METHOD AND KIT FOR THE IDENTIFICATION OF VACCINIUM MYRTILLUS
20220186326 · 2022-06-16
Inventors
Cpc classification
International classification
Abstract
Disclosed is a method for the identification of Vaccinium myrtillus in a botanical composition and a kit specifically designed for its implementation. The method is based on the detection, using PCR amplification, of nucleic acid fragments within a genomic region of Vaccinium myrtillus.
Claims
1. A method for the identification of Vaccinium myrtillus in a botanical composition, which comprises detecting from a sample thereof, by means of PCR-amplification, a V. myrtillus nucleic acid fragment located within the internal transcribed spacer 1, 5.8S ribosomal RNA genomic region and the internal transcribed spacer 2, said method comprising: (a) isolating nucleic acids from said sample; (b) conducting a real-time PCR on the isolated nucleic acid, using: a set of primers selected from the group consisting of: (i) SEQ ID NO:5 and SEQ ID NO:6; (ii) SEQ ID NO:7 and SEQ ID NO:8; (iii) SEQ ID NO:9 and SEQ ID NO:10; (iv) SEQ ID NO:11 and SEQ ID NO:12; and a probe annealing within the nucleic acid region amplified by the primers, said probe consisting of the sequence SEQ ID NO:13; (c) determining the presence of the amplification product, whereby the detection of the amplification product is indicative of the presence of Vaccinium myrtillus in the botanical composition.
2. The method of claim 1, wherein the set of primers (i) is used in step (b).
3. The method of claim 1, wherein said rt-PCR is conducted under the following conditions: initial denaturation step at 95° C. for 180 sec; 2-step cycles of 15 sec at 95° C. (1st step) and 15 sec at 62-68.5° C. (2nd step) repeated 40 to 50 times.
4. The method of claim 1, wherein the botanical composition is a plant extract.
5. A kit for the identification of Vaccinium myrtillus in a botanical composition, comprising a set of primers selected from the group consisting of: (i) SEQ ID NO:5 and SEQ ID NO:6; (ii) SEQ ID NO:7 and SEQ ID NO:8; (iii) SEQ ID NO:9 and SEQ ID NO:10; (iv) SEQ ID NO:11 and SEQ ID NO:12; and a probe consisting of the sequence SEQ ID NO:13.
6. The kit of claim 5, further comprising a DNA polymerase, a mixture of deoxynucleotides (dNTP), buffer solutions.
7. The kit of 5, further comprising, in separate containers, a sample of Vaccinium myrtillus nucleic acid suitable for use as positive control and nuclease-free water or buffer solution as negative control.
8. The method of claim 2, wherein said rt-PCR is conducted under the following conditions: initial denaturation step at 95° C. for 180 sec; 2-step cycles of 15 sec at 95° C. (1st step) and 15 sec at 62-68.5° C. (2nd step) repeated 40 to 50 times.
9. The method of claim 2, wherein the botanical composition is a plant extract.
10. The method of claim 2, wherein the botanical composition is a plant extract.
11. The method of claim 8, wherein the botanical composition is a plant extract.
12. The kit of 6, further comprising, in separate containers, a sample of Vaccinium myrtillus nucleic acid suitable for use as positive control and nuclease-free water or buffer solution as negative control.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
DESCRIPTION OF THE PREFERRED EMBODIMENTS
Experimental Section—General Procedures
[0056] Extraction of Genomic DNA (gDNA)
[0057] The DNA extraction was performed by using the NucleoSpin® plant II protocol as described by the supplier (Macherey nagel. Cat. 740770.250—July 2014/Rev. 09).
[0058] Purification of Residual DNA from the Dry Extract.
