Resistant protein for use in herbicide, encoding gene and application thereof
11365425 · 2022-06-21
Assignee
- BEIJING DABEINONG BIOTECHNOLOGY CO., LTD. (Beijing, CN)
- Nanjing Agricultural University (Jiangsu, CN)
Inventors
- Jian He (Province, CN)
- Li Yao (Province, CN)
- Xingjun Jia (Province, CN)
- Xiangting Xie (Beijing, CN)
- Yechun Wu (Beijing, CN)
- Qing TAO (Beijing, CN)
- Derong Ding (Beijing, CN)
Cpc classification
C12N9/0044
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
C12N15/8201
CHEMISTRY; METALLURGY
C12N5/10
CHEMISTRY; METALLURGY
International classification
C12N15/82
CHEMISTRY; METALLURGY
C12N5/10
CHEMISTRY; METALLURGY
Abstract
Provided are a resistant protein for use in herbicide dicamba, encoding gene and application thereof, the gene comprising: (a) a nucleotide sequence of an amino acid sequence as shown in SEQ ID NO: 2; or (b) a nucleotide sequence which is complementary to the nucleotide sequence as defined by (a) under stringent conditions; or (c) a nucleotide sequence as shown in SEQ ID NO: 1.
Claims
1. A gene, wherein the gene comprises: (a) the nucleotide sequence shown as SEQ ID NO: 1; or (b) a nucleotide sequence complementary to the nucleotide sequence defined in (a).
2. An expression cassette, wherein the expression cassette comprises the gene of claim 1 under the regulation of an effectively linked regulatory sequence.
3. A recombinant vector, comprising the gene of claim 1.
4. A method for extending the tolerance of a plant to herbicides, wherein the method comprises: expressing in the plant a first protein encoded by a gene comprising the nucleotide sequence shown as SEQ ID NO:1 or a first protein encoded by the expression cassette of claim 2 in a plant together with at least one second protein which is different from the first protein.
5. A method for selecting transformed plant cells, wherein the method comprises: transforming a plurality of plant cells with a gene comprising the nucleotide sequence shown as SEQ ID NO: 1 or the expression cassette of claim 2, and cultivating the cells under a concentration of herbicide allowing the growth of the transformed cells expressing the gene or the expression cassette, while killing the untransformed cells or inhibiting the growth of the untransformed cells, wherein the herbicide is dicamba.
6. A method for weed control, wherein the method comprises: applying an effective dose of a dicamba herbicide to a field for planting a plant, the plant containing a gene comprising the nucleotide sequence shown as SEQ ID NO: 1 or the expression cassette of claim 2.
7. A method for protecting a plant from damages caused by herbicides, wherein the method comprises: introducing a gene comprising the nucleotide sequence shown as SEQ ID NO: 1 or the expression cassette of claim 2 into a plant to make the resultant plant produce a sufficient amount of herbicide tolerant proteins for protecting the plant from damages caused by dicamba.
8. A method for conferring the dicamba herbicide tolerance to a plant, wherein the method comprises: introducing a gene comprising the nucleotide sequence shown as SEQ ID NO: 1 or the expression cassette of claim 2.
9. A method for controlling glyphosate tolerant weeds in a field for a glyphosate tolerant plant, wherein the method comprises: applying an effective dose of dicamba to a field for planting a glyphosate tolerant plant, the glyphosate tolerant plant containing a gene comprising the nucleotide sequence shown as SEQ ID NO: 1 or the expression cassette of claim 2.
10. A method for producing a dicamba tolerant plant, wherein the method comprises: introducing a gene comprising the nucleotide sequence shown as SEQ ID NO: 1 or the expression cassette of claim 2 into the genome of the plant to produce the dicamba tolerant plant.
11. The method for producing a dicamba tolerant plant according to claim 10, wherein the method comprises: producing a dicamba tolerant plant by selfing of a parent plant or hybridizing a parent plant with a second plant, the parent plant and/or the second plant containing a gene comprising the nucleotide sequence shown as SEQ ID NO: 1 or an expression cassette comprising a nucleotide sequence shown as SEQ ID NO: 1 under the regulation of an effectively linked regulatory sequence, and the dicamba tolerant plant inheriting the gene or the expression cassette from the parent plant and/or the second plant.
12. A method for cultivating a plant tolerant to a dicamba herbicide, wherein the method comprises: planting at least one plant seed, the genome of which containing a gene comprising the nucleotide sequence shown as SEQ ID NO: 1 or the expression cassette of claim 2; growing the plant seed into a plant; and spraying the plant with an effective dose of the dicamba herbicide, and harvesting a plant having a reduced plant damage compared to other plants without the gene or the expression cassette.
13. The method according to claim 4, wherein the plant is soybean, cotton, maize, rice, wheat, beet or sugar cane.
14. A recombinant vector, comprising the expression cassette of claim 2.
15. A method for weed control, wherein the method comprises: applying an effective dose of a dicamba herbicide to a field for planting a plant, the plant containing the recombinant vector of claim 3.
16. A method for protecting a plant from damages caused by herbicides, wherein the method comprises: introducing the recombinant vector of claim 3 into a plant to make the resultant plant produce a sufficient amount of herbicide tolerant proteins for protecting the plant from damages caused by dicamba.
17. A method for conferring the dicamba herbicide tolerance to a plant, wherein the method comprises: introducing the recombinant vector of claim 3 into a plant.
