PHARMACEUTICAL COMPOSITION COMPRISING MIXTURE EXTRACT OF COPTIS RHIZOME AND SCHIZONEPETA TENUIFOLIA AS ACTIVE INGREDIENT FOR PREVENTION OR TREATMENT OF INFLAMMATORY BOWEL DISEASE

Abstract

The present invention relates to a pharmaceutical composition comprising a mixture extract of Coptis Rhizome and Schizonepeta tenuifolia as an active ingredient for prevention or treatment of an inflammatory bowel disease. The use of Coptis Rhizome and Schizonepeta tenuifolia extracts of the present invention can provide a pharmaceutical composition for prevention or treatment of an inflammatory bowel disease, the pharmaceutical composition being capable of being used safely on the human body without toxicity and side effects, or can provide a food composition and a feed composition each for prevention or alleviation of an inflammatory bowel disease.

Claims

1. A composition for preventing or treating inflammatory bowel disease, comprising a mixed extract of Coptis Rhizome and Schizonepeta tenuifolia Briquet as an active ingredient.

2. The composition of claim 1, wherein the inflammatory bowel disease is selected from the group consisting of ulcerative colitis, Crohn's disease, intestinal Behcet's disease, indeterminate colitis, bacterial enteritis, viral enteritis, amoebic enteritis, hemorrhagic rectal ulcer, ischemic colitis, and tuberculous enteritis.

3. The composition of claim 1, wherein the pharmaceutical composition inhibits the activation of TNF-α, IL-1β, IL-17, IL-23, CCL2, or MIP-2, which is an inflammatory factor.

4. The composition of claim 1, wherein the mixed extract of Coptis Rhizome and Schizonepeta tenuifolia Briquet is a mixed extract in which Coptis Rhizome and Schizonepeta tenuifolia Briquet are mixed at a weight ratio of 1-30:1-30.

5. The composition of claim 1, wherein the mixed extract of Coptis Rhizome and Schizonepeta tenuifolia Briquet is obtained by extraction with at least one solvent selected from water, an alcohol having 1 to 4 carbon atoms, or a mixture thereof.

6. The composition of claim 5, wherein the alcohol is ethanol.

7. The composition of claim 6, wherein the concentration of the alcohol is 20 to 99%.

8.-9. (canceled)

10. A method for preventing, alleviating, or treating inflammatory bowel disease, the method comprising: administering to a subject in need thereof, a pharmaceutical composition, food composition or feed composition comprising the mixed extract of Coptis Rhizome and Schizonepeta tenuifolia Briquet.

11. The method of claim 10, wherein the inflammatory bowel disease is selected from the group consisting of ulcerative colitis, Crohn's disease, intestinal Behcet's disease, indeterminate colitis, bacterial enteritis, viral enteritis, amoebic enteritis, hemorrhagic rectal ulcer, ischemic colitis, and tuberculous enteritis.

12. The method of claim 10, wherein the pharmaceutical composition inhibits the activation of TNF-α, IL-1β, IL-17, IL-23, CCL2, or MIP-2, which is an inflammatory factor.

13. The method of claim 10, wherein the mixed extract of Coptis Rhizome and Schizonepeta tenuifolia Briquet is a mixed extract in which Coptis Rhizome and Schizonepeta tenuifolia Briquet are mixed at a weight ratio of 1-30:1-30.

14. The method of claim 10, wherein the mixed extract of Coptis Rhizome and Schizonepeta tenuifolia Briquet is obtained by extraction with at least one solvent selected from water, an alcohol having 1 to 4 carbon atoms, or a mixture thereof.

15. The method of claim 14, wherein the alcohol is ethanol.

16. The method of claim 15, wherein the concentration of the alcohol is 20 to 99%.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0063] FIG. 1 shows the disease activity index (DAI) score of day 10 for each administration group in dextran sulfate sodium (DSS)-induced colitis mice.

[0064] FIG. 2 shows the histological colitis score for each administration group in DSS-induced colitis mice.

[0065] FIG. 3 shows the survival rate (%) for each administration group in dinitrobenzene sulfonic acid (DNBS)-induced colitis mice.

[0066] FIG. 4 shows the colon length for each administration group in DNBS-induced colitis mice.

[0067] FIG. 5 shows the body weight change rate (%) for 14 days for each administration group in DSS-induced colitis mice.

[0068] FIG. 6 shows the DAI score of day 10 for each administration group in DSS-induced colitis mice.

[0069] FIG. 7 shows the DAI scores of day 10 for single extract and mixed extract administration groups in DSS-induced colitis mice.

[0070] FIG. 8 shows the TNF-α expression levels for single extract and mixed extract administration groups in DSS-induced colitis mice.

[0071] FIG. 9 shows the IL-IP expression levels for single extract and mixed extract administration groups in DSS-induced colitis mice.

[0072] FIG. 10 shows the IL-17 expression levels for single extract and mixed extract administration groups in DSS-induced colitis mice.

[0073] FIG. 11 shows the IL-23 expression levels for single extract and mixed extract administration groups in DSS-induced colitis mice.

[0074] FIG. 12 shows the MIP-2 expression levels for single extract and mixed extract administration groups in DSS-induced colitis mice.

[0075] FIG. 13 shows the CCL2 expression levels for single extract and mixed extract administration groups in DSS-induced colitis mice.

[0076] FIG. 14 shows the NO production amounts for the groups administered single extract and mixed herbal extracts with various mixing ratios in macrophages having inflammation induced by LPS.

