VIRAL VECTORS FOR THE TREATMENT OF DIABETES

20220186251 · 2022-06-16

    Inventors

    Cpc classification

    International classification

    Abstract

    They are provided gene constructs comprising a nucleotide sequence encoding the Insulin-like growth factor 1 (IGF-1) of a mammal; and target sequences of a microRNA of a tissue where the expression of IGF-1 is wanted to be prevented, wherein the sequences (a) and (b) are operationally linked to a promoter of ubiquitous expression. Also provided are expression vectors comprising the gene construct and pharmaceutical compositions comprising them. They are useful in the treatment and/or prevention of diabetes mellitus in mammals, wherein a dysfunction and/or a loss of the beta-cells of the islets of Langerhans is present.

    Claims

    1. A gene construct comprising: (a) a nucleotide sequence encoding the Insulin-like growth factor 1 (IGF-1) of a mammal; and (b) at least one target sequence of a microRNA of a tissue where the expression of IGF-1 is to be prevented, wherein the sequences (a) and (b) are operationally linked to a ubiquitous promoter.

    2. The gene construct according to claim 1, wherein the nucleotide sequence encoding the IGF-1 protein is selected from a nucleotide sequence encoding the human IGF-1 protein, which comprises an amino acid sequence selected from the group consisting of sequences having at least 70% identity with SEQ ID NOs: 23 to 27.

    3. The gene construct according to claim 1, wherein the nucleotide sequence encoding the IGF-1 of a mammal, is selected from the group consisting of sequences having at least 70% identity with SEQ ID NOs: 3 to 7.

    4. The gene construct according to claim 1, wherein the target sequence of a microRNA is selected from a group consisting of sequences SEQ ID NOs: 8 to 20, 22, 93, 94 and 95 and/or combinations thereof.

    5. The gene construct according to claim 1, wherein the gene construct comprises at least one target sequence of the microRNA-122a and at least one target sequence of the microRNA-1.

    6. The gene construct according to claim 1, wherein the gene construct comprises four copies of the target sequence or of the target sequences of a microRNA.

    7. The gene construct according to claim 1, wherein the promoter is a constitutive promoter.

    8. The gene construct according claim 7, wherein the promoter is the CAG promoter.

    9. An expression vector that comprises the gene construct comprising: (a) a nucleotide sequence encoding the Insulin-like growth factor 1 (IGF-1) of a mammal; and (b) at least one target sequence of a microRNA of a tissue where the expression of IGF-1 is to be prevented, wherein the sequences (a) and (b) are operationally linked to a ubiquitous promoter.

    10. The vector according to claim 9, characterized for being a viral vector selected from the group consisting of adenoviral vectors, adeno associated vectors, retroviral vectors, and lentiviral vectors.

    11. The vector according to claim 9, characterized for being an adeno associated viral vector selected from the group consisting of adeno associated viral vector of serotype 6, adeno associated viral vector of serotype 7, adeno associated viral vector of serotype 8, adeno associated viral vector of serotype 9, adeno associated viral vector of serotype 10, adeno associated viral vector of serotype 11, adeno associated viral vector of serotype rh8, and adeno associated viral vector of serotype rh10.

    12. (canceled)

    13. The vector according to claim 9, which is for the expression of the gene construct in the pancreas.

    14. (canceled)

    15. A method of treatment and/or prevention of diabetes comprising administering a therapeutically effective amount of the vector of claim 9, wherein a dysfunction and/or a loss of the beta-cells of the islets of Langerhans is present.

    16. The method of claim 15 wherein the diabetes is type 1 diabetes mellitus.

    17. A pharmaceutical composition comprising a therapeutically effective amount of the vector of claim 9 and one or more pharmaceutically acceptable excipients or vehicles.

    18. An adeno-associated viral (AAV) vector comprising a gene construct comprising: (a) a nucleotide sequence encoding the Insulin-like growth factor 1 (IGF-1) of a mammal; and (b) at least one target sequence of a microRNA of a tissue where the expression of IGF-1 is to be prevented, wherein the sequences (a) and (b) are operationally linked to a ubiquitous promoter.

    19. The AAV vector of claim 18, wherein the at least one target sequence of a microRNA is selected from sequences that bind to microRNAs expressed in heart and/or liver.

    20. The AAV vector of claim 18, characterized as AAV vector selected from the group consisting of adeno associated viral vector of serotype 6, adeno associated viral vector of serotype 7, adeno associated viral vector of serotype 8, adeno associated viral vector of serotype 9, adeno associated viral vector of serotype 10, adeno associated viral vector of serotype 11, adeno associated viral vector of serotype rh8, and adeno associated viral vector of serotype rh10.

    21. A method of treatment and/or prevention of diabetes comprising administering a therapeutically effective amount of the AAV vector of claim 18, preferably diabetes mellitus in mammals, wherein a dysfunction and/or a loss of the beta-cells of the islets of Langerhans is present.

    22. A method of obtaining an AAV vector as defined in claim 18 comprising: (a) providing a cell with: (i) a gene construct comprising (a) a nucleotide sequence encoding the Insulin-like growth factor 1 (IGF-1) of a mammal and (b) at least one target sequence of a microRNA of a tissue where the expression of IGF-1 is to be prevented, wherein the sequences (a) and (b) are operationally linked to a ubiquitous promoter, flanked by AAV ITRs; (ii) cap and rep proteins of adeno associated virus; and (iii) adequate viral proteins for the replication of AAV; (b) cultivating the cell in suitable conditions to produce the AAV assembly; and (c) purifying the AAV vector produced by the cell.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0198] Otherwise indicated IGF-1 refers to IGF-1a.

    [0199] FIG. 1. Experimental design. Intraductal administration of the AAV8-CAG-GFP vector: AAV vector of serotype 8 encoding the green fluorescent protein GFP under the control of the CAG promoter (hybrid cytomegalovirus enhancer/chicken β-actin constitutive promoter).

    [0200] FIGS. 2A-2B. Pancreas transduction of female NOD mice intraductally administered with the AAV8-CAG-GFP vector. Pancreas immunohistochemistry against GFP (grey) and insulin (black) in samples from mice injected intraductally with 1.4×10.sup.12 vg at the age of 4 weeks and killed 1 month later. FIG. 2A Islet n-cell transduction. Original magnification ×400. FIG. 2B Exocrine pancreas transduction. Two representative images of the exocrine pancreas immunostained against GFP. Original magnification ×200.

    [0201] FIGS. 3A-3D. Liver and heart transduction of female NOD mice intraductally administered with the AAV8-CAG-GFP vector. Samples from mice injected intraductally with 1.4×10.sup.12 vg at the age of 4 weeks and killed 1 month later. FIG. 3A and FIG. 3B. Liver immunohistochemistry against GFP. Original magnification ×100. FIG. 3C and FIG. 3D. Heart immunohistochemistry against GFP. Original magnification ×200.

    [0202] FIG. 4. Expression of microRNA-122a in pancreas and liver. The levels of expression of microRNA-122a (miR-122a) were quantified by qPCR in pancreas and liver samples from female NOD mice. 8-week-old normoglycemic (NG) and 24-week-old hyperglycemic (HG) animals were analyzed. Results are expressed as mean±SEM, n=4-6 animals per group. ND: Non-Detected. a.u.: arbitrary units.

    [0203] FIG. 5. Expression of microRNA-1 in pancreas and heart. The levels of expression of microRNA-1 (miR-1) were quantified by qPCR in pancreas and heart samples from female NOD mice. 8-week-old normoglycemic (NG) and 24-week-old hyperglycemic (HG) animals were analyzed. Results are expressed as mean±SEM, n=4-6 animals per group. ND: Non-Detected. a.u.: arbitrary units.

    [0204] FIG. 6. Schematic diagram of the construct encoding murine IGF-1 protein pAAV-CAG-IGF1-dmiRT. ITR: Inverted Terminal Repeats; CAG: hybrid cytomegalovirus enhancer/chicken β-actin constitutive promoter; mIGF-1: murine sequence of the Igf-1 gene; miRT-122a: target sequence of the microRNA-122a (4 copies); miRT-1: target sequence of the microRNA-1 (4 copies); pA: poly A, polyadenylation signal. The abbreviated form dmiRT refers to both target sequences for microRNA-122a and -1.

    [0205] FIG. 7. In vitro testing of the plasmid pAAV-CAG-IGF1-dmiRT expression in INS-1 cells. Igf-1 expression levels 48 h post-transfection. 12-well culture plates were used and each well was transfected with 1 μg of DNA. Control wells were not transfected with any DNA. Values are expressed in arbitrary units normalized for the Rplp0 gene and relative to control group. Results are expressed as mean±SEM, n=3 wells per condition. ***p<0.001 vs. CONTROL.

    [0206] FIG. 8. In vitro testing of the plasmid pAAV-CAG-IGF1-dmiRT expression in C2C12 cells. Igf-1 expression levels 6 days post-transfection and post-induction of the differentiation process of the cells. 6-well culture plates were used and each well was transfected with 4 μg of DNA 6 h before the initiation of the differentiation process. Control wells were not transfected with any DNA. Values are expressed in arbitrary units normalized for the RplpO gene and relative to control group. Results are expressed as mean±SEM, n=3 wells per condition. *p<0.05 vs. CONTROL; ***p<0.001 vs. CONTROL; ##p<0.01 vs. pAAV CAG IGF1.

    [0207] FIG. 9. In vivo testing of the plasmid pAAV-CAG-IGF-1-dmiRT expression by hydrodynamic administration in ICR mice. Igf-1 expression levels in the liver 24 h post-hydrodynamic administration of 20 μg of DNA diluted in saline. Control animals were administered with saline. Values are expressed in arbitrary units normalized for the Rplp0 gene and relative to control group. Results are expressed as mean±SEM, n=3-5 male mice per group. **p<0.01 vs. CONTROL; ##p<0.01 vs. pAAV CAG IGF1.

    [0208] FIGS. 10A-10C. Schematic diagram of the AAV8 vectors generated. FIG. 10A AAV8-CAG-IGF-1-dmiRT. Genome of the AAV8 vector expressing Igf-1 and the target sequences for the microRNA-122a and -1 (dmiRT). FIG. 10B AAV8-CAG-IGF-1. Genome of the AAV8 vector expressing Igf-1 without the dmiRT fragment. FIG. 10C AAV8-CAG-NULL. Genome of the AAV8 vector that does not encode any transgene. All the viral vectors contain the CAG promoter (hybrid cytomegalovirus enhancer/chicken β-actin constitutive promoter) and the signal of polyadenylation (pA) flanked by the ITRs. The schematic representation is not to scale.

    [0209] FIG. 11. Experimental design. Intraductal administration of AAV8-CAG-IGF-1-dmiRT, AAV8-CAG-IGF-1 and AAV8-CAG-NULL viral vectors in 4-week-old female NOD mice at a dose of 1.4×10.sup.12 vg. The animals were killed 1 month post-injection and the expression of Igf-1 and viral genomes were analyzed.

    [0210] FIG. 12. In vivo testing of the AAV8-CAG-IGF-1-dmiRT viral vectors infectivity by intraductal administration in NOD mice. Igf-1 expression levels were quantified in pancreas, liver and heart RNA samples from NOD mice 1-month post-intraductal administration of 1.4×10.sup.12 vg per mouse. Values are expressed in arbitrary units normalized for the Rplp0 gene and relative to AAV8-CAG-NULL group. Results are expressed as mean±SEM, n=4-5 animals per group. **p<0.01 vs. AAV8 CAG NULL; ##p<0.01 vs. AAV8 CAG IGF-1; ###p<0.001 vs. AAV8 CAG IGF-1.

