Maple-leaf-type cucumber plant

Abstract

Provided is a mutant cucumber plant CC81221 having a maple-leaf-type split leaf or a cucumber plant derived therefrom which has a maple-leaf-type leaf single recessive nuclear gene; also provided is a method for breeding, molecular identification, and application of the maple-leaf-type cucumber plant.

Claims

1. A homozygous maple-leaf-type cucumber plant, characterized in that, it is: 1) a cucumber mutant plant having a single recessive nuclear gene for maple-leaf-type leaf, which is a Cucumis plant CC81221 with the accession number CGMCC No. 11285, or 2) a cucumber plant derived from CC81221 and having a single recessive nuclear gene for maple-leaf-type leaf; wherein, the single recessive nuclear gene for maple-leaf-type leaf is a single gene located at the base position of 16383700 to 16385719 on the second chromosome of the cucumber genome, and the base A at position 859 is mutated to T compared with the gene of cucumbers with a common leaf shape, wherein position 859 is the 8.sup.th position in SEQ ID NO: 5.

2. A part of the maple-leaf-type cucumber plant according to claim 1, wherein the part is plant cells, seeds, anthers, pollen, ovules, leaves, germs, roots, root tips, flowers, fruits, stems, shoots, scion, protoplasts or calluses.

3. A method for breeding a homozygous maple-leaf-type cucumber plant variety, characterized in that, the maple-leaf-type cucumber plant variety is bred using CC81221 or a cucumber plant derived from CC81221 and having a single recessive nuclear gene for maple-leaf-type leaf as a genetic source of the maple-leaf type, wherein the single recessive nuclear gene for maple-leaf-type leaf is a single gene located at the base position of 16383700 to 16385719 on the second chromosome of the cucumber genome, and the base A at position 859 is mutated to T compared with the gene of cucumbers with a common leaf shape, wherein position 859 is the 8.sup.th position in SEQ ID NO: 5.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(Refer to the Attachments)

(1) FIG. 1 shows photographs of maple-leaf-type leaves of the present invention, wherein the upper left one is a common leaf, and the rest are maple-leaf-type leaves having different genetic backgrounds.

(2) FIG. 2 shows a photograph of the CC81221 maple-leaf-type cucumber plants according to Example 1 in the field.

(3) FIG. 3 shows the comparative photograph between the leaf of the CC81221 maple-leaf-type cucumber plant according to Example 1 and a common cucumber leaf, wherein the left one is the common cucumber leaf, and the right one is the leaf of the CC81221 maple-leaf-type cucumber plant.

(4) FIG. 4 shows a photograph of the CC81413 maple-leaf-type cucumber plants according to Example 2 in the field.

(5) FIG. 5 shows the comparative photograph between the leaf of the CC81413 maple-leaf-type cucumber plant according to Example 2 and a common cucumber leaf, wherein the left one is the common cucumber leaf, and the right one is the leaf of the CC81413 maple-leaf-type cucumber plant.

(6) FIG. 6 shows a photograph of the CC81423 maple-leaf-type cucumber plants according to Example 2 in the field.

(7) FIG. 7 shows the comparative photograph between the leaf of the CC81423 maple-leaf-type cucumber plant according to Example 2 and a common cucumber leaf, wherein the left one is the common cucumber leaf, and the right one is the leaf of the CC81423 maple-leaf-type cucumber plant.

(8) FIG. 8 shows a photograph of the CC81433 maple-leaf-type cucumber plants according to Example 2 in the field.

(9) FIG. 9 shows the comparative photograph between the leaf of the CC81433 maple-leaf-type cucumber plant according to Example 2 and a common cucumber leaf, wherein the left one is the common cucumber leaf, and the right one is the leaf of the CC81433 maple-leaf-type cucumber plant.

(10) FIG. 10 shows a photograph of the MCC81411 maple-leaf-type cucumber plants according to Example 3 in the field.

(11) FIG. 11 shows the comparative photograph between the leaf of the MCC81411 maple-leaf-type cucumber plant according to Example 3 and a common cucumber leaf, wherein the left one is the common cucumber leaf, and the right one is the leaf of the MCC81411 maple-leaf-type cucumber plant.

(12) FIG. 12 shows a photograph of the maple-leaf-type Jingtong cucumber plants according to Example 4 in the field

(13) FIG. 13 shows the comparative photograph between the leaf of the maple-leaf-type Jingtong cucumber plant according to Example 4 and a common cucumber leaf, wherein the left one is the common cucumber leaf, and the right one is the leaf of the maple-leaf-type Jingtong cucumber plant.

(14) FIG. 14 shows a peak diagram of sequencing result of the male paternal in Example 5 using SNP marker.

