Plant gene for granule development, modified cereal plants and grain
11365420 · 2022-06-21
Assignee
Inventors
Cpc classification
A23L7/00
HUMAN NECESSITIES
C12N15/8261
CHEMISTRY; METALLURGY
A01H6/46
HUMAN NECESSITIES
C12N15/8245
CHEMISTRY; METALLURGY
International classification
A01H1/00
HUMAN NECESSITIES
C12N15/82
CHEMISTRY; METALLURGY
Abstract
There is provided a plant of domesticated Triticeae species able to produce a grain with a modified (i.e. decreased or increased) level of B-type granules within the endosperm relative to the unmodified form of the grain. The level of B-type granules can be assessed by number or content by weight or volume. Whilst the level of B-type granule within the grain can be increased or decreased, optionally the grain contains substantially no B-type granules. The plant can contain a wheat Flo6 gene which is genetically modified. The plant of domesticated Triticeae species can be common wheat, barley, rye, durum wheat, spelt wheat, triticale, einkorn wheat or oat. Grain produced the plants, and flour and compositions of matter formed from the grain are also provided.
Claims
1. A tetraploid or hexaploid wheat plant having at least one non-functional Flo6 gene in an A or B sub-genome of tetraploid wheat or an A, B, or D sub-genome of hexaploid wheat, wherein SEQ ID No. 53, SEQ ID No. 55, and SEQ ID No. 57 each set out the sequence of a functional A, B, or D sub-genome Flo6 gene in wheat, respectively, and wherein the number, weight, or volume of B-type granules in endosperm in grain of the tetraploid or hexaploid wheat plant is reduced compared to endosperm in grain of a wild type tetraploid or hexaploid wheat plant.
2. The plant as claimed in claim 1 which is Triticum aestivum.
3. Grain produced from the wheat plant as claimed in claim 1.
4. The grain as claimed in claim 3 which is Triticum aestivum.
5. Grain harvested from the wheat plant as claimed in claim 1.
6. A genetically modified Flo6 wheat gene of SEQ ID Nos. 53, 55, or 57, wherein the Flo6 wheat gene is genetically modified to express a non-functional protein in one or more of the A, B, or D sub-genomes of a hexaploid wheat plant or the A or B sub-genomes of a tetraploid wheat plant, such that the number, weight, or volume of B-type granules in endosperm in grain from the hexaploid or tetraploid wheat plant is reduced compared to endosperm in grain of a wild type wheat plant.
7. The genetically modified Flo6 wheat gene as claimed in claim 6, wherein said genetic modification of SEQ ID No. 53 comprises modification of the codons for Trp 291 and/or Trp 400 of SEQ ID No 54 to produce non-functional expression product.
8. The wheat plant as claimed in claim 1 which is a hexaploid wheat plant and has non-functional Flo6 genes in at least two sub-genomes.
9. The wheat plant as claimed in claim 8, wherein the non-functional Flo6 genes are in the A and D sub-genomes.
10. The wheat plant as claimed in claim 1, wherein a FLO6 expression product is reduced in the wheat plant such that the number, weight, or volume of B-type granules in endosperm in grain of the wheat plant is reduced compared to endosperm in grain of a wild type wheat plant.
11. The wheat plant as claimed in claim 1, which has a tetraploid genome and non-functional Flo6 gene in both the A and B sub-genomes.
12. The wheat plant as claimed in claim 1, which has a tetraploid genome and a non-functional Flo6 gene in either the A or B sub-genome, and wherein said FLO6 expression product is reduced such that the number, weight, or volume of B-type granules in endosperm of grain of the wheat plant is reduced compared to endosperm in grain of a wild type wheat plant.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9) The locations of genes in the Bgc-1 regions of A. peregrina and wheat are shown. Genes are numbered as in Table 2. Orthologous genes have the same number in each map.
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
DETAILED DESCRIPTION OF THE INVENTION
(19) Work performed by the present inventors and described for the first time within this application identified a gene as responsible for B-granule initiation in domesticated Triticeae species which was designated “Bgc-1 QTL marker gene” or “Bgc-1” and as given in SEQ ID No. 4. However, further work has demonstrated, that this gene is not in fact the gene responsible for B-granule formation in wheat. Significant further work has been required to identify the gene responsible.
(20) Wheat and other domesticated Triticeae species (as defined herein), other than oats but including without limitation barley and rye, produce both A-type and B-type starch granules within the grain endosperm (see
(21) Analysis of granule type within the endosperm has been reported in the literature (summarised in Saccomanno et al. 2017, Journal of Cereal Science 76: 46-54) as (where the term “simple granule” is used to refer to the small granules referenced herein as “B-type granules”):
(22) TABLE-US-00001 TABLE A Oats Wheat Barley Simple granule diameter (μm) 4-10 <10 2-5 Compound granule diameter (μm) 20-150 — — Simple granule volume (μm.sup.3) — 10-35 12-32 Compound granule volume (μm.sup.3) 64 56.6 10.9 A-granule volume (μm.sup.3) — 1824 1242 Simple granules (% by number) 91% 90% 92% Simple granules (% by volume) 10% <30% 9%
(23) Simply for convenience of reference, the term “domesticated Triticeae species” as used herein refers to plants classified as Triticeae and also to the following other cereals and grasses: Aveneae; Hordeum vulgare (barley); and Triticum aestivum (common wheat or bread wheat), but specifically excludes Aegilops grasses. In particular, the term “domesticated Triticeae species” refers to Triticeae and Aveneae plants which are classified as cereals (i.e. produce edible grain). More specifically, the term “domesticated Triticeae species” refers to small grain temperate cereals classified as Triticeae and Aveneae. Non-limiting examples include common wheat, barley, rye, durum wheat, spelt wheat, triticale, einkorn wheat and oats. The term “domesticated Triticeae species” as used herein can refer to common wheat, barley, rye, durum wheat, spelt wheat, triticale, and einkorn wheat. Any cultivar of these cereals can be used in the present invention. Common wheat, barley, rye and oats are of particular interest. Preferably the cultivar is suitable for commercial growth.
(24) Where the term “wheat” is used herein without a further qualifier, it refers a plant of the genus Triticum and therefore includes common wheat (also termed “bread wheat”), namely Triticum aestivum, durum wheat (Triticum durum), spelt (a form of Triticum aestivum) and einkorn (Triticum boeoticum or the domesticated form, Triticum monococcum). References to “durum” are to durum wheat; to “spelt” are to spelt wheat; and to “einkorn” are to einkorn wheat. Preferred forms of “wheat” as referenced herein are common wheat (also termed “bread wheat”), namely Triticum aestivum, and durum wheat (Triticum durum).
(25) The term “B-type granule” refers to a distinct population of small granule type observed within the endosperm of wheat. B-type granules have a diameter of 10 μm or less.
(26) It is an object of the present invention to provide a plant of domesticated Triticeae species able to produce a grain with a modified (i.e. decreased or increased) level (i.e. number or content by weight or volume) of B-type granules within the endosperm relative to the unmodified form of the grain. For example, the number of B-type granules within the endosperm can be modified by 10% or more relative to the unmodified form of the grain, for example can be modified by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% relative to the unmodified form of the grain. For example, the number of B-type granules within the endosperm can be reduced by 10% or more relative to the unmodified form of the grain, for example can be reduced by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% relative to the unmodified form of the grain. Alternatively, the weight of the B-type granules within the endosperm can be reduced by 10% or more relative to the unmodified form of the grain, for example can be reduced by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 100% or more relative to the unmodified form of the grain. Optionally, the grain substantially lacks B-type granules. The grain can be of any domesticated Triticeae species (as herein defined), but specific mention can be made of common wheat, barley, rye, and oats. Optionally, the grain does not produce any B-type granules in the endosperm since initiation of this granule type does not occur.
(27) Methods for measurement of granule content by number are well-known in the art. Exemplary methods include the use of a laser diffraction particle size analyser. Use of a laser diffraction particle size analyser requires a relatively large sample to be available for analysis and may not be suitable for all grain types. For example this method cannot be used to analyse oat grains which contain compound particles, as the procedure used causes the compound granules to disintegrate. A suitable alternative method analyses the sample by viewing individual grains using a microscope and manually counting the granule number within a sample view. Multiple views of each sample can be used to enhance accuracy. Further, each sample view can be photographed so that granule count can be conducted using image analysis. Granule weight and volume can be calculated following analysis of granule number. A review of granule size determination techniques can be found in Lindeboom et al., 2004, Starch 56:89-99.
(28) In common wheat (Triticum aestivum), barley (Hordeum vulgare) or oats (Avena sativa) the endosperm of an unmodified grain will typically contain approximately 90% B-type granules and 10% A-type granules, when granule content is assessed by granule number. In the present invention, the modified endosperm can contain 80% B-type granules or less, for example 70% B-type granules, for example 60%, 50%, 40%, 30%, 20% or 10% B-type granules or less when assessed by granule number (with the remainder being A-type granules (common wheat, rye or barley) or compound granules (oats)).