[0077] FIG. 15 shows the NO production amounts for the groups administered mixed herbal extracts according to the concentration of an extraction solvent in macrophages having inflammation induced by LPS.

[0078] FIG. 16 shows the body weight change rate (%) for single extract and mixed herbal extract administration groups in DSS-induced colitis mice.

[0079] FIG. 17 shows the DAI scores of day 10 for single extract and mixed herbal extract administration groups in DSS-induced colitis mice.

[0080] FIG. 18 shows the colon lengths for single extract and mixed herbal extract administration groups in DSS-induced colitis mice.

DETAILED DESCRIPTION

[0081] Hereinafter, the present disclosure will be described in more detail with reference to exemplary embodiments. These exemplary embodiments are provided only for the purpose of illustrating the present disclosure in more detail, and therefore, according to the purpose of the present disclosure, it would be apparent to a person skilled in the art that these examples are not construed to limit the scope of the present disclosure.

EXAMPLES

[0082] Throughout the present specification, the “%” used to express the concentration of a specific material, unless otherwise particularly stated, refers to (wt/wt) % for solid/solid, (wt/vol) % for solid/liquid, and (vol/vol) % for liquid/liquid.

Example 1: Preparation of Single Herbal Extract Powders

[0083] Twenty-four kinds of herbs in a washed and dried state, Mume Fructus, Terminaliae Fructus, Ecliptae Herba, Dioscoreae Rhizoma, Selaginellae Herba, Schizonepeta tenuifolia Briquet, Geranii Herba, Psoraleae Semen, Thujae Orientalis Folium, Sophorae Flos, Sophorae Radix, Coptis Rhizome, Cirsii Herba, Sanguisorbae Radix, Galla Rhois, Arecae Semen, Cimicifugae Rhizoma, Ailanthi Radicis Cortex, Araliae Continentalis Radix, Puerariae Radix, Platycodonis Radix, Schisandrae Fructus, Liriopis Tuber, and Auriculariae Polyporus, were purchased.

[0084] Mume Fructus, Terminaliae Fructus, Ecliptae Herba, Dioscoreae Rhizoma, Selaginellae Herba, Schizonepeta tenuifolia Briquet, Geranii Herba, Psoraleae Semen, Thujae Orientalis Folium, Sophorae Flos, Sophorae Radix, Coptis Rhizome, Cirsii Herba, Sanguisorbae Radix, Galla Rhois, Arecae Semen, Cimicifugae Rhizoma, Ailanthi Radicis Cortex, Araliae Continentalis Radix, Puerariae Radix, Platycodonis Radix, Schisandrae Fructus, Liriopis Tuber, and Auriculariae Polyporus were separately subjected to extraction with favorable stirring at room temperature for 72 hours after the addition of 70% (v/v) ethanol solution having a 10-fold weight of each. The extracts were filtered, concentrated under reduced pressure at 50-5° C., and then freeze-dried, to obtain single extract powders for the 24 kinds of herbs, respectively, and yields thereof are shown in Table 1 below.

TABLE-US-00001 TABLE 1 Extraction yields of single herbal extracts Herb name Extraction yield (%) Mume Fructus 21.09 Terminaliae Fructus 53.90 Ecliptae Herba 14.51 Dioscoreae Rhizoma 7.28 Selaginellae Herba 8.93 Schizonepeta tenuifolia Briquet 9.19 Geranii Herba 11.53 Psoraleae Semen 8.35 Thujae Orientalis Folium 14.81 Sophorae Flos 26.11 Sophorae Radix 12.95 Coptis Rhizome 17.81 Cirsii Herba 10.58 Sanguisorbae Radix 33.90 Galla Rhois 58.27 Arecae Semen 6.92 Cimicifugae Rhizoma 19.60 Ailanthi Radicis Cortex 5.00 Araliae Continentalis Radix 8.10 Puerariae Radix 21.79 Platycodonis Radix 21.56 Schisandrae Fructus 32.50 Liriopis Tuber 26.49 Auriculariae Polyporus 1.90

Example 2: Experiment of Effects of Single Herbal Extracts in DSS-Induced Enteritis Model

[0085] After 8-week-old male mice (C57BL/6) were acclimated for one week or longer, the mice were classified into: a normal group; a DSS and distilled water administration group in which Dextran Sulfate Sodium (DSS; 36,000-50,000 MW, MP Biomedicals, USA) was administered to induce ulcerative colitis and then distilled water was administered (negative control); a DSS and 5-aminosalicylic acid (5-ASA; Tokyo Chemical Industry Co., Japan) administration group (positive control group); and groups in which DSS and respective single herbal extracts prepared in Example 1 were administered (experimental groups).

[0086] The DSS-induced enteritis model has been known to show similar morphological changes and symptoms to human ulcerative colitis. The mice were fed 100 mL of DSS diluted in drinking water to 2.5%, which was then changed every two days. After the induction by DSS for 5 days, drinking water was changed.

[0087] 5-ASA, used as a drug for the positive control group, was diluted in drinking water to 25 mg/kg, and administered orally once/day for 14 days from the start date of the experiment. Each single herbal extract was orally administered at a dose of 100 mg/kg once/day for 14 days from the start date of the experiment.

[0088] The mice of each group were weighed to calculate weight loss rates, and the feces state and the presence of bloody feces were checked, every day after the start of the experiment. Scoring was conducted for the three indicators according to the standards in Table 2 below.