(15) FIG. 15 shows a peak diagram of sequencing result of the female paternal in Example 5 using SNP marker.

(16) FIG. 16 shows a peak diagram of sequencing result of the F1 generation in Example 5 using SNP marker.

SPECIFIC MODES FOR CARRYING OUT THE EMBODIMENTS

(17) The following examples are intended to illustrate the invention but not intended to limit the scope of the invention.

Example 1: Genetic Analysis Experiment of a Maple-Leaf-Type Cucumber Mutant Plant CC81221

(18) (I) Test Materials

(19) In the spring of 2012, the inventors planted offspring inbred line materials obtained by multiple composite crosses of the farm variety of Tangshan autumn cucumber, Baiyesan cucumber and European fresh cucumber variety, in the Shangzhuang experimental greenhouse in Haidian District, Beijing, found a maple-leaf-type mutant, and named it as CC81221. The photographs of the mutant are shown in FIG. 2 and FIG. 3.

(20) The Cucumis sativus L. CC81221 was deposited in China General Microbiological Culture Collection Center (deposit institution address: Institute of Microbiology, Chinese Academy of Sciences, 3th, No. 1 Courtyard, Beichen West Road, Chaoyang District, Beijing, China) with the accession number of CGMCC No. 11285 on Oct. 16, 2015.

(21) The following cucumbers with a common leaf shape provided by Beijing Beinong Sanyi Cucumber Ecological Breeding Science and Technology Center were used as control varieties:

(22) (1) North China type (dense thorn, palm-like pentagonal leaves): M111

(23) (2) Two inbred lines of the South China type (sparse thorn, palm-like pentagonal leaves), which are: (a) Short and thick inbred line TA511 of Tangshan autumn cucumber (b) Medium and short inbred line HA411 of dry land cucumber

(24) (3) Two inbred lines of European fresh-eaten cucumber (thornless type, heart-like pentagonal leaves), which are: (a) inbred line SL311 of green cucumber (b) inbred line SL322 of white cucumber

(25) (II) Experimental Design

(26) Seedlings were transplanted from 50-well plates, wherein 50 seeds were sowed for each of the F.sub.1 generation and BC.sub.1 generation, and 100 seeds were sowed for the F.sub.2 generation.

(27) The combination types were as follows:

(28) (1) Maple-leaf-type: inbreeding

(29) (2) Maple-leaf-type×Common leaf-type.fwdarw.F.sub.1.fwdarw.F.sub.2 F.sub.1×maple-leaf-type

(30) (3) Common leaf-type×maple-leaf-type□.fwdarw.F.sub.1.fwdarw.F.sub.2 F.sub.1×maple-leaf-type

(31) (III) Test Methods

(32) (1) In May 2012, in the Shangzhuang Experimental Greenhouse in Haidian District, Beijing, a maple-leaf-type leaf material with the number CC81221 was used as one of the parents, and different types of cucumber inbred lines with common leaves were used as the other parent to obtain direct-cross hybrids and reciprocal-cross hybrids (hybridization of the maple-leaf-type plant as a female parent with the common leaf-type inbred line was defined as direct-cross, and hybridization of the maple-leaf-type plant as a male parent with the common leaf-type inbred line was defined as reciprocal-cross), and harvesting was carried out respectively to give F.sub.1 generation.

(33) (2) The F.sub.1 generations from various cross combinations were planted, and the leaf shape of the F.sub.1 generation plants was observed; one half of the F.sub.1 generation plants were selected for inbreeding, and harvesting was carried out respectively to give F.sub.2 generation; and the other half of the F.sub.1 generation plants were subjected to test cross with CC81221, and BC.sub.1 generation seeds were harvested.

(34) (3) The F.sub.2 generation and BC.sub.1 generation were planted separately, and leaf shape segregation data were observed at the seedling stage and statistics were made.

(35) The results (see Table 1 and Table 2) show that the leaf shapes of the F.sub.1 generation plants obtained by hybridization of the maple-leaf-type plant with the common leaf type plant are all common leaf shapes; the segregation ratios (see Table 1) of common leaves to maple-leaf-type leaves in the F.sub.2 generation are all 3:1 (common leaves: maple-leaf-type leaves). The ratio of common leaves to maple-leaf-type leaves in the test cross BC.sub.1 generation is 1:1. The above ratios indicate that the leaf shape character of maple-leaf-type conform to the genetic law of a pair of recessive genes, demonstrating that the leaf shape character of maple-leaf-type is controlled by a single recessive gene and belong to a discrete-character, and that the character is genetically stable and unaffected by environmental conditions. Photographs for leaf shape character segregation at the seedling stage are shown in FIG. 2.