(29) Since B-type granules are very small, the percentage number of this granule type within the endosperm is high. However, in terms of their content by weight, the much larger A-type granules are more significant. Analysis of granule content by weight (or volume) can be obtained through calculation, following completion of analysis of granule number and size.
(30) In common wheat, Triticum aestivum, the endosperm of an unmodified grain will typically contain approximately 30% B-type granules and 70% A-type granules, when granule content is assessed by weight or volume. In the present invention, the modified endosperm can contain 25% B-type granules or less, for example 20% or less, for example 10% or less, or even 5% or less B-type granules when assessed by weight or volume (with the remainder being A-type granules). For barley (Hordeum vulgare), the endosperm of an unmodified grain will typically contain approximately 10% B-type granules and 90% A-type granules, when granule content is assessed by weight or volume. In the present invention, the modified endosperm can contain 8% B-type granules or less, for example 5% or less, for example 3% or less, or even 1% or less B-type granules when assessed by weight or volume (with the remainder being A-type granules). For oats, the endosperm of an unmodified grain will typically contain approximately 33% of B-type granules when assessed by weight or volume, with the remainder being compound granules. In the present invention, the modified endosperm can contain 30% B-type granules or less, for example 25% or less, for example 20% or less, for example 10% or less, or even 5% or less B-type granules when assessed by weight or volume. Preferably, the present invention provides a plant of a domesticated Triticeae species wherein the percentage weight or volume of B-type granules (relative to the whole granule content of the endosperm) is reduced by 5% or more, for example is reduced by 10% or more.
(31) Alternatively the grain can exhibit an increased B-granule content within the endosperm, for example the level (number or weight or volume) of B-type granule can be increased by at least 20%, for example at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% relative to the level observed in the unmodified grain. Optionally the granule number of B-type granules is increased from 90% to 95% or more, for example to 98% or 99% or more. Optionally the grain can consist predominantly of small (i.e. B-type) granules (for example in wheat, barley and oats). Optionally, when assessed by granule weight (or volume) the B-type granule content for wheat is increased from 30% to at least 50%, for example to 60% or more, to 70% or more, 80% or more or to 90% or more. Optionally, when assessed by granule weight (or volume) the B-type granule content for barley is increased from 10% to at least 30%, for example to 40% or more, to 50% or more, to 60% or more, to 70% or more, to 80% or more or to 90% or more. Optionally, when assessed by granule weight (or volume) the B-type granule content for oats is increased from 30% to at least 50%, for example to 60% or more, to 70% or more, to 80% or more or to 90% or more.
(32) It is a further object of the present invention to provide methods for the selective modification of B-type granule content in the grain of a domesticated Triticeae species, and to provide a domesticated Triticeae species able to form grain with modified levels of B-type granules within the grain, and in particular to provide wheat and/or oats and/or barley and/or rye plants able to form grain with modified levels of B-type granules within the grain as described above. The methods include the modification of the Bgc-1 QTL marker gene or its control elements using the genetic information provided herein either by manipulation of its sequence to produce a non-functional expression product (thereby reducing B-type granule content) or by manipulation of its promoter or other elements affecting control of its expression (thereby selectively increasing or decreasing B-type granule content). Alternative methods include crossing the B-less wheat produced by the present inventors (or the progeny thereof) with domesticated Triticeae plants (preferably commercial cultivars) and selecting for progeny having the required modified levels of B-type granules within the grain or selecting for the ability to produce grain having modified levels of B-type granules. The method can further comprise a step of backcrossing and selecting plants able to produce grain with a modified number, weight or volume of B-type granules within the endosperm. Molecular markers and other genetic analysis (e.g. sequencing) can be used to enhance the efficiency of selection.
(33) It is a further object of the present invention to provide methods for the selective modification of B-type granule content in the grain of a wheat plant, and to provide a wheat plants able to form grain with modified levels of B-type granules within the grain, and in particular to provide wheat plants able to form grain with modified levels of B-type granules within the grain as described above. The methods include the modification of the wheat Flo6 gene (also designated as TaFlo6) or its control elements using the genetic information provided herein either by manipulation of its sequence to produce a non-functional (or reduced activity) expression product (thereby reducing B-type granule content) or by manipulation of its promoter or other elements affecting control of its expression (thereby selectively increasing or decreasing B-type granule content). Alternative methods include crossing the B-less wheat produced by the present inventors (or the progeny thereof) with domesticated Triticeae plants (preferably commercial cultivars, for example of wheat) and selecting for progeny having the required modified levels of B-type granules within the grain or selecting for the ability to produce grain having modified levels of B-type granules. The method can further comprise a step of backcrossing and selecting plants able to produce grain with a modified number, weight or volume of B-type granules within the endosperm. Molecular markers and other genetic analysis (e.g. sequencing) can be used to enhance the efficiency of selection. Surprisingly, it has been found that the wheat Flo6 gene can be manipulated in wheat in a dose-dependent manner, i.e. not all of the gene copies present need to be mutated to observe a reduction in B-granule content. Thus, in a hexaploid wheat, mutation of 3 of the 6 Flo6 genes provide a phenotype having fewer B granules relative to the wild type but a further decrease in B granule content (to essentially zero B-granules) can be obtained with mutation of 4 of the 6 Flo6 genes. In a tetraploid wheat, mutation of 2 of the 4 gene copies present will result in a grain with a small decrease in B granule content relative to the wild type but a further decrease in B granule content can be obtained with mutation of 3 of the 4 Flo6 genes. Mutation of all 4 gene copies in a tetraploid wheat, where two mutated copies have nonsense mutations and 2 have missense mutations, will result in a grain with substantially no B-granules.
(34) Thus, the present invention provides methods for the selective reduction of B-type granule number in the grain of a domesticated Triticeae species, and provides a domesticated Triticeae species plant having decreased levels of B-type granules within the grain. In particular the present invention provides wheat and/or barley and/or oats and/or rye plants with decreased levels of B-type granules within the grain, for example with substantially no B-type granules (small granules) within the grain. In particular the present invention provides wheat plants with decreased level of B-type granules within the grain, for example with substantially no B-type granules within the grain.
(35) In one aspect, the method of the present invention can lead to the number of B-type granules being decreased by 10% or more relative to the unmodified form of the grain, for example the number of B-type granules in the grain can be reduced by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% relative to the unmodified form of the grain. Optionally, the modified endosperm can contain 80% B-type granules or less, for example 70% B-type granules, for example 60%, 50%, 40%, 30%, 20% or 10% B-type granules or less when assessed by granule number (with the remainder being A-type granules (common wheat, rye or barley) or compound granules (oats)). Preferably, the percentage weight or volume of B-type granules (relative to the whole granule content of the endosperm) is reduced by 5% or more, for example is reduced by 10% or more.
(36) Optionally, the method of the present invention can produce a grain which substantially lacks B-type granules. Optionally, the method can produce a grain which lacks any B-type granules in the endosperm (since initiation of this granule type does not occur). The method can be used with any domesticated Triticeae species (as herein defined), but specific mention can be made of wheat, barley, rye, and oats. Wheat is particularly of interest. Commercial cultivars are of particular interest.
(37) Optionally, the method of the present invention can produce a wheat plant able to produce a grain comprising an endosperm which contains 25% B-type granules or less, for example 20% or less, for example 10% or less, or even 5% or less B-type granules when assessed by weight or volume (with the remainder being A-type granules). Optionally, the method of the present invention can produce a barley plant able to produce a grain comprising an endosperm which contains 8% B-type granules or less, for example 5% or less, for example 3% or less, or even 1% or less B-type granules when assessed by weight or volume (with the remainder being A-type granules). Optionally, the method of the present invention can produce an oat plant able to produce a grain comprising an endosperm which contains 30% B-type granules or less, for example 25% or less, for example 20% or less, for example 10% or less, or even 5% or less B-type granules when assessed by weight or volume (with the remainder being compound granules). The method also covers the grain formed by the plants described above.
(38) In one aspect, the method of the present invention can lead to a domesticated Triticeae plant able to produce grain in which the level of B-type granule is increased by at least 20%, for example at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% relative to the level of these granules observed in the unmodified grain. Optionally the method can produce grain which consists predominantly of small (i.e. B-type) granules. Thus the grain produced can lack large A-type granules (for example in wheat, barley, and rye) or can lack compound granules (for example in oats). In one embodiment the domesticated Triticeae plant is a wheat plant.
(39) Thus, the present invention provides methods for the selective increase of B-type granule number in the grain of a domesticated Triticeae species, and provides a domesticated Triticeae species plant having increased levels of B-type granules within the grain. In particular the present invention provides wheat and/or barley and/or oats and/or rye plants with increased levels of B-type granules (i.e. small granules) within the grain, for example with substantially all B-type granules within the grain. In one embodiment the domesticated Triticeae plant is a wheat plant.