[0059] The first purification was done by using the kit NucleoSpin® plant II Maxi protocol as described by the supplier (Macherey nagel. Cat. 740770.250—July 2014/Rev. 09), with some modification reported below. [0060] Weigh 3-5 g of dry extract in a 50 ml conical tube [0061] Add 3 ml of distilled water [0062] Add 9 ml of lysis buffer [0063] Vortex for 30 sec [0064] Transfer the sample to a NucleoSpin® Filter Maxi [0065] Centrifuge 5 min at 4500× g, collect the clear flow-through and discard the NucleoSpin Filter Maxi [0066] Add 20 ml binding buffer [0067] Vortex for 30 sec. [0068] Load sample on a NucleoSpin® Plant II Maxi Column [0069] Centrifuge for 3 min at 4500× g and discard the flow-through. [0070] Repeat the loading for all the resting sample [0071] Add 4 ml wash buffer (PW1) to the NucleoSpin® Plant II Maxi Column [0072] Centrifuge for 3 min at 4500× g and discard the flow-through. [0073] Add 10 ml wash buffer (PW2) to the NucleoSpin® Plant II Maxi Column [0074] Centrifuge for 3 min at 4500× g and discard the flow-through. [0075] Add 2 ml wash buffer (PW2) to the NucleoSpin® Plant II Maxi Column [0076] Centrifuge for 12 min at 4500× g and discard the flow-through. [0077] Place the NucleoSpin® Plant II Maxi Column into a new collection tube (50 ml) [0078] Pipette 1000 μl elution buffer (PE) (65° C.) onto the membrane. [0079] Incubate the NucleoSpin® Plant II Maxi Column for 5 min at 65° C. [0080] Centrifuge for 3 min at 4500× g to elute the DNA
[0081] The second purification was done by using the kit ReliaPrep™ DNA Clean-UP and Concentration System protocol as described by the supplier (Promega. Cat. A2893).
[0082] Quantification of DNA
[0083] The DNA was quantified through the NanoQuant Plate™ instrument. The quantification was performed by using the UV-method. The 260 nm absorbance was used to quantify the DNA as 1 OD at 260 nm correspond to 50 μg/μl of DNA. The 260 nm/280 nm absorbance ratio was determined for the assessment of DNA purity.
[0084] rt-PCR and Melt Curve Analysis
[0085] The rt-PCR amplification was performed by using the SYBR Green or probe based chemistry as described by the supplier (SsoAdvanced™ Universal SYBR® Green Supermix, BioRad Cat. N. 1725272; SsoAdvanced™ Universal Probes Supermix, BioRad Cat. N. 1725281), with 3-step based amplification protocol, as reported in
[0086] Real-Time PCR
[0087] Prepare the mix as follos, final volume 20 μl:
TABLE-US-00001 Probe Mastermix (BioRad or equivalent) 2X 10 μl Primer F 10 μM 0.5 μl Primer R 10 μM 0.5 μl Probe M-FAM 10 μM 0.5 μl DNA 0.5-30 ng/μl 2 μl Nuclease-free water 6.5 μl
[0088] Load the sample in a real-time instrument (BioRad or equivalent) and set the following method:
TABLE-US-00002 95° C. 180 sec 95° C. 15 sec 50 X 62 C.-68.5° C. 15 sec
[0089] Acquisition after the second step of cycling.
[0090] DNA Sequencing
[0091] The amplified DNA was purified on agarose gel and the purified fragment was sequenced through the generation of two sequences for each sample: one is generated by using forward primer and the other one by using reverse primer. Each sequencing tube was prepared by mixing the purified DNA and TRIS-HCl 5 mM pH 8.0 in order to obtain the concentration requested for the sequencing (depending on the length of the sequence, 2-5 ng/μL).
[0092] The sequences were analysed by using BioEdit or BLAST software in order to compare and identify the sequences.
EXAMPLES
Example 1—Method Validation
[0093] The gDNA was purified and quantified (Table 1) for the Vaccinium myrtillus frozen fruit and its contaminant/related species hereafter reported:
TABLE-US-00003 TABLE 1 Quantification of gDNA extracted for all species tested in the present report. DNA Ratio Ref. QdL (ng/μl) (260/280) Vaccinium myrtillus 1072/10/12 7.9 1.61 Empetrum nigrum 1072/10/6 29 2.07 Sambucus nigra 1072/10/4 12 2 Vaccinium macrocarpon 1072/10/7 3.4 2.83 Vaccinium oxycoccos 1072/10/1 6.9 1.25 Vaccinium corymbosum 1072/10/3 10.2 1.23
[0094] The set-up of rt-PCR reaction parameters, in terms of Cq (quantification cycle) and Tm (melt temperature) peak, were initially evaluated by using the gDNA extracted from Vaccinium myrtillus frozen fruit (
TABLE-US-00004 TABLE 2 Tm Amplicon Region Name Sequence (5′-3′) (° C.) (bp) Large sequence Vac-ex_LF CCATCGAGTCTTTGAACGCA 57.3 275 (L) Vac-ex_LR CACTTCAGGGTCAAATGGGC 59.4 Small sequence Vac-ex_sF GCATTGCGTCACCCACTC 58.2 131 (S) Vac-ex_sR ACTTGTCGTTGAATGTCCGT 57.3 CA Large sequence Frw_Large TTGCAGAATCCCGTGAACCA 57.3 230 2 2 (L2) Rev_Small TTTAGCAACCACCACTTGTC 58.4 2 GT Small sequence Frw_Small TGAAGGCACGTCTGCCTG 58.2 162 2 2 (S2) Rev_Small TTTAGCAACCACCACTTGTC 58.4 2 GT
TABLE-US-00005 TABLE 3 Primer set Sample Cq Cq Mean Cq Std. Dev L2 1072/10/12 25.61 25.37 0.212 25.28 25.21 S2 1072/10/12 26.17 25.89 0.247 25.70 25.80 L 1072/10/12 24.88 25.11 0.203 25.20 25.25 S 1072/10/12 25.97 26.15 0.166 26.19 26.29
[0095] The rt-PCR was also performed with DNA isolated from V. myrtillus contaminant/related species and the results showed that it is possible to distinguish the different DNA by using the primer sets and particularly the small 2 primers (Table 4).
TABLE-US-00006 TABLE 4 melt curve peak results Sample Large2 Small2 Large Small V. myrtillus 90.50 90.50 90.50 89.50 E. nigrum 88.50 88.00 90.50 89.00/89.50 S. nigra 88.50 87.50 89.50 87.50 V. oxycoccos 91.00 91.00 91.00 89.50/90.00 V. corymbosum 89.00 89.00 89.00 88.00 V. macrocarpon 91.50 91.50 91.00 90.50
[0096] The linearity of the amplification curve was also evaluated with the standard curve PP-6T generation for Vaccinium myrtillus by using the small 2 primer set (
[0097] In order to improve the method capability to distinguish between Vaccinium myrtillus and contaminant/related species, the rtPCR was conducted with the Minor Groove Binding-Probe (M-FAM-SEQ ID NO: 13) specifically designed to enable the amplification of V. myrtillus sequences.
[0098] In a comparative experiment, the rtPCR was conducted with simultaneous use of the Minor Groove Binding-Probes SEQ ID NO:13 (M-FAM) and SEQ ID NO:14 (E-HEX).
[0099] To test the probe-based method different subsets of experiments have been carried out, summarized in the table below.
TABLE-US-00007 TABLE 5 Probe Sample Expected result Result M- V. myrtillus Amplification of FIG. 4 FAM E. nigrum V. myrtillus S. nigra V. oxycoccos V. corymbosum V. macrocarpon M- V. myrtillus 100% No Amplification FIG. 5(a) FAM E. nigrum 100% Amplification V. myrtillus 95% Proportional E. nigrum 5% amplification with V. myrtillus 98% the percentage of E. nigrum 2% V. myrtillus V. myrtillus 99% E. nigrum 1% E- V. myrtillus 100% No Amplification FIG. 5(b) HEX E. nigrum 100% Amplification V. myrtillus 95% Proportional E. nigrum 5% amplification with V. myrtillus 98% the percentage of E. nigrum 2% E. nigrum V. myrtillus 99% E. nigrum 1%
[0100] The amplification results were proportional to the content of the target species (
Example 2—Vaccinium myrtillus Dry-Extract Residual DNA Identification
[0101] For each sample, two independent isolations of residual DNA were performed (biological replicates) and for each extracted DNA three technical replicates were tested,
[0102] The whole procedure was initially performed on four samples: 32549/H76, 32549/1H80, 32549/1H83, 32549/1H84. After the residual DNA isolation and quantification (Table 6), these samples were analysed for their rt-PCR amplification characteristics (Cq and Tm) compared with that of positive control (
TABLE-US-00008 TABLE 6 Residual DNA quantification Biological DNA Ratio Sample replicate (ng/μL) (260/280) 32549/H76 1 0 3.5 2 1 1.25 32549/H80 1 0 0 2 1.1 0.55 32549/H83 1 0.7 1.4 2 0 2 32549/H84 1 10.3 1.41 2 10.3 1.38
TABLE-US-00009 TABLE 7 rt-PCR Summary results DNA Sample (ng/μL) Cq. Mean Cq. Std. Dev Melt Temp 32549/H76_2 1.0 32.05 0.180 89.50 32549/H83_1 0.7 35.26 0.181 89.00 32549/H84_1 10.3 28.96 0.119 89.50 32549/H84_2 10.6 28.44 0.092 89.50 Negative ctrl 0.0 None None None Positive ctrl 24.8 23.60 0.040 89.50
[0103] The results of rt-PCR amplification with all samples showed that: [0104] the DNA was amplified for the positive control as well as for all tested samples; [0105] the negative control (no DNA) showed no amplification signal; [0106] positive control and samples showed equal values for Tm peaks.
[0107] This result indicates that the amplicons have the same characteristics in terms of length and/or nucleotide bases composition.
[0108] Moreover the Cq results are correlated with the DNA amount tested, meaning that the amplification is specific for the selected target.
[0109] To verify if the generated amplicons have the same sequence of the positive control, all amplified sequences were purified on agarose gel (
[0110] The agarose gel analysis confirmed the differences of the amplicons length: the fragment generated with primer set S shows a length of about 130 bp, while the fragment generated with primer set L shows a length of about 270 bp. Moreover, from gel agarose analysis it is possible to see also the presence of unspecific rt-PCR products, as in
[0111] All generated sequences were aligned by considering only the portion with high quality sequencing parameters. The sequencing results (
Example 3—Vaccinium myrtillus 36% Dry Ethanolic Extract (E. ET.) Residual DNA Identification
[0112] The residual DNA analysis was also performed on samples with Indena code 9042202, MIRTILLO (V. MYRTILLUS) E. ET. 36% after the dry-powder mixing phase, 32788/M1, 32786/M2, 32788/M2. The previous samples 32549/H76, 32549/H80 and 32549/H83 were tested again as control samples.
[0113] In order to optimize the purification procedure, after the first step of DNA purification the isolated residual DNA was processed with ReliaPrep™ Kit (Promega). The results in terms of DNA quantity (ng/μL) and quality (260/280 ratio) on the two purification steps (Table 8) revealed that the concentration as well as the purification are better introducing the second step.
TABLE-US-00010 TABLE 8 Residual DNA quantification - E. ET. 36% I purification II purification DNA Ratio DNA Ratio Sample (ng/μL) (260/280) (ng/μL) (260/280) 32549/H76 0 — 2.3 1.77 32549/H80 0 2 0.2 0.5 32549/H83 0 0.84 2.1 1.75 32788/M1 1.2 0.71 3.4 1.55 32786/M2 0 — 2.5 1.67 32788/M2 0.3 0.75 3.6 1.5
[0114] The rt-PCR analysis was performed by using SYBR green (
[0115] The results indicate that: [0116] (a) all tested samples showed the same Tm peak of the positive control (
TABLE-US-00011 TABLE 9 rt-PCR Summary results, SYBR green method - E. ET. 36% DNA Sample (ng/μL) Cq. Mean Cq. Std. Dev Melt Temp 32549/H76 2.3 31.59 0.099 89.50 32549/H80 0.2 31.87 0.107 89.50 32549/H83 2.1 33.61 0.276 89.50 32788/M1 3.4 31.85 0.286 89.50 32786/M2 2.5 31.88 0.011 89.50 32788/M2 3.6 31.36 0.144 89.50 Negative ctrl 0 0 0 None Positive ctrl 24.8 23.75 0.016 89.50 [0117] (b) all tested samples were detected with the probe specific for the sequence of V. myrtillus (
TABLE-US-00012 TABLE 10 rt-PCR Summary results, Probe-based method - E. ET. 36% DNA Sample (ng/μL) Cq. Mean Cq. Std. Dev 32549/H76 2.3 31.52 0.306 32549/H80 0.2 31.38 0.073 32549/H83 2.1 33.44 0.326 32788/M1 3.4 31.10 0.098 32786/M2 2.5 31.52 0.156 32788/M2 3.6 30.53 0.197 Negative ctrl 0 0 0 Positive ctrl 7.45 24.84 0.177
Example 4—Kit for the Analysis
[0118] The kit is composed by: [0119] One 1.5 ml tube containing all reagents necessary to perform the analysis (DNA Polymerase, dNTPs, Buffer, Probe chemistry, Primers and Probe) [0120] One 1.5 ml tube containing the positive control (DNA of Vaccinium myrtillus) [0121] One 1.5 ml tube containing the negative control DNA (Nuclease-free water)
[0122] The kit can be used with all commercially available Real-time PCR System (es: BioRad CFX96™, BioRad CFX96™, bCube®, Roche LightCycler® 480, etc)
TABLE-US-00013 List of sequences Nucleic acid fragments GCATTGCGTCACCCACTCCCCCCGTGCCCCAAGCGGGCACGTCGGAGCG TGGGCGGATATTGGCCCCCCGTTCGCATCCGTGCGCGGTCGGCCTAAAA AACGGGTCCCCAATGACGGACATCACGACAAGT (SEQ ID NO: 1) TGAAGGCACGTCTGCCTGGGCGTCACGCATTGCGTCACCCACTCCCCCC GTGCCCCAAGCGGGCACGTCGGAGCGTGGGCGGATATTGGCCCCCCGTT CGCATCCGTGCGCGGTCGGCCTAAAAAACGGGTCCCCAATGACGGACAT CACGACAAGTGGTGGTTGCTAAA (SEQ ID NO: 2) TTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGA AGCCATTAGGTTGAAGGCACGTCTGCCTGGGCGTCACGCATTGCGTCAC CCACTCCCCCCGTGCCCCAAGCGGGCACGTCGGAGCGTGGGCGGATATT GGCCCCCCGTTCGCATCCGTGCGCGGTCGGCCTAAAAAACGGGTCCCCA ATGACGGACATCACGACAAGTGGTGGTTGCTAAA (SEQ D NO: 3) CCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGTTGAAGG CACGTCTGCCTGGGCGTCACGCATTGCGTCACCCACTCCCCCCGTGCCC CAAGCGGGCACGTCGGAGCGTGGGCGGATATTGGCCCCCCGTTCGCATC CGTGCGCGGTCGGCCTAAAAAACGGGTCCCCAATGACGGACATCACGAC AAGTGGTGGTTGCTAAACCGTCGCGTCACGTCGTGCATGCCATCGTTTG TTGCGGGTTGGCCCATTTGACCCTGAAGTG (SEQ ID NO: 4) Primers “S” F GCATTGCGTCACCCACTC (SEQ ID NO: 5) R ACTTGTCGTGATGTCCGTCA (SEQ ID NO: 6) “S2” F TGAAGGCACGTCTGCCTG (SEQ ID NO: 7) R TTTAGCAACCACCACTTGTCGT (SEQ ID NO: 8) “L2” F TTGCAGAATCCCGTGAACCA (SEQ ID NO: 9) R TTTAGCAACCACCACTTGTCGT (SEQ ID NO: 10) “L” F CCATCGAGTCTTTGAACGCA (SEQ ID NO: 11) R CACTTCAGGGTCAAATGGGC (SEQ ID NO: 12) Probes M-FAM ACGTCGGAGCGTGGGC (SEQ ID NO: 13) E-HEX TAGGGCGGGTAAGTGAGT (SEQ ID NO: 14)