    [0211] FIG. 13. Viral genome quantification in liver and heart. Viral genomes corresponding to AAV8-CAG-NULL, AAV8-CAG-IGF-1 and AAV8-CAG-IGF-1-dmiRT vectors were quantified by qPCR in liver and heart samples of NOD mice 1-month post-intraductal administration of 1.4×10.sup.12 vg per mouse. Results are expressed as mean±SEM, n=4-5 animals per group.

    [0212] FIG. 14. Experimental design. Intraductal administration of AAV8-CAG-IGF-1-dmiRT and AAV8-CAG-NULL viral vectors in 4-week-old female NOD mice at a dose of 1.4×10.sup.12 vg. Glycaemia was followed-up in treated mice until 28 weeks of age and diabetes incidence was determined.

    [0213] FIGS. 15A-15B. Individual glycaemic profiles in female NOD mice intraductally administered with AAV8 vectors. FIG. 15A. Glycaemia follow-up in AAV8-CAG-NULL treated NOD mice. n=10. Due to the death of one hyperglycemic mouse, one of the blood glucose monitoring lines is discontinued from 16 weeks of age onwards. FIG. 15B. Glycaemia follow-up in AAV8-CAG-IGF-1-dmiRT treated mice. n=16. The arrow indicates the age at which the corresponding viral vectors were administered (4 weeks). Results are expressed as mean±SEM.

    [0214] FIG. 16. Diabetes incidence in female NOD mice intraductally administered with AAV8 vectors. Mice were considered diabetic after two consecutives measurements of blood glucose ≥250 mg/dl. n=10 (AAV8-CAG-NULL); n=16 (AAV8-CAG-IGF-1-dmiRT). The arrow indicates the age at which the corresponding viral vectors were administered (4 weeks).

    [0215] FIGS. 17A-17B. Pancreas transduction in female NOD mice intraductally administered with the AAV8-CAG-IGF1-dmiRT vector. FIG. 17A and FIG. 17B. Pancreas, liver and heart immunohistochemistry against IGF-1 in samples from NOD mice intraductally injected at 4 weeks of age with 1.4×10.sup.12 vg and killed 1 month later. FIG. 17A. Pancreatic islets transduction. NULL: AAV8-CAG-NULL; IGF-1: AAV8-CAG-IGF-1-dmiRT. Original magnification ×400. FIG. 17B. Liver and heart representative image of AAV8-CAG-IGF1-dmiRT administered mice. Original magnification ×100.

    [0216] FIGS. 18A-18D. Intraductal delivery of AAV8-CAG-IGF-1a-dmiRT vectors protects NOD mice from autoimmune diabetes. FIG. 18A. Immunohistochemical detection of IGF-1 (black) (upper panel) and double immunostaining of insulin (grey) and IGF-1 (black) (lower panel) in islets at 8 and 28 weeks of age; Original magnification ×400. FIG. 18B and FIG. 18C. Igf1a gene expression was analyzed in isolated islets (B) and total pancreas (C) at 28 weeks of age (n=4-6). FIG. 18D. Serum IGF-1 circulating levels at 28 weeks of age (n=8-10). Results are expressed as mean ±SEM. *p<0.05 vs. AAV8-CAG-NULL.

    [0217] FIGS. 19A-19B. Liver and heart IGF-1 overproduction is prevented in AAV8-CAG-IGF1a-dmiRT treated mice. FIG. 19A. No IGF-1+ cells were detected neither in the liver nor in the heart of 28-week-old NOD mice intraductally injected with 1×10.sup.12vg of AAV8-CAG-IGF-la-dmiRT (AAV-IGF-1). Original magnification ×400 (insets ×1000). FIG. 19B. Igf1a gene expression analysis in liver and heart of AAV8-CAG-IGF-1a-dmiRT and AAV8-CAG-NULL-treated mice at 28 weeks of age (n=9-10).

    [0218] FIGS. 20A-20F. AAV8-CAG-IGF1a-dmiRT treated mice show preservation of β-cell mass by protection against autoimmune attack. FIG. 20A.

    [0219] Immunohistochemical analysis of insulin (brown) in pancreas from AAV8-CAG-NULL (AAV-NULL) and AAV8-CAG-IGF-la-dmiRT (AAV-IGF-1) treated mice at 8 weeks and 28 weeks of age. NG: Normoglycemic HG: Hyperglycemic. FIG. 20B. β-cell mass quantification. (n=3-5) FIG. 20C. Insulitis score was quantified in normoglycemic mice at 8 and 28 weeks of age. FIG. 20D. Fed serum concentration of insulin at 28 weeks of age. ND, Non-Detected. FIG. 20E and FIG. 20F. Relative gene expression of pro-inflammatory cytokines FIG. 20E. and antigen presenting molecules FIG. 20F. in isolated islets from normoglycemic mice at 28 weeks of age (n=4-6). Results are expressed as mean±SEM. *p<0.05 vs. AAV8-CAG-NULL.

    [0220] FIGS. 21A-21B. Absence of miR-122a repression in the liver upon intraductal administration of AAV8 vectors bearing miRT-122a sequences. FIG. 21A. Relative hepatic expression levels of target genes known to be regulated by endogenous miR-122a at 28 weeks of age. Gys1, glycogen synthase 1; AldoA, aldolase A/fructose-biphosphate; Slc7a1, solute carrier family 7; Ccng1, cyclin G1. FIG. 21B. Fed serum cholesterol levels at 28 weeks of age. NG: Normoglycemic. Results are expressed as mean±SEM (n=4-7).

    [0221] FIG. 22. Schematic representation of the AAV-CAG-IGF-1b-dmiRT expression cassette for the murine isoform IGF-lb. ITR: Inverted Terminal Repeats; CAG: hybrid promoter based on chicken beta-actin promoter and cytomegalovirus enhancer; mIGF-1b: sequence of murine IGF-1b (; splicing isoform of pro-Igf-1, also called mechano-growth factor-MGF); miRT-122A: microRNA-122A target sequence (4 copies); miRT-1: microRNA-1 target sequence (4 copies); pA: poly A polyadenylation sequence. The abbreviated form dmiRT refers to microRNA target sequences for both 122A and 1.

    [0222] FIGS. 23A-23D. Intraductal delivery of AAV8-CAG-IGF-1b-dmiRT vectors protects NOD mice from autoimmune diabetes. FIG. 23A. Cumulative diabetes incidence of NOD mice intraductally injected with 1.4×10.sup.12 vg of AAV8-CAG-NULL or AAV8-CAG-IGF1b-dmiRT vectors at 4 weeks of age. FIG. 23B. Individual glycemic profiles (n=10, AAV8-CAG-NULL; n=17, AAV8-CAG-IGF1b-dmiRT). FIG. 23C. Immunohistochemical detection of IGF1 (black) (upper panel) in islets, liver and heart at 8 weeks of age; Original magnification ×400 (islets) and ×100 (liver, heart). AAV-NULL: AAV8-CAG-NULL; AAV-IGF- 1b: AAV8-CAG-IGF-1b-dmiRT. FIG. 23D. Serum IGF-1 circulating levels at 28 weeks of age (n=8-10). Results are expressed as mean±SEM.

    EXAMPLES

    [0223] We developed an AAV8-mediated gene transfer strategy to overexpress IGF-1 specifically in the pancreas of NOD mice. In order to target β-cells as well as to maximize the number of acinar cells that would supply IGF-1 to β-cells, the ubiquitous CAG promoter was selected to drive IGF-1 expression (Otherwise indicated IGF-1 refers to IGF-1a).

    [0224] Infectivity and Tropism of AAV8 Vectors Into NOD Mouse Pancreas

    [0225] Most studies examining the tropism of AAV vectors have been conducted in adult male individuals from healthy mouse strains (ICR, BALB/c, C57BL/6, etc.). However, the development of a gene therapy strategy for the prevention or treatment of diabetes in the spontaneous model NOD model requires the transfer of therapeutic genes in female individuals. At 4 weeks of age, NOD mice still preserve beta-cell mass, which is free of insulitis. It is from this age onwards that begins the process of infiltration of the islets and massive loss of beta-cells, culminating in the appearance of the disease. Therefore, 4-weeks-old would be a convenient time for the administration of candidate genes in NOD females to preserve beta-cell mass. One such candidate gene would be IGF-1.

    [0226] 1. Analysis of AAV8 Vector Transduction Locally Administered to 4-Week-Old Female NOD Mice

    [0227] We used a single-stranded AAV8 vector that overexpressed the green fluorescent protein (GFP) under the control of the ubiquitous promoter CAG (promoter hybrid based on the (3-actin promoter of the cytomegalovirus enhancer and chicken) to asses the transduction of pancreatic islets from 4-week-old female NOD mice at a dose of 1.4×10.sup.12 viral genomes (vg) (AAV8-CAG-GFP, viral vector comprising the sequence SEQ ID NO: 32). At one month post-injection animals were killed and tissue transduction was examined (FIG. 1).

    [0228] 1.1. Pancreas Transduction

    [0229] It was observed that female NOD mice locally injected in the pancreas with AAV8-CAG-GFP showed efficient transduction of beta-cells of the islets and a wide distribution of the vector in the exocrine pancreatic tissue (FIGS. 2A-2B), similar to what had been described in other animal models (Jimenez et al., 2011). Transduction of pancreatic islets was examined by double immunohistochemical staining against GFP and against insulin (FIG. 2A). In addition, it was observed that the dose administered allowed the transduction of mostly the periphery of the islet cells but also cells from the core.

    [0230] 1.2. Transduction of Peripheral Tissues

    [0231] It has been described that when AAV8 vectors are administered locally by intraductal injection in the pancreas, part of the burden of the administered viral vector is able to reach the systemic circulation and transduce non-pancreatic tissues, mainly the liver and heart (Jimenez et al., 2011). Thus, the use of ubiquitous promoters such as CAG promoter, allows expression of the gene construct carried in the AAV8 vector in the heart and liver of intradctally injected mice.

    [0232] The histological analysis of these tissues in female NOD mice injected with AAV8-CAG-GFP vectors confirmed the expression of green fluorescent protein GFP in liver and heart. Hepatocyte transduction was mostly dected around the central venules of the liver (FIGS. 3A-3D).

    [0233] 1.3. Modulation of AAV Tropism by Means of microRNA Target Sequences

    [0234] To preclude transgene expression in liver and heart and restrict AAV8-mediated transgene overexpression to the pancreas, we took advantage of the microRNAs (miRs) regulation network. miRs are small RNA sequences that negatively regulate mRNAs through effects on the stability and translation of mRNA transcripts (Bartel, 2004). Thus, by incorporating target sites for a specific miR (miRTs) into the 3′-UTR of a transgene, its expression is inhibited in cells in which that miR is highly expressed (Brown and Naldini 2009). In this work, the highly expressed liver-specific microRNA-122a (miR-122a) and heart-specific microRNA-1 were selected to modulate AAV tropism.

    [0235] 1.3.1. Analysis of the Expression of microRNA-122a in the Liver of NOD Mice

    [0236] To validate the incorporation of the target sequence for the microRNA-122a (miRT-122a) into the AAV construct as a strategy to block the expression of the transgene in the liver, the levels of expression of miR-122a were assessed in female NOD mice. This study was conducted in pre-diabetic individuals (normoglycemic) and individuals at the stage of overt diabetes (hyperglycemia) to study whether there were changes in the hepatic expression of miR-122a during the progressive advancement of the disease. In addition, we also analyzed the expression of miR-122a in the pancreas of NOD mice to rule out possible interference of transgene expression in the tissue of interest due to the presence of miRT-122a sequences in the AAV construct.