18. A method for controlling glyphosate tolerant weeds in a field for a glyphosate tolerant plant, wherein the method comprises: applying an effective dose of dicamba to a field for planting a glyphosate tolerant plant, the glyphosate tolerant plant containing the recombinant vector of claim 3.
Description
DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
PARTICULAR EMBODIMENTS
(12) The technical solutions of the herbicide resistant protein, the coding gene thereof and use thereof in the present invention are further described through specific examples below.
Example 1
In Vitro Efficient Expression and Functional Identification of Methyltetrahydrofolate Reductase MTHFR66
1. Construction of a Bacterial Expression Vector and Acquisition of a Recombinant Microorganism
(13) (1) PCR amplification of MTHFR66 gene
(14) A pair of primers were designed:
(15) TABLE-US-00001 primer 1: 5-GGAATTCCATATGGGCTCGCCCGTTATGG-3 (the sequence underlined is NdeI restriction site), shown as SEQ ID NO: 4 in the sequence listing; primer 2: 5-CCGCTCGAGGTGCTTTCGAGCGTAGTCAG-3 (the sequence underlined is XhoI restriction site), shown as SEQ ID NO: 5 in the sequence listing;
(16) the MTHFR66 gene was amplified using the following PCR amplification system:
(17) TABLE-US-00002 Taq DNA polymerase (5 U/μL) 0.5 μL 5 × PrimeSTARBuffer 25 μL (Mg.sup.2+Plus) dNTP mixture (each 2.5 mM) 5 μL Template DNA 10 ng Primer 1 (25 μM) 1 μL Primer 2 (25 μM) 1 μL Total volume 50 μL
(18) The template DNA (i.e. the natural MTHFR66 nucleotide sequence) is shown as SEQ ID NO: 3 in the sequence listing. PCR reaction conditions: denaturation at 98° C. for 1 min; then entering the following cycle: denaturation at 98° C. for 15 s, annealing at 55° C. for 15 s, extension at 72° C. for 1 min, totally including 29 cycles; finally extension at 72° C. for 10 min, and cooling to room temperature.
(19) (2) Construction of a bacterial expression vector and acquisition of a recombinant microorganism
(20) The above PCR amplification product and a bacterial expression vector pET-29a (+) were digested respectively with restriction enzymes NdeI and XhoI, the excised MTHFR66 nucleotide sequence fragment was enzymatically linked with the bacterial expression vector pET-29a (+) after enzyme digestion, and the expression host strain BL21 (DE3) was transformed with the enzymatically linked products to obtain the recombinant microorganism BL21 (MTHFR66).
2. Expression and Purification of MTHFR66 Protein in E. coli
(21) The recombinant microorganism BL21 (MTHFR66) was cultured in 100 mL of LB medium (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl and 100 mg/L of kanamycin, adjusted to pH 7.5 with NaOH) to a concentration of OD600 nm=0.6-0.8, and induced with isopropyl thiogalactoside (IPTG) at a concentration of 0.4 mM at a temperature of 16° C. for 20 hours. Bacterial cells were collected by centrifugation and resuspended in 20 ml of Tris-HCl buffer (100 mM, pH 8.0), followed by performing ultrasonication (X0-900D ultrasonic processor ultrasonic processor, 30% intensity) for 10 min, then centrifuging, collecting the supernatant, purifying the MTHFR66 protein with nickel ion affinity chromatography column, and detecting the purification result using SDS-PAGE protein electrophoresis with the stripe size being consistent with theoretically predicted stripe size (31.79 kDa) (as shown in
3. Determination of Enzymatic Activity of MTHFR66 Protein
(22) Enzymatic reaction system (300 μL): containing 1 mM substrate (dicamba), 0.2 mg of MTHFR66, 1 mM tetrahydrofolate (THF) and a buffer system of Tris-HCl at a concentration of 100 mM (pH 8.0), which were reacted in a water bath at a temperature of 30° C. for 1 hour, then kept in boiling water for 1 min, after which the reaction was terminated. The reaction solution was lyophilized, and then dissolved by adding 300 μl of methanol. The amount of the generated intermediate metabolite of dicamba, 3,6-dichlorosalicylic acid (DCSA), was detected using high performance liquid chromatography (HPLC). An enzymatic activity unit is defined as: the amount of enzyme required for degradation of dicamba to generate 1 nmol of product DCSA at pH 8.0, at a temperature of 30° C. within 1 min, and is expressed as U.
(23) The above experimental results showed that: purified MTHFR66 protein can generate 0.15 mM DCSA within 1 hour, and the specific enzymatic activity of MTHFR66 protein was 3.75 U/mg (as shown in
4. Determination of the Dicamba Demethylation Function of MTHFR66 Protein in the Presence of Trace Tetrahydrofolate
(24) Enzymatic reaction system (300 μL): containing 1 mM substrate (dicamba), 0.2 mg of MTHFR66, respectively containing 0.01 mM, 0.02 mM, 0.05 mM and 1 mM tetrahydrofolate (THF), and a buffer system of Tris-HCl at a concentration of 100 mM (pH 8.0), which were reacted in a water bath at a temperature of 30° C. for 1 hour, then kept in boiling water for 1 min followed by terminating the reaction. The reaction solution was lyophilized, and then dissolved by adding 300 μl of methanol. The amount of the generated intermediate metabolite of dicamba, DCSA, was detected using high performance liquid chromatography (HPLC).
