USE OF PRIMER PROBE COMBINATION AND KIT THEREOF IN HBV DETECTION
20220195542 · 2022-06-23
Assignee
Inventors
Cpc classification
C12Q1/6818
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
International classification
Abstract
Provided is the use of a primer and probe combination and a kit thereof in HBV detection. The primer and probe combination is selected from at least one of an S gene region primer and probe combination, a C gene region primer and probe combination, and an X gene region primer and probe combination. Primers and probes are respectively designed in conserved sequences of the S, C and X genomes of the hepatitis B virus, and a fluorescent quantitative PCR technique is used to simultaneously detect HBV DNA in the same tube.
Claims
1. A primer and probe combination, selected from at least one of an S gene region primer and probe combination, a C gene region primer and probe combination, and an X gene region primer and probe combination; wherein the S gene region primer and probe combination is specifically selected from any one of the following combinations: TABLE-US-00007 Combination S1: an upstream primer comprising a sequence as shown in SEQ ID NO: 1 (TTGCCCGTTTGTCCTCTAATTC), a downstream primer comprising a sequence as shown in SEQ ID NO: 2 (CATCCATAGGTTTTGTACAGCAAC), and a probe comprising a sequence as shown in SEQ ID NO: 3 (AGGATCATCAACCACCAGCACGGG); Combination S2: an upstream primer comprising a sequence as shown in SEQ ID NO: 4 (GTGTCTGCGGCGTTTATCA), a downstream primer comprising a sequence as shown in SEQ ID NO: 5 (CCCGTTTGTCCTCTAATTCCAG), and a probe comprising a sequence as shown in SEQ ID NO: 6 (TTCCTCTGCATCCTGCTGCTATGCC); and Combination S3: an upstream primer comprising a sequence as shown in SEQ ID NO: 7 (TGCCCGTTTGTCCTCTAATTCC), a downstream primer comprising a sequence as shown in SEQ ID NO: 8 (AGGTGCAGTTTCCATCCATAGG), and a probe comprising a sequence as shown in SEQ ID NO: 9 (TCATCAACCACCAGCACGGGACCA); the C gene region primer and probe combination is specifically selected from any one of the following combinations: TABLE-US-00008 Combination C1: an upstream primer comprising a sequence as shown in SEQ ID NO: 10 (AGCCTTAAAATCTCCTGAGCATTG), a downstream primer comprising a sequence as shown in SEQ ID NO: 11 (CAAATTATTACCCACCCAGGTAGC), and a probe comprising a sequence as shown in SEQ ID NO: 12 (TCACCACACAGCACTCAGGCAAGC); Combination C2: an upstream primer comprising a sequence as shown in SEQ ID NO: 13 (AGGCAGGTCCCCTAGAAGAAG), a downstream primer comprising a sequence as shown in SEQ ID NO: 14 (ACATTGGGATTCCCGAGATTGAG), and a probe comprising a sequence as shown in SEQ ID NO: 15 (ACTCCCTCGCCTCGCAGACGAAGG); and Combination C3: an upstream primer comprising a sequence as shown in SEQ ID NO: 16 (ATCAACACTTCCGGAAACTACTG), a downstream primer comprising a sequence as shown in SEQ ID NO: 17 (TTCCCGAGATTGAGATCTTCTGC), and a probe comprising a sequence as shown in SEQ ID NO: 18 (GGCAGGTCCCCTAGAAGAAGAACT); the X gene region primer and probe combination is specifically selected from any one of the following combinations: TABLE-US-00009 Combination X1: an upstream primer comprising a sequence as shown in SEQ ID NO: 19 (TGCACTTCGCTTCACCTCTG), a downstream primer comprising a sequence as shown in SEQ ID NO: 20 (TTGCTGAAAGTCCAAGAGTCCTC), and a probe comprising a sequence as shown in SEQ ID NO: 21 (CGCATGGAGACCACCGTGAACGCC); Combination X2: an upstream primer comprising a sequence as shown in SEQ ID NO: 22 (ACTTCGCTTCACCTCTGCAC), a downstream primer comprising a sequence as shown in SEQ ID NO: 23 (AGGTCGGTCGTTGACATTGC), and a probe comprising a sequenceas shown in SEQ ID NO: 24 (AGACCACCGTGAACGCCCACCG); and Combination X3: an upstream primer comprising a sequence as shown in SEQ ID NO: 25 (CACCTCTCTTTACGCGGACTC), a downstream primer comprising a sequence as shown in SEQ ID NO: 26 (AGTCCTCTTATGCAAGACCTTGG), and a probe comprising a sequence as shown in SEQ ID NO: 27 (TGCCTTCTCATCTGCCGGACCGTG); each of the above probes comprises a fluorescent dye and a fluorescence quencher.
2. The primer and probe combination according to claim 1, wherein the fluorescent dye is selected from at least one of VIC, FAM, HEX, Cy5, Rox, and TET.
3. The primer and probe combination according to claim 1, wherein the fluorescence quencher is selected from at least one of BHQ-1, BHQ-2, BHQ-3, BBQ, and TAMRA.
4. (canceled)
5. (canceled)
6. A kit comprising the primer and probe combination according to claim 1.
7. The kit according to claim 6, further comprising a fluorescent quantitative reaction solution.
8. The kit according to claim 6, further comprising at least one of a template, a positive control substance, and a negative control substance.
9. The kit according to claim 8, wherein the template is selected from any one of a standard positive template and a human genomic DNA extract.
10. The kit according to claim 8, wherein the positive control substance is hepatitis B virus DNA, and the negative control substance is water.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
DETAILED DESCRIPTION
[0080] The embodiments of the present disclosure will be further described below through specific examples, and those skilled in the art can easily understand other advantages and effects of the present disclosure from the content disclosed in this specification. The present disclosure can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present disclosure.
[0081] Hepatitis B virus infection has been confirmed to be tightly related to the occurrence and development of diseases such as liver cirrhosis and primary liver cancer, and may also increase related clinical harm, such as the transmission of HBV through blood transfusion and organ transplantation.
[0082] At present, the detection of HBV DNA is the gold standard for the diagnosis of hepatitis B virus infection, and is mainly performed by real-time fluorescent quantitative PCR detection with specific primers for the conserved region of HBV gene. However, the existing detection kits generally only amplify one gene fragment, and if the target fragment has mutations, it may lead to false negative results.
[0083] In order to avoid false negative results, it is necessary to establish a method to detect different HBV genes simultaneously, so that the detection and determination of HBV infection will not be affected by the false negative results due to the mutation in a target detection fragment.
[0084] Therefore, in order to solve this problem, it is necessary to establish a highly sensitive HBV detection method, and multiple target genes can be set for detection at the same time, which can avoid gene mutation and detection escape, and can also detect the presence of HBV infection with high sensitivity.
[0085] The fluorescent quantitative PCR has the advantages of strong specificity, high sensitivity, good reproducibility, accurate quantification, fast speed, and fully enclosed reaction. It has been widely used in research fields such as molecular biology and medicine. Besides, compared with conventional PCR, it has the characteristics of stronger specificity, capable of effectively solving the contamination problem in PCR, and high degree of automation, so it has been widely used in scientific research and clinical diagnosis.
[0086] The present disclosure utilizes the advantages of fluorescent quantitative PCR, and provides a method of a multiplex multiple-gene (triplex triple-gene) fluorescent quantitative PCR detection in a single tube, which can solve the following problems in the existing HBV detection method:
[0087] 1. Avoiding inaccurate results caused by HBV drug-resistant mutations in the HBV DNA. If the drug-resistant mutation occurs in one gene of HBV, there are still two more gene fragments that can be detected.
[0088] 2. Overcoming the problem of low sensitivity of the existing HBV detection. If the copy number of the virus after HBV infection is not high, and there are differences in the copy number between genes, multiple detection will increase the detection possibility.
[0089] 3. Overcoming the problem of being unable to meet the requirements of occult HBV infection (OBI) detection for positive fragments. For the principle of at least two positive fragments required for OBI detection, multiplex multiple-gene detection can fully follow it.
[0090] Based on the above, the present disclosure provides a triplex triple-gene HBV DNA detection method.
[0091] The following factors have also been considered:
[0092] 1. Economics of detection: without increasing the detection cost too much by detection of multiple genes in a single tube.
[0093] 2. Convenience of detection: without adding too many detection steps by detection of multiple genes in a single tube.
[0094] 3. Accuracy of detection: without reducing the accuracy of detection by fluorescence quantitative PCR method.
[0095] 4. Timeliness of detection: without increasing the time of detection by detection of multiple genes in a single tube.
[0096] 5. Sample size for detection: without increasing the amount of serum required for detection by detection of multiple genes in a single tube.
[0097] 6. Complexity of detection: without requiring additional training of detection operators by same fluorescence quantitative PCR method.
[0098] 7. Sensitivity of detection: a higher detection sensitivity by simultaneous detection of multiple genes.
[0099] The present disclosure adopts multiple pairs of primer and probe combination, not only can detect different genes in a single tube, but also can detect the conservative sequences of different HBV genes in a single tube at the same time by using the fluorescent quantitative PCR method. The present disclosure can further improve the sensitivity of the HBV DNA detection method, obtain more accurate and effective quantitative results, and provide a more powerful basis for the formulation of clinical prevention or treatment regimens.
[0100] Main Experimental Materials:
[0101] DNA extraction kit (QIAamp Viral DNA Mini Kit) purchased from Qiagen; 2×PCR Probes Master (fluorescence quantitative reaction solution, specification 5 ml) purchased from Roche, cat. No. 04707494001; Escherichia coli DH5a, plasmid extraction kit, purchased from Tiangen BioTech (Beijing) Co., Ltd.
[0102] Primers and probes. According to the standard sequences of hepatitis B virus in GenBank (accession number: X02763, D00329, X04615, X65259, X75657, X69798, AF160501, AY090454), CLUSTAL X multiple sequence alignment software based on Smith Waterman algorithm was used for alignment and analysis, and MEGA5.0 software, Oligo6.71 software were used for analysis to find out conserved specific regions that can be used for designing primers and probes. A pair of specific primer and a specific TaqMan probe were designed according to the conservative sequences of the S gene region, C gene region and X gene region of HBV DNA respectively to establish a method of multiplex multiple-gene fluorescent quantitative PCR detection for hepatitis B virus in a single tube with high sensitivity and specificity, which can quickly and accurately detect HBV DNA load. The primers and probes were synthesized by Shanghai Invitrogen Life Technologies Co., Ltd.
[0103] Standard positive template is pLB-T vector plasmid inserted with a specific sequence of the whole genome of hepatitis B virus (the plasmid extraction kit used was the pLB zero background rapid cloning kit, purchased from Tiangen BioTech Co., Ltd.). Specifically, the whole genomic fragment of hepatitis B virus was cloned into the vector, which was then transformed into Escherichia coli DH5a for amplification, and then plasmid DNA was extracted with a plasmid extraction kit. The plasmid DNA was then quantified by a spectrophotometer A.sub.260 and diluted to 1×10.sup.8 copies/μL.
[0104] The negative control was water.
[0105] The positive control substance was HBV DNA, which was derived from the HBV isolated from patient, cloned and sequenced, and aligned with NCBI gene tools to obtain the positive control hepatitis B virus nucleic acid.
[0106] The sequences used in the following examples are as follows:
TABLE-US-00004 Combinations S1 Primer TTGCCCGTTTGTCCTCTAATTC for S Gene (5′-3′) CATCCATAGGTTTTGTACAGCA AC Probe VIC-TCATCAACCACCAGCACG GGACCA-BHQ1 S2 Primer GTGTCTGCGGCGTTTATCACCC (5′-3′) GTTTGTCCTCTAATTCCAG Probe VIC-TTCCTCTGCATCCTGCTG CTATGCC-BHQ1 S3 Primer TGCCCGTTTGTCCTCTAATTCC (5′-3′) AGGTGCAGTTTCCATCCATAGG Probe VIC-AGGATCATCAACCACCAG CACGGG-BHQ1 Combinations C1 Primer AGCAACACTTCCGGAAACTACT for C Gene (5′-3′) GTTCCGGAGATTGAGATCTTCA GG Probe FAM-GGTAGTCCCTTAGAAGAA GAAC-BHQ1 C2 Primer AGGCAGGTCCCCTAGAAGAAGA (5′-3′) CATTGGGATTCCCGAGATTGAG Probe FAM-ACTCCCTCGCCTCGCAGA CGAAGG-BHQ1 C3 Primer AGCCTTAAAATCTCCTGAGCAT (5′-3′) TGCAAATTATTACCCACCCAGG TAGC Probe FAM-TCACCACACAGCACTCAG GCAAGC-BHQ1 Combinations X1 Primer TGCACTTCGCTTCACCTCTGTT for X Gene (5′-3′) GCTGAAAGTCCAAGAGTCCTC Probe CY5-CGCATGGAGACCACCGTG AACGCC-BHQ3 X2 Primer ACTTCGCTTCACCTCTGCACAG (5′-3′) GTCGGTCGTTGACATTGC Probe CY5-AGACCACCGTGAACGCCC ACCG-BHQ3 X3 Primer CACCTCTCTTTACGCGGACTCA (5′-3′) GTCCTCTTATGCAAGACCTTGG Probe CY5-TGCCTTCTCATCTGCCGG ACCGTG-BHQ3
Example 1
Single S Gene Region Fluorescence Quantitative PCR for Quantitative Detection of HBV
[0107] 1. The standard positive template was dissolved with distilled water, and diluted in series to 5×10.sup.5 copies/μL, 5×10.sup.4 copies/μL, 5×10.sup.3 copies/μL, 5×10.sup.2 copies/μL, 5×10.sup.1 copy/μL, and 5×10.sup.0 copies/μL.
[0108] 2. Fluorescence quantitative PCR (10 μL, of amplification reaction system): the fluorescence quantitative reaction solution 5.0 μL, forward primer of S gene region primer pair 0.35 μL (0.5 μM), reverse primer of S gene region primer pair 0.35 μL (0.5 μM), fluorescent probe 0.75 μL (0.2 μM). The primer and probe combination was selected from combination S1, and the standard positive template was 3.5 μL.
[0109] Fluorescence quantitative PCR reaction parameters were as follows:
[0110] Pre-denaturation: 95° C., 10 min; denaturation: 95° C., 10 s; annealing: 62° C., 30 s; a total of 45 denaturation-annealing cycles. These steps were automatically completed by the Light Cycler 480 II fluorescent quantitative PCR machine (ROCHE, Switzerland), and the quantitative results were automatically calculated by the machine. The results are shown in
Example 2
Single C Gene Region Fluorescence Quantitative PCR for Quantitative Detection of HBV
[0111] Fluorescence quantitative PCR (10 μL of amplification reaction system): the fluorescence quantitative reaction solution 5.0 μL, forward primer of C gene region primer pairs 0.35 μL (0.5 μM), reverse primer of C gene region primer pair 0.35 μL (0.5 μM), fluorescent probe 0.75 μL (0.2 μM). The primer and probe combination was selected from combination C1, and the standard positive template was 3.5 μL.
[0112] The fluorescence quantitative PCR reaction parameters were the same as in Example 1, and the results are shown in
Example 3
Single X Gene Region Fluorescence Quantitative PCR for Quantitative Detection of HBV
[0113] Fluorescence quantitative PCR (10 of amplification reaction system): the fluorescence quantitative reaction solution 5.0 μL, forward primer of X gene region primer pairs 0.35 μL (0.5 μM), reverse primer of X gene region primer pairs 0.35 μL (0.5 μM), fluorescent probe 0.75 μL (0.2 μM). The primer and probe combination was selected from combination X1, and the standard positive template was 3.5 μL.
[0114] The fluorescence quantitative PCR reaction parameters were the same as in Example 1, and the results are shown in
Example 4
Duplex Double-Gene Fluorescence Quantitative PCR for Quantitative Detection of HBV in the Same Tube
[0115] Fluorescence quantitative PCR (10 μL of amplification reaction system): the fluorescence quantitative reaction solution 5.0 μL, forward primer of S gene region primer pairs 0.175 μL (0.5 μM), reverse primer of S gene region primer pair 0.175 μL (0.5 μM), fluorescent probe 0.375 μL (0.2 μM), forward primer of C gene region primer pair 0.175 μL (0.5 μM), reverse primer of C gene region primer pair 0.175 μL (0.5 μM), fluorescent probe 0.375 μL (0.2 μM). The primer and probe combination was selected from combination S1 and C1, and the standard positive template was 3.5 μL.
[0116] The fluorescence quantitative PCR reaction parameters were the same as in Example 1. Dual-channel fluorescence detection was performed, and the settings are shown in
[0117] The amplification result of the S gene region is shown in
[0118] The experiment results show that as for both the amplification efficiency of the method of duplex double-gene PCR detection in a single tube and the amplification efficiency of singlet single-gene fluorescence quantitative PCR, the target fragment of each gene were amplified well without interference.
Example 5
Duplex Double-Gene Fluorescence Quantitative PCR for Quantitative Detection of HBV in the Same Tube
[0119] Fluorescence quantitative PCR (10 μL of amplification reaction system): the fluorescence quantitative reaction solution was 5.0 μL, forward primer of S gene region primer pair 0.175 μL (0.5 μM), reverse primer of S gene region primer pair 0.175 μL (0.5 μM), fluorescent probe 0.375 μL (0.2 μM), forward primer of X gene region primer pair 0.175 μL (0.5 μM), reverse primer of X gene region primer pair 0.175 μL (0.5 μM), fluorescent probe 0.375 μL (0.2 μM). The primer and probe combination was selected from combination S1 and X1, and the standard positive template was 3.5 μL.
[0120] The fluorescence quantitative PCR reaction parameters were the same as in Example 1 and Dual-channel fluorescence detection was performed.
[0121] The amplification result of the S gene region is shown in
[0122] The experiment results show that the amplification efficiencies of the method of duplex double-gene PCR detection in a single tube, singlet single-gene fluorescence quantitative PCR, and triplex triple-gene fluorescent quantitative PCR in a single tube were basically the same, and the target fragment of each gene were amplified well without interference.
Example 6
Multiplex Multiple-Gene Fluorescence Quantitative PCR for Quantitative Detection of HBV in the Same Tube
[0123] Fluorescence quantitative PCR (10 of amplification reaction system): the fluorescence quantitative reaction solution 5.0 μL, forward primer of S gene region primer pair 0.125 μL (0.5 μM), reverse primer of S gene region primer pair 0.125 μL (0.5 μM), fluorescent probe 0.25 μL (0.2 μM), forward primer of C gene region primer pair 0.125 μL (0.5 μM), reverse primer of C gene region primer pair 0.125 μL (0.5 μM), fluorescent probe 0.25 μL (0.2 μM), forward primer of X gene region primer pair 0.125 μL (0.5 μM), reverse primer of X gene region primer pair 0.125 μL (0.5 μM), fluorescent probe 0.25 μL (0.2 μM). The S, C, X gene region primer and probe combination was selected from combination S1, C1, X1, respectively, and the standard positive template was 3.5 μL.
[0124] The fluorescence quantitative PCR reaction parameters were the same as in Example 1. Triple-channel fluorescence detection was performed and the settings are shown in
[0125] The amplification result of the S gene region is shown in
[0126] The experiment results show that the amplification efficiencies of the method of multiplex multiple-gene fluorescence quantitative PCR detection for occult hepatitis B virus in a single tube and singlet single-gene fluorescence quantitative PCR were basically the same, and the target fragment of each gene were amplified well without interference.
Example 7
Multiplex Multiple-Gene Fluorescence Quantitative PCR for Quantitative Detection of HBV in a Single Tube
[0127] Fluorescence quantitative PCR experiment (20 μL of amplification reaction system): the fluorescence quantitative reaction solution was 10.0 μL, forward primer of S gene region primer pair 0.25 μL (0.5 μM), reverse primer of S gene region primer pair 0.25 μL (0.5 μM), fluorescent probe 0.50 μL (0.2 μM), forward primer of C gene region primer pair 0.25 μL (0.5 μM), reverse primer of C gene region primer pair 0.25 μL (0.5 μM), fluorescent probe 0.50 μL (0.2 μM), forward primer of X gene region primer pair 0.25 μL (0.5 μM), reverse primer of X gene region primer pair 0.25 μL (0.5 μM), fluorescent probe 0.50 μL (0.2 μM). The S, C, X gene region primer and probe combination was selected from combination S1, C1 and X1, respectively, and the standard positive template was 7.0 μL.
[0128] The fluorescence quantitative PCR reaction parameters were the same as in Example 1. Triple-channel fluorescence detection was performed at the same time.
Example 8
Analysis of Specificity of Multiplex Multiple-Gene Fluorescence Quantitative PCR for Detection of HBV DNA in a Single Tube
[0129] In this example, the specificity of S, C, and X gene region primer and probe combinations was tested. The above multiplex fluorescence quantitative PCR was performed using human genomic DNA as a template in order to verify the specificity of the method.
[0130] Fluorescence quantitative PCR (10 of amplification reaction system): the fluorescence quantitative reaction solution 5.0 μL, forward primer of S gene region primer pair 0.125 μL (0.5 μM), reverse primer of S gene region primer pair 0.125 μL (0.5 μM), fluorescent probe 0.25 μL (0.2 μM), forward primer of C gene region primer pair 0.125 μL (0.5 μM), reverse primer of C gene region primer pair 0.125 μL (0.5 μM), fluorescent probe 0.25 μL (0.2 μM), forward primer of X gene region primer pair 0.125 μL (0.5 μM), reverse primer of X gene region primer pair 0.125 μL (0.5 μM), fluorescent probe 0.25 μL (0.2 μM). The S, C, X gene region primer and probe combination was selected from combination S1, C1, X1, respectively, and the human genomic DNA extract was used as a template, 3.5 μL.
[0131] The fluorescence quantitative PCR reaction parameters were the same as in Example 1. Triple-channel fluorescence detection was performed and the results are shown in
Example 9
Detection of Clinical Samples by Multiplex Multi-Gene Fluorescence Quantitative PCR
[0132] DNA extraction kit was used. According to the operating instructions of the kit, the DNA of the sample to be tested (serum/plasma samples were isolated from clinical samples from patients in the Department of Infectious Diseases) was extracted, and stored at 4° C. for later use.
[0133] Fluorescence quantitative PCR (10 of amplification reaction system): the fluorescence quantitative reaction solution 5.0 μL, forward primer of S gene region primer pair 0.125 μL (0.5 μM), reverse primer of S gene region primer pair 0.125 μL (0.5 μM), fluorescent probe 0.25 μL (0.2 μM), forward primer of C gene region primer pair 0.125 μL (0.5 μM), reverse primer of C gene region primer pair 0.125 μL (0.5 μM), fluorescent probe 0.25 μL (0.2 μM), forward primer of X gene region primer pair 0.125 μL (0.5 μM), reverse primer of X gene region primer pair 0.125 μL (0.5 μM), fluorescent probe 0.25 μL (0.2 μM). The S, C, X gene region primer and probe combination was selected from combination S1, C1, X1, respectively, and the template was 3.5 μL. The serial dilutions of standard positive template were used to plot standard curve, with the negative control substance water as negative control for PCR reaction, and the positive control substance as positive control for PCR reaction, in order to detect whether the PCR reaction system functioned well. Three replicates were set for the sample to be tested to ensure the accuracy and stability of the experiment. The fluorescence quantitative PCR reaction parameters were the same as in Example 1. Triple-channel fluorescence detection was performed.
[0134] By comparing the sample to be tested with the standard curve of the serial dilutions of standard positive template, the initial copy number of the sample to be tested was quantified. The detection results of samples 1-23 are shown in Table 1.
TABLE-US-00005 TABLE 1 Quantitative detection results of test samples Concentration (copies/mL) Sample No. S Gene Region C Gene Region X Gene Region Test sample 1 7.97 × 10.sup.4 1.04 × 10.sup.5 — Test Sample 2 4.74 × 10.sup.4 1.46 × 10.sup.3 — Test Sample 3 3.37 × 10.sup.4 6.67 × 10.sup.3 — Test Sample 4 1.51 × 10.sup.5 2.13 × 10.sup.5 — Test Sample 5 1.09 × 10.sup.6 1.30 × 10.sup.6 1.52 × 10.sup.6 Test Sample 6 2.08 × 10.sup.5 2.33 × 10.sup.5 3.77 × 10.sup.3 Test Sample 7 1.71 × 10.sup.5 2.49 × 10.sup.4 2.67 × 10.sup.3 Test Sample 8 3.62 × 10.sup.5 2.04 × 10.sup.5 — Test Sample 9 4.65 × 10.sup.6 6.77 × 10.sup.6 — Test Sample 10 8.22 × 10.sup.5 1.26 × 10.sup.6 — Test Sample 11 4.28 × 10.sup.5 2.28 × 10.sup.5 — Test Sample 12 6.11 × 10.sup.6 8.40 × 10.sup.6 2.80 × 10.sup.6 Test Sample 13 2.02 × 10.sup.5 2.33 × 10.sup.5 3.77 × 10.sup.3 Test Sample 14 9.28 × 10.sup.5 3.49 × 10.sup.5 2.05 × 10.sup.2 Test Sample 15 1.07 × 10.sup.6 1.77 × 10.sup.6 — Test Sample 16 2.46 × 10.sup.5 6.88 × 10.sup.4 1.94 × 10.sup.4 Test Sample 17 1.42 × 10.sup.7 5.30 × 10.sup.6 3.06 × 10.sup.4 Test Sample 18 3.45 × 10.sup.8 6.23 × 10.sup.8 3.19 × 10.sup.8 Test Sample 19 7.99 × 10.sup.8 1.79 × 10.sup.9 — Test Sample 20 9.35 × 10.sup.6 8.82 × 10.sup.5 8.19 × 10.sup.2 Test Sample 21 8.66 × 10.sup.8 1.21 × 10.sup.9 6.09 × 10.sup.8 Test Sample 22 6.45 × 10.sup.8 5.94 × 10.sup.8 — Test Sample 23 1.38 × 10.sup.9 1.64 × 10.sup.9 — Negative Control 0 Positive Control ≥500 ≥500 ≥500
[0135] From the experimental results in Table 1, it can be seen that after the PCR reaction, there is no detectable fluorescent signal in the negative control substance tube, while the hepatitis B virus with a copy number within the control range was detected in the positive control substance tube, indicating that the PCR reaction system functioned well.
[0136] By comparing with the standard curve, the hepatitis B virus copy number of the sample to be tested was determined, indicating the sample as hepatitis B virus positive. The specific value (such as 7.97×10.sup.4) represents the specific copy number of hepatitis B virus infected.
Comparative Example 1
[0137] Detection Using Hepatitis B Virus Nucleic Acid Detection Kit from Shanghai Fosun Diagnostics Co., Ltd. (Hereinafter Referred to as Fosun)
[0138] Fosun Hepatitis B Virus Quantitative Detection Kit was used. Product Name: Hepatitis B Virus Nucleic Acid Detection Kit (PCR-Fluorescence Probe Method), Medical Device Registration Certificate Number: 20173401101, approval for registration of medical devices in China. 23 samples of Example 6 were under detection, and the specific steps were carried out in accordance with the operating instructions of the kit. The detection results of samples 1-23 are shown in Table 2.
TABLE-US-00006 TABLE 2 Quantitative detection results of test samples Sample No. Concentration (copies/mL) Test Sample 1 2.95 × 10.sup.3 Test Sample 2 2.21 × 10.sup.3 Test Sample 3 1.54 × 10.sup.3 Test Sample 4 3.60 × 10.sup.3 Test Sample 5 2.23 × 10.sup.3 Test Sample 6 3.95 × 10.sup.3 Test Sample 7 9.87 × 10.sup.3 Test Sample 8 3.52 × 10.sup.3 Test Sample 9 6.30 × 10.sup.4 Test Sample 10 3.97 × 10.sup.4 Test Sample 11 1.13 × 10.sup.4 Test Sample 12 7.70 × 10.sup.4 Test Sample 13 1.25 × 10.sup.4 Test Sample 14 1.47 × 10.sup.4 Test Sample 15 2.19 × 10.sup.5 Test Sample 16 1.21 × 10.sup.5 Test Sample 17 1.27 × 10.sup.5 Test Sample 18 5.85 × 10.sup.6 Test Sample 19 3.55 × 10.sup.6 Test Sample 20 2.49 × 10.sup.6 Test Sample 21 5.69 × 10.sup.7 Test Sample 22 1.80 × 10.sup.7 Test Sample 23 2.64 × 10.sup.7
[0139] The independent HBV DNA positive samples were analyzed with the Hepatitis B Virus Nucleic Acid Detection Kit (Shanghai Fosun), and all the tested samples were HBV DNA positive. However, the method and the kit of the present disclosure have higher detection sensitivity, the concentration results from the quantitative detection of different gene fragments in most of the samples to be tested were higher than that of the Fosun kit. By simultaneously amplifying different gene fragments of the same sample, the occurrence of false negative results can be further reduced.
[0140] In summary, by designing the primers and probes on the conservative sequences of the hepatitis B virus S, C, and X gene regions, the present disclosure provides method of using triplex triple-gene fluorescence quantitative PCR technology to simultaneously detect HBV DNA in a single tube. The present disclosure has simple and rapid operation, improves the sensitivity and specificity of the hepatitis B virus detection method, minimizes the probability of false negative results due to mutations which further improves the detection efficiency, and is suitable for the detection of occult hepatitis B virus infection with low viral load.
[0141] The primers provided by the present disclosure have strong specificity and high sensitivity, and can be used for effective amplification of HBV DNA, thereby realizing accurate and quantitative detection of HBV infection. By simultaneous amplification and detection of highly conserved fragments of three different gene regions of HBV, the present disclosure effectively reduces the occurrence of problems such as false negatives, and improves the specificity of hepatitis B virus detection. The present disclosure has a fast detection speed requiring only one hour, and it requires a total of only 2˜3 hours including nucleic acid extraction. The present disclosure has simple steps, and enables the high-throughput sample detection at the same time. The present disclosure is suitable for clinical or laboratory quantitative detection of hepatitis B virus infection, monitoring and prediction of hepatitis B virus prevalence, and detecting and evaluation of curative effects timely.
[0142] The above-mentioned embodiments only exemplarily illustrate the principles and effects of the present disclosure, but are not used to limit the present disclosure. Anyone familiar with this technology can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present disclosure. Therefore, all equivalent modifications or changes made by those with ordinary knowledge in the technical field without departing from the spirit and technical ideas disclosed by the present disclosure should still be encompasses by the claims of the present disclosure.