- 2,6- diisopropylphenyl) propanamide Chiralpak IA, 2*25 cm, 5 um IPA in Hex (0.1% FA) 456 194 244ba embedded image (R, S) or (R, R)-N-(amino(2- (2-hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4-fluoro- 2,6- diisopropylphenyl) propanamide Chiralpak IA, 2*25 cm, 5 um IPA in Hex (0.1% FA) 456 195 244aa embedded image (R, R) or (R, S)-N-(amino(2- (2-hydroxypropan-2- yl)thiazol-5-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4-fluoro- 2,6- diisopropylphenyl) propanamide Chiralpak IA, 2*25 cm, 5 um IPA in Hex (0.1% FA) 456 196 220a embedded image (R) or (S)-N-(amino(2-(2- hydroxypropan-2-yl)thiazol-5- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (2-cyclopropyl-4-fluoro-6- (trifluoromethyl)phenyl) acetamide Chiralpak IC, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 466 197 220b embedded image (S) or (R)-N-(amino(2-(2- hydroxypropan-2-yl)thiazol-5- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (2-cyclopropyl-4-fluoro-6- (trifluoromethyl)phenyl) acetamide Chiralpak IC, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 466 198 218a embedded image (R) or (S)-N-(amino(1- methyl-1H-indazol-5- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (3-fluoro-2,6- diisopropylphenyl)acetamide CHIRALPAK IG, 2*25 cm, (5 um) EtOH in Hex (8 mM NH.sub.3•MeOH) 431 199 218b embedded image (S) or (R)-N-(amino(1- methyl-1H-indazol-5- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (3-fluoro-2,6- diisopropylphenyl)acetamide CHIRALPAK IG, 2*25 cm, (5 um) EtOH in Hex (8 mM NH.sub.3•MeOH) 431 200 217a embedded image (R) or (S)-N-(amino(5- ((dimethylamino)methyl) pyridin-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3-fluoro- 2,6- diisopropylphenyl)acetamide CHIRALPAK ID, 2*25 cm, (5 um) IPA in Hex (8 mM NH.sub.3•MeOH) 435 201 217b 0embedded image (S) or (R)-N-(amino(5- ((dimethylamino)methyl) pyridin-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(3-fluoro- 2,6- diisopropylphenyl)acetamide CHIRALPAK ID, 2*25 cm, (5 um) IPA in Hex (8 mM NH.sub.3•MeOH) 435 202 303 embedded image N-(amino(2-(2- hydroxypropan-2-yl)thiazol-5- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (5-fluoro-2,4-diisopropyl-6- (3- (trifluoromethyl)phenyl) pyridin-3-yl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 587 203 302 embedded image (S) or (R)-N-(amino(2-(2- hydroxypropan-2-yl)thiazol-5- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (5-fluoro-2,4-diisopropyl-6- (3- (trifluoromethyl)phenyl) pyridin-3-yl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 587 204 203b embedded image N-(amino(5-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (5-fluoro-2,4- diisopropylpyridin-3- yl)acetamide CHIRALPAK IF, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 443 205 203a embedded image (S) or (R)-N-(amino(5-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (5-fluoro-2,4- diisopropylpyridin-3- yl)acetamide CHIRALPAK IF, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 443 206 202a embedded image N-(amino(4-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (5-fluoro-2,4- diisopropylpyridin-3- yl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 