(25) The above experimental results showed that: purified MTHFR66 protein can demethylate dicamba to generate DCSA in the presence of 0.01 mM tetrahydrofolate, and can fully demethylate 1 mM dicamba to generate DCSA in the presence of 0.5 mM of tetrahydrofolate (as shown in
Example 2
Hydrolase Functional Identification and Product Identification of Methyltetrahydrofolate Reductase MTHFR66
1. Hydrolase Functional Determination of MTHFR66 Protein
(26) Enzymatic reaction system (300 μL): containing 0.2 mg of MTHFR66, 1 mM 5-methyl-tetrahydrofolate (5-CH.sub.3—H.sub.4F) and a buffer system of Tris-HCl at a concentration of 100 mM (pH 8.0), which were reacted in a water bath at a temperature of 30° C. for 1 hour, then kept in boiling water for 1 min, after which the reaction was terminated. The reaction solution was lyophilized, dissolved by adding 300 μl of 0.1 mol/L KH.sub.2PO.sub.4 (pH 6.8, 1% ascorbic acid and 0.1% β-mercaptoethanol), filtered using a filter membrane (with a pore size of 0.22 μm), and detected using high performance liquid chromatography. Liquid chromatography conditions were: mobile phase: 0.05 mol/l KH.sub.2PO.sub.4 (pH 3.0):acetonitrile (90:10, V/V), Zorbax C218 ODS Spherex reversed phase column (5 μm, 4.6 mm×250 mm, Agilent, USA), column temperature of 23° C., UV-detector, with a detection wavelength of 298 nm, a sample injection volume of 20 μl, and a flow rate of 1.0 mL/min. Quantification was performed by peak area according to the external standard method.
(27) The above HPLC results showed that: purified MTHFR66 protein can transform 5-methyl-tetrahydrofolate to other substances in the absence of the electron acceptor NAD.sup.+ (as shown in
2. Product Identification
(28) Metabolites were identified through HPLC-MS (high performance liquid chromatography-mass spectrum) under the conditions as follows: mobile phase: 0.05 mol/l KH.sub.2PO.sub.4 (pH 3.0):acetonitrile (90:10, V/V), Zorbax XDB-C18, 5 cm×0.46 cm, 1.8 mm reversed phase column (5 μm, 4.6 mm×250 mm, Agilent, USA), and a flow rate of 0.25 mL/min. MS analysis uses ESI mode and a detector of Agilent G6410B Triple Quad Mass Spectrometer.
(29) The results suggested that purified MTHFR66 protein can hydrolyze 5-methyl-tetrahydrofolate to tetrahydrofolate in the absence of the electron acceptor NAD.sup.+ (as shown in
Example 3
Gene Sequence Optimization and Synthesis
1. Acquisition of Optimized Plant Sequence
(30) The amino acid sequences (289 amino acids, shown as SEQ ID NO: 2 in the sequence listing) of the methyltetrahydrofolate reductase MTHFR66 were kept unchanged, and codon optimization and modification of the MTHFR66 nucleotide sequence (870 nucleotides) encoding the amino acid sequence corresponding to the methyltetrahydrofolate reductase MTHFR66 was performed.
(31) Codon optimization and modification strategies mainly include: depending on preferred codons of monocotyledonous maize plants and dicotyledonous soybean plants, unstable sequence modification, G+C content improvement, etc. Natural genes contain a low content of G+C, but a high content of A+T. On the one hand, if natural gene sequences are directly introduced into plant genomes, they may be mistaken for plant gene regulatory sequences, besides, A+T-rich regions will arise in these natural genes, similar to the TATA box in the gene promoter, and will lead to abnormal gene transcription; on the other hand, the polyadenylation signal sequence (AAUAAA) in the transcribed mRNA and small RNA complementary sequence associated with the mRNA splicing will lead to unstability of RNA. Therefore, the modified gene sequence not only has a high content of G+C, but also changes the unstable structure arising in DNA and transcribed mRNA, so as to ensure normal protein translation; on the other hand, preferred codons of maize and soybean are used to modify natural gene sequences, and eliminate the modification of restriction sites and some sequences.
(32) Based on the above optimization strategies, an optimized MTHFR66 nucleotide sequence are obtained, the optimized MTHFR66 nucleotide sequence totally contains 870 nucleotides, and encodes 289 amino acids, and the nucleotide sequence is shown as SEQ ID NO: 1 in the sequence listing.
2. Synthesis of an Optimized MTHFR66 Nucleotide Sequence
(33) The optimized MTHFR66 nucleotide sequence was synthesized by GenScript (Nanjing) Co., Ltd; and the synthetic optimized MTHFR66 nucleotide sequence (SEQ ID NO: 1) is further connected with a Sad restriction site at the 5′ terminus, and the optimized MTHFR66 nucleotide sequence (SEQ ID NO: 1) is further connected with a KasI restriction site at the 3′ terminus.