(40) In one aspect, the present invention provides a domesticated Triticeae species plant able to form grain wherein the level (granule number or weight or volume) of B-type granule within the endosperm is increased by at least 20%, for example at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% relative to the level of these granules observed in the unmodified grain. In particular the present invention provides wheat and/or barley and/or oats and/or rye plants with increased levels of B-type granules (i.e. small granules) within the grain, for example at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% more B-type granules relative to the number of these granules observed in the unmodified grain. Optionally the method can produce grain which consists predominantly of small (i.e. B-type) granules. Thus the grain produced can lack large A-type granules (for example in wheat, and barley). In certain embodiments (for example in oats), the method can produce grain which consists predominantly of compound granules. In one embodiment the domesticated Triticeae plant is a wheat plant.
(41) It is a further object of the present invention to provide methods for the selection of a domesticated cereal plant of a Triticeae species (for example a cereal such as wheat, oats, barley or rye) which produces grain endosperm which lacks B-type granules by the evaluation of the genome. In particular the sequence of the gene Bgc-1 in any individual plant can be analysed for selection, for example by DNA sequencing, analysis of granule content or other techniques. In one embodiment the domesticated Triticeae plant is a wheat plant.
(42) It is a further object of the present invention to provide methods for the selection of a domesticated cereal plant of the Triticeae species (for example a cereal such as wheat, oats, barley or rye) which produces grain endosperm which substantially consists of B-type granules by the evaluation of the genome. Preferably the domesticated cereal plant is a cultivar suitable for commercial use. In one embodiment the domesticated Triticeae plant is a wheat plant.
(43) It is a yet further object of the present invention to provide flour milled from the grain of a plant of domesticated Triticeae species (for example a cereal such as wheat, oats, barley or rye), wherein said grain has modified levels of B-type granules. The modified levels can be an increased level or a decreased level (i.e. number) of B-type granules, as compared to the unmodified form of the grain as is described above. Optionally the modified grain can have substantially no B-type granules within the grain. Optionally the starch content of the modified grain can consist predominantly of B-type granules. The modified grain can be produced from a plant of a domesticated Triticeae species (preferably from a cultivar suitable for commercial use) according to the invention.
(44) It is a still further object of the present invention to provide compositions of matter comprising grain and/or flour milled from the grain of a plant of domesticated Triticeae species with modified levels of B-type granules within the grain according to the present invention and as described above. In particular, the modified levels of B-type granules can be an increased level or a decreased level (i.e. number) of B-type granules, as compared to the unmodified form of the grain. Optionally the modified grain (or flour produced therefrom) can have substantially no B-type granules within the grain. Optionally the modified grain (or flour produced therefrom) can have a starch content which consists predominantly of B-type granules.
(45) These and other objects of the invention are provided by one or more of the embodiments described below.
(46) Manipulation of the genome of polyploid wheat and oats is particularly complex and difficult. For example, T. aestivum is an allohexaploid having 3 genomes, each consisting of 7 pairs of chromosomes, and each believed to originate from a different diploid parent. The genomes are identified as A, B and D. Thus, any phenotypic trait within wheat can be due to gene expression from a minimum of one of any one of the 6 homoeologous chromosomes. Additionally the polyploid wheat genome means that a mutation in any one genome can be phenotypically masked due to expression of an equivalent gene in one of the other genomes.
(47) For the first time, the inventors have produced a wheat plant which does not produce B-type starch granules within its endosperm. Seeds of this plant have been deposited at the National Collections of Industrial, Food and Marine Bacteria (NCIMB) (Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, UK) on 8 Feb. 2017 under Accession No. NCIMB 42723). The B-less wheat plants can be crossed with commercial wheat varieties to produce commercial common wheat with modified B-type granule content, for example with reduced B-type granule content as described above.
(48) The wheat plant lacking B-type granules (Triticum aestivum cv Paragon) was produced following identification of a QTL locus responsible for B-type granule production in Aegilops (
(49) The presence of B-type granules within the grain of domesticated Triticeae species was postulated to be due to expression of the orthologue of Aegilops gene Bgc-1, such that inactivation of this gene by suitable mutation (including deletion or point mutation) or by other known techniques (e.g. reduced expression due to RNAi or gene editing) can produce grain with decreased levels of B-type granules, for example grains which substantially lack B-type granules or in which B-type granules are absent. In wheat, the orthologues of Bgc-1 that control B-granule content are predicted from conservation of gene order between related species to lie on chromosomes 4AL, 4BS and 4DS.
(50) The inventors have further found that, within wheat Triticum aestivum (cultivar Paragon), there are active Bgc-1 QTL marker genes that control B-granule content on two of the three group 4 chromosomes: 4AL and 4DS. A publically-available collection of deletion mutants of Paragon wheat (M4 generation) was screened for the presence/absence of genes predicted to flank Bgc-1 and a double deletion mutant, with deletions in the A and D genomes, was produced by crossing resulting in a single wheat plant which lacked B-type granules. The B genome copy of Bgc-1 is presumed to be inactive in Paragon.
(51) The present invention provides a wheat plant having mutations or deletions in the Bgc-1 QTL marker genes on chromosomes 4AL and/or 4DS for use in the production of a progeny plant which produces decreased levels of B-type granules in its endosperm, preferably which produces no B-type granules in its endosperm.
(52) Thus the present invention further provides grain from wheat plants which contains decreased levels of B-type granules in its endosperm (preferably which has no B-type granules in its endosperm) and to flour and/or compositions of matter produced therefrom.
(53) A candidate Bgc-1 QTL marker gene (cBgc-1) was identified by fine mapping in Aegilops.
(54) The genomic sequence for functional Bgc-1 found in the synthetic tetraploid KU37 is given as SEQ ID No. 1, with the corresponding amino acid sequence of the expressed Bgc-1 protein being set out at SEQ ID No. 4. It was postulated that expression of this gene enabled KU37 to produce B-type granules within its endosperm.
(55) In contrast, neither native Aegilops peregrina nor Aegilops crassa produce B-type granules; analysis of their endosperms shows that only A-type granules are present. The corresponding genomic Bgc-1 sequences are given in SEQ ID Nos. 2 and 3, respectively, and the corresponding amino acid sequence are given as SEQ ID Nos. 5 and 6, respectively.
(56) Comparison of SEQ ID Nos. 4 (KU37) and 5 (A. peregrina) show a single amino acid change at position 824. In KU37 the amino acid is alanine, whereas in A. peregrina the amino acid at this position is proline. Similarly, comparison of SEQ ID Nos. 4 (KU37) and 6 (A. crassa) shows a single amino acid change at position 475. In KU37 the amino acid is proline (Pro491), whereas in A. crassa the amino acid at the equivalent position (475) is leucine.
(57) The present invention provides a Bgc-1 protein comprising at least one amino acid substitution mutation, for example at the position or positions functionally equivalent to Pro491 and/or Ala824 of SEQ ID No. 4.
(58) The present invention provides a genetically modified form of the gene Bgc-1 which expresses a non-functional protein. For example, the codons for Pro491 and/or Ala824 of SEQ ID No 4 (or functional equivalents thereof) can be altered to produce non-functional expression product. Optionally, the codon for Ala824 is modified to express Proline. By “functionally equivalent” it is meant that the amino acid substitution is considered to occur at the amino acid position that has the same functional role in the protein. Generally functionally equivalent substitution mutations in two or more different proteins occur at homologous amino acid positions in the amino acid sequences. An example of sequence alignment to identify functionally equivalent residues is shown in
(59) Techniques for changing a codon are well-known within the art, and include, but are not limited to: RNAi, crispr cas9, TILLING mutants, deletion mutants, site-directed point mutagenesis, random point mutagenesis, in vitro or in vivo homologous recombination (DNA shuffling and combinatorial overlap PCR), mutagenesis using uracil containing templates, oligonucleotide-directed mutagenesis, phosphorothioate-modified DNA mutagenesis, mutagenesis using gapped duplex DNA, point mismatch repair, mutagenesis using repair-deficient host strains, restriction-selection and restriction-purification, deletion mutagenesis, mutagenesis by total gene synthesis, degenerate PCR, double-strand break repair, and many others known in the art.
(60) Also presented herein is a nucleic acid molecule encoding an altered Bgc-1 protein as defined in any the above embodiments. Also presented herein is an expression vector comprising the nucleic acid molecule described above. Also presented herein is a host cell comprising the vector described above.
(61) A method to reduce B-type granule content in the endosperm of plants of domesticated Triticeae species comprises the step of introducing a mutation within the gene Bgc-1 which affects functionality of the expression product, for example to produce a non-functional expression product. For example, the codons for 491 Pro and/or 824 Ala (relative to SEQ ID No 4 or the functional equivalents thereof) can be modified to affect the amino acid type such that a non-functional protein is produced.