443 207 202b embedded image (S) or (R)-N-(amino(4-(2- hydroxypropan-2-yl)thiazol-2- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (5-fluoro-2,4- diisopropylpyridin-3- yl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 443 208 213a embedded image N-(amino(4-(2- hydroxypropan-2-yl)thiophen- 2-yl)(oxo)-λ.sup.6-sulfaneylidene)- 2-(5-fIuoro-2,4- diisopropylpyridin-3- yl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 442 209 213b embedded image (S) or (R)-N-(amino(4-(2- hydroxypropan-2-yl)thiophen- 2-yl)(oxo)-λ.sup.6-sulfaneylidene)- 2-(5-fluoro-2,4- diisopropylpyridin-3- yl)acetamide Chiralpak ID, 2*25 cm, 5 um IPA in Hex (0.1% FA) 442 210 210a embedded image (S) or (R)-N-(amino(3-fluoro- 5-(2-hydroxypropan-2- yl)thiophen-2-yl)(oxo)-λ.sup.6- sulfaneylidene)-2-(5-fluoro- 2,4-diisopropylpyridin-3- yl)acetamide CHIRALPAK IG, 20*250 mm, 5 um IPA in Hex (0.1% FA) 460 211 210b 00embedded image N-(amino(3-fluoro-5-(2- hydroxypropan-2-yl)thiophen- 2-yl)(oxo)-λ.sup.6-sulfaneylidene)- 2-(5-fluoro-2,4- diisopropylpyridin-3- yl)acetamide CHIRALPAK IG, 20*250 mm, 5 um IPA in Hex (0.1% FA) 460 212 216a 01embedded image (R) or (S)-N-(amino(2-(2- hydroxypropan-2-yl)thiazol-5- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (4,6-diisopropyl-2,3-dihydro- 1H-inden-5-yl)acetamide Chiralpak ID, 2*25 cm, 5 um EtOH in MTBE (0.1% FA) 464 213 216b 02embedded image (S) or (R)-N-(amino(2-(2- hydroxypropan-2-yl)thiazol-5- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (4,6-diisopropyl-2,3-dihydro- 1H-inden-5-yl)acetamide Chiralpak ID, 2*25 cm, 5 um EtOH in MTBE (0.1% FA) 464 214 110a′ 03embedded image (R) or (S)-N-(amino(4- ((dimethylamino)methyl)-2- fluorophenyl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4- (difluoromethyl)-2,6- diisopropylphenyl)acetamide CHIRALPAK IG, 2*25 cm, (5 um) EtOH in Hex (8 mM NH.sub.3•MeOH) 484 215 110b′ 04embedded image (S) or (R)-N-(amino(4- ((dimethylamino)methyl)-2- fluorophenyl)(oxo)-λ.sup.6- sulfaneylidene)-2-(4- (difluoromethyl)-2,6- diisopropylphenyl)acetamide CHIRALPAK IG, 2*25 cm, (5 um) EtOH in Hex (8 mM NH.sub.3•MeOH) 484 216 263a 05embedded image (R) or (S)-N-(amino(4-(2- hydroxypropan-2-yl)thiophen- 2-yl)(oxo)-λ.sup.6-sulfaneylidene)- 2-(4,6-diisopropyl-1,3- dihydroisobenzofuran-5- yl)acetamide CHIRALPAK IG, 2*25 cm, (5 um) EtOH in Hex (8 mM NH.sub.3•MeOH) 465 217 263b 06embedded image (S) or (R)-N-(amino(4-(2- hydroxypropan-2-yl)thiophen- 2-yl)(oxo)-λ.sup.6-sulfaneylidene)- 2-(4,6-diisopropyl-1,3- dihydroisobenzofuran-5- yl)acetamide CHIRALPAK IG, 2*25 cm, (5 um) EtOH in Hex (8 mM NH.sub.3•MeOH) 465 218 264a 07embedded image (R) or (S)-N-(amino(1- isopropyl-1H-pyrazol-3- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (4,6-diisopropyl-1,3- dihydroisobenzofuran-5- yl)acetamide Chiralpak ID, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 433 219 264b 08embedded image (S) or (R)-N-(amino(1- isopropyl-1H-pyrazol-3- yl)(oxo)-λ.sup.6-sulfaneylidene)-2- (4,6-diisopropyl-1,3- dihydroisobenzofuran-5- yl)acetamide Chiralpak ID, 2*25 cm, 5 um EtOH in Hex (0.1% FA) 433