Example 4
Construction of Arabidopsis thaliana Recombinant Expression Vectors and Transformation of Agrobacterium with the Recombinant Expression Vectors
1. Construction of an Arabidopsis thaliana Recombinant Cloning Vector Containing an Optimized MTHFR66 Nucleotide Sequence
(34) The synthetic optimized MTHFR66 nucleotide sequence was ligated into cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), and the operational procedure was carried out according to Promega's pGEM-T vector product instructions, obtaining a recombinant cloning vector DBN01-T, the construction process of which was shown as
(35) Then, Escherichia coli T1 competent cells (Transgen, Beijing, China, CAT: CD501) were transformed with the recombinant cloning vector DBN01-T using the heat shock method with the following heat shock conditions: water bathing 50 μL Escherichia coli T1 competent cells and 10 μL plasmid DNA (recombinant cloning vector DBN01-T) at 42° C. for 30 seconds; shake culturing at 37° C. for 1 hour (using a shaker at a rotation speed of 100 rpm for shaking); and growing on an LB plate (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 15 g/L of agar, adjusting the pH to 7.5 with NaOH) of ampicillin (100 mg/L) having its surface coated with IPTG (isopropylthio-β-D-galactoside) and X-gal (5-bromo-4-chloro-3-indole-β-D-galactoside) overnight. White colonies were picked out and cultured in an LB liquid culture medium (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 100 mg/L of ampicillin, adjusting the pH to 7.5 with NaOH) at a temperature of 37° C. overnight. The plasmids in the cells were extracted through an alkaline method: centrifuging the bacteria solution at a rotation speed of 12000 rpm for 1 min, removing the supernatant, and suspending the precipitated thalli with 100 μL ice pre-cooled solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), and 50 mM glucose, pH 8.0); adding 200 μL newly formulated solution II (0.2M NaOH, 1% SDS (sodium dodecyl sulfate)), inverting the tube 4 times, mixing and placing on ice for 3-5 min; adding 150 μL ice-cold solution III (3 M potassium acetate, 5 M acetic acid), mixing uniformly immediately and placing on ice for 5-10 min; centrifuging under the conditions of a temperature of 4° C. and a rotation speed of 12000 rpm for 5 min, adding 2 volumes of anhydrous ethanol to the supernatant and placing at room temperature for 5 min after mixing uniformly; centrifuging under the conditions of a temperature of 4° C. and a rotation speed of 12000 rpm for 5 min, discarding the supernatant, and air drying the precipitate after washing with ethanol with a concentration of 70% (V/V); adding 30 μL TE (10 mM Tris-HCl, and 1 mM EDTA, pH 8.0) containing RNase (20 μg/mL) to dissolve the precipitate; water bathing at a temperature of 37° C. for 30 min to digest RNA; and storing at a temperature of −20° C. for use.
(36) After identifying the extracted plasmid by SacI and KasI digestion, positive clones were verified by sequencing. The results showed that the optimized MTHFR66 nucleotide sequence inserted in the recombinant cloning vector DBN01-T was the nucleotide sequence shown as SEQ ID NO: 1 in the sequence listing, that is, the optimized MTHFR66 nucleotide sequence was inserted correctly.
2. Construction of Arabidopsis thaliana Recombinant Expression Vector DBN111101 Containing an Optimized MTHFR66 Nucleotide Sequence
(37) The recombinant cloning vector DBN01-T and an expression vector DBNBC-01 (vector backbone: pCAMBIA2301 (which can be provided by the CAMBIA institution)) were digested with restriction enzymes SacI and KasI, respectively; the excised optimized MTHFR66 nucleotide sequence fragment was inserted between the SacI and KasI sites in the expression vector DBNBC-01; and it is well known to a person skilled in the art to construct a vector using conventional enzyme digestion methods, a recombinant expression vector DBN111101 was constructed, and the construction process of which was shown as
(38) Escherichia coli T1 competent cells were transformed with the recombinant expression vector DBN111101 by a heat shock method with the following heat shock conditions: water bathing 50 μL Escherichia coli T1 competent cells and 10 μL plasmid DNA (recombinant expression vector DBN111101) at 42° C. for 30 seconds; shake culturing at 37° C. for 1 hour (using a shaker at a rotation speed of 100 rpm for shaking); then culturing under the condition of a temperature of 37° C. on an LB solid plate containing 50 mg/L of kanamycin (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 15 g/L of agar, adjusted to a pH of 7.5 with NaOH) for 12 hours, picking white colonies, and culturing under the condition of a temperature of 37° C. overnight in an LB liquid culture medium (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 50 mg/L of kanamycin, adjusted to a pH of 7.5 with NaOH). The plasmids in the cells were extracted through an alkaline method. The extracted plasmid was identified after digesting with restriction enzymes SacI and KasI, and positive clones were identified by sequencing. The results showed that the nucleotide sequence between the SacI and KasI sites in the recombinant expression vector DBN111101 was the nucleotide sequence shown as SEQ ID NO: 1 in the sequence listing, i.e., the optimized MTHFR66 nucleotide sequence.
3. Construction of Arabidopsis thaliana Recombinant Expression Vector DBN111101N Containing a Natural MTHFR66 Nucleotide Sequence
(39) The recombinant cloning vector DBN01R1-T containing a natural MTHFR66 nucleotide sequence was constructed using the natural MTHFR66 nucleotide sequence (SEQ ID NO: 3) according to the method for constructing the recombinant cloning vector DBN01-T containing the optimized MTHFR66 nucleotide sequence as described in point 1 of this example. Positive clones were verified by sequencing. The results showed that the natural MTHFR66 nucleotide sequence inserted in the recombinant cloning vector DBN01R-T was the nucleotide sequence shown as SEQ ID NO: 3 in the sequence listing, that is, the natural MTHFR66 nucleotide sequence was inserted correctly.