    [0237] As expected, miR-122a expression was only detected in the liver of NOD animals. In addition, it was observed that the expression levels of miR-122a in the liver were higher in diabetic NOD mice compared with pre-diabetic individuals, although the differences did not reach statistical significance (FIG. 4). This could be due to the role of miR-122a in lipid metabolism in the liver (Esau et al., 2006), which is altered in diabetic mice. In any case, this suggested that even disease progression in NOD mice, the inhibition of the AAV construct in the liver would be sustained, or even increased. However, there was no significant detectable levels of expression of miR-122a in the pancreas, regardless of the stage of diabetic animal.

    [0238] 1.3.2. Analysis of the Expression of microRNA-1 in the Heart of NOD Mice

    [0239] Similarly, to validate the use of the target sequence for the microRNA-1 (miRT-1) as a strategy to block the expression of the transgene carried in the AAV vector specifically in the heart, it the levels of expression of miR-1 were assessed in pre-diabetic (normoglycemic) female NOD mice and NOD mice at the phase of overt diabetes (hyperglycemic). In addition, we also analyzed the expression of miR-1 in the pancreas to rule out possible interference of the expression of the transgene in this tissue. The results showed that miR-1 was expressed in the heart of NOD animals at similar levels regardless of the diabetic stage. Regarding the pancreas, expression of miR-1 was not detected for any of the conditions tested (FIG. 5).

    [0240] Thus, the use of an AAV8 vector intraductally administered to 4-week-old NOD mice would be an appropriate approach to direct the expression of a transgene as IGF-1 in the pancreas of NOD mice. In addition, the incorporation of the target sequences miRT-122a and miRT-1 in the 3′-UTR region of the AAV construct may be an effective strategy to block the expression of the transgene in undesired tissues, such as liver and heart without altering the levels of expression in the pancreas. Thereby, overexpression of IGF-1 locally in the pancreas would be achieved. Moreover, the inhibition of transgene expression provided by the recognition of miRT-122a and miRT-1 in the liver and heart, respectively, would not be altered during diabetes progression in NOD mice.

    [0241] 1.4. Construction of an Adeno-Associated Viral Vector Encoding Murine IGF-1

    [0242] A construct for producing AAV8 vectors capable of directing the overexpression of IGF-1 specifically in the pancreas of NOD female individuals was prepared. With the aim of achieving high levels of overexpression of the transgene and transduce the largest possible number of cells in the pancreas, the ubiquitous CAG promoter was used. With the aim of blocking the expression of IGF-1 in undesired tissues such as liver or heart, four copies of the target sequence of the liver-specific miR-122a and four copies of the target sequence of the heart-specific miR-1 totally complementary (pAAV-CAG-IGF-1-4xmiRT122a-4xmiRT1, SEQ ID NO: 30 or SEQ ID NO: 31) were introduced in the region 3′-UTR of the construct. To simplify the nomenclature of the construct, the term dmiRT was used to refer to the presence of four copies of the target sequence for both microRNA-122A and -1 (pAAV-CAG-IGF-1-dmiRT) (FIG. 6).

    [0243] 1.4.1. Checking the Expression of the Construct pAAV-CAG-IGF-1-dmiRT In Vitro and In Vivo.

    [0244] Before producing the serotype 8 viral vectors AAV8-CAG-IGF-1-dmiRT the in vitro expression of the generated construct pAAV-CAG-IGF-1-dmiRT was verified. To this end, INS-1 cells (from rat insulinoma) and C2C12 cells (mouse myoblasts) were transfected and the levels of IGF-1 were quantified. Furthermore, the expression construct pAAV-CAG-IGF-1-dmiRT was also evaluated in vivo by hydrodynamic administration to ICR mice.

    [0245] 1.4.1.1. Transfection of the Construct pAAV-CAG-IGF-1-dmiRT Into INS-1 Cells

    [0246] INS-1 cells were transfected with plasmid pAAV-CAG-IGF-1-dmiRT (SEQ ID NO: 30 or SEQ ID NO: 31) to evaluate whether the generated construct correctly expressed IFG-1. In addition, in order to assess the possible influence of target sequences of microRNAs 122A and 1 in the expression of the construct, INS-1 cells were also transfected with a vector containing the same expression cassette without the target sequences of microRNAs 122A and 1 (pAAV-CAG-IGF-1, SEQ ID NO: 33). At 48 hours post-transfection, the mRNA was isolated from the cells and the levels of IFG-1 quantified by PCR. The result showed a high expression of IGF-1 transcript in transfected cells compared to control cells not transfected, thus verifying the functionality of the generated expression vector. In addition, the levels of overexpression of IGF-1 from construct pAAV-CAG-IGF-1-dmiRT were indistinguishable from the levels obtained with the construct pAAV-CAG-IGF-1 (SEQ ID NO: 33) (FIG. 7). These data indicated that the plasmid was functional in vitro and that the target sequences of microRNAs 122A and 1 did not interfere with the expression of IGF-1 in INS-1 cells.

    [0247] 1.4.1.2. Transfection of the Construct pAAV-CAG-IGF-1-dmiRT Into C2C12 Cells: Functionality of the Target Sequence of the microRNA-1

    [0248] C2C12 cells, an immortalized line of mouse myoblasts, proliferate rapidly under conditions of high concentration of serum, and differentiate and fuse into myotubes in low serum concentration. In order to check the functionality of the target sequence of microRNA-1 in the construct pAAV-CAG-IGF-1-dmiRT, C2C12 cells were transfected and the differentiation process of these cells was induced. To assess the effect of the microRNA target sequence-1 in the construct, cells were also transfected with plasmid pAAV-CAG-IGF-1. After six days of transfection and having induced differentiation to myotubes, mRNA was isolated from the cells and the levels of Igf-1 quantified by PCR. The results showed a marked overexpression of Igf-1 in C2C12 cells transfected with plasmid pAAV-CAG-IGF-1. However, the presence of the target sequence of microRNA-1 in the plasmid construct pAAV-CAG-IGF-1-dmiRT caused a decrease of approximately 50% in the expression of IGF-1 compared to the levels obtained from construct pAAV-CAG-IGF-1 (FIG. 8). These results validate the use of microRNA target sequence-1 to reduce the levels of Igf-1 in muscle cells.

    [0249] 1.4.1.3. Hydrodynamic Administration of the Construct pAAV-CAG-IGF-1-dmiRT in ICR Mice: Gunctionality of the Target Sequence of the microRNA-122a in Liver.

    [0250] The cell line mainly used for the in vitro study of liver tissue, cells derived from a hepatocellular carcinoma HepG2, do not express the microRNA-122a. Therefore, to assess the functionality of the target sequence of microRNA-122A, expressed in the liver, and validate the expression construct pAAV-CAG-IGF-1-dmiRT in vivo, an hydrodynamic injection of plasmid in mice ICR was carried out. The hydrodynamic administration through the tail vein (HTV injection) of plasmid DNA is an invaluable tool for gene transfer in mouse. It consists of a fast injection, in about 5 seconds, of a saline solution containing the plasmid DNA in a volume equivalent to 8-10% of body weight of the mouse. ICR male mice of 8 weeks of age were administered by HTV injection with the construct pAAV-CAG-IGF-1-dmiRT. To compare the effect of the microRNA target sequence-122A, animals were also injected with pAAV-CAG-IGF-1 plasmid. The control group was administered with saline solution without any plasmid.

    [0251] At 24 hours post-administration, the liver was recovered, hepatocytes mRNA was isolated and the levels of Igf-1 were quantified by quantitative PCR. The results showed that the presence of the microRNA-122a target sequence in the construct pAAV-122A-CAG-IGF-1-dmiRT was able to completely block Igf-1 expression in the liver of mice. In contrast, in animals injected with plasmid pAAV-CAG-IGF-1 a marked overexpression of Igf-1 was obtained in this tissue (FIG. 9). These results indicated that the expression vector pAAV-CAG-IGF-1-dmiRT was also functional in vivo and validated the use of the microRNA target sequence-122A to reduce the levels of Igf-1 in liver cells.

    [0252] 1.4.2. Production of Vectors AAV8-CAG-IGF-1-dmiRT for the Gene Transfer in Pancreas of NOD Mice

    [0253] Once validated the expression of the construct pAAV-CAG-IGF-1-dmiRT validated both in vitro and in vivo, the production of vectors AAV of serotype 8 AAV8-CAG-IGF-1-dmiRT was carried out. In addition, to confirm that the target sequences of microRNAs 122A and 1- contained in AAV8-CAG-IGF-1-dmiRT were also functional in the NOD mouse and did not alter the expression in the pancreas, vectors encoding the same expression construct without the dmiRT fragment (AAV8-CAG-IGF-1) were generated. Finally, in order to rule out any effect produced by the administration of a vector AAV8, vectors not encoding any transgene (AAV8-CAG-NUL, vector comprising SEQ ID NO: 34) were also generated (FIGS. 10A-10C). All-viral vectors AAV8-CAG-IGF-1-dmiRT, AAV8-CAG-IGF and AAV8-CAG-NUL were produced using the system triple transfection in HEK-293 cells as specified in Material and Methods section. Once generated, they were administered to NOD mice to evaluate their infectivity.

    [0254] 1.4.2.1. In Vivo Analysis of Infectivity and Expression of Vectors AAV8-CAG-IGF-1-dmiRT in NOD Mice

    [0255] Female NOD mice of 4 weeks old were intraductal administered with vectors AAV8-CAG-IFGF-1-dmiRT, AAV8-CAG-IGF-1 and AAV8-CAG-NUL at a dose of 1.4×10.sup.12 vg (vg: viral genomes) per animal to assess their infectivity. One month post-administration, the animals were killed and samples were extracted from the pancreas, liver and heart to quantify the expression of Igf-1 and the presence of viral genomes in these tissues (FIG. 11).

    [0256] Quantitative PCR analysis of the expression of Igf-1 in pancreas showed a significant increase in Igf-1 mRNA both in animals administered with vectors AAV8-CAG-1IGF1 and in animals with AAV8-CAG-IGF1-dmiRT, compared with the control group injected with the vector AAV8-CAG-NUL. In addition, levels of overexpression in pancreas were similar between the two groups, which corroborated the non-interference of sequences miRT-122a and miRT-1 in the expression of the transgene. However, when measuring the expression of Igf-1 in liver and heart, only increased levels of Igf-1 mRNA were detected in animals injected with the vectors AAV8-CAG-IGF-1. Animals that were administered with the vector containing the target sequences of microRNAs 122A and 1 (AAV8-CAG-IFG-1-dmiRT) showed levels of Igf-1 expression similar to those obtained in animals injected with the vector AAV8-CAG-NUL (FIG. 12).

    [0257] To confirm that the reduced expression of Igf-1 in liver and in heart of animals injected with the vector AAV8-CAG-IGF-1-dmiRT was not due to a different infectivity of viral preparations AAV8-CAG-IGF-1 and AAV8-CAG-IGF-1-dmiRT, a quantification of viral genomes in these tissues was done. The presence of viral genomes was determined by quantitative PCR, as specified in the Materials and Methods section. The result allowed to observe similar levels of viral genomes present in liver and in heart of the animals injected, regardless of the viral preparation. This indicated that the viral preparations AAV8-CAG-IGF-1-dmiRT, AAV8-CAG-IGF-1 and AAV8-CAG-NUL, administered at the same dose, had a similar infectious power in liver and heart in animals injected intraductally. Therefore, this confirmed that the lower Igf-1 expression observed in these tissues was due to the presence of the target sequences of the microRNA-122A, in liver, and of the microRNA-1 in heart, in the vector AAV8-CAG-IGF-1-dmiRT. In addition, it was observed that the tropism of vectors AAV8 was much higher in the liver, compared with the heart, where a much lower amount of viral genomes per cell was found (FIG. 13).