(36) TABLE-US-00002 TABLE 1 F.sub.2 generation segregation test results Materials South China type European type Tangshan autumn dry land green white Segregation ratio North China type cucumber cucumber cucumber cucumber direct-cross or reciprocal-cross All being common All being common leaves All being common F.sub.1 leaves leaves F.sub.2 Theoretical ratio 3:1 3:1 3:1 3:1 3:1 (common leaves:maple-leaf-type leaves) Actual number 37(36.75):12(12.25) 41(36.75):8(12.25) 41(37.5):9(12.5) 38(37.5):12(12.5) 37(37.5):13(12.5) (theoretical number) (common leaves:maple-leaf-type leaves) X.sub.c.sup.2 0.01 1.97 1.31 0.03 0.3

(37) TABLE-US-00003 TABLE 2 Test-cross test results about the character of maple-leaf-type leaf Materials South China type European type North China Tangshan autumn Dry land green white Segregation ratio type cucumber cucumber cucumber cucumber Theoretical ratio 1:1 1:1 1:1 1:1 1:1 (common leaves:maple-leaf-type leaves) Actual number (theoretical 22(24):26(24) 22(25):28(25) 24(25):26(25) 24(23):22(23) 25(25):25(25) number) (common leaves:maple-leaf-type leaves) X.sub.c.sup.2 0.33 0.72 0.08 0.09 0

Example 2: Breeding Maple-Leaf-Type Cucumber Plant Variety by Hybridization

(38) Maple-leaf-type cucumber plants were bred by using the cucumber plant CC81221 with maple-leaf-type leaves or the cucumber inbred lines derived therefrom and having maple-leaf-type leaves, F.sub.1 hybrids or heterozygote as the donors of maple-leaf-type leaves. Therefore, any maple-leaf-type cucumber plant bred by the method of the present invention, and the plant CC81221 or the maple-leaf-type cucumber plant derived therefrom, all fall within the scope of the present invention.

(39) (1) On May 25, 2012, an experiment was carried out in an experimental shed in Haidian district, Beijing. The experimental shed was closed and isolated with insect-proof nets. The maple-leaf-type cucumber material CC81221 was used as one of the parents, and three different types of common leaf inbred lines provided by Beijing Beinong Sanyi Cucumber Ecological Breeding Science and Technology Center, i.e. dense-thorn cucumber inbred line M1141 (palm-like pentagonal leaves), South China-type cucumber inbred line HA1151 (palm-like pentagonal leaves) and smooth and thornless fresh-eaten cucumber inbred line SG1131 (heart-like pentagonal leaves) were used as the other parent; the hybridization was carried out respectively by artificial pollination, and harvesting was carried out respectively to obtain F.sub.1 generation seeds.

(40) (2) On Sep. 15, 2012, F.sub.1 generation seeds were planted in the experimental shed, inbred and harvested, respectively, to give F.sub.2 generation seeds;

(41) (3) On Jan. 15, 2013, F.sub.2 generation seeds were planted in the experimental shed. According to the phenotypic segregation situation, maple-leaf-type plants with good agronomic characters or common leaf plants with good agronomic characters were selected for inbreeding. Harvesting was carried out respectively for each plants to give F.sub.3 generation seeds.

(42) (4) On May 25, 2013, the F.sub.3 generation seeds were planted in the experimental shed, and among the F.sub.3 generation population obtained from plants with maple-leaf-type leaves by inbreeding, plants were selected according to the target agronomic characters to perform inbreeding; the plants without the maple-leaf-type marker character were weed out, and with respect to the selected population of plants having maple-leaf-type leaves, the step (3) was repeated; and harvesting was carried out respectively for each plant to give F.sub.4 generation seeds.

(43) (5) On Sep. 25, 2013, the F.sub.4 generation seeds were planted in the experimental shed, respectively, and the step (4) was repeated; and harvesting was carried out respectively for each plant to give F.sub.5 generation seeds.

(44) (6) On Jan. 15, 2014, the F.sub.5 generation seeds were planted in the experimental shed, respectively, and the step (4) was repeated; and harvesting was carried out respectively for each plant to give F.sub.6 generation seeds.

(45) (7) From May 2014 to September 2014, F.sub.6 and F.sub.7 generation seeds were planted, respectively, and step (4) was repeated to obtain homozygous and stable cucumber inbred lines with maple-leaf-type cleft leaves:

(46) The dense-thorn maple-leaf-type inbred line CC81413 (photographs are shown in FIG. 4 and FIG. 5); the South China-type maple-leaf-type inbred line CC81423 (photographs are shown in FIG. 6 and FIG. 7); and the European smooth and thornless maple-leaf-type inbred line CC81433 (The photographs are shown in FIG. 8 and FIG. 9).

Example 3: Breeding of Maple-Leaf-Type Cucumber Varieties by Backcrossing Method

(47) The backcross method was used in the present invention for the primary purpose of altering or replacing the leaf shape of the original variety while substantially retaining all other desirable genetic, physiological and morphological composition of the original variety.

(48) The character of maple-leaf-type leaves is controlled by a single recessive nuclear gene. In this case, the test directed to offspring must be introduced to the backcross transformation step, that is, the inbred offspring corresponding to each backcross generation was subjected to phenotypic test so as to determine which backcross plant carries the recessive gene encoding the maple-leaf-type leaves.

(49) The backcrossing process could be simplified and speeded up by using molecular markers such as SSR, RFLP, SNP or AFLP markers.

(50) (1) On May 25, 2012, in the test shed in Haidian district, Beijing, the maple-leaf-type cucumber plant CC81221 was used as the non-recurrent parent; the dense-thorn cucumber inbred line M1142 (palm-like pentagonal leaves) provided by Beijing Beinong Sanyi Cucumber Ecological Breeding Science and Technology Center was used as the recurrent parent to perform hybridization, so as to obtain F.sub.1 generation seeds.

(51) (2) On Sep. 15, 2012, the F.sub.1 generation and the recurrent parent as described in step (1) were planted in the experimental shed, respectively, and backcross with the recurrent parent was carried out to obtain BC.sub.1F.sub.1 generation seeds.

(52) (3) On Jan. 15, 2013, the BC.sub.1F.sub.1 generation and the recurrent parent were planted in an experimental shed, the individual plants with good agronomic characters were selected for self-crossing, the selected individual plants were used as the male parent to be back-crossed with the recurrent parent, and they were numbered correspondingly; and BC.sub.1F.sub.2 seeds and BC.sub.2F.sub.1 seeds were harvested for individual plants respectively.

(53) (4) On May 25, 2013, the BC.sub.1F.sub.2 generation seeds and BC.sub.2F.sub.1 generation seeds were planted in an experimental shed, respectively, and the maple-leaf-type plants of the BC.sub.1F.sub.2 generation were selected and correspondingly numbered, and then an individual plant were selected for self-crossing; and the selected individual plant was used as the male parent to back-crossed with the recurrent parent, numbered correspondingly, and harvesting was carried out respectively for each plant to give BC.sub.2F.sub.2 generation seeds and BC.sub.3F.sub.1 generation seed, respectively.

(54) (5) From Sep. 25, 2013 to January 2015, the step (4) was repeated for 2 to 8 generations in an experimental shed; when other characters of the BC.sub.nF.sub.1 (n represents the number of the generation) generation except for the leaf shape no longer segregated, self-crossing was carried out once to give the cucumber inbred line MCC81411 with maple-leaf-type leaves (FIG. 10 shows one photograph in the field, and FIG. 11 shows the comparative photograph between the leaf of the MCC81411 and a common cucumber leaf, wherein the left one is the common cucumber leaf, and the right one is the leaf of MCC81411).

Example 4: Test for Breeding Maple-Leaf-Type Cucumber Plant Hybrid with Maple-Leaf-Type Inbred Lines as Male and Female Parents

(55) Compared with the hybrids other than those of the present invention, hybrids bred in accordance with the methods of the present invention were characterized by hybridization using two cucumber parents having maple-leaf-type leaves. The purpose of this test was to achieve commercial production of hybrid seeds of cucumber plants with maple-leaf-type leaves. Specifically, the test included the following steps:

(56) (1) From September 2012 to January 2015, in the experimental greenhouse in Haidian district, Beijing, the maple-leaf-type cucumber plant CC81221 was used as a non-recurrent parent, D2-4-1 (the female parent of Jintong (variety number: CNA 20100699.0)) and D2-4-31 (the male parent of Jintong (variety number: CNA20100699.0)) were used as maple-leaf-type receptors, respectively, and cucumber inbred line D2-4-1-CC3 (Maple-leaf-type Jingtong cucumber female parent) and D2-4-31-CC1 (Maple-leaf-type Jingtong cucumber male parent) having maple-leaf-type leaves were separately bred by the backcross transformation method as described in Example 3.

(57) (2) Sowing and seedling were carried out on Feb. 5, 2015. On March 5, 4,000 plants per 667 square meters were planted with the ratio of male parent to female parent of 1:4. The hybridization was carried out by artificial pollination. On July 1st, the maple-leaf-type Jingtong cucumber hybrid was harvested.

(58) (3) On Jul. 15, 2015, 500 seeds of each of Jintong cucumber and maple-leaf-type Jingtong cucumber were planted, and the seedlings were planted on August 1.

(59) (4) Phenotypic test for hybrid purity: comparing with the original Jintong cucumber in leaf shape, cucumber shape, cucumber color, female property, early maturity, disease resistance, yield and so on. The test was completed on October 15. The result shows that 100% of the plants are Jingtong cucumber having maple-leaf-type leaves, and the photographs are shown in FIG. 12 and FIG. 13.

Example 5: Test for Using SNP Molecular Marker to Assist Selection of the Gene for Maple-Leaf-Type Leaf

(60) (I) Test Materials:

(61) Male parent: Mill (provided by Beijing Beinong Sanyi Cucumber Ecological Breeding Science and Technology Center): common leaves (dominant homozygous).

(62) Female parent: CC81221 (accession number: CGMCC No. 11285), maple-leaf-type (recessive homozygous).

(63) F1: common leaves (heterozygous).

(64) (II) Test Methods:

(65) 1. Extraction of Leaf DNA

(66) The DNA was extracted using the DNA Rapid Extraction Kit from Aidlab biotechnologies Co., Ltd, and the procedures were performed according to the instruction of the kit.

(67) 2. Cloning of Gene Fragment

(68) The primer sequences used for SNP point mutation were as follows:

(69) upstream primer: GTCCAGGTTCTCAATCGAGCT, as shown in SEQ ID No. 1;

(70) downstream primer: GCCACGATATTGAGAGGTTCT, as shown in SEQ ID No. 2.

(71) The reaction system for PCR amplification was given as follows:

(72) TABLE-US-00004 10 μM upstream primer 1 μl 10 μM downstream primer 1 μl DNA 2 μl Premixture (Beijing Liuhetong Trading Co., 12.5 μl Ltd., trade name: Premix Taq, product RR901A) Sterilized water the remainder The total reaction system was 25 μl.

(73) The reaction conditions for the PCR amplification were given as follows:

(74) Pre-denaturation at 94° C. for 2 min; 30 cycles of denaturation at 94° C. for 30 sec, annealing at 56° C. for 45 sec, and extension at 72° C. for 2.0 min; extension at 72° C. for 15 min, ending at 4° C.

(75) 3. Sequencing of PCR Product

(76) The amplification product was sent for sequencing, and the results were shown in FIG. 14 (male parent; SEQ ID NO: 3-TAAAAAAAGAGGC, wherein the A at the 8.sup.th position corresponds with position 859), FIG. 15 (female parent; SEQ ID NO: 4-TAAAAAATGAGGC, wherein the T at the 8.sup.th position corresponds with position 859), and FIG. 16 (F1; SEQ ID NO: 5-, wherein the A/T at the 8.sup.th position corresponds with position 859), which indicate that the SNP molecular marker can mark the cucumber plants having the single recessive nuclear gene for maple-leaf-type leaf.

(77) Although the present invention has been described in detail by general description and specific embodiments, it will be apparent to a person skilled in the art that some modifications and improvements can be made based on the present invention. Therefore, such modifications or improvements made without departing from the spirit of the invention are intended to be within the scope of the invention.

INDUSTRIAL APPLICABILITY

(78) The present invention discloses a maple-leaf-type cucumber plant, which is a mutant cucumber plant CC81221 having maple-leaf-type cleft leaves and found in the process of hybridization and breeding, or a cucumber plant derived therefrom and having a single recessive nuclear gene for maple-leaf-type leaf. The present invention provides a cucumber leaf mutant plant having maple-leaf-type cleft leaves and found in the process of hybridization and breeding. The present invention provides the derivatives of those plants and plant parts thereof, and also provides the application method of these plants. The significance of the present invention lies in that: the present invention discloses that the genetic character of having such maple-leaf-type leaves is a discrete character controlled by a single recessive nuclear gene, and discloses the morphological characteristic and molecular marker of the character. With the present invention, in the process of breeding a new variety of cucumber, the cucumber plant character of maple-leaf-type leaves can be more simply introduced to different kinds of varieties by conventional breeding methods, compared with quantitative characters that are controlled by plural genes, such as leaf area, thereby solving various breeding contradictions of populations, such as the contradiction between planting density and photosynthetic efficiency, the contradiction between vegetative growth and reproductive growth, which are prevalent but difficult to balance in cucumber production. The purpose of improving marketability, disease resistance, yield and the like can also be achieved by enhancing ventilating and light transmitting effect. The present invention also provides a new character usable for breeding beautiful and high-ornamental value cucumber varieties.