(40) The recombinant expression vector DBN111101N containing natural MTHFR66 nucleotide sequence was constructed using the natural MTHFR66 nucleotide sequence according to the method for constructing the recombinant expression vector DBN111101 containing the optimized MTHFR66 nucleotide sequence as described in point 2 of this example, and has a structure as shown in
4. Transformation of Agrobacterium with the Arabidopsis thaliana Recombinant Expression Vectors
(41) The Agrobacterium GV3101 was transformed with the recombinant expression vectors DBN111101 and DBN111101N which had been correctly constructed using the liquid nitrogen method with the following transformation conditions: placing 100 μL of Agrobacterium GV3101, and 3 μL of plasmid DNA (recombinant expression vector) in liquid nitrogen for 10 minutes, warm water bathing at 37° C. for 10 minutes; inoculating the transformed Agrobacterium GV3101 into an LB tube, culturing under the conditions of a temperature of 28° C. and a rotation speed of 200 rpm for 2 hours, spreading on an LB plate containing 50 mg/L of rifampicin and 50 mg/L of kanamycin until positive single clones were grown, picking out single clones for culturing and extracting the plasmids thereof, and performing enzyme digestion verification using restriction enzymes digesting DBN111101 and DBN111101N. The results showed that the structures of the recombinant expression vectors DBN111101 and DBN111101N were completely correct.
Example 5
Acquisition of the Transgenic Arabidopsis thaliana Plants
(42) Seeds of wild-type Arabidopsis thaliana were suspended in a 0.1% agarose solution. The suspended seeds were stored at 4° C. for 2 days to complete the need for dormancy, in order to ensure synchronous seed germination. Vermiculite was mixed with horse manure soil, the mixture was sub-irrigated with water to wet, and the soil mixture was allowed to drain the water away for 24 hours. The pretreated seeds were sowed in the soil mixture and covered with a moisturizing cover for 7 days. The seeds were germinated and the plants were cultivated in a greenhouse under long day conditions (16 hour light/8 hour dark) of a constant temperature (22° C.) and a constant humidity (40-50%) with a light intensity of 120-150 μmol/(m.sup.2.Math.sec). The plants were initially irrigated with the Hoagland's nutrient solution, followed by deionized water, keeping the soil moist but not wet through.
(43) Arabidopsis thaliana was transformed using the flower soaking method. One or more 15-30 mL of precultures of YEP culture solution (containing kanamycin (100 mg/L) and rifampicin (10 mg/L)) were inoculated with the picked Agrobacterium colonies. The cultures were incubated at 28° C. and 220 rpm with shaking at a constant speed overnight. Each preculture was used to inoculate two 500 ml of cultures of YEP culture solution (containing kanamycin (100 mg/L) and rifampicin (10 mg/L)), and the cultures were incubated at 28° C. with continuous shaking overnight. Cells were precipitated by centrifuging at about 8700×g at room temperature for 10 minutes, and the resulting supernatant was discarded. The cell precipitate was gently re-suspended in 500 mL osmotic medium which contained 1/2×MS salt/B5 vitamin, 10% (w/v) sucrose, 0.044 μM benzylaminopurine (10 μL/L (1 mg/mL, a stock solution in DMSO)) and 300 μL/L of Silvet L-77. About 1-month-old plants were soaked in a culture medium for 15 seconds to ensure immersion of the latest inflorescence. Then, the plants were reclined laterally and covered (transparently or opaquely) for 24 hours, then washed with water, and placed vertically. The plants were cultivated with a photoperiod of 16 hour light/8 hour dark at 22° C. Seeds were harvested after soaking for about 4 weeks.
(44) The newly harvested (the optimized MTHFR66 nucleotide sequence and the natural MTHFR66 nucleotide sequence) T.sub.1 seeds were dried at room temperature for 7 days. The seeds were sowed in 26.5×51 cm germination disks, and 200 mg T.sub.1 seeds (about 10000 seeds) were accepted per disk, wherein the seeds had been previously suspended in 40 mL of 0.1% agarose solution and stored at 4° C. for 2 days to complete the need for dormancy, in order to ensure synchronous seed germination.
(45) Vermiculite was mixed with horse manure soil, the mixture was sub-irrigated with water to wet, and water was drained through gravity. The pretreated seeds (each 40 mL) were sowed evenly in the soil mixture using a pipette, and covered with a moisturizing cover for 4-5 days. The cover was removed 1 day before performing initial transformant selection by spraying glufosinate (used to select the co-transformed PAT gene) post emergence.
(46) The T.sub.1 plants were sprayed with a 0.2% solution of a Liberty herbicide (200 g ai/L of glufosinate) reusing a DeVilbiss compressed air nozzle at a spray volume of 10 mL/disc (703 L/ha) 7 days after planting (DAP) and 11 DAP (the cotyledon stage and 2-4 leaf stage, respectively), to provide an effective amount of glufosinate of 280 g ai/ha per application. Surviving plants (actively growing plants) were identified 4-7 days after the final spraying, and transplanted to 7 cm×7 cm square pots prepared with horse manure soil and vermiculite (3-5 plants/disc), respectively. The transplanted plants were covered with a moisturizing cover for 3-4 days, and placed in a 22° C. culture chamber or directly transferred into a greenhouse as previously. Then, the cover was removed, and at least 1 day before testing the ability of the MTHFR66 gene to provide dicamba herbicide tolerance, the plants were planted in a greenhouse (22±5° C., 50±30% RH, 14 hour light:10 hour dark, a minimum of 500 μE/m.sup.2s.sup.1 natural+supplemental light).