(62) Comparison of the orthologous sequences in other grasses, including Triticeae species (Aegilops tauschii, Triticum uratu, Triticum aestivum, Hordeum vulgare) which, like KU37 have B-type starch granules, shows that Alanine-824 and Proline-475 (Proline 491 of SEQ ID No. 4) are highly conserved. It was postulated that the presence of Proline at position 824 in the Aegilops peregrina sequence and the presence of Leucine at position 475 in A. crassa is sufficient to prevent functional protein from being produced, and ultimately to prevent B-type granule production.
(63) Comparison of SEQ ID Nos. 1 (KU37) and 2 (A. peregrina) shows that a single nucleotide point mutation causes the amino acid shift. In SEQ ID No. 1 (KU37), nucleotide 5392 is “g”, whereas the equivalent nucleotide in SEQ ID No. 2 (A. peregrina) is 5380 which is “c”. Thus the DNA codon changes from GCT in the functional protein to CCT in the non-functional protein.
(64) Comparison of SEQ ID Nos. 1 (KU37) and 3 (A. crassa) shows that a single nucleotide point mutation causes the amino acid shift. In SEQ ID No. 1 (KU37), nucleotide 3213 is “c”, whereas the equivalent nucleotide in SEQ ID No. 3 (A. crassa) is 2933 which is “t”. Thus the DNA codon changes from CCG in the functional protein to CTG in the non-functional protein.
(65) From analysis from the sequences of SEQ ID Nos. 1 to 6, it is further postulated that the BGC-1 protein is a protein pumping ATPase. The ATPase is postulated to be located in the plasma membrane.
(66) The present invention contemplates the use of suitable genetic manipulation techniques to inactivate orthologues of Bgc-1 in different species in order to modify B-granule content. As an example, the Bgc-1 orthologues in wheat are:
(67) (A1) TRIAE_CS42_4AL_TGACv1_288750_AA0957220,
(68) (A2) TRIAE_CS42_4AL_TGACv1_290111_AA0981820,
(69) (B) TRIAE_CS42_4BS_TGACv1_328355_AA1086780,
(70) (D) TRIAE_CS42_4DS_TGACv1_361106_AA1161080.
(71) The corresponding orthologue in barley is MLOC_52920.
(72) The corresponding orthologue in Triticum uratu is TRIUR3_02152, TRIUR3_05748.
(73) The corresponding orthologue in Aegilops tauschii is F775_14999.
(74) The present invention also lists orthologues in other species. It is contemplated that Bgc-1 mutants in various species can now be generated using techniques known in the art (including RNAi, crispr cas9, TILLING mutants, deletion mutants and the selection of natural genetic variants or other techniques as listed above). The following are domesticated Triticeae species as defined herein: Hordeum vulgare (barley), Triticum aestivum (common wheat).
(75) It is contemplated that deletion or substitution mutants of the above orthologs can now be generated using techniques known in the art.
(76) However, as noted above subsequent work has clarified that the Bgc-1 QTL marker gene (SEQ ID No. 1) and expressed protein sequence (SEQ ID No. 4), despite the initial promising results, are not responsible for B-granule initiation. Further fine mapping in Aegilops refined the region containing the gene responsible for controlling B-granule content (
(77) The wheat Flo6 gene is given in SEQ ID No. 53. Kronos TILLING mutant lines affected in the Flo6 gene were selected and are given below:
(78) TABLE-US-00002 TABLE B Gene Chromosome Mutant ID Effect on TaFlo6 TraesCS4A01G284000 A K2244 Trp291 to STOP A K3145 Trp400 to STOP TraesCS4B01G029700 B K0456 Glu469 to Lys B K3239 Val470 to Ile
(79) When lines K2244 and K3239 were crossed together and a double mutant was selected from the F.sub.2 progeny it was found to lack B-type starch granules. Thus the present invention further provides grain from wheat plants which contains decreased levels of B-type granules in its endosperm (preferably which has no B-type granules in its endosperm) and to flour and/or compositions of matter produced therefrom.
(80) The genomic sequence for functional Flo6 in wheat is given as SEQ ID No. 53 (A genome), as SEQ ID No. 55 (B genome), and as SEQ ID No. 57 (D genome), with the respective corresponding amino acid sequence of the expressed protein being set out at SEQ ID Nos. 54, 56 and 58. Expression of this gene enables enable wheat to produce B-type granules within its endosperm. There is a dosage effect to gene expression.
(81) The present invention provides a wheat FLO6 protein comprising at least one amino acid substitution mutation, for example a STOP codon at Trp291 or Trp400 (A genome) and/or the equivalent locations in the B and/or D genomes.
(82) The present invention provides a wheat FLO6 protein comprising at least one amino acid substitution mutation, for example a Glu469 to Lys and/or Val470 to Ile in the B genome and/or the equivalent locations in the A and/or D genomes.
(83) The present invention provides a genetically modified form of the wheat gene Flo6 which expresses a non-functional protein. For example, the codons for at Trp291 or Trp400 of SEQ ID No 53 (or functional equivalents thereof) can be altered to produce non-functional expression product. Optionally, the codon for Glu469 (B genome) is modified to express lysine. Optionally, the codon for Val470 is modified to express Isoleucine. By “functionally equivalent” it is meant that the amino acid substitution is considered to occur at the amino acid position that has the same functional role in the protein. Generally functionally equivalent substitution mutations in two or more different proteins occur at homologous amino acid positions in the amino acid sequences. An example of sequence alignment to identify functionally equivalent residues is shown in
(84) Techniques for changing a codon are well-known within the art, and include, but are not limited to: RNAi, crispr cas9, TILLING mutants, deletion mutants, site-directed point mutagenesis, random point mutagenesis, in vitro or in vivo homologous recombination (DNA shuffling and combinatorial overlap PCR), mutagenesis using uracil containing templates, oligonucleotide-directed mutagenesis, phosphorothioate-modified DNA mutagenesis, mutagenesis using gapped duplex DNA, point mismatch repair, mutagenesis using repair-deficient host strains, restriction-selection and restriction-purification, deletion mutagenesis, mutagenesis by total gene synthesis, degenerate PCR, double-strand break repair, and many others known in the art.
(85) Also presented herein is a nucleic acid molecule encoding an altered wheat FLO6 protein as defined in any the above embodiments. Also presented herein is an expression vector comprising the nucleic acid molecule described above. Also presented herein is a host cell comprising the vector described above.
(86) A method to reduce B-type granule content in the endosperm of wheat plants comprises the step of introducing a mutation within the gene Flo6 which affects functionality of the expression product, for example to produce a non-functional expression product, within at least one genome, optionally within two genomes or within 3 genomes (for hexaploid wheat). For example, the codons for Trp291 or Trp400 (relative to SEQ ID No 53 or the functional equivalents thereof) can be modified to affect the amino acid type such that a non-functional protein is produced.
(87) In particular, cereal grain (e.g. wheat, barley, rye or oat grain) with decreased levels of B-type granules in its endosperm are likely to be of commercial importance in the production of bread, the production of alcohol (for example for beer or whisky and industrial alcohol), as starch additives for food production, and for biscuits (cookies). Other uses within the food and drink industry and non-food uses are also contemplated.
(88) Preferred or alternative features of each aspect or embodiment of the invention apply mutatis mutandis to each aspect or embodiment of the invention (unless the context demands otherwise).
(89) The term “comprising” as used herein means consisting of, consisting essentially of, or including and each use of the word “comprising” or “comprises” can be independently revised by replacement with the term “includes”, “consists essentially of” or “consists of”.
Examples
(90) Location of Bac-1 in Goat Grass (Aegilops)
(91) A population of Aegilops which segregated for B-type granules was produced as described in Howard et al., supra. Analysis of granule-size distribution within the segregating population suggested that a single locus (Bgc-1) is responsible for B-granule content. The region of the genome responsible for initiation of B-type granule production in Aegilops was identified in the F2 population as being on the short arm of chromosome 4S. The mapping population was increased by backcrossing one F.sub.2 line lacking B-type granules with the Aegilops peregrina parent line, which introgressed the Bgc-1 region into a background that is near iso-genic with Aegilops peregrina. Homozygous recombinant plants were selected from the backcrossed population and the original population, and were both phenotyped and genotyped. Genotyping included identification of SNPs using RNA sequencing of the parent plants. Markers were designed to these SNPs and fine mapping refined the location of Bgc-1 to a region near the telomere of chromosome 4S in A. peregrina.
(92)
(93) One of the ten conserved genes (the gene amplified by marker KT71) was identified as a candidate Bgc-1 QTL marker gene (cBgc-1) by consideration of the functional annotations, patterns of gene expression, the lack of a functional protein encoded by the B-genome homoeologues in wheat, and allelic variation in protein sequence amongst Aegilops with and without B-type starch granules. The class of proteins encoded by Bgc-1 and its orthologues, encodes a proton-pumping ATPase located in the plasma membrane.
(94) TABLE-US-00003 TABLE 1 Genes in the Bgc-1 region and their orthologues in other species. The markers found to flank Bgc-1 by mapping in Aegilops are shown in bold. The genes between the flanking markers in Triticum aestivum (A genome) and their orthologues in other species are as described in Ensembl Plants release 34 (ensemblgenomes.org). Oryza sativa Aegilops T. aestivum Ae. Brachypodium Hordeum vulgare Hordeum Japonica (RAP: marker (A genome) tauchii (D) T. uratu (A) distachyon (IPK) vulgare Bd orthologue) KT106 TRIAE_CS42_ F775_06205 TRIUR3_ BRADI1G12200 HORVU4Hr1G004470 MLOC_52290 OS03G0686900 4AL_TGACv1_ 17222, 288748_AA0957140 3RIUR3_ 17223 KT116 TRIAE_CS42_ F775_27418 TRIUR3_ Bradi1g12190 HORVU7Hr1G018540 MLOC_52153 OS03G0687000 4AL_TGACv1_ 17224 288748_AA0957150 TRIAE_CS42_ No orthologue No orthologue No orthologue No orthologue No orthologue No orthologue 4AL_TGACv1_ 288748_AA0957160 TRIAE_CS42_ No orthologue No orthologue No orthologue No orthologue No orthologue No orthologue 4AL_TGACv1_ 290993_AA0991220 TC35 TRIAE_CS42_ F775_12930 TRIUR3_ BRADI1G12180 HORVU4Hr1G004440 MLOC_56677 OS06G0712500 4AL_TGACv1_ 20887 290993_AA0991230 TC36 TRIAE_CS42_ F775_01647 TRIUR3_ BRADI1G12170 no orthologue MLOC_56679 OS03G0687200 4AL_TGACv1_ 20886 290993_AA0991240 KT121 TRIAE_CS42_ F775_28299 — BRADI1G12157 HORVU4Hr1G004410 MLOC_7897 OS03G0688200 4AL_TGACv1_ 290974_AA0991080 TRIAE_CS42_ No orthologue No orthologue No orthologue No orthologue No orthologue No orthologue 4AL_TGACv1_ 290753_AA0988980 TRIAE_CS42_ F775_07147 TRIUR3_ BRADI1G12150 HORVU4Hr1G004540 — OS03G0688300 4AL_TGACv1_ 22664 288750_AA0957180 KT70 TRIAE_CS42_ F775_28757 TRIUR3_ BRADI1G12140 HORVU4Hr1G004590, MLOC_3791 OS03G0689100 4AL_TGACv1_ 02150 HORVU3Hr1G076320 288750_AA0957210 KT71 A1 TRIAE_CS42_ F775_14999 TRIUR3_ BRADI1G12117 HORVU4Hr1G004820 MLOC_52920 OS03G0689300 4AL_TGACv1_ 02152 288750_AA0957220 TRIAE_CS42_ F775_23325 TRIUR3_ No orthologue No orthologue No orthologue No orthologue 4AL_TGACv1_ 05747 290111 _AA0981830 KT71 A2 TRIAE_CS42_ No orthologue TRIUR3_ BRADI1G12117 No orthologue No orthologue OS03G0689300 4AL_TGACv1_ 05748 290111_AA0981820 KT110 TRIAE_CS42_ F775_02372 TRIUR3_ BRADI1G12110 HORVU4Hr1G004800 MLOC_54406, OS03G0689900 4AL_TGACv1_ 05749 MLOC_71666 290111_AA0981810
Deletion Mutants in Wheat
(95) Deletion mutants were generated by T-irradiation (as described by Al-Kaff et al 2008, Annals of Botany 101:863-872) in the wheat cultivar Paragon (as part of the Wheat Genetic Improvement Network, WGIN project). This publically-available mutated population (M4 generation) was grown in 11-cm pots using ICL Levington Advance M2 Potting & Bedding compost) in a glasshouse with natural heat and light (during UK summer) or with 20° C. day and 15° C. night and lighting supplemented to give 16-h day length (during UK winter). DNA was prepared from seedling leaves using the methodology based on Fulton et al., 1995, Plant Molecular Biology Reporter 13:207-209.
(96) Screening for Deletion Mutants
(97) The deletion mutant population was screened for deletions in genes orthologous to those flanking the previously-identified Aegilops QTL for B-granule content on the short arm of chromosome 4S. Selection was conducted by genetic analysis of six genes (Table 1) one of which was later identified as the candidate Bgc-1 QTL marker gene, (amplified by marker KT71). Primers were designed to the six wheat genes. KT71 primers were designed to amplify all homoeologues whilst the other primers were designed to be homoeologue-specific. All the selected genes had three homoeologues except KT71 which had four. There are two copies of the KT71 gene on the A genome (genes A1 and A2), one on the B-genome (B) and one on the D-genome (D). The KT71 primers were designed to amplify fragments of the KT71 homoeologues that differed in size. The PCR products were separated by capillary electrophoresis as shown in
(98) Some or all of the markers developed for all six genes shown in Table 2 were used to screen the Paragon deletion-mutant population. Deletion mutants of the A and D genomes were obtained and the genotype of the markers closely flanking cBgc-1 revealed the extent of the deletions (Table 3). All the deletions discovered were extensive, encompassing not only KT71 but also many of the flanking genes.
(99) TABLE-US-00004 TABLE 2 PCR primers and conditions Primers were designed to wheat genes. KT71 primers were designed to amplify all homoeologues whilst the other primers were designed to be homoeologue-specific. For 4N5.5, only a D-genome-specific primer pair was designed. Primer sequences and PCR conditions are shown. The primers are listed as SEQ ID Nos. 7 to 30 in the order shown below Exten- Amplicon sion Aegilops Chromo- Wheat Primer Forward Primer Reverse size Tm time marker some gene 5′-3′ 5′-3′ (bp) (° C.) (s) DMSO TC37B 4AL 289950_ AACTACAGAT CTACTGCTAC 85 60 30 No AA0979330 TCATGACAGG CTCCTCTCTT 4BS 328956_ — — AA1096100 4DS 361737_ ACGGATTAGT GTTGGGAAGA 80 60 30 No AA1172310 CACAACAAGC CAGATAATGC KT71 4AL 288750_ GGARTTTGAT [FAM]GCAGCCCA 279 59 30 No AA0957220 TTCCCGCCAT GAAGAAAATGACA 4AL 290111_ 301 AA0981820 4DS 328355_ 298 AA1086780 4DS 361106_ 310 AA1161080 TC30B 4AL 29007_ ATCTGGTACCTGATT CCACAACTGTACC 265 60 30 Yes AA0981360 TCATAGTGA ATTATCTACTGC 4BS 328641_ CAAGGACGCAAT GCAACGAGGAGA 506 60 30 Yes AA1091570 CTCACCA TGAGCC 4DS 361093_ CAAGTTCTCTA TTGATCAAGAGA 311 60 30 Yes AA1160690 CGGTTTGGAGT ATGGGGAT TC34 4AL 289509_ ATGACACCTTT AGCTCGGTC 639 62 30 No AA0972250 ATTTCAGCCAG TGCATTTGA 4BS 328517_ CGCTCACCATC GAGCTGAAGCGA 283 62 30 No AA1089200 ACCCAAG ACGAAC 4DS 362688_ TGCCATCATCG TGGTGTGCTGT 333 62 30 No AA1181550 GTAGTCATT TGATCCTT 4G 4AL 289219_ GATGAGCCGCC CCTTTGCTGA 304 60 30 No AA0967530 TCCCCAT TGCAGTTCG 4BS 362384_ — — AA1179360 4DS 362384_ TGGAACACTGC GGTGGAGCGAG 311 60 30 No AA1179360 CATCGTG ATATGAGATC 4N5.5 4DS 363571_ GGCTTTGATAC CAGTGTAAGGC AA1183970 TGGAACGAAT TCTGTTGCG
(100) For the wheat genes, the IDs given in Table 2 are preceded by:
(101) TRIAE_CS42_[chromosome]_TGACv1_.
(102) TABLE-US-00005 TABLE 3 Genotypes of the deletion mutant lines. The markers are ordered (left to right) in the order in which they occur on the chromosome arm (telomere to centromere). PCR-positive (gene present) = ‘+’. PCR-negative (gene deleted) = ‘−’. PCR not determined = nd. PCR amplicon observed but low in abundance = FAINT. Chromo- Marker some arm Line Plant TC37b KT71 TC30b TC34 4G 4N5.5 4AL A1 1 − − − − + nd 4AL A1 2 FAINT − FAINT − + nd 4AL A2 1 − − − − − nd 4AL A2 2 FAINT − − − − nd 4AL A2 3 − − FAINT − − nd 4AL A2 4 − − − − − nd 4AL A3 1 − − − − − nd 4AL A3 2 − − − − − nd 4DS D1 1 − − FAINT − + nd 4DS D1 2 − − FAINT − + nd 4DS D2 1 − − − − + nd 4DS D3 1 − − − − − − 4DS D4 1 − − − − − − 4DS D4 2 − − − − − − 4DS D4 3 − − − − − − 4DS D4 4 FAINT − − − − − 4DS D5 1 + + + + − + 4DS D5 2 + + + + − + 4DS D5 3 + + + + − +
Stacking the Deletion Mutants
(103) Stacking was conducted (by repeated rounds of crossing and selection) to incorporate multiple suitable deletions into a single plant.