    [0258] These results confirmed that the presence of the sequence of recognition of miR-122A, in liver, and miR-1 in heart, in the construct AAV8-CAG-IGF-1-dmiRT, blocked the expression of Igf-1 induced by vector AAV8 in the tissues mentioned. Thus, the vector AAV8-CAG-IGF-1-dmiRT administered intraductal represented an appropriate strategy to direct the overexpression of Igf-1 locally in pancreas of NOD mice.

    [0259] 2. Study of Prevention of Diabetes in NOD Mice Administered with Vector AAV8-CAG-IGF-1-dmiRT

    [0260] To examine whether AAV-mediated specific pancreatic overexpression of Igf1 may prevent the development of autoimmune diabetes, 1×10.sup.12 vg of AAV8-CAG-IGF-1-dmiRT vectors were intraductally delivered to 4-week-old NOD mice. Control NOD mice received the same dose of non-coding AAV8-CAG-NULL vectors (FIG. 14). Long-term follow-up of blood glucose levels in AAV8-CAG-IGF-1-dmiRT treated mice revealed that whereas 60% of the animals in the control group became diabetic by 28 weeks of age, 75% of the IGF-1-treated mice remained normoglycemic (FIGS. 15A-15B and FIG. 16).

    [0261] 2.1. IGF-1 Expression in Animals Administered with AAV8-CAG-IGF-1-dmiRT

    [0262] One month after intraductal administration of AAV8-CAG-IGF-1-dmiRT vectors IGF-1 overexpression was found in the pancreas of NOD mice. Islets of animals treated with AAV8-CAG-IGF-1-dmiRT vectors showed a clear overexpression of IGF-1 compared to the islets of animals administered with AAV8-CAG-NULL vectors. Immunohistochemical staining against IGF-1 in the pancreas did not allowed to observe transduction of acinar cells possibly due to the rapid secretion of IGF-1. On the other hand, IGF-1 overproduction was not detected in the liver or the heart of animals administered with AAV8-CAG-IGF-1-dmiRT vectors (FIGS. 17A-17B).

    [0263] Long-term overproduction of IGF-1 was predominantly detected in beta-cells of the mice receiving AAV8-CAG-IGF-1a-dmiRT vectors but not in the AAV8-CAG-NULL-treated animals (FIG. 18A). Accordingly, at 28 weeks of age, a 30-fold increase in Igf1a mRNA levels was found in islets from AAV8-CAG-IGF-1a-dmiRT-treated mice (FIG. 18B). No IGF-1.sup.+ exocrine cells were detected probably due to the rapid secretion of the factor (FIG. 18A). However, a 10-fold increase in Igf1a mRNA levels confirmed IGF1 overexpression in total pancreas of AAV8-CAG-IGF-1a-dmiRT treated mice at 28 weeks of age (FIG. 18C), very similarly to the results reported at 1 month after vector administration (FIG. 12). Consistent with the presence of the dmiRT sequence in the AAV construct, neither IGF-1.sup.+ cells nor increased Igf1a mRNA were observed in the liver or the heart of AAV8-CAG-IGF-1a-dmiRT treated mice (FIGS. 19A-19B). In agreement, no differences in circulating IGF-1 levels were found between groups (FIG. 18D), suggesting that prevention of diabetes was mediated by IGF-1 locally produced in the pancreas.

    [0264] 2.2. AAV8-CAG-IGF-1-dmiRT-Treated Mice Show Preservation of Beta-cell Mass by Protection Against Autoimmune Attack.

    [0265] NOD mice treated with AAV8-CAG-IGF-1a-dmiRT vectors were significantly protected against lymphocytic infiltration of the islets and preserved beta-cell mass over time (FIG. 20A-C). Insulitis quantification was not possible in hyperglycemic mice, as beta-cells could barely be detected and the inflammatory infiltrate had disappeared. In agreement with preserved beta-cell mass, normal insulin circulating levels were detected in AAV8-CAG-IGF-1a-dmiRT treated mice at 28 weeks of age (FIG. 20D). Furthermore, islets from AAV8-CAG-IGF-1a-dmiRT mice showed a reduction in the expression of the inflammatory mediators Mip-lalpha, mip-1beta, Mig, IP-10 and Rantes as well as in the expression of Ifn-gamma, Tnf-alpha, and Il-1beta that exert direct cytotoxic effects against beta-cells (FIG. 20E). Additionally, the expression levels of the beta.sub.2-microglobulin (β.sub.2-m), H2-Aa, B7.1 and B7.2 genes, involved in antigen presentation, were also decreased in islets of IGF-la-treated animals (FIG. 20F).

    [0266] 2.3 Absence of miR-122a Repression in the Liver Upon Intraductal Administration of AAV8 Vectors Bearing miRT-122a Sequences.

    [0267] Given that vectors bearing miRTs have been used as competitive inhibitors to repress endogenous miRs, we investigated specific inhibition of miR-122a in the liver of AAV8-CAG-IGF-1-dmiRT treated mice. To exclude diabetes-related alterations, potential miR-122a repression was analyzed in normoglycemic animals. No interference in the expression levels of various miR-122a-regulated genes (Tsai et al 2012) was confirmed in 28-week-old NOD mice treated with AAV8-CAG-IGF-1-dmiRT compared to mice injected with AAV8-CAG-NULL vectors, which do not encode for any target site for miR122a (FIG. 21A). Additionally, serum cholesterol levels, reported to be regulated by miR-122a (Tsai et al 2012), were unchanged in the AAV8-CAG-IGF-1-dmiRT group (FIG. 21B). These results suggest that intraductal administration of AAV8-CAG-IGF-1-dmiRT vectors did not alter microRNA regulation network in the liver.

    [0268] 2.4. Intraductal Delivery of AAV8-CAG-IGF-1b-dmiRT Vector Protects Against Diabetes Development in NOD Mice.

    [0269] To examine whether AAV-mediated specific pancreatic overexpression of Igf-lb may prevent the development of autoimmune diabetes, 1×10.sup.12 vg of AAV8-CAG-IGF-1b-dmiRT vectors (FIG. 22) were intraductally delivered to 4-week-old NOD mice. Control NOD mice received the same dose of non-coding AAV8-CAG-NULL vectors. Long-term follow-up of blood glucose levels in AAV8-CAG-IGF-1b-dmiRT treated mice revealed that whereas 60% of the animals in the control group became diabetic by 28 weeks of age, 47% of the IGF-1b-treated mice remained normoglycemic (FIG. 23A, FIG. 23B). Overproduction of IGF-1 was predominantly detected in beta-cells of the mice receiving AAV8-CAG-IGF-1b-dmiRT vectors but not in the AAV8-CAG-NULL-treated animals (FIG. 23C). Consistent with the presence of the dmiRT sequence in the AAV construct, no IGF-1.sup.+ cells were detected in the liver or the heart of AAV8-CAG-IGF-1b-dmiRT treated mice (FIG. 23C). In agreement, no differences in circulating IGF-1 levels were found between groups (FIG. 23D), suggesting that prevention of diabetes was mediated by IGF-1 locally produced in the pancreas.

    [0270] 3. Materials

    [0271] 3.1. Animals

    [0272] Female NOD mice were purchased to Charles River Laboratories, Barcelona, Spain. To study the function of the target sequence of microRNA-122a, male ICR mice of 8 weeks old were used (Harlan Teklad, Barcelona, Spain).

    [0273] Mice were housed in pathogen-free facilities (SER-CBATEG, Centre de Biotecnologia Animal i Teràpia Gènica, Barcelona) under controlled conditions of temperature (22±2° C.) and light (cycles of 12 hours of light and 12 hours of darkness) and fed ad libitum i.e., without restricting access to food, with a standard diet (2019S Teklad Global; Harlan Teklad, Madison, Wis., USA). For sampling, animals were anesthetized using anesthetic inhalators (Isoflurane, IsoFlo®, Abbott Animal Health, Illinois, USA) and were eutanized by beheading. Blood and tissue samples were taken between 9:00 and 11:00 a.m. and immediately frozen with liquid N.sub.2 and stored at −80° C. (blood and tissues) and preserved in formaldehyde (tissues). The Ethics Committee in Human and Animal Research and the Autonomous University of Barcelona (UAB) approved all experimental procedures.

    [0274] 3.2. Bacterial Strains

    [0275] XL2Bue E. coli strains (Stratagene-Agilent Technologies, Santa Clara, Calif., USA) were used to obtain the different plasmid constructs. All plasmids contain the gene for resistance to ampicillin to be selected. The bacterial culture was grown in solid LB media (Miller's LB Broth, Conda, Madrid, Spain) with 2% agar and 50 μg/ml ampicillin.

    [0276] 3.3. Antibodies

    [0277] The tissue samples were fixed with a buffered solution of 4% formaldehyde, included in paraffin blocks and subsequently, sections of 2-3 microns were obtained to perform incubation with the corresponding antibodies. The antibodies used for the detection of proteins using immunohistochemical techniques are summarized in the following table 1:

    TABLE-US-00002 TABLE 1 Antibodies Antibody Host Provider Ref. Anti-insulin Guinea Pig Sigma-Aldrich I-8510 Anti-IGF-1 Goat R&D Systems AF791 Anti-GFP Goat Abcam ab6673 Anti-IgG of Guinea Goat Molecular Probes A-11075 pig conjugated with Alexa Fluor 568 Anti-IgG goat, Donkey Santa Cruz sc-2042 byotinylated

    [0278] 3,3-diaminobenzidine (DAB) (Sigma-Aldrich D5637-1G) and counterstaining with Mayer hematoxylin (Merck 109 249) were used for the preparations for light field imaging. For fluorescence images, streptavidin conjugated with Alexa Fluor 488 (Molecular Probes S-11223) was used to amplify the signal of antibody conjugated with biotin.

    [0279] 3.4. Reagents

    [0280] Molecular biology reagents were obtained from Roche (Roche Diagnostics Corp., IN, USA), Invitrogen Corporation/Life Technologies (San Diego, CA, USA), Bio-Rad Laboratories (Hercules, Calif., USA), Amersham Biosciences (Piscataway, N.J., USA), Sigma (St.Louis, Mo., USA), Promega Corporation (Madison, Wis., USA), BASF (Barcelona, Spain), Qiagen (Hilden, Germany), QBIOgen/MP Biomedicals (Irvine, Calif., USA) and Fermentas (St. Leon-Rot, Germany). Culture media and antibodies were obtained from PAA (Pasching, Austria) and serum (FBS) from Gibco (Invitrogen, Life Technologies).

    [0281] 3.5. Plasmids

    [0282] Plasmids used are identified in table 2.

    TABLE-US-00003 TABLE 2 Plasmids used Gene of Name Promoter interest PolyA pAAV-CAG-GFP CAG GFP rabbit β-globin (SEQ ID NO: 32) pAAV-CAG-NULL CAG — rabbit β-globin (SEQ ID NO: 34) pAAV-CAG-IGF1-dmiRT CAG mIGF1 rabbit β-globin (SEQ ID NO: 30 or miRT122a SEQ ID NO: 31) miRT1 pAAV-CAG-IGF1 CAG mIGF1 rabbit β-globin (SEQ ID NO: 33)

    [0283] The CAG promoter (SEQ ID NO: 52) is a hybrid promoter consisting of the chicken β-actin promoter and the enhancer of Cytomegalovirus and has a ubiquitous expression.