Example 6
Detection of Herbicide Tolerance Effects of the Transgenic Arabidopsis thaliana Plants
(47) Arabidopsis thaliana was first transformed with the MTHFR66 gene. T.sub.1 transformants were initially selected from the background of untransformed seeds using a glufosinate selection scheme. The plants that were transformed with the recombinant expression vector DBN111101 were Arabidopsis thaliana plants (At mMTHFR66) into which an optimized MTHFR66 nucleotide sequence located in the chloroplast was introduced, and the plants that were transformed with the recombinant expression vector DBN111101N were Arabidopsis thaliana plants (At MTHFR66) into which a natural MTHFR66 nucleotide sequence located in the chloroplast was introduced. About 20000 T.sub.1 seeds of At mMTHFR66 were screened, and 197 T.sub.1 positive transformants (PAT gene) were identified with a transformation efficiency of about 1.0%; and about 20000 T.sub.1 seeds of At MTHFR66 were screened, and 182 T.sub.1 positive transformants (PAT gene) were identified with a transformation efficiency of about 0.91%. Arabidopsis thaliana T.sub.1 plants (At-mMTHFR66) into which an optimized MTHFR66 nucleotide sequence was introduced, Arabidopsis thaliana T.sub.1 plants (At-MTHFR66) into which a natural MTHFR66 nucleotide sequence was introduced and wild-type Arabidopsis thaliana plants (18 days after sowing) were tested for the herbicide tolerance effect to dicamba.
(48) Arabidopsis thaliana T.sub.1 plants into which an optimized MTHFR66 nucleotide sequence was introduced, Arabidopsis thaliana T.sub.1 plants into which a natural MTHFR66 nucleotide sequence was introduced and wild-type Arabidopsis thaliana plants were sprayed with dicamba (560 g ae/ha, 1-fold field concentration) and a blank solvent (water) respectively. Plants were counted for the tolerance situations 7 days and 14 days after spraying: those having a consistent growth status with the blank solvent (water) group after 7 days were classified as highly resistant plants, those having curled rosette leaves after 7 days were classified as moderately resistant plants, those still not capable of bolting after 14 days were classified as lowly resistant plants, and those dead after 14 days were classified as non-resistant plants. Since each Arabidopsis thaliana T.sub.1 plant was an independent transformation event, a significant difference in individual T.sub.1 responses could be expected at a given dose. The results were shown as Table 1 and
(49) TABLE-US-00003 TABLE 1 Experimental results of the herbicide tolerance of transgenic Arabidopsis thaliana T.sub.1 plants Arabidopsis Mod- thaliana Highly erately Lowly Non- Treatment genotypes resistant resistant resistant resistant Total Blank At 24 0 0 0 24 solvent -mMTHFR66 (water) At 23 0 0 0 23 -MTHFR66 wild-type 20 0 0 0 20 560 g ae/ha At 0 18 0 5 23 dicamba -mMTHFR66 (1 × dicamba) At 0 3 2 19 24 -MTHFR66 wild-type 0 0 0 22 22
(50) For Arabidopsis thaliana, 560 g ae/ha dicamba is an effective dose distinguishing sensitive plants from plants having an average level of tolerance. The results of Table 1 and
Example 7
Construction of Maize Recombinant Expression Vectors and Transformation of Agrobacterium with the Recombinant Expression Vectors
1. Construction of Maize Recombinant Expression Vector DBN-HT130066 Containing an Optimized MTHFR66 Nucleotide Sequence
(51) The recombinant cloning vector DBN01-T and an expression vector DBNBC-02 (vector backbone: pCAMBIA2301 (which can be provided by the CAMBIA institution)) were digested with restriction enzymes SacI and KasI, respectively, and the excised optimized MTHFR66 nucleotide sequence fragment was inserted between the SacI and KasI sites in the expression vector DBNBC-02; and it is well known to a person skilled in the art to construct a vector using conventional enzyme digestion methods, a recombinant expression vector DBN-HT130066 was constructed, and the construction process of which was shown as
(52) Escherichia coli T1 competent cells were transformed with the recombinant expression vector DBN-HT130066 by a heat shock method with the following heat shock conditions: water bathing 50 μL Escherichia coli T1 competent cells and 10 μL plasmid DNA (recombinant expression vector DBN-HT130066) at 42° C. for 30 seconds; shake culturing at 37° C. for 1 hour (using a shaker at a rotation speed of 100 rpm for shaking); then culturing under the condition of a temperature of 37° C. on an LB solid plate containing 50 mg/L of kanamycin (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 15 g/L of agar, adjusted to a pH of 7.5 with NaOH) for 12 hours, picking white colonies, and culturing under the condition of a temperature of 37° C. overnight in an LB liquid culture medium (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 50 mg/L of kanamycin, adjusted to a pH of 7.5 with NaOH). The plasmids in the cells were extracted through an alkaline method. The extracted plasmid was identified after digesting with restriction enzymes SacI and KasI, and positive clones were identified by sequencing. The results showed that the nucleotide sequence between the SacI and KasI sites in the recombinant expression vector DBN-HT130066 was the nucleotide sequence shown as SEQ ID NO: 1 in the sequence listing, i.e., the optimized MTHFR66 nucleotide sequence.