TABLE-US-00002 TABLE 2 Scoring standards for DAI calculation Body weight loss Score rate Feces state Bleeding 0  <1% Normal Normal 1 1-5% — — 2  5-10% Watery feces not sticking to the Slight periphery of the anus bleeding 3 10-15% — — 4 >15% Diarrhea sticking to the periphery Visible of the anus bleeding

[0089] Disease activity index (DAI), which is the sum calculated according to the scoring standards on Table 2 above, is shown in Table 3 below and FIG. 1.

TABLE-US-00003 TABLE 3 DAI score for each administration group Subject DAI score of Day 10 Normal group 0.0 Negative control 7.3 Positive control 2.4 Terminaliae Fructus 3.8 Selaginellae Herba 4.0 Schizonepeta tenuifolia Briquet 2.4 Geranii Herba 2.8 Psoraleae Semen 5.0 Thujae Orientalis Folium 2.6 Coptis Rhizome 2.0 Galla Rhois 8.0 Ailanthi Radicis Cortex 3.3 Puerariae Radix 5.0 Liriopis Tuber 3.8

[0090] As shown in Table 3 above, the DAI score of the group administered Coptis Rhizome was 2.0, the lowest value, and the DAI score of the group administered Schizonepeta tenuifolia Briquet was 2.4, the same as that of the positive control group.

[0091] On the last day of the experiment, the mice were sacrificed with carbon dioxide gas, and the colon site was excised. The colon length was measured from the excised colon, and then the state of the intestinal mucosa was investigated by incision in the longitudinal direction.

[0092] The measured colon distribution is shown in Table 4 below.

TABLE-US-00004 TABLE 4 Subject Colon length (cm) Normal group 7.2 Negative control group 3.9 Positive control 5.6 Terminaliae Fructus 5.5 Selaginellae Herba 5.3 Schizonepeta tenuifolia Briquet 5.8 Geranii Herba 6.0 Psoraleae Semen 5.4 Thujae Orientalis Folium 5.5 Coptis Rhizome 6.1 Galla Rhois 4.2 Ailanthi Radicis Cortex 5.9 Puerariae Radix 6.1 Liriopis Tuber 4.9

[0093] The histological colitis score was calculated by measuring the lengths of the mucosal ulcer site and the damaged mucosal layer in the colon tissue and averaging the values. The results are shown in Table 5 below and FIG. 2.

TABLE-US-00005 TABLE 5 Histological colitis score of each administration group Subject Histological colitis score Normal group 0.00 Negative control group 3.75 Positive control 1.00 Terminaliae Fructus 1.75 Selaginellae Herba 1.20 Schizonepeta tenuifolia Briquet 1.00 Geranii Herba 0.80 Psoraleae Semen 2.00 Thujae Orientalis Folium 1.40 Coptis Rhizome 2.20 Galla Rhois 1.60 Ailanthi Radicis Cortex 2.50 Puerariae Radix 1.80 Liriopis Tuber 2.80

[0094] As shown in Table 5 above, the histological colitis score of the group administered Geranii Herba was lowest, 0.80, and then the histological colitis score of the group administered Schizonepeta tenuifolia Briquet was 1.00, which was the same as that of the positive control group.

[0095] Ultimately, as a result of inducing enteritis by DSS administration, the groups administered the extracts of 11 kinds of herbs, Terminaliae Fructus, Selaginellae Herba, Schizonepeta tenuifolia Briquet, Geranii Herba, Psoraleae Semen, Thujae Orientalis Folium, Coptis Rhizome, Galla Rhois, Ailanthi Radicis Cortex, Puerariae Radix, and Liriopis Tuber showed an improvement effect in DAI score or histological colitis score compared with the negative control group.

Example 3: Experiment of Effects of Single Herbal Extracts on DNBS-Induced Enteritis Model

[0096] After 8-week-old male mice (C57BL/6) were acclimated for one week or longer, the mice were classified into: a normal group; a DNBS and distilled water administration group in which dinitrobenzene sulfonic acid (DNBS; Sigma-Aldrich, USA) was administered to induce inflammatory bowel disease and then distilled water was administered (negative control); a DNBS and 5-ASA administration group (positive control group); and groups in which DNBS and extracts of 11 kinds of herbs (Terminaliae Fructus, Selaginellae Herba, Schizonepeta tenuifolia Briquet, Geranii Herba, Psoraleae Semen, Thujae Orientalis Folium, Coptis Rhizome, Galla Rhois, Ailanthi Radicis Cortex, Puerariae Radix, and Liriopis Tuber) selected in Example 2 (experimental groups).

[0097] The DNBS-induced enteritis model is known to be closely related with human Crohn's disease in that T cell-mediated immune response is induced. DNBS in 50% ethanol/distilled water at 40 mg/mL was prepared, and 0.1 mL was slowly injected into the rectum of the mouse by using a catheter. 5-ASA, used as a drug for the positive control group, was diluted in drinking water to 25 mg/kg, and administered orally once/day for 5 days from the start date of the experiment. Each single herbal extract was orally administered at a dose of 100 mg/kg once/day for 5 days from the start date of the experiment, and the survival rate was checked every day. The results are shown in Table 6 below and FIG. 3.

TABLE-US-00006 TABLE 6 Survival rate (%) of each administration group Subject Survival rate (%) Normal group 100 Negative control group 25 Positive control 60 Coptis Rhizome 40 Geranii Herba 40 Selaginellae Herba 40 Schizonepeta tenuifolia Briquet 40

[0098] As shown in Table 6 above, most of the administration groups showed individual death due to DNBS administration, but all the groups administered the extracts of four kinds of herbs showed a survival rate of 40%.

[0099] On the last day of the experiment, the mice were sacrificed with carbon dioxide gas, and the colon site was excised, and the colon length was measured. The results are shown in Table 7 below and FIG. 4.

TABLE-US-00007 TABLE 7 Colon length for each administration group Subject Colon length (cm) Normal group 7.96 Negative control group 4.98 Positive control 7.10 Coptis Rhizome 7.04 Geranii Herba 6.58 Selaginellae Herba 6.64 Schizonepeta tenuifolia Briquet 6.23

[0100] As shown in Table 7 above, as a result of measuring the colon length, the groups administered Coptis Rhizome, Geranii Herba, Schizonepeta tenuifolia Briquet, and Selaginellae Herba showed a reduction in the degree of colon length decrease compared with the negative control group.

[0101] It can be ultimately seen that Coptis Rhizome, Geranii Herba, Schizonepeta tenuifolia Briquet, and Selaginellae Herba had an excellent effect in the alleviation or treatment of enteritis.

Example 4: Experiment of Effects of Single Herbal Extracts with Different Concentration

[0102] After 8-week-old male mice (C57BL/6) were acclimated for one week or longer, the mice were classified into: a normal group; a DSS and distilled water administration group (negative control); a DSS and 5-ASA administration group (positive control group); and groups in which DSS and extracts of four kinds of herbs (Coptis Rhizome, Geranii Herba, Schizonepeta tenuifolia Briquet, and Selaginellae Herba) selected in Example 1 (experimental groups).

[0103] The mice were fed 100 mL of DSS diluted in drinking water to 2.5%, which was then changed every two days. To evaluate the effects of single herbal extracts with different concentrations, DSS was administered for a total of 6 days, and then drinking water was changed.

[0104] 5-ASA was distilled in drinking water to 25 mg/kg and orally administered.

[0105] Each single herbal extract was orally administered at doses of 10, 30, and 100 mg/kg once/day for 14 days from the start date of the experiment, and the body weight change, feces state, and the presence of bloody feces were checked every day. The body weight change is shown in Table 8 and FIG. 5.

TABLE-US-00008 TABLE 8 Body weight change rate for each administration group with different concentrations Body weight change Subject rate for 14 days (%) Normal group 1.16 Negative control group −21.65 Positive control −19.38 Coptis Rhizome_10 −18.08 Coptis Rhizome_30 −16.12 Coptis Rhizome_100 −2.76 Schizonepeta tenuifolia Briquet_10 −11.43 Schizonepeta tenuifolia Briquet_30 −15.80 Schizonepeta tenuifolia Briquet_100 −18.20 Geranii Herba_10 −28.80 Geranii Herba_30 −26.70 Geranii Herba_100 −28.68 Selaginellae Herba_10 −19.34 Selaginellae Herba_30 −24.02 Selaginellae Herba_100 −24.56

[0106] As shown in Table 8 above, the body weight change rate decreased with the increase in concentration in the groups administered Coptis Rhizome. However, the body weight change rate rather increased with the increase in concentration in the groups administered Schizonepeta tenuifolia Briquet, and there was no significant difference in body weight change rate according to the concentration in the groups administered Geranii Herba and Selaginellae Herba.

[0107] In addition, DAI scores were calculated based on the results of the body weight change, feces state, and the presence of bloody feces, and the results are shown in Table 9 below and FIG. 6.

TABLE-US-00009 TABLE 9 DAI score for each administration group Subject DAI score of Day 10 Normal group 0.2 Negative control group 6.1 Positive control 4.8 Coptis Rhizome_10 4.0 Coptis Rhizome_30 3.6 Coptis Rhizome_100 1.6 Schizonepeta tenuifolia Briquet_10 4.1 Schizonepeta tenuifolia Briquet_30 4.6 Schizonepeta tenuifolia Briquet_100 4.2 Geranii Herba_10 5.6 Geranii Herba_30 5.6 Geranii Herba_100 4.8 Selaginellae Herba_10 4.6 Selaginellae Herba_30 5.2 Selaginellae Herba_100 5.6

[0108] As shown in Table 9 above, the DAI score significantly decreased with the increase in concentration in the groups administered Coptis Rhizome. However, there was no significant difference in DAI score according to the concentration in the groups administered Schizonepeta tenuifolia Briquet, Geranii Herba and Selaginellae Herba.

Example 5: Comparison of Effects Between Single Extracts and Mixed Extracts

[0109] After 8-week-old male mice (C57BL/6) were acclimated for one week or longer, the mice were classified into: a normal group; a DSS administration group, a DSS and distilled water administration group (negative control); a DSS and 5-ASA administration group (positive control group); and a group administered DSS and Coptis Rhizome 100 mg/kg, a group administered DSS and Schizonepeta tenuifolia Briquet 10 mg/kg, and a group administered DSS, Coptis Rhizome 100 mg/kg, and Schizonepeta tenuifolia Briquet 10 mg/kg (mixed extract administration group).

[0110] The mice were fed 100 mL of DSS diluted in drinking water to 2.5%, which was then changed every two days. After DSS administration for 5 days, drinking water was changed.

[0111] 5-ASA, used as a drug for the positive control group, was diluted in drinking water to 25 mg/kg, and orally administered.

[0112] Coptis Rhizome 100 mg/kg, Schizonepeta tenuifolia Briquet 10 mg/kg, and a 10:1 mixture of Coptis Rhizome and Schizonepeta tenuifolia Briquet at a dose of 110 mg/kg were orally administered once/day for 14 days, and the body weight change rate, feces state, and the presence of bloody feces were checked every day. DAI scores were calculated based on the experimental results, and shown in Table 10 below and FIG. 7.

TABLE-US-00010 TABLE 10 DAI score of Day 10 for each administration group Subject DAI score of Day 10 Normal group 0.0 Negative control group 5.3 Positive control 2.8 Coptis Rhizome 100 0.7 Schizonepeta tenuifolia Briquet 10 2.2 Coptis Rhizome 100 and Schizonepeta 0.4 tenuifolia Briquet 10

[0113] As shown in Table 10 above, the single Coptis Rhizome 100 mg/kg single administration group, the Schizonepeta tenuifolia Briquet 10 mg/kg single administration group, and the Coptis Rhizome and Schizonepeta tenuifolia Briquet mixed administration group all showed lower DAI scores than the positive control group. It was also identified that the mixed administration group had a lower DAI score compared with single administration groups.

Example 6: Measurement of Expression Changes of Inflammatory Factors TNF-α, IL-1β, IL-17, IL-23, CCL2, and MIP-2

[0114] RNA was isolated from the colon of the mice collected in Example 5 by using TRIzol (Invitrogen, USA). Thereafter, quantitative PCR through primers specific to the inflammatory factors TNF-α, IL-1β, IL-17, IL-23, CCL2, and MIP-2, and SYBR green (Takara, Japan) was performed using cDNA obtained by performing RT-PCR. The expression levels of RNA obtained therefrom were expressed as a relative change compared with the untreated group (normal group) by using GAPDH mRNA as the standard gene. The experimental results are shown in Tables 11 to 16 below and FIGS. 8 to 13. The primer sequences for mouse genes used in the experiments are shown in Table 17 below.

TABLE-US-00011 TABLE 11 TNF-α expression level (relative value) for each administration group TNF-α expression Subject level Normal group 1.00 Negative control group 3.91 Positive control 2.16 Coptis Rhizome 100 1.54 Schizonepeta tenuifolia Briquet 10 2.12 Coptis Rhizome 100 and Schizonepeta 1.22 tenuifolia Briquet 10

TABLE-US-00012 TABLE 12 IL-1β expression level (relative value) for each administration group Subject IL-1β expression level Normal group 1.00 Negative control group 5.94 Positive control 2.28 Coptis Rhizome 100 3.87 Schizonepeta tenuifolia Briquet 10 4.15 Coptis Rhizome 100 and Schizonepeta 1.57 tenuifolia Briquet 10

TABLE-US-00013 TABLE 13 IL-17 expression level (relative value) for each administration group Subject IL-17 expression level Normal group 1.00 Negative control group 5.12 Positive control 1.77 Coptis Rhizome 100 3.62 Schizonepeta tenuifolia Briquet 10 2.03 Coptis Rhizome 100 and Schizonepeta 1.55 tenuifolia Briquet 10

TABLE-US-00014 TABLE 14 IL-23 expression level (relative value) for each administration group Subject IL-23 expression level Normal group 1.00 Negative control group 5.51 Positive control 1.65 Coptis Rhizome 100 2.65 Schizonepeta tenuifolia Briquet 10 2.91 Coptis Rhizome 100 and Schizonepeta 1.60 tenuifolia Briquet 10

TABLE-US-00015 TABLE 15 MIP-2 expression level (relative value) for each administration group MIP-2 expression Subject level Normal group 1.00 Negative control group 5.21 Positive control 1.86 Coptis Rhizome 100 2.85 Schizonepeta tenuifolia Briquet 10 4.50 Coptis Rhizome 100 and Schizonepeta tenuifolia 1.68 Briquet 10

TABLE-US-00016 TABLE 16 CCL2 expression level (relative value) for each administration group CCL2 expression Subject level Normal group 1.00 Negative control group 4.51 Positive control 3.26 Coptis Rhizome 100 3.42 Schizonepeta tenuifolia Briquet 10 3.51 Coptis Rhizome 100 and Schizonepeta tenuifolia 1.92 Briquet 10

TABLE-US-00017 TABLE 17 Primer sequences for mouse genes Gene Direction Nucleotide sequence (5' to 3) GAPDH Forward AGCCTCGTCCCGTAGACAA (SEQ ID NO: 1) Reverse AATCTCCACTTTGCCACTGC (SEQ ID NO: 2) TNF-α Forward GCCTCTTCTCATTCCTGCTTG (SEQ ID NO: 3) Reverse CTGATGAGAGGGAGGCCATT (SEQ ID NO: 4) IL-1β Forward TGTGCAAGTGTCTGAAGCAGC (SEQ ID NO: 5) Reverse TGGAAGCAGCCCTTCATCTT (SEQ ID NO: 6) IL-23 Forward GCTGTGCCTAGGAGTAGCAG (SEQ ID NO: 7) Reverse TGGCTGTTGTCCTTGAGTCC (SEQ ID NO: 8) CCL2 Forward TCCCACTCACCTGCTGCTACTCA (SEQ ID NO: 9) Reverse GCTTCTTTGGGACACCTGCTG (SEQ ID NO: 10) MIP-2 Forward CCCTGCCAAGGGTTGACTTC (SEQ ID NO: 11) Reverse GCAAACTTTTTGACCGCCCT (SEQ ID NO: 12) IL-17 Forward TCTCCACCGCAATGAAGACC (SEQ ID NO: 13) Reverse CACACCCACCAGCATCTTCT (SEQ ID NO: 14)

[0115] As shown in Tables 11 to 16, the mixed administration group showed lower values in expression levels of the inflammatory factors TNF-α, IL-1β, IL-17, IL-23, CCL2, and MIP-2 compared with the single administration groups. Ultimately, it can be seen that the mixed administration group is excellent in inflammation inhibitory effect compared with single administration groups.

Example 7: Preparation of Mixed Herbal Extract Powders

[0116] To prepare mixed herbal extract powders, washed and dried Coptis Rhizome and Schizonepeta tenuifolia Briquet (Schizonepetae Spica and Schizonepetae Herba) were used. Coptis Rhizome and Schizonepeta tenuifolia Briquet were mixed at weight ratios (w/w) shown in Table 18, and a 70% (v/v) ethanol aqueous solution having a 10-fold volume was added thereto, followed by stirring at room temperature for 72 hours, and then extracts were obtained. Thereafter, the respective extracts were filtered, concentrated at 50 to 65° C., and freeze-dried, thereby obtaining powder-type mixed herbal extracts, and yields thereof are shown as follows.

TABLE-US-00018 TABLE 18 Yields of extracts with different mixing ratios Coptis Schizonepeta tenuifolia Extraction yield Classification Rhizome Briquet (%) Example 7-1 1 1 12.25 Example 7-2 2 1 14.05 Example 7-3 4 1 15.97 Example 7-4 8 1 16.78 Example 7-5 10  1 16.75

Example 8: Preparation of Mixed Herbal Extract Powders According to Different Extraction Solvents

[0117] Washed and dried Coptis Rhizome and Schizonepeta tenuifolia Briquet (Schizonepetae Spica and Schizonepetae Herba) were used. Coptis Rhizome and Schizonepeta tenuifolia Briquet were mixed at a weight ratio (w/w) of 10:1, and then 25, 50, 70, and 95% (v/v) ethanol aqueous solutions having a 10-fold volume were added thereto, followed by stirring at room temperature for 72 hours, and then extracts were obtained. Coptis Rhizome and Schizonepeta tenuifolia Briquet were mixed at a weight ratio (w/w) of 10:1, and then distilled water having a 10-fold volume was added thereto, followed by extraction under reflux at a temperature at which 90-95° C. was maintained, thereby obtaining an extract. Thereafter, the respective extracts were filtered, concentrated at 50 to 65° C., and freeze-dried, thereby obtaining powder-type mixed herbal extracts, and yields thereof are shown as follows.

TABLE-US-00019 TABLE 19 Extraction yields of mixed herbal extracts according to different extraction solvents Extraction Coptis Schizonepeta tenuifolia Extraction yield solvent Rhizome Briquet (%) water extraction 10 1 16.06 EtOH 25% 10 1 18.68 EtOH 50% 10 1 21.29 EtOH 70% 10 1 20.56 EtOH 95% 10 1  4.37

Example 9: Experiment of Effects of Single and Mixed Herbal Extracts on LPS-Induced Nitric Oxide (NO) Production of Macrophage Cell Line

[0118] The mouse macrophage cell line Raw264.7 cells (ATCC, USA) were cultured at 37° C. in a 5% CO.sub.2 incubator using RPMI media (Invitrogen, USA) containing 10% FBS. The cells were prepared on a 24-well plate at 5×10.sup.4 cells per well, and stabilized. After 24 hours, the cell supernatant was removed, and then the cells were treated with the single herbal extracts in Example 1 and the mixed herbal extracts in Example 7 at a concentration of 20 μg/mL. After 30 minutes, the cells were further treated with 100 ng/mL LPS. After 24 hours, the cell supernatant was collected, and the Griess test for measuring the change in NO production was performed. The concentrations of NO were calculated using the standard curve according to the concentration of sodium nitrite (NaNO.sub.2). The results are shown in Table 20 below and FIG. 14.

[0119] As shown in FIG. 14, the production of the inflammatory factor NO increased to a level of 4.62 μM by LPS treatment in macrophages (negative control group). The NO concentrations decreased to 2.75 and 3.93 μM in the experimental groups treated with the single herbal extracts together with LPS, respectively. However, the NO concentrations decreased to 1.69, 1.71, 1.41, 1.79, and 1.99 μM in the experimental groups treated with the mixed herbal extracts together with LPS, respectively, indicating that the treatment with mixed herbal extracts shows a significantly high inhibitory ability on NO production compared with the treatment with single herbal extracts. It can be therefore identified that the mixed herbal extracts of the present disclosure showed an excellent anti-inflammatory effect.

TABLE-US-00020 TABLE 20 NO production of each administration group NO production Subject (μM) Normal group 1.10 Negative control group 4.62 Coptis Rhizome 2.75 Schizonepeta tenuifolia Briquet 3.93 Coptis Rhizome:Schizonepeta tenuifolia Briquet = 10:1 1.69 Coptis Rhizome:Schizonepeta tenuifolia Briquet = 8:1 1.71 Coptis Rhizome:Schizonepeta tenuifolia Briquet = 4:1 1.41 Coptis Rhizome:Schizonepeta tenuifolia Briquet = 2:1 1.79 Coptis Rhizome:Schizonepeta tenuifolia Briquet = 1:1 1.99

Example 10: Experiment of Effects of Mixed Herbal Extracts According to Hot Water and Extraction Solvent with Different Concentrations on LPS-Induced Nitric Oxide (NO) Production of Macrophage Cell Line

[0120] The mouse macrophage cell line Raw264.7 cells (ATCC, USA) were cultured at 37° C. in a 5% CO.sub.2 incubator using RPMI media (Invitrogen, USA) containing 10% FBS. The cells were prepared on a 24-well plate at 5×10.sup.4 cells per well, and stabilized. After 24 hours, the cell supernatant was removed, and then the cells were treated with mixed herbal extracts according to hot water and extraction solvent (ethanol) with different concentrations in Example 8 at a concentration of 20 μg/mL. After 30 minutes, the cells were further treated with 100 ng/mL LPS. After 24 hours, the cell supernatant was collected, and the Griess test for measuring the change in NO production was performed. The concentrations of NO were calculated using the standard curve according to the concentration of sodium nitrite (NaNO.sub.2). The results are shown in Table 21 below and FIG. 15.

[0121] As shown in FIG. 15, the production of the inflammatory factor NO increased to a level of 4.62 μM by LPS treatment in macrophages (negative control group). The NO concentrations were measured to be 2.22, 1.48, 1.73, 1.45, and 1.55 μM in the experimental groups treated with hot water and an extraction solvent (ethanol) with different concentrations, respectively. A significant inhibitory ability on NO production was identified in all the extraction experimental groups.

TABLE-US-00021 TABLE 21 NO production of each administration group Subject NO production (μM) Normal group 1.10 Negative control group 4.62 Ethanol 0% (water extraction) 2.22 Ethanol 25% 1.48 Ethanol 50% 1.73 Ethanol 70% 1.45 Ethanol 95% 1.55

Example 11: Experiment of Effects of Single and Mixed Herbal Extracts on DSS-Induced Enteritis Model

[0122] After 8-week-old male mice (C57BL/6) were acclimated for one week or longer, the mice were classified into: a normal group;

a DSS and distilled water administration group in which Dextran Sulfate Sodium (DSS; 36,000-50,000 MW, MP Biomedicals, USA) was administered to induce ulcerative colitis and then distilled water was administered (negative control); a DSS and 5-aminosalicylic acid (5-ASA; Tokyo Chemical Industry Co., Japan) administration group (positive control group); and groups in which together with DSS, Coptis Rhizome and Schizonepeta tenuifolia Briquet extracts prepared in Example 1 and mixed herbal extracts prepared in Example 7 were administered (experimental groups).

[0123] The DSS-induced enteritis model has been known to show similar morphological changes and symptoms to human ulcerative colitis. The mice were fed 100 mL of DSS diluted in drinking water to 2.5%, which was then changed every two days. After the induction by DSS for 5 days, drinking water was changed.

[0124] 5-ASA, used as a drug for the positive control group, was diluted in drinking water to 25 mg/kg, and administered orally once/day for 10 days from the start date of the experiment. Each mixed herbal extract was orally administered at a dose of 50 mg/kg once/day for 10 days from the start date of the experiment.

[0125] The mice of each group were weighed to calculate weight loss rates every day after the start of the experiment. The body weight changes are shown in Table 22 below and FIG. 16.

TABLE-US-00022 TABLE 22 Body weight change rate of each administration group Body weight change Subject rate for 10 days (%) Normal group 6.24 Negative control group −11.55 Positive control −11.66 Coptis Rhizome −6.83 Schizonepeta tenuifolia Briquet −11.4 Coptis Rhizome:Schizonepeta tenuifolia −5.63 Briquet = 1:1 Coptis Rhizome:Schizonepeta tenuifolia −0.44 Briquet = 10:1

[0126] As shown in Table 22 above, the body weight change rates in the groups administered mixed herbal extracts of Coptis Rhizome:Schizonepeta tenuifolia Briquet at ratios of 1:1 and 10:1 had lower values than those in the Coptis Rhizome single extract administration group, the Schizonepeta tenuifolia Briquet single extract administration group, and the positive control group. Especially, a significantly lower value in body weight change rate was observed in the administration of the mixed herbal extract of Coptis Rhizome and Schizonepeta tenuifolia Briquet at a ratio of 10:1 than the administration of the mixed herbal extract thereof at a ratio of 1:1.

[0127] In addition, DAI scores were calculated based on the results of the body weight change, feces state, and the presence of bloody feces, and the results are shown in Table 23 below and FIG. 17.

TABLE-US-00023 TABLE 23 DA score for each administration group DAI score Subject of DAY 10 Normal group 0.0 Negative control group 7.8 Positive control 4.8 Coptis Rhizome 6.8 Schizonepeta tenuifolia Briquet 4.6 Coptis Rhizome:Schizonepeta tenuifolia Briquet = 1:1 5.0 Coptis Rhizome:Schizonepeta tenuifolia Briquet = 10:1 3.0

[0128] As shown in Table 23 above, the DAI score in the group administered the mixed herbal extract of Coptis Rhizome and Schizonepeta tenuifolia Briquet at a ratio of 1:1 was lower than that in the Coptis Rhizome single extract group, and similar to those in the positive control group and the Schizonepeta tenuifolia Briquet single extract administration group. The DAI score in the group administered the mixed herbal extract of Coptis Rhizome: Schizonepeta tenuifolia Briquet at a ratio of and 10:1 had a lower value than those in the Coptis Rhizome single extract administration group, the Schizonepeta tenuifolia Briquet single extract administration group, and the positive control group.

[0129] On the last day of the experiment, the mice were sacrificed with carbon dioxide gas, and the colon site was excised. The colon length was measured from the excised colon, and the results are shown in Table 24 below and FIG. 18.

TABLE-US-00024 TABLE 24 Colon length of each administration group Colon length Subject (cm) Normal group 8.26 Negative control group 5.65 Positive control 7.04 Coptis Rhizome 6.63 Schizonepeta tenuifolia Briquet 6.44 Coptis Rhizome:Schizonepeta tenuifolia Briquet = 1:1 7.25 Coptis Rhizome:Schizonepeta tenuifolia Briquet = 10:1 7.78

[0130] As shown in Table 24 above, the colon lengths in the groups administered mixed herbal extracts of Coptis Rhizome:Schizonepeta tenuifolia Briquet at ratios of 1:1 and 10:1 had higher values than those in the Coptis Rhizome single extract administration group, the Schizonepeta tenuifolia Briquet single extract administration group, and the positive control group. Especially, a significantly high value in colon length was shown in the administration of the mixed herbal extract of Coptis Rhizome and Schizonepeta tenuifolia Briquet at a ratio of 10:1 than the administration of the mixed herbal extract thereof at a ratio of 1:1.

[0131] Ultimately, as a result of inducing enteritis by DSS administration, the groups administered the mixed herbal extracts of Coptis Rhizome and Schizonepeta tenuifolia Briquet showed an improvement effect in body weight change rate, DAI score, or colon length compared with the single herbal extract administration groups.

[0132] Hereinafter, formulation examples of the composition containing the extract of the present disclosure will be described, but the present disclosure is not limited thereto and these examples are to specifically explain the present disclosure.

FORMULATION EXAMPLES

Formulation Example 1. Preparation of Powder Formulation

[0133]

TABLE-US-00025 Mixed extract of Coptis Rhizome and Schizonepeta tenuifolia 500 mg Briquet in Example 7-5 Lactose 100 mg Talc  10 mg

[0134] The above ingredients were mixed, and a sealed package was filled with the mixture, thereby preparing a powder formulation.

Formulation Example 2: Preparation of Tablet Formulation

[0135]

TABLE-US-00026 Mixed extract of Coptis Rhizome and Schizonepeta tenuifolia 300 mg Briquet in Example 7-5 Corn starch 100 mg Lactose 100 mg Magnesium stearate  2 mg

[0136] The above ingredients were mixed, and then the mixture was tableted according to an ordinary tablet preparation method, thereby preparing a tablet formulation.

Formulation Example 3: Preparation of Capsule Formulation

[0137]

TABLE-US-00027 Mixed extract of Coptis Rhizome and Schizonepeta tenuifolia 200 mg Briquet in Example 7-5 Crystalline cellulose 3 mg Lactose 14.8 mg Magnesium stearate 0.2 mg

[0138] According to an ordinary capsule preparation method, the above ingredients were mixed, and then a gelatin capsule was filled with the mixture, thereby preparing a capsule formulation.

Formulation Example 4: Preparation of Liquid Formulation

[0139]

TABLE-US-00028 Mixed extract of Coptis Rhizome and 4 g Schizonepeta tenuifolia Briquet in Example 7-5 Saccharide isomerate 10 g  Mannitol 5 g Purified water appropriate amount

[0140] According to an ordinary liquid formulation preparation method, the respective ingredients were added to and dissolved in purified water, followed by the addition of an appropriate amount of lemon flavor, and then the above ingredients were mixed and purified water was added thereto to make a total volume of 100 mL, with which a brown bottle was then filled, followed by sterilization, thereby preparing a liquid formulation.

Formulation Example 5: Preparation of Health Food

[0141]

TABLE-US-00029 Mixed extract of Coptis Rhizome and 1,000 mg Schizonepeta tenuifolia Briquet in Example 7-5 Vitamin mixture appropriate amount Vitamin A acetate 70 μg Vitamin E 1.0 mg Vitamin B1 0.13 mg Vitamin B2 0.15 mg Vitamin B6 0.5 mg Vitamin B12 0.2 μg Vitamin C 10 mg Biotin 10 μg Nicotinamide 1.7 mg Folic acid 50 μg Calcium pantothenate 0.5 mg Mineral mixture appropriate amount Ferrous sulfate 1.75 mg Zinc oxide 0.82 mg Magnesium carbonate 25.3 mg Potassium dihydrogen phosphate 15 mg Calcium monohydrogen phosphate 55 mg Potassium citrate 90 mg Calcium carbonate 100 mg Magnesium chloride 24.8 mg

[0142] The vitamin and mineral mixtures were prepared by mixing and composing ingredients comparatively suitable for a health food as preferable examples, but the mixing ratio therefor may be optionally changed. According to an ordinary health food manufacturing method, the above ingredients were mixed and granulated, and according to an ordinary method, the granules were used to prepare a health food composition.

Formulation Example 6: Preparation of Health Drink

[0143]

TABLE-US-00030 Mixed extract of Coptis Rhizome and 1,000 mg Schizonepeta tenuifolia Briquet in Example 7-5 Citric acid 1,000 mg Oligosaccharides 100 g Plum concentrate 2 g Taurine 1 g Purified water being added to a total of 900 ml

[0144] According to an ordinary health drink manufacturing method, the above ingredients were mixed, heated with stirring at 85° C. for 1 hour, and then the solution thus obtained was filtered, sealed and sterilized in a sterile 2 L vessel, and kept refrigerated. Thereafter, the resulting solution was used to prepare a health drink composition of the present disclosure.

[0145] The composition ratio was prepared by mixing ingredients relatively appropriate for favorite drink according to a preferred example, but the mixing ratio of the ingredients may be optionally modified depending on geographic and ethnic preferences, such as target customers, target country, and purposes of use.