    [0284] The cloning strategies used for the generation of different plasmids are summarized in the following table 3.

    TABLE-US-00004 TABLE 3 cloning strategies used Name Cloning strategy pAAV-CAG-IGF1-dmiRT vector pAAV-CAG-GFP-dmiRT - digested with HindIII and NotI. insert pAAV-CAG-IGF-1 digested with HindIII and NotI. pAAV-CAG-IGF1 vector pAAV-CAG-IGF-1-dmiRT digested with BamHI/KpnI and blunt extremes

    [0285] 3.6. Methods

    [0286] 3.6.1. Basic DNA Techniques

    [0287] 3.6.1.1. Preparation of Plasmid DNA

    [0288] To obtain small amounts of plasmid DNA (3-4 μg) minipreparacions (minipreps) were performed according to the alkaline lysis protocol originally described by Bionboim and collaborators (Birnboim and Doly, 1979).

    [0289] To obtain large amounts of DNA (1-2.5 mg) maxipreparacions (maxipreps) or megapreparacions (megapreps) were performed from 250 or 500 ml of culture medium, respectively. The method is also based on alkaline lysis but in this case, DNA purification was performed by adsorption columns (PureYield™ plasmid MaxiPrep System, Promega Corporation, for maxipreps or EndoFree Plasmid Mega Kit, Qiagen, for the megapreps). The purity and concentration of the obtained DNA was determined by using a Nanodrop device (ND-1000, ThermoCientific).

    [0290] 3.6.1.2. DNA Digestion with Restriction Enzymes

    [0291] Each restriction enzyme requires specific reaction conditions of pH, ionic strength and temperature. In each case, the instructions of the manufacturer were followed (New England Biolabs, Roche, Promega and Fermentas). In general, DNA was digested with 0.5 units enzyme per 1 μg of DNA in the buffer supplied by the manufacturer for 1-2 hours at the optimum temperature of each enzyme. The reaction product was analyzed on 1-2% agarose gels. When DNA should be digested with two or more restriction enzymes, digestions were carried out jointly if buffers and temperature conditions were compatible. If the enzymes had different requirements, after the first digestion DNA was purified by using the Geneclean® kit (QBIOgene) according to the manufacturer's instructions. DNA was eluted with 30 μL of elution buffer provided by the manufacturer to subsequently perform the second digestion.

    [0292] 3.6.1.3. Dephosphorylation of DNA Fragments

    [0293] The plasmid DNA, once digested, can be religated. This process can be avoided by removing the phosphate residues at the 5′ end of the vector. For dephosphorylation, one unit of alkaline phosphatase (Shrimp Alkaline phosphatase, Promega) per 1 μg of DNA was used in the commercial buffer 1×. The dephosphorylation reaction was performed for 30 min at 37° C. Subsequently, the enzyme was inactivated at 65° C. for 15 min to avoid any interaction of the phosphatase in the ligation reaction.

    [0294] 3.6.1.4. Generation of DNA Fragments with Blunt Ends

    [0295] When blunt ends were needed for cloning, the digested DNA fragment was treated with the enzyme Klenow DNA polymerase I (New England Biolabs). The reaction was carried out following the manufacturer's instructions.

    [0296] 3.6.1.5. Generation of Hybrid DNA Molecules: Ligation

    [0297] The combination of hybrid DNA molecules from different fragments can be made by the action of the enzyme ligase (ligation). The DNA fragments of interest were mixed in various ratios of vector and insert (1:1, 1:5, 1:10) with the enzyme DNA ligase of bacteriophage T4 (New England Biolabs) and the corresponding buffer according to the protocol established by the trading house. The products resulting from the ligation were transformed into competent E. coli cells of the XL2-blue strain (Stratagene-Agilent Technologies, Santa Clara, Calif., USA).

    [0298] 3.6.1.6. Transformation of Competent XL2-blue E.coli Cells

    [0299] The plasmid DNA can be introduced into competent bacterial cells via transformation. In this study, the electroporation method was chosen to carry out the transformation of XL2-blue E.coli cells. 40 μl of competent cells (2×10.sup.10 cells/ml) were thawed on ice until use. 1 μl (approximately 10 ng) of the ligation reaction of DNA or control DNA was added directly to the electrocompetent cells. After incubation on ice for 5 min, cells were electroporated at 2500 V with an electroporador (Bio-Rad). Later, diluted μl LB 200, were sown on LB plates with appropriate antibiotics and were incubated at 37° C. O/N (overnight). The next morning DNA was extracted from recombinant colonies. By using restriction enzymes the presence of the hybrid molecules of DNA was analyzed.

    [0300] 3.6.1.7. DNA Purification from Agarose Gels

    [0301] Electrophoresis in agarose gel is the standard method used to separate, identify and purify DNA fragments. To separate DNA fragments between 0.2 and 7 kb 1% agarose gels were used. To separate fragments <0.2 kb 2% agarose gels were used. The visualization of the DNA in the gel was achieved by adding low concentrations of the fluorescent dye ethidium bromide (0.5 μg/ml), which is sandwiched between two strands of DNA. DNA was visualized using low wavelength (310 nm) ultraviolet light (UV) using a transiluminator and a camera system (Syngene). 1 kb DNA ladder (Invitrogen) was used as molecular weight marker.

    [0302] The agarose gels were prepared dissolving agarose in 1× TAE electrophoresis buffer (40 mM Tris-acetate pH 8.3 and 1 mM EDTA) with 0.5 μg/ml of ethidium bromide. DNA samples were loaded in the agarose gel with lx loading buffer (Fermentas) and ran within 1× TAE electrophoresis buffer at 80 V. In order to obtain and purify DNA fragments of interest from the agarose gel, the GeneJET™_9 Gel Extraction Kit (Fermentas) was used. The DNA was quantified using a Nanodrop 1000 spectrophotometer (Thermo Fisher Scientific Inc., USA).

    [0303] 3.6.2. Eukaryotic Cells in Culture

    [0304] 3.6.2.1. INS-1 Cells

    [0305] INS-1 cells (ATCC) are from a rat insulinoma. INS-1 cells were incubated at 37° C., 5% CO.sub.2 and medium RPMI-1640 (PAA) (10 mM glucose) with 2 mM glutamine, supplemented with FBS (Fetal Bovine Serum, PAA) at 10% (heat inactivated), 10 mM HEPES, 1 mM sodium pyruvate and 50 μM 2-mercaptoethanol. To perform the maintenance steps, INS-1 cells were trypsinated to cause plate desadhesion, and then cells were plated at different dilutions.

    [0306] 3.6.2.2. C2C12 Cells

    [0307] C2C12 cell line (ATCC) is from an immortalized line of mouse myoblasts. The maintenance of the cells was conducted in medium DMEM (PAA) with 2 μM glutamine and supplemented with 10% FBS (heat inactivated). To induce their differentiation to myotubes, the same medium was used but supplemented with HS (Horse Serum, PAA) 2% (inactivated by heat) instead of 10% FBS. In both cases they were grown in the incubator at 37° C. and 8.5% CO.sub.2.

    [0308] 3.6.2.3. HEK-293 Cells

    [0309] HEK-293 or 293 cells (ATCC) are human embryonic kidney cells that present the adenoviral gene of Ad5 El stably integrated into the genome of cells. These cells were used for the amplification of viral vectors. They were kept in culture medium DMEM (PAA) with 2 mM glutamine, supplemented with 10% FBS (heat inactivated) in an incubator set at 8.5% CO.sub.2 and 37° C. When they had a 70% confluence, cells were trypsinated and plated in different dilutions.

    [0310] 3.6.3. DNA Transfection in Cultured Cells

    [0311] To carry out the analysis of the in vitro expression of the constructs obtained, plasmid transfections were performed in different cell lines (INS-1, C2C12). For this purpose, the technique of transfection with Lipofectamina (Lipofectamine™2000, Invitrogen) was used. The proportion of Lipofectamina/DNA used was 2.5 μl of Lipofectamina (1 mg / ml) to 1 μg DNA in INS-1 cells and 10 μl of Lipofectamina (1 mg / ml) for four μg DNA C2C12 cells. Upon transfection, INS-1 cells and C2C12 were 70-80% confluence. After 4-6 h post-transfection, the medium was changed from INS-1 cells to fresh culture medium. For C2C12 cells, the medium used was differentiation medium DMEM (PAA) with 2 mM glutamine and supplemented with HS (Horse Serum, PAA) 2% (inactivated by heat). The culture of the cells was stopped at 48 h post-transfection, in the case of INS-1 and 6 days post-transfection and induction of differentiation process in the case of C2C12 cells for analyzing the samples.

    [0312] 3.6.4. Production, Purification and Titration of Adeno Associated Viral Vectors

    [0313] 3.6.4.1. Production and Purification

    [0314] Infective viral particles of AAV8 vectors were generated in HEK-293 cell cultures grown in Roller Bottles (RB) using a triple transfection protocol (Ayuso et al., 2010) which involves the use of three plasmids. This protocol is based on the precipitation of the virus using polyethylene glycol (PEG) and gradient ultracentrifugation with CsC1 that eliminates capsids content and lower protein impurities. The co-transfection of each RB (roller bottle) was carried out in 30 ml of calcium phosphate, 150 μg of plasmid DNA of interest (with the ITR sequences and the corresponding expression cassette), together with 150 μg of accessory plasmid rep2/cap8 (expression plasmid coding for the capsid proteins of the virus particles and for proteins necessary for viral replication, Plasmid Factory) and 150 μg of plasmid helper pWEAD (expression plasmid coding for necessary adenoviral proteins; Plasmid Factory).

    [0315] A total of 10 RB for each vector AAV8-CAG-IGF-1, AAV8-CAG-NULL and AAV8-CAG-IGF-1-dmiRT, and 20 RB for AAV8-CAG-GFP, were used for viral production. 48 h post-transfection, cells were collected and centrifuged at 2500×g for 10 min. The culture medium was stored at 4° C. The cell pellet was reconstituted in TMS (50 mM Tris-HCl, 150 mM NaCl, 2 mM MgCl.sub.2, pH 8.0) and was sonicated to lyse the cells and release the virus from the inside. The lysate was centrifuged for 30 min at 2500×g and the supernatant of this centrifugation was added to the culture medium previously stored at 4° C. Then the viral particles were precipitated by an incubation of 15 hours in PEG 8000 8% (Sigma) at 4° C. After that, vectors were precipitated by centrifugation at 4000×g for 30 min. This new precipitate, which contained viral vectors from the culture medium and from the cells, were reconstituted in TMS treated with benzonase (Merck) for 1 h at 37° C. and then centrifuged for 10 min at 10000×g. The resulting supernatant was loaded into 37.5 ml tubes Ultra clear (Beckman) containing a CsCl discontinuous gradient of density 1.5 (5 ml) and 1.3 g/ml (10 ml). Then, they were centrifuged for 17h at 27000 rpm in a SW28 rotor (Beckman). The virus bands were collected using 18G needles and were transferred to Ultra clear tubes of 12.5 ml. The remaining of the 12.5 ml was filled with CsCl to 1.379 g/ml to generate a continuous gradient. These tubes were centrifuged at 38000 rpm in a SW40Ti rotor (Beckman) for 48 h. Finally, the bands corresponding to the full virus were collected and dialyzed through a 10 kDa membrane (Slide-A-Lyzer Dialysis Products, Pierce) and then filtered through 0.22 μm filters (Millipore).

    [0316] 3.6.4.2. Titration of Viral Genomes

    [0317] The AAV8 viral genomes were determined by quantitative PCR (qPCR) adapting the protocol described by AAV2 and AAV8 Reference Standard Material (Lock et al., 2010) to vectors used in this study. Quantification of each vector was made in parallel with a reference vector of known concentration to ensure the validity of results. As a standard curve a linearized plasmid was used and quantified by measuring the absorbance at 260 nm. To ensure that the title of the viral vector will not be overestimated due to the presence in the final viral preparation of remaining DNA plasmids from the transfection, a DNAse treatment was performed prior to quantification. Only encapsidated genomes are resistant to digestion with DNase. 5 μl of each preparation of the viral vector in 5 μl of DNAse buffer 10× (130 mM Tris-HCl, 50 mM MgCl.sub.2, 1.2 mM CaCl.sub.2, pH 7.5), 1 μl of DNAse (10 U/mL) and 36 μl Milli-Q water. The digestion was incubated 60 min at 37° C. After digestion of the samples, they were diluted to obtain an amplification value within the range of standard curve. Each TaqMan qPCR reaction contained in a final volume of 10 TaqMan LightCycler® 480 Probe Master 5 Primer forward (10 μM) 0.2 μl, Primer reverse (10 μM) 0.2 μl, probe (10 μM) 0.1 μl, H.sub.2O Milli-Q 2 μl, diluted vector 2.5 μl. The reaction involved an initial incubation for 10 min at 95° C. (activation of the polymerase and denaturation of viral capsids, allowing the release of genomes) followed by 40 cycles of 30 s at 95° C. (denaturation) and 30 s at 60° C. (alignment and elongation). The primers used in the quantification of viral genomes of AAV hybridized to the common zone of the poly A (β-globin intron):

    TABLE-US-00005 Forward: (SEQ ID NO: 38) 5′CTT GAG CAT CTG ACT TCT GGC TAA T 3′ Reverse: (SEQ ID NO: 39) 5′GGA GAG GAG GAA AAA TCT GGC TAG 3′ Probe: (SEQ ID NO: 40) 5′CCG AGT GAG AGA CAC AAA AAA TTC CAA CAC 3′

    [0318] The viral title was the result of the median of three quantification performed on different days as identified in table 4.

    TABLE-US-00006 TABLE 4 viral titres Viral vector Titre (vg/ml) AAV8-CAG-GFP 8.7 × 10.sup.13 AAV8-CAG-NULL 1.4 × 10.sup.13 AAV8-CAG-IGF-1 9.8 × 10.sup.13 AAV8-CAG-IGF-1-dmiRT 1.3 × 10.sup.14

    [0319] 3.6.4.3. Quantification of Viral Particles by Silver Staining

    [0320] The analysis of the viral preparations by protein electrophoresis SDS-PAGE and subsequent staining with silver nitrate allows quantification of the viral capsids, which compared with the value of viral genomes obtained by qPCR allows to calculate the percentage of empty capsids in each preparation (ratio: viral particles/viral genomes). Moreover, this method allows display on the gel the degree of contamination of non-viral protein that could affect the transduction efficiency in vivo. The appropriate volumes of the vector of interest, of the vector reference (control also used in the quantification by qPCR) and of different dilutions of K208 vector (of known concentration and used as a standard curve) were mixed with the buffer 4× Novex® Tris-Glycine LDS Sample Buffer (Invitrogen) and 10× NuPAGE Sample Reducing Agent (Invitrogen) to a final volume of 20 μl. After 5 minutes of boiling, samples were loaded on a gel 10% Bis-Tris Gel 1.5 mm 15 well (Invitrogen) and ran to 120 V for 2 h. Proteins of the gel were fixed with a mixture of Milli-Q H.sub.2O/ethanol/acetic acid. Then the gel was sensitized with a mixture of Na.sub.2S.sub.2O.sub.3/sodium acetate/ethanol/H.sub.2O Milli-Q. Finally, the gel was stained with silver nitrate and the bands were revealed using a mixture of Na.sub.2CO.sub.3/Formaldehyde/Milli-Q H.sub.2O. The title of viral particles was obtained by densitometry. From the intensity of the VP3 of each dilution of vector K208 a standard curve was generated to quantify viral particles of different preparations.

    [0321] 3.6.4.4. Determination of Viral Genomes in Tissues by qPCR

    [0322] The final value of the number of viral genomes that have transduced a given cell is also representative of the transgene copy number per cell. The determination of viral genomes was obtained from the comparison of 20 ng of genomic DNA extracted from various tissues of mice with a calibration curve generated from linearized plasmid serial dilutions.

    [0323] 3.6.4.4.1.Generation of the Calibration Curve

    [0324] The calibration curve was generated with linearized plasmid DNA pAAV-CAG-GFP-WPRE. Therefore, knowing the concentration of the plasmid and the number of base pairs of the construct (7772 bp) the number of copies of transgene per μl was obtained. This plasmid DNA was serially diluted so as to achieve a calibration curve of logarithmic dilutions 10.sup.7:10.sup.6:10.sup.5:10.sup.4:10.sup.3:10.sup.2 copies of the transgene/μl.

    [0325] 3.6.4.4.2. Quantification of the Number of Copies of the Transgene by qPCR

    [0326] Once the calibration curve generated and samples diluted, a qPCR was performed for calculating the number of copies of the transgene. Each qPCR reaction (TaqMan LightCycler® 480 Probe Master, Roche) was performed in 20 μl final volume: TaqMan LightCycler® 480 Probe Master 10 Primer forward (10 μM) 1 μl, Primer reverse (10 μ.M) 1 probe (10 μM) 0.2 H.sub.2O Milli-Q 6.8 diluted vector 1 μl. The reaction involved an initial denaturation for 10 min at 95° C. and 45 cycles of 10 s at 95° C., alignment (30 s at 60° C.) and elongation (ls at 72° C.). The oligonucleotides used are the following:

    TABLE-US-00007 Forward: (SEQ ID NO: 41) 5′ CTT GAG CAT CTG ACT TCT GGC TAA T 3′ Reverse: (SEQ ID NO: 42) 5′ GGA GAG GAG GAA AAA TCT GGC TAG 3′ Probe: (SEQ ID NO: 43) 5′ CCG AGT GAG AGA CAC AAA AAA TTC CAA CAC 3′.

    [0327] The values obtained in the qPCR relative to the calibration curve, provided the number of copies of the transgene that was initially in 20 ng of total genomic DNA. Knowing that in mice, 20 ng of genomic DNA correspond to 3115.26 diploid cells, the number of copies of the transgene per diploid cell was obtained.

    TABLE-US-00008 TABLE 5 TaqMan reaction TaqMan Reaction Volume TaqMan LightCycler ® 480 Probe custom-characterMaster 10 μl Primer forward (10 μM) 1 μl Primer reverse (10 μM) 1 μl Sonda (10 μM) 0.2 μl H.sub.2O Milli-Q 6.8 μl Vector dilution 1 μl

    [0328] 3.6.4.5. In Vivo Injection of the Viral Vectors

    [0329] 3.6.4.5.1. Retrograde Administration Through Pancreatic Biliary Duct

    [0330] The retrograde injection via pancreatic biliary duct was conducted following the protocol described by Loiler and collaborators (Loiler et al., 2005) with minor modifications. The animals were anesthetized by an intraperitonial injection of ketamine (100 mg/kg) and xylacine (10 mg/kg). Once the zone shaved and an incision of 2-3 cm done, the abdomen was opening through an incision through the alba line, putting an abdominal separator. The bile duct was identified. Liver lobes were separated and the bile duct was clamped in the bifurcation of the hepatic tryad to prevent the spread of viral vector to the liver. Later, a 30G needle was introduced through the Vater papilla and retrogrally followed through biliary duct. The needle was fixed clamping the duct at the point of the intestine to secure its position and prevent the escape of viral vectors in the intestine . Slowly, a total volume of 100 μl was injected with the corresponding dose of viral vectors. 1 min after injection, the clip which fixed the needle was pulled from and a drop of surgical veterinary adhesive Histoacryl (Braun, TS1050044FP) was applied at the entry point of the needle. Approximately 2 min later the clip of the biliar duct was pulled from and the abdominal wall and skin were sutured. The mice were left to recover from anesthesia on a heating mantle to prevent heat loss.

    [0331] 3.6.4.5.2. Hydrodynamic Administration

    [0332] The hydrodynamic administration via tail vein was performed as previously described (Liu et al., 1999). The DNA plasmid was diluted in saline volume (ml) equal to ˜10% of the average body weight (g) of the animals and it was manually injected through the tail lateral vein in less than 5 seconds. Before injection, the animals were exposed to infrared light under a 250 W (Philips) for a few minutes to dilate blood vessels and facilitate the visualization and access to the vein of the tail. The animals were placed in a plastic restrainer (Harvard Apparatus) to immobilize them and to facilitate the injection. 30G needles (BD) were used. In general, the mice tolerated well the hydrodynamic injections. Immediately after injection the mice normally remained motionless and showed forced breath that persisted for a few minutes, reaction which is caused by the nature of the injection. Apart from these immediate effects due to the hydrodynamic injection, the animals did not suffer known consequences during treatment.

    [0333] 3.6.4.6. Isolation of Pancreatic Islets

    [0334] The pancreatic islets were extracted from pancreas digestion and subsequent isolation of pancreatic islets. In order to digest the pancreas, mice were sacrificed, the abdominal cavity was exposed and 3 ml of a solution of Liberase (Roche, 0104 mg/ml medium without serum M199 (Gibco-Life Technologies 10012-037)) was perfused to the pancreas via the common biliar duct. During perfusion, circulation through the Vatter ampoule was blocked by placing a clamp. Once perfused, the pancreas were isolated from the animal remained in a tube in gel before being digested at 37° C. for 19 min. To stop digestion and dilute the Liberase solution, 35 ml of cold medium M199 with 10% serum (Biowest S0250-500) were added and the tube stirred for 30 s to completely disintegrate the tissue. Then, two washes with 30 ml and 10 ml respectively of M199 medium supplemented with serum were done. Then, the solution of disintegrated tissue was filtered (450 mm PGI 34-1800-09) and collected into a new tube. The filtrate with 20 ml of medium with serum was centrifuged (Eppendorf 5810R rotor A-4 -62) at 200-230×g for 5 min at 4° C. The supernatant was discarded and after carefully removing all traces of the medium, the pellet was resuspended in 13 ml of Histopaque-1077 (Sigma 10771) and M199 medium without serum was added to a volume of 25 ml avoiding mixing the two phases. Then it was centrifuged (Eppendorf 5810R) at 1000×g for 24 min at 4° C. to obtain the pancreatic islets at the interface between the medium and the Histopaque and thus, they were collected with the pipette. Once isolated, the islets were washed twice with 40 ml of medium with serum and centrifuged at 1400 rpm, 2.5 min at room temperature. In the final wash the pellet with islets was resuspended in 15 ml of M199 medium. In this step, and to help their identification under the microscope, the islets were stained by adding a solution of 200 μl Dithizone to the medium (for 10 ml volume: 30 mg Dithizone (Fluka 43820), 9 ml absolute EtOH, 150 μl NH.sub.4OH and 850 μl H.sub.2O). After 5 min of incubation, islets were transferred to a petri dish to be caught under the binocular microscope.

    [0335] Once islets recovered, they were centrifuged at 300×g, 5 min and 4° C. to remove the remains of medium, and were processed to RNA extraction.

    [0336] 3.6.5. Analysis of the mRNA Expression by qPCR

    [0337] 3.6.5.1. Total RNA Extraction

    [0338] The tissue samples to obtain total RNA were obtained from freshly sacrificed animals and were quickly frozen in liquid nitrogen. Frozen tissues were homogenized (Polytron® MICCRA D-KIT-9 Prozess ART & Labortechnik GmbH & Co. KG, Mullheim, Germany) in 1 ml solution TriPure Isolation Reagent (Roche, 11667), and following the protocol of RNA purification in column RNeasy Mini Kit de QIAGEN (Cat.No.74104, QIAGEN, Invitrogen), total RNA was obtained. All samples were treated with DNasel purification columns (RNase-Free DNase Set supplied with the columns, Qiagen) and after removing the enzyme with the buffer supplied by the manufactured, the RNA was eluted in 30 μl of distilled water free of RNases (DEPC). Finally, the concentration of RNA obtained was determined using a device Nanodrop (ND-1000, ThermoCientific).

    [0339] 3.6.5.2. RNA Extraction from Pancreatic Islets

    [0340] The obtention of RNA from pancreatic islets was performed by adding 1 ml of the solution TriPure Isolation Reagent (Roche, 11667) to resuspend the islets and following the commercial protocol of RNA purification in column RNeasy Micro Kit by QIAGEN (Cat.No.74004, QIAGEN, Invitrogen). The RNA was finally eluted in a volume of 14 μl of water free of RNases. The concentration and purity of the obtained RNA was determined using a device Nanodrop (ND-1000, ThermoCientific).

    [0341] 3.6.5.3. cDNA Synthesis

    [0342] One μg of total RNA was retrotranscripted to cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche) following the manufacturer's instructions. Oligo-dT and random hexamer oligonucleotides were used as primers in the reaction with the presence of RNA inhibitor.

    [0343] 3.6.5.4. Quantitative PCR

    [0344] The qPCR was done in LightCycler® 480 (Roche) using LightCycler® 480 SYBR Green I Master (Roche). The following table 6 shows the different primers of mouse (m) or rat (r) used in qPCR:

    TABLE-US-00009 TABLE 6 primers used in qPCR Forward sequence Reverse sequence Gene (5′-3′) (5′-3′) mIGF-1a TGGATGCTCTTCAGTTCGTGT CAACACTCATCCACAATGCCT mCc13 (Mip-1α) GCAACCAAGTCTTCTCAGCG AGCAAAGGCTGCTGGTTTCA mCc14 (Mip-1β) CCATGAAGCTCTGCGTGTCT GAGAAACAGCAGGAAGTGGGA mCxcl9 (MIG) CGAGGCACGATCCACTACAA AGTCCGGATCTAGGCAGGTT mCxcl10 (IP-10) CCAAGTGCTGCCGTCATTTT AGCTTCCCTATGGCCCTCAT mCc15 (RANTES) GTGCCCACGTCAAGGAGTATT CCCACTTCTTCTCTGGGTTGG mCCL2 (MCP-1) ATGCAGTTAACGCCCCACTC GCTTCTTTGGGACACCTGCT mIFN-γ AGACAATCAGGCCATCAGCA TGGACCTGTGGGTTGTTGAC mTNF-α TCTTCTCATTCCTGCTTGTGG GGTCTGGGCCATAGAACTGA mIL-1β TGCCACCTTTTGACAGTGATG TGATGTGCTGCTGCGAGATT mH2-Aa CTCTGATTCTGGGGGTCCT ACCATAGGTGCCTACGTGGT mβ2-microglobulin CCGGAGAATGGGAAGC GTAGACGGTCTTGGGC mCD80 (B7.1) ATACGACTCGCAACCACACC GAATCCTGCCCCAAAGAGCA mCD86 (B7.2) GCTTCAGTTACTGTGGCCCT TGTCAGCGTTACTATCCCGC mSlc7a1 AAA CAC CCG TAA TCG CCA CT GGC TGG TAC CGT AAG ACC AA mCcng1 TGA CTG CAA GAT TAC GGG ACT CCC AAG ATG CTT CGC CTG TA mGys1 CCG CTA ACT CTA CCG GTC AC CCC CAT TCA TCC CCT GTC AC mAldoA GCG TTC GCT CCT TAG TCC TT AAT GCA GGG ATT CAC ACG GT mRplp0 TCCCACCTTGTCTCCAGTCT ACTGGTCTAGGACCCGAGAAG rRplp0 GATGCCCAGGGAAGACAG CACAATGAAGCATTTTGGGTAG (identified as SEQ ID NO: 53-92)

    [0345] Each qPCR reaction contained 20 μl of total volume: SYBR Green LightCycler® 480 Probe Master 10 μl, Primer forward (10 μM) 0.4 .sub.11.1, Primer reverse (10 μM) 0.4 μl, H.sub.2O Milli-Q 7.2 μl, cDNA (dil.1/10) 2 μl. The reaction consisted of 5 min at 95° C. for initial denaturation and 45 cycles of four phases: denaturation (10 s at 95° C.), alignment (10 s at 60° C.), elongation (10 s at 72° C.) and 30 s at 60° C. Before cooling the reaction to 4° C., it was kept 5 s at 95 C and 1 min at 65° C. to determine the melting temperature. The method delta-delta-Ct (2-ΔΔCt) described by Livak (Livak and Schmittgen 2001) was used to quantify the relative expression of genes of interest.

    [0346] 3.6.6. Analysis of miRNA expression by qPCR

    [0347] 3.6.6.1. miRNA Extraction from Tissues

    [0348] Tissues were mecanically disintegrated with a polytron (Polytron® MICCRA-KIT D-9, ART Prozess & Labortechnik GmbH & Co. KG, Mullheim, Germany) with a lysis solution following the manufacturer's instructions of the comercial kit miRVana™ miRNA Isolation Kit (Ambion by Life Technologies, Madrid, Spain).

    [0349] 3.6.6.2. cDNA Synthesis

    [0350] The obtained miRNA were diluted to a concentration of 5 ng/μl, from which 2 μl were retrotranscripted into cDNA using miRCURY LNA™ Universal RT microRNA PCR—Universal cDNA synthesis kit II (Exiqon, Vedbaek, Denmark) following manufacturer's instructions.

    [0351] 3.6.6.3. Quantitative PCR

    [0352] Differently to the aforementioned quantitative PCR mRNA method, for the miRNA, ExilLENT SYBR® Green Master mix (Exiqon, Vedbaek, Denmark) was used following the manufacturer's instructions. Each qPCR reaction contained 10 mL total volume: PCR Master mix 5 μl, Primer mix 1 μl, cDNA (dil. 1/80) 4 μl. The results of Ct were processed as explained in section 7.4, but in this case a different housekeeping gene, the U6, was used.

    [0353] 3.6.7. Determination of Serum Parameters

    [0354] Serum was obtained from blood samples obtained from the tail vein, or after the decapitation of mice in studies to final time. In both cases, blood was collected in heparine tubes and was kept for 1 h at 4° C. Later, it was centrifuged for 10 min at 4° C. 12000xg to obtain the serum, which was kept frozen at −80° C. until the time of the determination of different parameters.

    [0355] 3.6.7.1. Glucose

    [0356] Serum glucose levels were determined from a drop of blood (5 μl) from the tail of mice, through the system Glucometer Elite™ (Bayer Leverkusen, Germany). An animal was considered as diabetic, with two consecutive measurements of a glycemia ≥250 mg/dl.

    [0357] 3.6.7.2. Insulin

    [0358] The circulating insulin levels were determined from 100 μl of serum by radioimmunoassay (RIA) using the Rat Insulin kit (Millipore) following the manufacturer's instructions. Mouse Insulin has a cross-reactivity of 100% compared to the one of rat.

    [0359] 3.6.7.3. IGF-1

    [0360] Circulating IGF-1 levels were determined from 10 μl of serum using a commercial ELISA kit for mouse/rat IGF-1 (AC-18F1, Novozymes, Denmark) and following the manufacturer instructions. The detection limit of the kit is 63 ng/ml.

    [0361] 3.6.7.4. Cholesterol

    [0362] Total cholesterol in serum was quantified spectrophotometrically using an enzymatic assay kit (Horiba-ABX, Montpellier, France) and determined by Pentra 400 Analyzer (Horiba-ABX).

    [0363] 3.6.8. Immunohistochemical Analysis of the Tissues

    [0364] Tissues were fixed with a buffered solution of formalin 10% for 24 h at 4° C., they were included in paraffin blocks (inclusor type Histokinette) and sections were obtained (2-3 p.m) with the help of a microtome (RM2135, Leica Biosystems, Barcelona). Subsequently, tissue sections were deparaffined (2 washes with xylol 10 min, 2 washes with 100% ethanol 5 min and 2 washes with 96% ethanol 5 min) and proceeded to the stain. The sections were incubated O/N at 4° C. with primary antibodies (see section 3.3.), three washes of 5 min with PBS were done, and then incubated with the corresponding secondary antibody (see section 3.3) for lh at room temperature. For fluorescence immunohistochemistry, sections were subsequently incubated with streptavidin conjugated with fluorophores. For immunohistochemistry in light field, they were revealed with diaminobenzidine (DAB) (see section 3.3.). The images were obtained with an Eclipse 90i microscope (Nikon Instruments Inc., Tokyo, Japan). The program Nis Elements Advanced Research 2:20 was used to quantify the marked areas.

    [0365] 3.6.9. Determination of Beta-Cell Mass

    [0366] Beta cell mass was calculated by multiplying the total weight of the pancreas by the percentage of the beta cell area. The beta cell area of the pancreas was calculated from three sections separated 200 μm and immunostaining against insulin by dividing the area of all insulin positive cells in each section between the total area of the corresponding section.

    [0367] 3.6.10. Determination of the Degree of Insulitis

    [0368] The incidence and severity of insulitis was analyzed in 3 pancreatic paraffin sections, each separately 100-150 microns and immunostained against insulin. The degree of insulitis (lymphocyte infiltration) in the pancreatic islets was determined according to the following classification criteria: no infiltration (0%), periinsulitis (mononuclear cells surrounding ducts and islets, but without major infiltration of the architecture of the islet, <25%); moderate insulitis (mononuclear cell infiltrate <50% of the surface of the islet); severe insulitis (>50% of the area of the islet infiltrated by lymphocytes and/or loss of islet architecture).

    [0369] 3.6.11. Statistical Analysis

    [0370] Results were expressed as mean±standard error of the mean (SEM). Comparison of the results was performed using the Student t test of impaired data or through the table ANOVA of two factors. The differences were considered statistically significant with */190 p<0.05, **/##p<0.01 and ***/###p<0.001.

    TABLE-US-00010 TABLE 7 list of SEQ ID Nos identified in the sequence listing SEQ ID NO Type of sequence 1 Murine nucleic acid coding for IGF-1a (SEQ ID NO: 28) 2 Murine nucleic acid coding for IGF-1b (SEQ ID NO: 29) 3 Human nucleic acid coding for IGF-1a (SEQ ID NO: 23) 4 Human nucleic acid coding for IGF-1b (SEQ ID NO: 24) 5 Human nucleic acid coding for IGF-1c/MGF (SEQ ID NO: 25) 6 Human nucleic acid coding for IGF-1c/MGF (SEQ ID NO: 26) 7 Human nucleic acid (SEQ ID NO: 27)  8-22 Nucleic acid sequences target for a given miRNA 23 Human protein IGF-1a (isoform 2) 24 Human protein IGF-1b (isoform 3) 25 Human protein IGF-1c/MGF (isoform 1) 26 Human protein IGF-1c/MGF (isoform 4) 27 Human protein IGF-1 (isoform XI) 28 Murine protein IGF-1a (isoform 5) 29 Murine protein IGF-1b 30 pAAV-CAG-preproIGF-1a-doble-miRT122a-miRT1 (SEQ ID NO: 28) 31 pAAV-CAG-preproIGF-1b-doble-miRT122a-miRT1 (SEQ ID NO: 29) 32 pAAV-CAG-GFP 33 pAAV-CAG-IGF-1 34 pAAV-CAG-NULL 35-43 primers 44 Murine protein IGF-1b/MGF (variant 1) 45 Murine protein IGF-1 (variant 2) 46 Murine protein IGF-1b/MGF (variant 3) 47 Murine protein IGF-1a (variant 4) 48 Murine nucleic acid coding for IGF-1b/MGF (SEQ ID NO: 44) 49 Murine nucleic acid coding for IGF-1 (SEQ ID NO: 45) 50 Murine nucleic acid coding for IGF-1b (SEQ ID NO: 46) 51 Murine nucleic acid coding for IGF-1a (SEQ ID NO: 47) 52 CAG promoter 53-92 primers 93-95 Nucleic acid sequences target for a given miRNA 96 Expression cassette of SEQ ID NO: 30 97 Viral vector of SEQ ID NO: 30 98 Expression cassette of SEQ ID NO: 31 99 Viral vector of SEQ ID NO: 31

    BIBLIOGRAPHIC REFERENCES

    [0371] Agudo, J., Ayuso, E., Jimenez, V., Salavert, A., Casellas, A., Tafuro, S., Haurigot, V., Ruberte, J., Segovia, J. C., Bueren, J., et al. (2008). IGF-I mediates regeneration of endocrine pancreas by increasing beta cell replication through cell cycle protein modulation in mice. Diabetologia 51, 1862-1872.

    [0372] Alexopoulou, A. N., Couchman, J. R., and Whiteford, J. R. (2008). The CMV early enhancer/chicken beta actin (CAG) promoter can be used to drive transgene expression during the differentiation of murine embryonic stem cells into vascular progenitors. BMC Cell Biol. 9, 2.

    [0373] Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389-3402.

    [0374] American Diabetes Association (2010). Diagnosis and Classification of Diabetes Mellitus, Diabetes Care, vol. 33, Suppl. S62-69.

    [0375] American Diabetes Association (2014). Diagnosis and classification of diabetes mellitus. Diabetes Care 37 Suppl 1, S81-S90.

    [0376] Anguela, X. M., Tafuro, S., Roca, C., Callejas, D., Agudo, J., Obach, M., Ribera, A., Ruzo, A., Mann, C. J., Casellas, A., et al. (2013). Nonviral-mediated hepatic expression of IGF-I increases Treg levels and suppresses autoimmune diabetes in mice. Diabetes 62, 551-560.

    [0377] Ayuso, E., Mingozzi, F., and Bosch, F. (2010). Production, purification and characterization of adeno-associated vectors. Curr. Gene Ther. 10, 423-436.

    [0378] Bartel, D. P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.

    [0379] Bergerot, I., Fabien, N., Maguer, V., and Thivolet, C. (1995). Insulin-like growth factor-1 (IGF-1) protects NOD mice from insulitis and diabetes. Clin. Exp. Immunol. 102, 335-340.

    [0380] Bergerot, I., Fabien, N., and Thivolet, C. (1996). Effects of insulin like growth factor-1 and insulin on effector T cells generating autoimmune diabetes. Diabetes Metab. 22, 235-239.

    [0381] Birnboim, H. C., and Doly, J. (1979). A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7,1513-1523.

    [0382] Brown, B. D., and Naldini, L. (2009). Exploiting and antagonizing microRNA regulation for therapeutic and experimental applications. Nat. Rev. Genet. 10,578-585.

    [0383] Carter, P. J., and Samulski, R. J. (2000). Adeno-associated viral vectors as gene delivery vehicles. Int. J. Mol. Med. 6,17-27.

    [0384] Casellas, A., Salavert, A., Agudo, J., Ayuso, E., Jimenez, V., Moya, M., Munoz, S., Franckhauser, S., and Bosch, F. (2006). Expression of IGF-I in pancreatic islets prevents lymphocytic infiltration and protects mice from type 1 diabetes. Diabetes 55, 3246-3255.

    [0385] Cheetham, T. D., Holly, J. M., Clayton, K., Cwyfan-Hughes, S., and Dunger, D. B. (1995). The effects of repeated daily recombinant human insulin-like growth factor I administration in adolescents with type 1 diabetes. Diabet. Med. 12,885-892.

    [0386] Chen, S., Ding, J., Bekeredjian, R., Yang, B., Shohet, R. V, Johnston, S. A., . . . Grayburn, P. A. (2006). Efficient gene delivery to pancreatic islets with ultrasonic microbubble destruction technology. Proceedings of the National Academy of Sciences of the United States of America, 103(22), 8469-74.

    [0387] Ebert, M. S., Neilson, J. R., and Sharp, P. A. (2007). MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Nat. Methods 4,721-726.

    [0388] Esau, C., Davis, S., Murray, S. F., Yu, X. X., Pandey, S. K., Pear, M., Watts, L., Booten, S. L., Graham, M., McKay, R., et al. (2006). miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. Cell Metab. 3,87-98.

    [0389] Gao, G., Vandenberghe, L. H., Alvira, M. R., Lu, Y., Calcedo, R., Zhou, X., and Wilson, J. M. (2004). Clades of Adeno-associated viruses are widely disseminated in human tissues. J. Virol. 78,6381-6388.

    [0390] Geisler, A., Jungmann, A., Kurreck, J., Poller, W., Katus, H. A., Vetter, R., . . . Muller, O. J. (2011). microRNA122-regulated transgene expression increases specificity of cardiac gene transfer upon intravenous delivery of AAV9 vectors. Gene Therapy, 18(2), 199-209.

    [0391] George, M., Ayuso, E., Casellas, A., Costa, C., Devedjian, J. C., and Bosch, F. (2002). Beta cell expression of IGF-I leads to recovery from type 1 diabetes. J. Clin. Invest. 109, 1153-1163.

    [0392] Hendrick, L. M., Harewood, G. C., Patchett, S. E., and Murray, F. E. (2011). Utilization of resource leveling to optimize ERCP efficiency. Ir. J. Med. Sci. 180, 143-148.

    [0393] Hill, D. J., and Hogg, J. (1992). Expression of insulin-like growth factors (IGFs) and their binding proteins (IGF BPs) during pancreatic development in rat, and modulation of IGF actions on rat islet DNA synthesis by IGF BPs. Adv. Exp. Med. Biol. 321, 113-120; discussion 121-122.

    [0394] Jabri, N., Schalch, D. S., Schwartz, S. L., Fischer, J. S., Kipnes, M. S., Radnik, B. J., Turman, N. J., Marcsisin, V.S ., and Guler, H. P. (1994). Adverse effects of recombinant human insulin-like growth factor I in obese insulin-resistant type II diabetic patients. Diabetes 43, 369-374.

    [0395] Jimenez, V., Ayuso, E., Mallol, C., Agudo, J., Casellas, A., Obach, M., Munoz, S., Salavert, A., and Bosch, F. (2011). In vivo genetic engineering of murine pancreatic beta cells mediated by single-stranded adeno-associated viral vectors of serotypes 6, 8 and 9. Diabetologia 54, 1075-1086.

    [0396] Jimenez, V., Munoz, S., Casana, E., Mallol, C., Elias, I., Jambrina, C., Ribera, A., Ferre, T., Franckhauser, S., and Bosch, F. (2013). In vivo adeno-associated viral vector-mediated genetic engineering of white and brown adipose tissue in adult mice. Diabetes 62, 4012-4022.

    [0397] Kaino, Y., Hirai, H., Ito, T., and Kida, K. (1996). Insulin-like growth factor I (IGF-I) delays the onset of diabetes in non-obese diabetic (NOD) mice. Diabetes Res. Clin. Pract. 34, 7-11.

    [0398] Kang, W. J., Cho, Y. L., Chae, J. R., Lee, J. D., Ali, B. A., Al-Khedhairy, A. A., . . .

    [0399] Kim, S. (2012). Dual optical biosensors for imaging microRNA-1 during myogenesis. Biomaterials, 33(27), 6430-7.

    [0400] Kulkarni, R. N., Holzenberger, M., Shih, D. Q., Ozcan, U., Stoffel, M., Magnuson, M. A., and Kahn, C. R. (2002). beta-cell-specific deletion of the Igf1 receptor leads to hyperinsulinemia and glucose intolerance but does not alter beta-cell mass. Nat. Genet.

    [0401] 31,111-115.

    [0402] Liu, F., Song, Y., and Liu, D. (1999). Hydrodynamics-based transfection in animals by systemic administration of plasmid DNA. Gene Ther. 6,1258-1266.

    [0403] Livak, K. J., and Schmittgen, T.D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408.

    [0404] Lock, M., McGorray, S., Auricchio, A., Ayuso, E., Beecham, E. J., Blouin-Tavel, V., Bosch, F., Bose, M., Byrne, B. J., Caton, T., et al. (2010). Characterization of a recombinant adeno-associated virus type 2 Reference Standard Material. Hum. Gene Ther. 21,1273-1285.

    [0405] Loiler, S. A., Tang, Q., Clarke, T., Campbell-Thompson, M. L., Chiodo, V., Hauswirth, W., Cruz, P., Perret-Gentil, M., Atkinson, M. A., Ramiya, V. K., et al. (2005). Localized gene expression following administration of adeno-associated viral vectors via pancreatic ducts. Mol. Ther. 12,519-527.

    [0406] Lu, Y., Herrera, P. L., Guo, Y., Sun, D., Tang, Z., LeRoith, D., and Liu, J.-L. (2004). Pancreatic-specific inactivation of IGF-I gene causes enlarged pancreatic islets and significant resistance to diabetes. Diabetes 53,3131-3141.

    [0407] Mingozzi F, High K A. Therapeutic in vivo gene transfer for genetic disease using AAV: progress and challenges. Nat Rev Genet. 2011 May;12(5):341-55.

    [0408] Pescovitz, M. D., Greenbaum, C. J., Bundy, B., Becker, D. J ., Gitelman, S. E., Goland, R., Gottlieb, P. A., Marks, J. B., Moran, A., Raskin, P., et al. (2014). B-lymphocyte depletion with rituximab and β-cell function: two-year results. Diabetes Care 37,453-459.

    [0409] Rehman, K. K., Wang, Z., Bottino, R., Balamurugan, A. N., Trucco, M., Li, J., . . . Robbins, P. D. (2005). Efficient gene delivery to human and rodent islets with double-stranded (ds) AAV-based vectors. Gene Therapy, 12(17), 1313-23.

    [0410] Savage, M. O., Camacho-Hübner, C., and Dunger, D. B. (2004). Therapeutic applications of the insulin-like growth factors. Growth Horm. IGF Res. 14,301-308.

    [0411] Sherry, N., Hagopian, W., Ludvigsson, J., Jain, S. M., Wahlen, J., Ferry, R. J., Bode, B., Aronoff, S., Holland, C., Carlin, D., et al. (2011). Teplizumab for treatment of type 1 diabetes (Protégé study): 1-year results from a randomised, placebo-controlled trial. Lancet 378,487-497.

    [0412] Smith, T. J. (2010). Insulin-like growth factor-I regulation of immune function: a potential therapeutic target in autoimmune diseases? Pharmacol. Rev. 62,199-236.

    [0413] Tsai, W.-C., Hsu, S.-D., Hsu, C.-S., Lai, T.-C., Chen, S.-J., Shen, R., Huang, Y., Chen, H.-C., Lee, C.-H., Tsai, T.-F., et al. (2012). MicroRNA-122 plays a critical role in liver homeostasis and hepatocarcinogenesis. J. Clin. Invest. 122,2884-2897.