2. Construction of Maize Recombinant Expression Vector DBN-HT130066N Containing a Natural MTHFR66 Nucleotide Sequence
(53) The recombinant expression vector DBN-HT130066N containing a natural MTHFR66 nucleotide sequence was constructed using the recombinant cloning vector DBN01R-T containing the natural MTHFR66 nucleotide sequence as described in point 3 of Example 4 of the present invention according to the method for constructing the recombinant expression vector DBN-HT120066 containing the optimized MTHFR66 nucleotide sequence as described in point 1 of this example, and has a structure as shown in
3. Transformation of Agrobacterium with the Maize Recombinant Expression Vectors
(54) Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT: 18313-015) was transformed with the recombinant expression vectors DBN-HT130066 and DBN-HT130066N which have been constructed correctly using a liquid nitrogen method, with the following transformation conditions: placing 100 μL of Agrobacterium LBA4404, and 3 μL of plasmid DNA (recombinant expression vector) in liquid nitrogen for 10 minutes, warm water bathing at 37° C. for 10 minutes; inoculating the transformed Agrobacterium LBA4404 into an LB tube, culturing under the conditions of a temperature of 28° C. and a rotation speed of 200 rpm for 2 hours, spreading on an LB plate containing 50 mg/L of rifampicin and 50 mg/L of kanamycin until positive single clones were grown, picking out single clones for culturing and extracting the plasmids thereof, and performing enzyme digestion verification after enzyme digestion of DBN-HT130066 and DBN-HT130066N using restriction enzymes. The results showed that the structures of the recombinant expression vectors DBN-HT130066 and DBN-HT130066N were completely correct.
Example 8
Acquisition and Verification of Transgenic Maize Plants
(55) According to the conventionally used Agrobacterium infection method, young embryos of a sterile culture of maize variety Zong31 (Z31) were co-cultured with the Agrobacterium in point 3 of Example 7 of the present invention, so as to introduce T-DNA (including the maize Ubiquitin1 gene promoter sequence, the optimized MTHFR66 nucleotide sequence, the natural MTHFR66 nucleotide sequence, the AcCTP2 chloroplast transit peptide sequence, the PMI gene and the Nos terminator sequence) in the recombinant expression vectors DBN-HT130066 and DBN-HT130066N constructed in points 1 and 2 of Example 7 of the present invention into the maize chromosome, thereby obtaining maize plants (Zm-mMTHFR66) into which the optimized MTHFR66 nucleotide sequence located in chloroplast was introduced, and maize plants (Zm-MTHFR66) into which the natural MTHFR66 nucleotide sequence was introduced; meanwhile, wild type maize plants were used as the control.
(56) As regards the Agrobacterium-mediated maize transformation, briefly, immature young embryos were separated from maize, and contacted with an Agrobacterium suspension, wherein the Agrobacterium can transfer the optimized MTHFR66 nucleotide sequence and the natural MTHFR66 nucleotide sequence to at least one cell of one of young embryos (step 1: infection step). In this step, the young embryos were preferably immersed in an Agrobacterium suspension (OD.sub.660=0.4-0.6, an infection culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 68.5 g/L of sucrose, 36 g/L of glucose, 40 mg/L of acetosyringone (AS), and 1 mg/L of 2,4-dichlorphenoxyacetic acid (2,4-D), pH 5.3)) to initiate the inoculation. The young embryos were co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-culturing step). Preferably, the young embryos were cultured in a solid culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 20 g/L of sucrose, 10 g/L of glucose, 100 mg/L of acetosyringone (AS), 1 mg/L of 2,4-dichlorphenoxyacetic acid (2,4-D), and 8 g/L of agar, pH 5.8) after the infection step. After this co-culturing stage, there can be an optional “recovery” step. In the “recovery” step, there may be at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium in a recovery culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 1 mg/L of 2,4-dichlorphenoxyacetic acid (2,4-D), and 3 g/L of phytagel, pH 5.8), without the addition of a selective agent for a plant transformant (step 3: recovery step). Preferably, the young embryos were cultured in a solid culture medium with an antibiotic but without a selective agent, to eliminate Agrobacterium and provide a recovery stage for the infected cells. Subsequently, the inoculated young embryos were cultured in a culture medium containing a selective agent (mannose), and growing transformed calli were selected (step 4: selection step). Preferably, the young embryos were cultured in a screening solid culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 12.5g/L of mannose, 1 mg/L of 2,4-dichlorphenoxyacetic acid (2,4-D), and 3 g/L of phytagel, pH 5.8) with a selective agent, resulting in selective growth of transformed cells. Then, plants were regenerated from the calli (step 5: regeneration step). Preferably, the calli grown on a culture medium containing a selective agent were cultured in solid culture media (MS differentiation culture medium and MS rooting culture medium) to regenerate plants.
(57) Resistant calli screened out were transferred onto the MS differentiation culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 2 mg/L of 6-benzyladenine, 5 g/L of mannose, and 3 g/L of phytagel, pH 5.8), and cultured at 25° C. for differentiation. The differentiated seedlings were transferred onto the MS rooting culture medium (2.15 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 1 mg/L of indole-3-acetic acid, and 3 g/L of phytagel, pH 5.8), cultured at 25° C. to a height of about 10 cm, and transferred to a glasshouse for culturing until fruiting. In the greenhouse, the plants were cultured at 28° C. for 16 hours, and then cultured at 20° C. for 8 hours every day.
2. Verification of the Transgenic Maize Plants Using TaqMan
(58) Leaves of about 100 mg from maize plants into which the optimized MTHFR66 nucleotide sequence was introduced, and maize plants into which the natural MTHFR66 nucleotide sequence was introduced were respectively taken as samples, extracted for genomic DNAs thereof with a DNeasy Plant Maxi Kit of Qiagen, and detected for copy number of PMI gene by the Taqman probe fluorescence quantitative PCR method so as to determine the copy number in the transgenic maize plants. Meanwhile, wild type maize plants were used as the control, and detected and analyzed according to the above-mentioned method. Triple repeats were set for the experiments, and averaged.