(104) Stacking of the A and D deletions by crossing was accomplished to produce double A/D mutant plants (derived from four F.sub.2 plants).
(105) Examination of the starch granules of the A/D double deletion mutant plants showed that they lacked B-type starch granules. Thus, the B-genome copy of Bgc-1 is postulated to be dysfunctional in these wheat plants.
(106) Specifically, to generate plants with deletions in the Bgc-1 regions of both the A- and D-genomes, mutant lines A1-3 were crossed pairwise to lines D1-4, in all combinations. All crosses were successful except A2×D3. The F.sub.1 plants were grown and allowed to self-fertilize. For each F.sub.2 family, 24 grains were sown. DNA was prepared from seedling leaves and was PCR-screened using the KT71 primers only. Out of a total of 457 F.sub.2 plants that were successfully screened, only one plant carried homozygous deletions on both 4AL and 4DS (
(107) To screen for additional double-deletion mutant plants, selected F.sub.2 plants with homozygous single deletions on either 4AL or 4DS were allowed to self-fertilize and the F.sub.3 seeds were each cut in half. Plants recovered from the embryo-halves of the F.sub.3 seeds were screened for deletions using the KT71 primer pair. Four additional double mutant plants were discovered. Only one of the additional double mutants survived and was fertile. This second double mutant plant, like the first double mutant, derived from a cross between mutant lines A1 and D4. The first double mutant and its progeny only, were used in subsequent experiments.
(108) Thus, two double-deletion mutant lines survived. These were derived from crosses between the same A and D genome deletions (A1×D4) but from different F1 plants. The mutant lines are therefore independent and this suggests that it is the combination of deletions of Bgc-1 regions on 4AL and 4DS rather than the combination of loci on other chromosome arms (background deletions) that is responsible for the lack of B-granules in the B-less mutants.
(109) To screen for a wildtype segregant control line for the first 4AL/4DS double deletion mutant plant, the PCR-positive F.sub.2 plants (wildtype or heterozygous for the deletion) from the A1×D4 F.sub.1 plant that gave rise to the first double deletion mutant were grown and allowed to self-fertilize. An F.sub.2 plant which gave progeny that were all PCR-positive (i.e. homozygous wildtype for the deletion) was selected.
(110) Phenotypes of Single and Double Mutants
(111) Granule analysis was conducted by microscopic examination. Howard et al., 2011 supra described suitable techniques for granule examination.
(112) The starch granules from the single deletion mutants were examined microscopically and, like the normal wheat cultivar Paragon, all were found to possess A- and B-type granules (see
(113) The progeny of the double mutant (B-less) plant were grown together with replicate wildtype segregant (Control) and Paragon plants. The height of the primary tillers of both the Control and B-less plants was statistically significantly less than that of Paragon. However, there was no difference in tiller height between the Control and B-less plants.
(114) Grain weight, length, width and area were compared between the three genotypes. As with Paragon tillers, the Paragon grains were bigger than either the Control or B-less mutant grains. (However, the difference in grain weight between Paragon and the Control was not statistically significant). There was no difference in grain size or weight between Control and B-less mutant grains. Similarly, the starch content of both Control and B-less plants was statistically significantly less than that of Paragon but there was no statistically significant difference in starch content between the Control and B-less plants.
(115) This analysis suggests that the background deletions in both Control and B-less plants are deleterious for plant growth. However, the lack of B-type starch granules due to deletions in the Bgc-1 region specifically, has no detectable effect on plant growth, grain size or starch content.
(116) Starch was purified from the grains of the three genotypes: Paragon, Control and B-less mutant. Several starch functional properties were examined and for the following, there were no differences between the Control and B-less starches: protein content, moisture content, the size of the A-type starch granules and most of the DSC parameters (enthalpy of starch gelatinization, onset and peak temperatures). However, some functional properties were different between the Control and B-less starches. These included grain hardness (B-less were softer), small granule content (small starch granules are defined as those between 1 and 10 μm in diameter; B-less had fewer granules less than 10 μm in diameter), size of the small granules (B-less had larger small-starch granules, on average), amylose content (B-less had slightly lower amylose content), swelling power (B-less starch swells more) and finally, the DSC end temperature for the starch gelatinization peak (B-less end temperature was approximately 1.5° C. higher).
(117) The lack of B-type granules was obvious when starch from mature grains was examined microscopically and was confirmed by quantitative analysis of starch-granule size distribution using image analysis. Image analysis showed that there are some small granules (with diameters between 1 and 10 μm) in the B-less mutant. This is also the case in the B-less Aegilops examined previously using a similar method. We assume that these small granules in the B-less mutant are small A-type granules rather than true B-type granules and this assumption is supported by the fact that the average size of this category of granules is larger in the B-less starch than in the wild-type Control.
(118) Starch from B-less wheat grains has different functional properties than Control starch with B-granules. To some extent this is predicted from published data on the properties of purified A and B-type granules from normal wheat and barley, which can vary (Lindeboom et al, 2004, Starch 56, 89-99). However, the precise differences observed in our B-less mutant starch are mainly not as predicted. First, the amylose content of purified A-type granules has been found to be either greater (Peng et al, 1999, Cereal Chemistry 76:375-379; Takeda et al, 1999, Carbohydrate Polymers 38:109-114) or the same (Evers et al, 1974, Starch 26: 42-46; Myllarinen et al, 1998, Journal of the Institute of Brewing, 104: 343-349) as that of purified B-type granules. Thus, the amylose content of the B-less wheat starch might be predicted to be higher or the same as that of the Control. However, we observed a slightly lower amylose content. Second, the swelling power of B-less mutant starch is predicted to be lower than normal (Wei, 2010, Acta Physiologiae Plantarum 32:905-916; Chiotelli et al, 2002, Cereal Chemistry 79:286-293) but surprisingly was observed it to be higher. These data suggests that the A-type granules in the B-less mutant wheat differ in composition from the A-type granules in normal wheat.
(119) The gelatinization enthalpy of B-less mutant starch was found to be the same as that of Control starch. The values obtained are within the range expected for wheat starch (7-10 J/g solids). This result is predicted by the work of Eliasson et al (1983, Physicochemical behaviour of the components of wheat flour. In: Cereals in breadmaking: a molecular colloid approach) which showed that the gelatinization enthalpy of wheat starch is independent of the granule-size distribution. However, others have found higher gelatinization enthalpies for A-type than for B-type starch granules in wheat (Peng et al., 1999, supra; Chiotelli et al, 2002, supra).
(120) The deletion mutant plants (both Control and B-less mutant) grew less well than Paragon. The WGIN Paragon deletion mutant population is known to harbour many large deletions. This inhibition of growth is likely to be due to deletions of genes at locations in the genome other than the Bgc-1 region (background deletions). If the Bgc-1 gene was specifically manipulated, then B-granules could be eliminated without any (or with far fewer) side effects on plant growth.
(121) The lack of any detectable decrease in grain weight or size suggests that yield of the B-less mutant may not be adversely affected. This together with the novel functional properties, indicate that B-less wheat is commercially useful. For example, uniform and on average larger-than-normal starch granules may lead to improvements in the yield of purified starch and gluten. Reduced grain hardness could lead to reduced milling energy. Increased swelling power could lead to increased bread softness and prolonged shelf life (reduced staling). B-granules are also predicted to be detrimental for malting and distilling suggesting that B-less wheat may be preferred for alcohol production.
(122) Further details are set out below in Table 4.
(123) TABLE-US-00006 TABLE 4 Growth metrics and starch functional properties. All values are expressed as mean ± SE per plant. The number of plants measured = n. Student's t-test (p value) Mutant Normal Control (wild-type B-less Normal Normal Mutant different (Paragon) segregant) mutant v v v from control Mean n SE Mean n SE Mean n SE Control Mutant control (p < 0.05) Growth metrics Height of primary 80.86 18 1.55 72.50 8 3.75 65.08 12 2.37 0.02 0.00 0.09 No tiller (cm) Grain weight (mg) 38.66 18 1.00 31.86 8 2.20 33.94 23 1.02 0.08 0.00 0.34 No Grain length (mm) 6.24 18 0.04 5.64 7 0.15 5.73 26 0.05 0.00 0.00 0.51 No Grain width (mm) 3.34 18 0.04 3.04 7 0.10 3.19 26 0.04 0.00 0.01 0.11 No Grain area (mm.sup.2) 17.03 18 0.29 14.01 7 0.73 14.75 26 0.24 0.00 0.00 0.22 No Starch content (% grain 64.8% 4 1.1% 57.8% 4 2.0% 52.0% 4 1.8% 0.02 0.00 0.08 No weight) Starch functional properties NIR Protein content 16.44 6 0.48 18.59 3 0.64 17.66 5 1.19 0.03 0.34 0.59 No Moisture content 12.25 6 0.06 11.82 3 0.17 12.15 5 0.11 0.02 0.44 0.14 No Hardness 68.45 6 2.09 63.33 3 1.76 39.62 5 4.21 0.16 0.00 0.01 Yes Granule size Small granule content (% 53% 4 4% 55% 4 4% 17% 4 5% 0.78 0.00 0.00 Yes granules 1-10 um diameter) Size of small granules 25.54 4 0.66 23.50 4 0.64 38.64 4 5.26 0.07 0.05 0.03 Yes (μm.sup.2) Size of large granules 317.8 4 6.6 294.5 4 15.1 349.3 4 23.6 0.21 0.25 0.10 No (μm.sup.2) Amylose content (% starch) 23% 4 1% 25% 4 1% 21% 4 1% 0.26 0.07 0.01 Yes Swelling power ( ) 9.12 4 0.27 9.09 4 0.32 11.37 4 0.39 0.94 0.00 0.00 Yes DSC Enthalpy of Starch 8.13 3 0.11 8.20 3 0.03 7.96 3 0.47 0.58 0.74 0.63 No Gelatinisation Onset temperature (° C.) 57.49 3 0.42 57.25 3 0.28 56.67 3 0.09 0.66 0.13 0.12 No Peak temperature (° C.) 61.79 3 0.48 61.82 3 0.24 62.34 3 0.40 0.96 0.43 0.33 No End temperature (° C.) 69.34 3 0.76 70.34 3 0.38 71.74 3 0.21 0.30 0.04 0.03 Yes Enthalpy of melting of the 0.39 3 0.02 0.46 3 0.04 0.67 3 0.06 0.24 0.01 0.04 Yes amylose-lipid complex Onset temperature (° C.) 98.53 3 0.19 98.72 3 0.29 97.52 3 0.18 0.60 0.02 0.02 Yes Peak temperature (° C.) 103.52 3 0.27 103.89 3 0.22 103.26 3 0.19 0.35 0.47 0.09 No End temperature (° C.) 108.02 3 0.31 108.79 3 0.25 108.28 3 0.25 0.13 0.55 0.22 No
(124) Table 5 below gives the markers on chromosome 4S of Aegilops, and their corresponding genes in wheat used to identify the Flo6 gene in wheat.
(125) RNA sequencing (RNAseq) of grains and leaves of the two parents, A. peregrina and KU37 was used to develop molecular markers for fine mapping. KASP assays Igcgroup.com were designed to sequence differences between the sequences of the parents and tested on a sub-set of the population to identify markers linked to Flo6.
(126) TABLE-US-00007 TABLE 5 Aegilops Wheat 4BS marker Primer (VIC) Primer (FAM) Primer common Orthologue VIC tag = GAAGGT FAM tag = GAAGGT CGGAGTCAACGGATT GACCAAGTTCATGCT SEQ ID NO: 62 SEQ ID NO: 63 TC60 TCGTCGCCATGGAGGA TCGTCGCCATGGAGGA AGGACCAAA Traes Gg Ga GACCGGGCG CS4B01G025500 SEQ ID NO: 64 SEQ ID NO: 65 SEQ ID NO: 66 TC61 ACAGTCTCCTAGGCGT ACAGTCTCCTAGGCGT CTACCAGCAGG Traes CTGc CTGa AGAATAGGATC CS4B01G025600 SEQ ID NO: 67 SEQ ID NO: 68 SEQ ID NO: 69 TC58 AGTTGATACAGGTGCA AGTTGATACAGGTGCA CCATCTATTTG Traes GtTTa GgTTC GCGGCAA CS4B01G026000 SEQ ID NO: 70 SEQ ID NO: 71 SEQ ID NO: 72 KT108 GGGAGATTGTGGTTAT GGGAGATTGTGGTTAT CAGCTGACTTCA Traes CTGGAAc CTGGAAt ATTCATTTAGC CS4B01G027900 SEQ ID NO: 73 SEQ ID NO: 74 SEQ ID NO: 75 KT116 GGAGATTGTGGTTATC GGAGATTGTGGTTATC CTGACTTCAATT Traes TGGAAc TGGAAt CATTTAGCACTG CS4B01G027900 SEQ ID NO: 76 SEQ ID NO: 77 SEQ ID NO: 78 KT113 TCCGAgGTTCCAGAGC TCCGAgGTTCCAGAGC TGCTGTCAAGAT Traes ACGg ACGa GATTGTATGGAG CS4B01G028900 SEQ ID NO: 79 SEQ ID NO: 80 SEQ ID NO: 81 TC36 GCAGACTCAAACAACT GCAGACTCAAACAGCT CAGCTTTCTGAA Traes TGCTc TGCTt CTTGAGAGG CS4B01G029300 SEQ ID NO: 82 SEQ ID NO: 83 SEQ ID NO: 84 TC35 ATGTTGCCGTTGTAGT ATGTTGCCGTTGTAGT AGCACGCGGAGA Traes GGAc GGAt TCGACA CS4B01G029400 SEQ ID NO: 85 SEQ ID NO: 86 SEQ ID NO: 87 KT106 AGGATGGAACAATCAG AGGATGGAACAATCAG CTACCGGGATAC Traes AAGGc AAGGa AACCTCAG CS4B01G029700 SEQ ID NO: 115 SEQ ID NO: 116 SEQ ID NO: 117 KT117 CTTCAAATAAATGGGG CTTCAAATAAATGGGG CCCAGTGGATGA Traes GCAc GCAa GAATTTTC CS4B01G031000 SEQ ID NO: 88 SEQ ID NO: 89 SEQ ID NO: 90 KT70 GCATGTCTTTAAGA GCATGTCTTTAAGATA AAGTAAGATGCCT Traes TATACATAAATaaa TACATAAATAAAC TTCTGAAGTTCT CS4B01G030400 tAAAC SEQ ID NO: 91 SEQ ID NO: 92 SEQ ID NO: 93 KT110 ATTTGGCATGCGGA ATTTGGCATGCGGAAT TTCATTCATACTT Traes ATGGCTc GGCTa GATAATGCCC CS4B01G030500 SEQ ID NO: 94 SEQ ID NO: 95 SEQ ID NO: 96
Testing Candidate Gene TaFlo6
(127) Despite the very different phenotype observed in barley and rice Flo6 mutants compared with that of B-granule-less Aegilops and Paragon deletion mutants, we selected Flo6 wheat TILLING mutants (wheat-tilling.com) in the tetraploid line Kronos (genome composition AB). An alignment of the wheat FLO6 protein seq is shown in
(128) The supplied Kronos plants were grown and homozygous mutant plants selected. Starch from the single-mutant grains was observed microscopically. All lines showed a bimodal starch granule-size distribution. However, analysis of granule size distribution showed a small reduction in the proportion of small (B) granules in the two 4A nonsense mutants (K2244 and K3145) and in one of the 4B mutants (K3239) when compared with wild-type controls (
(129) The Phenotype of Wheat Entirely Devoid of FLO6 Activity
(130) The apparent discrepancy between the phenotypes of the Kronos double mutant (lacking B-granules) and Franubet barley (heterogeneous granule morphology) is not completely understood. Of the two single mutant lines used to generate the Kronos double mutant line, the B-genome line, K3239 was a missense mutant (Val470-Ile) which might not completely lack FLO6 activity. The A-genome parent line, K2244, has a nonsense mutation (Trp291-STOP) which is highly likely to prevent the production of any active FLO6. Franubet barley, on the other hand is diploid and has a nonsense mutation (W396-STOP; AK373583) which should eliminate all active FLO6. (The Franubet mutation is in the same relative position in the protein as the mutation in the K3145).
(131) To test whether a total elimination of FLO6 activity in wheat would cause a phenotype similar to that in Franubet barley (i.e. heterogeneous starch granule morphology rather than a reduction in B-granules), the following experiments could be done. 1) Creation of a TaFlo6 triple mutant hexaploid wheat line, by crossing the Paragon double deletion mutant to a Cadenza TILLING mutant which has a nonsense mutation in Flo64B (such as line Cadenza1730). A triple mutant could be selected from the progeny of this cross. 2) A TaFlo6 triple mutant of Cadenza could be created by crossing suitable single tilling mutants together and selecting a triple mutant from the progeny of the cross.
(132) The Effect of Flo6 Gene Dosage on Starch Granule Phenotype in Wheat
(133) We found that the single mutants of Kronos wheat had slightly reduced numbers of B-granules compared to Kronos (
(134) Using the Kronos TILLING mutants, we looked at B-granule content in individual grains with different gene dosages. This was done by taking grains from a plant that was heterozygous for at least one genome-copy of TaFlo6, cutting the grains in half, germinating and genotyping the embryo half-grain and extracting and phenotyping the starch from the non-embryo half-grain. This showed that gene dosages of less than 50% wildtype gave drastically reduced numbers of small granules (corresponding to zero B-granules) whereas gene dosages equal to or more than 50% Flo6 gave near-normal small-granule content (
(135) We noticed that the phenotype of some grain from the Paragon deletion mutant population was intermediate between that of the wildtype (normal B-granule content) and that of the Paragon AD double mutant (B-granule-less). An F.sub.2 plant from the Paragon deletion mutant population (generated by crossing the A- and D-genome single mutants) was studied. This plant was homozygous mutant for the 4D-genome deletion but segregating for the 4A-genome deletion (AaBBdd). The genotype of the progeny of this plant was assessed from phenotype of their grains as follows: three A-genome wildtype plants (AABBdd) were identified with grains that all had normal B-granule content; three mutant plants (aaBBdd) were identified with grains that all lacked B-granules and three heterozygous plants (AaBBdd) were identified with grains that varied in B-granule content. The B-granule content of individual grains from these nine plants is shown in
(136) All documents referred to herein are incorporated by reference. Any modifications and/or variations to described embodiments that would be apparent to one of skill in art are hereby encompassed. Whilst the invention has been described herein with reference to certain specific embodiments and examples, it should be understood that the invention is not intended to be unduly limited to these specific embodiments or examples.
(137) The following are the genomic Bgc-1 DNA (A, B and C) and amino acid (D, E and F) sequences for Aegilops with B-type starch granules (KU37) and without B-type starch granules Aegilops peregrina and Aegilops crassa). The divergent nucleotides (A, B and C) and amino acids (D, E and F) are highlighted. A and D; B and E: Aegilops peregrina; C and F: Aegilops crassa. The position of amino acid changes are shown in bold and boxed. These sequences are followed by the genomic Flo6 DNA for genomes A, B and D (labelled G, K and L respectively) and their amino acid sequences (H, K and M respectively).
(138) TABLE-US-00008 A >Ku37seq_clonesD2&D3 (SEQ ID No. 1) CAAGACCATACGTACACATAAATAAATCAGTAAATCATAAAGAAGAAGAAGAAGAAGAGCAG AGGAGGAGGGTCCAGAAGAGTAGTTGGCGGTGGGAAGATCCAGAGGCTGCGCACTGCCTGCC CGGCCGCCTCCACGGCCATGGCCAGCAGCAGGCAGGAGGGGAACCTCGACGCCGTCCTCAAG GAGGCCGTCGACCTGGTAATCACTCAGTTCATCAATCAACTCCCTGCTCTTGGGGTAGTATA GTGCTTCCTCTCTGGTTTTTAGTTAGCGTTGCGCTTCTTGGGGAAATCACCATGTGGCTCGG CCGTCGGCCGCTGGGGTTTCTTTCCGCGCTTCGGGCGTCGCAGTTGCATTGCAGGGTGGTGG AGTTGGCCTGCCAGCGCCTCTTCTTGTAGGTCAATTTGGGAGCGTCGATCTCCCTCCCCTGC CTAGTGTACCGCACTGCTCTAAAATCTCACCCCCCAAATCTTACTAAGCAAAATTTCACCCA GGCTACAACTTTGAGCTACTATTTTTTCCCAGGGCTTACAAAAACTGCAGTTTAGTTTTAAA TTTTAAAATCTCGCAGTTTTATATATAGCTTTGATTTTTCTTTTGTCTGGACAGCGTGTGAG GGCTGCTTGTAAATGTATTTGCTCTAGCTTCGGATTATTTTGATTTTTCTTTTGTCTGGACA GTGTATGAGGGCTGATCACAAGAAGTACATACTTTTTCCTCTGTTTGATTAGAATTTTTATG ATCCTCTGTTTGATTAATTTTTTTTTTTTGTCTCTTGGTTCTCTCTTCTGGGTTCCTTAGAG TAGCAGGCTGCAGCTAGCATACTTGCTCGTTCAGATTTTGCTCATGCTAATGGTACTTGTTT GGTTTTGTTAAAAGAGATTGCCGTAACAAAATTTCAGGAGCACATCCCAATTGATGAAGTGT TTGAGAACCTTCGGTGCAGCCACGAGGGGCTCGCTTCCGAGCAGGCGCAGCAGCGGCTACAG ATCTTTGGCCCGAACAAGCTCGAGGAGAAGGAGGTCAGGTTCTTTCAGCCCATTTGATTATG GGGAAGATTTTGTCCTTGCTCTTCTTGAGAGCAGTAATGTTCTTCTCATTGATGTTATGCAC TTGAGTAAGTTGGAGTGTTTGATGGCTGCAGGAGAGCAAGTTCCTCAAGTTTCTGGGGTTCA TGTGGAATCCACTGTCATGGGTCATGGAGGCTGCGGCGATCATGGCCATCGCGCTGGCGAAC GGAGGGGTAAGACCCAGCACATAGTATTGCAGAATTTGTGGTGATGAGTGATGTTGTATGTC CTGCTCTGTTCTCAATATATATGTGGGATGTGTTCTGTCACCACCAGGGGAAGCCACCAGAT TGGCAAGACTTTGTCGGTATCATCACGCTGCTACTTATAAACTCCACCATCAGTTTCATCGA GGAAAACAATGCCGGAAATGCTGCCGCCGCGCTTATGGCACGTCTTGCGCCAAAAGCCAAGG TCCATATATTCACTTAATTTGTGGCATTTCCCCTGTTTCTGCACGTATCACCTTGTTGGAGT CCATTTTAATTTGTGAAACTCATTATTATATTGCTAAGTAGGTTCTCCGTGACGGTCGTTGG ACCGAGGAGGAGGCAGCCGTCCTTGTGCCTGGGGACATCATCAGCATCAAACTTGGAGATAT CATTCCTGCCGACGCCCGCCTCCTAGACGGCGATCCTTTGAAGATTGATCAGGTTTTTTCTG TCCTTCACATCCGAGTCACCTTCAGCTTTGCTTTTACTTATTTAGATTTCCTATTTCCTCAT CTCACTACTTGGTCTCTTATTTATAGTCTGCCCTGACTGGAGAATCGCTGCCAGCCACCAAA GGTCCTGGTGACGGCGTCTACTCTGGTTCGACGGTCAAGCAGGGCGAGATCGAGGCTGTTGT CATAGCAACTGGTGTGCACACTTTCTTTGGGAAGGCCGCACATCTCGTCGACTCCACCAACC AAGTTGGCCATTTCCAACAGGCAAGCTTGACAAGCCTCGGATACTTTTATCGAATTGTATCA TCGCTACATTGATGTTTTCATTATCATGCGATTGACGCAGGTGTTGACAGCCATCGGGAACT TTTGCATTTGCTCGATTGGTGTGGGGATGTTCATAGAGATCATTGTCATGTATCCTATCCAG CACAGGGCGTACCGCCCTGGGATCGACAACCTTTTGGTGCTTCTCATTGGAGGCATTCCCAT AGCGATGCCCACAGTCTTGTCGGTCACCATGGCGATTGGGTCTCATCGCTTGTCTCAACAGG TATGCATCATTCCAGGGACAGTGTCTCTTAACCATATTGTGACCAGACCTGAACTTCTGCAC TATGCAATCAATTCCTGAGTTTTCTTCCTGCAGGGAGCTATAACAAAGAGAATGACTGCAAT CGAAGAGATGGCCGGCATGGATGTTCTTTGCAGTGATAAGACTGGAACCCTGACTCTAAATA AGCTCAGCGTGGACAAGAACCTAATCGAGGTAAGGTTCACTTGAACACTCACTTTTTGTTAT CTCATATGTAACCTCAGAGCACTTACATACTTTTTTTGGTGCAGGTTTTTGAAAAAGGAGTG ACTCAGGACCAGGTGATTCTGATGGCTGCTAGAGCATCCCGGATAGAAAATCAAGATGCCAT TGATACGGCGATTGTTGGGATGCTAGGCGATCCAAAAGAGGTACATTGATTTGTCGAATAAT GAGACGTACAGCTATCACGTTTATTTGCTAAAATGGATACCTGTTAACTCTCCCCGTAGGCG CGTGCCGGTATTCAAGAGGTTCACTTTCTGCCGTTCAATCCTACCGACAAAAGAACCGCGTT GACATACATTGATGGCGATGGAAAGATGTACCGTGTTAGCAAAGGTGCACCAGAGCAGGTAT AATCTTTTTTTACTGCAAAAAGCTTAAAAAACATTTGCATAATGATGTAAATTGATTTCACA AATTGACCTGCAGATTCTTAACCTGGCCTACAACAAGTCAGAGATCGCACAAAAAGTCCACA CTGTCATCGACAAGTTCGCGGAACGTGGACTTCGGTCACTTGGTGTAGCATATCAGGTGAGA AAGGTTCTGGGTGTGCCCCTTCACAGTGCAGTTGAAGCTTGCAAGGCAGGAACTTAGTGGTG