(1936) Example 159: .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 7.92 (s, 2H), 7.62 (s, 1H), 7.60 (s, 1H), 7.08 (dd, J=8.7, 5.5 Hz, 1H), 6.91 (dd, J=11.9, 8.6 Hz, 1H), 5.19 (s, 1H), 3.68 (d, J=2.5 Hz, 2H), 3.20-2.90 (m, 2H), 1.39 (s, 6H), 1.25-1.04 (m, 12H).

(1937) Example 183: .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 8.07 (br s, 3H), 7.04 (s, 1H), 6.29 (s, 1H), 5.05 (s, 2H), 4.88 (s, 2H), 3.77-3.62 (m, 2H), 3.25-2.90 (m, 2H), 1.48 (s, 6H), 1.15-0.99 (m, 12H).

(1938) Example 216: .sup.1H NMR (300 MHz, DMSO-d.sub.6) δ 7.82 (br s, 2H), 7.59 (s, 1H), 7.58 (s, 1H), 7.03 (s, 1H), 5.19 (s, 1H), 5.04 (s, 2H), 4.87 (s, 2H), 3.67 (s, 2H), 3.25-3.00 (m, 2H), 1.38 (s, 6H), 1.20-0.80 (m, 12H).

(1939) The following protocol is suitable for testing the activity of the compounds disclosed herein.

Procedure 1: IL-1β Production in PMA-Differentiated THP-1 Cells Stimulated with Gramicidin

(1940) THP-1 cells were purchased from the American Type Culture Collection and sub-cultured according to instructions from the supplier. Cells were cultured in complete RPMI 1640 (containing 10% heat inactivated FBS, penicillin (100 units/ml) and streptomycin (100 μg/ml)), and maintained in log phase prior to experimental setup. Prior to the experiment, compounds were dissolved in dimethyl sulfoxide (DMSO) to generate a 30 mM stock. The compound stock was first pre-diluted in DMSO to 3, 0.34, 0.042 and 0.0083 mM intermediate concentrations and subsequently spotted using Echo550 liquid handler into an empty 384-well assay plate to achieve desired final concentration (e.g. 100, 33, 11, 3.7, 1.2, 0.41, 0.14, 0.046, 0.015, 0.0051, 0.0017 μM). DMSO was backfilled in the plate to achieve a final DMSO assay concentration of 0.37%. The plate was then sealed and stored at room temperature until required.

(1941) THP-1 cells were treated with PMA (Phorbol 12-myristate 13-acetate) (20 ng/ml) for 16-18 hours. On the day of the experiment the media was removed and adherent cells were detached with trypsin for 5 minutes. Cells were then harvested, washed with complete RPMI 1640, spun down, and resuspended in RPMI 1640 (containing 2% heat inactivated FBS, penicillin (100 units/ml) and streptomycin (100 μg/ml). The cells were plated in the 384-well assay plate containing the spotted compounds at a density of 50,000 cells/well (final assay volume 50 μl). Cells were incubated with compounds for 1 hour and then stimulated with gramicidin (5 μM) (Enzo) for 2 hours. Plates were then centrifuged at 340 g for 5 min. Cell free supernatant (40 μL) was collected using a 96-channel PlateMaster (Gilson) and the production of IL-1β was evaluated by HTRF (cisbio). The plates were incubated for 18 h at 4° C. and read using the preset HTRF program (donor emission at 620 nm, acceptor emission at 668 nm) of the SpectraMax i3x spectrophotometer (Molecular Devices, software SoftMax 6). A vehicle only control and a dose titration of CRID3 (100-0.0017 μM) were run concurrently with each experiment. Data was normalized to vehicle-treated samples (equivalent to 0% inhibition) and CRID3 at 100 μM (equivalent to 100% inhibition). Compounds exhibited a concentration-dependent inhibition of IL-1β production in PMA-differentiated THP-1 cells.

Procedure 2: IL-1β Production in PMA-Differentiated THP-1 Cells Stimulated with Gramicidin

(1942) THP-1 cells were purchased from the American Type Culture Collection and sub-cultured according to instructions from the supplier. Prior to experiments, cells were cultured in complete RPMI 1640 (containing 10% heat inactivated FBS, penicillin (100 units/ml) and streptomycin (100 μg/ml)), and maintained in log phase prior to experimental setup. Prior to the experiment THP-1 were treated with PMA (Phorbol 12-myristate 13-acetate) (20 ng/ml) for 16-18 hours. Compounds were dissolved in dimethyl sulfoxide (DMSO) to generate a 30 mM stock. On the day of the experiment the media was removed and adherent cells were detached with trypsin for 5 minutes. Cells were then harvested, washed with complete RPMI 1640, spun down, resuspended in RPMI 1640 (containing 2% heat inactivated FBS, penicillin (100 units/ml) and streptomycin (100 μg/ml). The cells were plated in a 384-well plate at a density of 50,000 cells/well (final assay volume 50 μl). Compounds were first dissolved in assay medium to obtain a 5× top concentration of 500 μM. 10 step dilutions (1:3) were then undertaken in assay medium containing 1.67% DMSO. 5× compound solutions were added to the culture medium to achieve desired final concentration (e.g. 100, 33, 11, 3.7, 1.2, 0.41, 0.14, 0.046, 0.015, 0.0051, 0.0017 μM). Final DMSO concentration was at 0.37%. Cells were incubated with compounds for 1 hour and then stimulated with gramicidin (5 μM) (Enzo) for 2 hours. Plates were then centrifuged at 340 g for 5 min. Cell free supernatant (40 μL) was collected using a 96-channel PlateMaster (Gilson) and the production of IL-1β was evaluated by HTRF (cisbio). A vehicle only control and a dose titration of CRID3 (100-0.0017 μM) were run concurrently with each experiment. Data was normalized to vehicle-treated samples (equivalent to 0% inhibition) and CRID3 at 100 μM (equivalent to 100% inhibition). Compounds exhibited a concentration-dependent inhibition of IL-1β production in PMA-differentiated THP-1 cells.

Procedure 3

(1943) 1. Experimental procedure 1.1 Cell Culture 1) Culture THP-1 cells in the complete RPMI-1640 medium with 10% FBS at 37° C., 5% CO.sub.2. 2) Passage the cells every 3 days by inoculating 3×10.sup.5 cells per ml. 1.2 Compound Preparation Prepare the 3-fold serial dilution of the compounds with DMSO in a 384-well LDV Microplate using TECAN EVO system to generate the compound source plate with 10 concentrations. Top concentration is 30 mM. 1.3 Cell preparation 1) Centrifuge THP-1 cells at 350 g for 5 min. 2) Re-suspend cells with complete RMPI-1640 medium, and count cells. 3) Seed cells in T225 flask, about 2.5×10.sup.7 per flask, treat cells with 20 ng/ml PMA (final DMSO concentration<1%). 4) Incubate overnight. 1.4 THP-1 Stimulation 1) Wash adherent THP-1 cells with PBS, and detach cells with 4 ml trypsin for T225 flask. 2) Centrifuge cells at 350 g for 5 min, re-suspend cells with RPMI-1640 containing 2% FBS and count cells with trypan blue. 3) Transfer 50 nl/well the serial dilution of test compound to 384-well plate by Echo; For the high control and first point of CRID3 (MCC950), transfer 165 nl, then backfill to make the DMSO concentration is consistent in all wells, the plate layout is as below. 4) Seed 50k cells in 40 μl RPMI-1640 with 2% FBS per well in 384-well plate. 5) Incubate for 1 h at 37° C., 5% CO.sub.2. 6) Prepare 5× gramicidin, add 10 μl per well, the final concentration is 5 μM, incubate for 2 hrs at 37° C., 5% CO.sub.2. 7) Centrifuge at 350 g for 1 min. 8) Pipet 16 μl supernatant by apricot, and transfer into white 384 proxiplate. FIG. 3 depicts the layout of the plates: HC: 100 μM CRID3 (MCC950)+5 μM gramicidin LC: 5 μM Gramicidin. 1.5 IL-1β detection 1) Homogenize the 5× diluent #5 with a vortex and add 1 volume of stock solution in 4 volumes of distilled water. 2) Thaw 20× stock solution of anti-IL1β-Cryptate-antibody and anti-IL1β XL-antibody. Dilute these two antibodies to 1× with detection buffer #3. 3) Pre-mix the two ready-to-use antibody solutions just prior to use. 4) Dispense 4 ul of pre-mixed Anti-IL1β antibodies working solution into all wells. 5) Seal the plate and incubate overnight at 4° C. 6) Read the cell plate using EnVison and plot Readout vs. the test compound concentration to calculate the IC.sub.50. 2. Data Analysis: 1. IC.sub.50 of compounds can be calculated using the following formulas Formula for IC.sub.50
% inhibition=100-100×[HC.sub.ave-Readout/(HC.sub.ave−LC.sub.ave)] 2. Fit the normalized data in a dose-response manner using XLfit, and calculate the compound concentration.

(1944) Table 12 shows the biological activity of compounds in hTHP-1 assay containing 2% fetal bovine serum: <0.008 μM=“++++++”; ≥0.008 and <0.04 μM=“+++++”; ≥0.04 and <0.2 μM=“++++”; ≥0.2 and <1 μM=“+++”; ≥1 and <5 μM=“++”; ≥5 and <30 μM=“+”.

(1945) TABLE-US-00030 TABLE 12 Average IC.sub.50 of compounds in hTHP-1 assay Compound hTHP-1 Example # Number IC.sub.50 1 131 ++ 2 131b or 131a ++ 3 131a or 131b >30 μM 4 129 + 5 129b or 129a >30 μM 6 129a or 129b ++ 7 132 +++ 8  132b ++ 9  132a +++ 10 134 + 11 137 + 12 136 >30 μM 13 133 +++ 14 141 +++++ 15 139 ++ 16 138 +++ 17 140 +++++ 18 142 ++++ 19 143 +++++ 20 197 +++ 21 101 ++++ 22 152 +++ 23 150 ++ 24 148 +++ 25 147 ++ 26 113 ++ 27 151 ++ 28 114 ++ 29 112 + 30 116 + 31 105 ++ 32 117 + 33 109 +++ 34 146 ++ 35 110 +++ 36 126 +++ 37 104 ++++ 38 130 +++ 39 107 +++ 40 106 +++ 41 135 + 42 133b or 133a ++++ 43 133a or 133b ++ 44 141b or 141a ++++ 45 141a or 141b ++ 46 139b or 139a >30 μM 47 139a or 139b +++ 48 138b or 138a ++++ 49 138a or 138b + 50 140b or 140a +++++ 51 140a or 140b +++ 52 144b or 144a +++++ 53 144a or 144b ++ 54 145b or 145a +++++ 55 145a or 145b ++ 56 197b or 197a +++ 57 197a or 197b ++ 58 116b or 116a >30 μM 59 116a or 116b + 60 106b or 106a ++++ 61 106a or 106b + 62 117b or 117a ++ 63 117a or 117b >30 μM 64 152b or 152a +++ 65 152a or 152b + 66 150b or 150a +++ 67 150a or 150b >30 μM 68 148b or 148a +++ 69 148a or 148b + 70 147b or 147a +++ 71 147a or 147b + 72 114b or 114a ++ 73 114a or 114b >30 μM 74 112b or 112a >30 μM 75 112a or 112b ++ 76 101b or 101a ++++ 77 101a or 101b ++ 78 126b or 126a +++ 79 126a or 126b + 80 104b or 104a +++++ 81 104a or 104b +++ 82 130b or 130a + 83 130a or 130b ++++ 84 107b or 107a ++++ 85 107a or 107b + 86 110b or 110a ++ 87 110a or 110b ++++ 88 241 +++ 89 219 +++ 90 218 + 91 217 + 92 214 >30 μM 93 235 >30 μM 94 230 ++ 95 245 +++ 96 244 >30 μM 97 221 +++ 98 220 + 99 304 ++ 100 301 +++ 101 212 + 102 240 + 103 258 +++ 104 257 +++ 105 256 ++++ 106 201 ++++ 107 255 + 108 254 ++++ 109 253 ++++ 110 252 +++ 111 251 ++++ 112 250 +++ 113 249 +++++ 114 248 ++ 115 247 +++ 116 246 + 117 309 ++++ 118 310 +++ 119 243 +++ 120 242 +++ 121 239 +++ 122 238 +++ 123 237 +++ 124 236 +++ 125 234 +++ 126 233 +++ 127 232 + 128 120 +++ 129 229 ++++ 130 228 ++ 131 308 + 132 227 ++ 133 226 +++ 134 225 ++ 135 224 ++ 136 191 +++ 137 222 +++ 138 307 ++ 139 231 +++ 140 306 +++ 141 305 ++++ 142 216 ++ 143 215 ++ 144 203 + 145 213 +++ 146 204 + 147 202 ++ 148 211 + 149 210 +++ 150 209 + 151 208 +++ 152 207 +++ 153 206 ++ 154 205 + 155  261b +++ 156  261a +++ 157  256a +++++ 158  256b ++ 159  201a ++++ 160  201b +++ 161  258a ++++ 162  258b + 163  249a ++++ 164  249b ++ 165  309b ++ 166  309a ++++ 167  239a ++ 168  239b +++ 169  238a ++ 170  238b +++ 171  221a +++ 172  221b + 173  229a +++ 174  229b + 175  234b ++ 176  234a +++ 177  236a ++++ 178  236b ++ 179  242a +++ 180  242b + 181  243a ++++ 182  243b + 183  227a +++ 184  227b + 185  251b ++++ 186  251a + 187  228a + 188  228b +++ 189  226a ++ 190  226b ++++ 191  225a ++ 192  225b >30 μM 193  244b >30 μM 194  244ab + 195  244aa >30 μM 196  220a + 197  220b >30 μM 198  218a + 199  218b >30 μM 200  217a ++ 201  217b >30 μM 202 303 +++ 203 302 + 204  203b ++ 205  203a >30 μM 206  202a +++ 207  202b >30 μM 208  213a ++++ 209  213b ++ 210  210a + 211  210b +++ 212  216a >30 μM 213  216b ++ 214   110a′ ++++ 215   110b′ ++ 216  263a +++ 217  263b + 218  264a + 219  264b >30 μM 220 263 ++++ 221 264 + 259 >17 μM  259a +  259b >30 μM  262a >30 μM  262b +

(1946) A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.