(59) The particular method for detecting the copy number of PMI gene was as follows:
(60) Step 11. Leaves of 100 mg were respectively taken from each of maize plants into which the optimized MTHFR66 nucleotide sequence was introduced, maize plants into which the natural MTHFR66 nucleotide sequence was introduced, and wild type maize plants, respectively ground as a homogenate in a mortar with liquid nitrogen, and triple repeats were taken for each sample;
(61) Step 12. Genomic DNAs of the above-mentioned samples were extracted using a DNeasy Plant Mini Kit of Qiagen, and the particular method can refer to the product manual thereof;
(62) Step 13. The concentrations of the genomic DNAs of the above-mentioned samples were detected using NanoDrop 2000 (Thermo Scientific);
(63) Step 14. The concentrations of the genomic DNAs of the above-mentioned samples were adjusted to a consistent concentration value which ranges from 80 to 100 ng/μL;
(64) Step 15. The copy numbers of the samples were identified using the Taqman probe fluorescence quantitative PCR method, wherein samples for which the copy numbers had been identified and known were taken as standards, the samples of the wild type maize plants were taken as the control, and triple repeats were taken for each sample and averaged; the sequences of fluorescence quantitative PCR primers and a probe were as follows, respectively:
(65) The following primers and probe were used to detect the PMI gene sequence:
(66) TABLE-US-00004 primer 3: CCGGGTGAATCAGCGTTT shown as SEQ ID NO: 14 in the sequence listing; primer 4: GCCGTGGCCTTTGACAGT shown as SEQ ID NO: 15 in the sequence listing; probe 1: TGCCGCCAACGAATCACCGG shown as SEQ ID NO: 16 in the sequence listing;
(67) PCR reaction system:
(68) TABLE-US-00005 JumpStart ™ Taq ReadyMix ™ 10 μL (Sigma) 50 × primer/probe mixture 1 μL genomic DNA 3 μL water (ddH.sub.2O) 6 μL
(69) The 50× primer/probe mixture comprises 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1×TE buffer, and was stored at 4° C. in an amber tube.
(70) PCR reaction conditions:
(71) TABLE-US-00006 Step Temperature Time 21 95° C. 5 minutes 22 95° C. 30 seconds 23 60° C. 1 minute 24 back to step 22, repeated 40 times
(72) Data were analyzed using software SDS2.3 (Applied Biosystems).
(73) The experimental results showed that both the optimized MTHFR66 nucleotide sequence and the natural MTHFR66 nucleotide sequence were integrated into the chromosome of the detected maize plants, and both the maize plants into which the optimized MTHFR66 nucleotide sequence was introduced, and the maize plants into which the natural MTHFR66 nucleotide sequence was introduced resulted in transgenic maize plants containing single-copy MTHFR66 genes.
Example 9
Detection of Herbicide Resistance Effects of the Transgenic Maize Plants
(74) The maize plants into which the optimized MTHFR66 nucleotide sequence was introduced, the maize plants into which the natural MTHFR66 nucleotide sequence was introduced and wild-type maize plants (at V5-V6 stage) were respectively tested for the herbicide resistance effect to dicamba.
(75) The maize plants into which the optimized MTHFR66 nucleotide sequence was introduced, the maize plants into which the natural MTHFR66 nucleotide sequence was introduced and wild-type maize T.sub.1 hybrid plants (at V5-V6 stage) were taken and sprayed with a dicamba herbicide (4480 g ae/ha, 8-fold field concentration) and a blank solvent (water) respectively. 21 days after spraying, the support root development situation was collected. A total of three strains (S1, S2 and S3) of Zm-mMTHFR66, a total of two strains (S4 and S5) of Zm-MTHFR66, and a total of 1 strain of wild type (CK) were taken; and 10-15 plants were selected from each strain and tested. The results were as shown in Table 2.
(76) TABLE-US-00007 TABLE 2 Experimental results of the herbicide resistance of transgenic maize T.sub.1 plants Proportion of Support root Support root normally Maize normally abnormally developed support Treatment genotypes developed developed root Blank solvent S1 15 0 100.00% (water) S2 16 0 100.00% S3 13 0 100.00% S4 11 0 100.00% S5 12 0 100.00% CK 18 0 100.00% 4480 g ae/ha S1 12 1 92.31% dicamba S2 10 1 90.91% (8 × dicamba) S3 10 2 83.33% S4 2 10 16.67% S5 4 9 30.77% CK 0 16 0%
(77) The results in Table 2 showed that The optimized MTHFR66 gene confers high-level dicamba herbicide tolerance to transgenic maize plants (monocotyledonous plant itself has certain resistance to the dicamba herbicide, thereby showing high-level resistance); compared to Zm-MTHFR66, Zm-mMTHFR66 can generate higher dicamba herbicide tolerance, showing that the MTHFR66 gene can enhance the dicamba herbicide tolerance of maize plants after the plant codon optimization; while the wild-type maize plants do not have dicamba herbicide tolerance.
(78) In conclusion, the MTHFR66 protein of the present invention can degrade a dicamba herbicide, and the optimized MTHFR66 gene uses preferred codons of maize and soybean, so that it is particularly suitable for expression in plants; the optimized MTHFR66 gene can confer better dicamba herbicide tolerance to transgenic plants; furthermore, the herbicide tolerant protein MTHFR66 of the present invention further has methyltetrahydrofolate reductase activity, and is different from the known dicamba tolerant gene, and therefore it is possible to expand the application scope of dicamba tolerance in plants.
(79) Finally, it should be stated that the above embodiments are merely used for illustrating rather than limiting the technical solution of the present invention; and although the present invention has been described in detail with reference to the preferred embodiments, a person skilled in the art should understand that modifications or equivalent substitutions may be made to the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention.