METHOD FOR IDENTIFYING FUNCTIONAL ELEMENTS
20220186210 · 2022-06-16
Assignee
Inventors
- Wensheng Wei (Beijing, CN)
- Yinan Wang (Beijing, CN)
- Yuexin Zhou (Beijing, CN)
- Xinyi ZHANG (Beijing, CN)
- Di YUE (Beijing, CN)
- Ying Liu (Beijing, CN)
Cpc classification
C12Q1/6897
CHEMISTRY; METALLURGY
C12N2310/20
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
C12N2320/11
CHEMISTRY; METALLURGY
C12N15/1079
CHEMISTRY; METALLURGY
C40B40/06
CHEMISTRY; METALLURGY
C12Q1/6897
CHEMISTRY; METALLURGY
International classification
C12N15/10
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
Abstract
Provided are a method for identifying functional elements of a genomic sequence and a library used for identifying functional elements of a genomic sequence.
Claims
1. A library used for identifying functional elements of a genomic sequence comprising a plurality of CRISPR-Cas system guide RNAs comprising guide sequences that are capable of targeting a plurality of genomic sequences within at least one continuous genomic region, wherein the guide RNAs target at least 100 genomic sequences comprising non-overlapping cleavage sites upstream of a PAM sequence for every 1000 base pairs within the continuous genomic region.
2. The library of claim 1, wherein the library comprises guide RNAs targeting genomic sequences upstream of every PAM sequence within the continuous genomic region.
3. The library of claim 1, wherein each guide RNA is designed to affect about 10 bp around the DSB site.
4. The library according to claim 1, wherein the PAM sequence is specific to at least one Cas protein.
5. The library according to claim 1, wherein the CRISPR-Cas system guide RNAs are selected based upon more than one PAM sequence specific to at least one Cas protein.
6. The library according to claim 1, wherein said targeting results in NHEJ of the continuous genomic region.
7. The library according to claim 1, wherein a cellular phenotype is altered and/or transcription and/or expression of a gene is increased or decreased by said targeting by at least one guide RNA within the plurality of CRISPR-Cas system guide RNAs.
8. The library according to claim 1, which is a plasmid library or viral library.
9. The library according to claim 1, which is a vector library or a host cell library.
10. A method for identifying functional elements of a genomic sequence comprising: (a) introducing the library of claim 1 into a population of cells that are adapted to contain at least one Cas protein, wherein each cell of the population contains no more than one guide RNA; (b) sorting the cells into at least two groups based on a change in cellular phenotype; (c) determining relative representation of the guide RNAs present in each group, whereby genomic sites associated with the change in cellular phenotype are determined by the representation of guide RNAs present in each group; (d) amplifying one or more cDNA or DNA sequences of the targeted one or more genes for sequencing; (e) mapping the sequencing reads to reference sequences of the target genes; (f) filtering the reads to retain those that carry only missense mutations or in-frame deletions; and (g) determining the weight of each amino acid or nucleotide acid for the cellular phenotype by applying a bioinformatics pipeline.
11. The method of claim 10, wherein the change in cellular phenotype is selected from the group consisting of loss of function, gain of function, decrease of transcription of a gene, increase of transcription of a gene, decrease of expression of a gene and increase of expression of a gene.
12. The method of claim 10, wherein the genomic sequence is for encoding a functional protein.
13. The method of claim 12, which is for identifying functional elements for the protein at single amino acid resolution.
14. The method of claim 10, wherein the genomic sequence is for encoding a non-coding RNA or genetic regulatory element.
15. The method of claim 14, wherein the genetic regulatory element is a promotor or an enhancer.
16. The method of claim 10, wherein the identification is in the native biological context.
17. The method of claim 10, the bioinformatics pipeline comprises: (h) For fragments containing missense mutations, computing the mutation ratio of each amino acid as follows:
essential score=w.sub.GHIJIKLM*score.sub.GHIJIKLM+w.sub.STUTIKLM*scores.sub.STUTIKLM; (6) ranking the amino acids based on their functional importance according to the essential scores.
18. A method of screening functional elements associated with resistance to a drug or toxin comprising: (a) introducing the library of claim 1 into a population of cells that are adapted to contain a Cas protein, wherein each cell of the population contains no more than one guide RNA; (b) treating the population of cells with the drug or toxin and sorting the cells into at least two groups based on change in resistance to the drug or toxin; (c) determining relative representation of the guide RNAs present in each group, whereby genomic sites associated with the change in resistance are determined by the representation of guide RNAs present in each group; (d) amplifying one or more cDNA or DNA sequences of the targeted one or more genes for sequencing; (e) mapping the sequencing reads to reference sequences of the target genes; (f) filtering the reads to retain those that carry only missense mutations or in-frame deletions; and (g) determining the weight of each amino acid or nucleotide acid for the resistance to the drug or toxin by applying a bioinformatics pipeline.
19. The method of claim 18, wherein the genomic sequence is for encoding a functional protein.
20. The method of claim 19, which is for identifying functional elements for the protein at single amino acid resolution.
21. The method of claim 18, wherein the genomic sequence is for encoding a non-coding RNA or genetic regulatory element.
22. The method of claim 21, wherein the genetic regulatory element is a promotor or an enhancer.
23. The method of claim 18, wherein the identification is in the native biological context.
24. The method of claim 18, wherein the population of cells are introduced into a plurality of guide RNAs comprising guide sequences that are capable of targeting a plurality of genomic sequences within at least one continuous genomic region, wherein the guide RNAs target at least 100 genomic sequences comprising non-overlapping cleavage sites upstream of a PAM sequence for every 1000 base pairs within the continuous genomic region.
25. The method of claim 24, wherein each guide RNA is designed to affect about 10 bp around the DSB site.
26. The method of claim 24, wherein the PAM sequence is specific to at least one Cas protein.
27. The method of claim 24, wherein the CRISPR-Cas system guide RNAs are selected based upon more than one PAM sequence specific to at least one Cas protein.
28. The method of claim 18, the bioinformatics pipeline comprises: (h) For fragments containing missense mutations, computing the mutation ratio of each amino acid as follows:
essential score=w.sub.GHIJIKLM*score.sub.GHIJIKLM+w.sub.STUTIKLM*scores.sub.STUTIKLM; (6) ranking the amino acids based on their functional importance according to the essential scores.
29. A method for identifying functional elements for a protein of interest comprising conducting saturation mutagenesis to the protein of interest by disrupting the genomic gene coding for the protein by using CRISPR-Cas system introduced into a population of cells, determining disrupted genomic sites associated with change of phenotype by sequencing DNA and cDNA of the targeted gene, retrieving in-frame mutations that give rise to the change of phenotype, and building a bioinformatics pipeline to identify functional elements of the protein of interest at single amino acid resolution.
30. The method of claim 29, wherein the identification of the functional elements for the protein of interest is in its native biological context.
31. The method of claim 29, wherein the in-frame mutations are in-frame deletions and missense point mutations.
32. The method of claim 29, wherein the change in cellular phenotype is selected from the group consisting of loss of function, gain of function, decrease of transcription of a gene, increase of transcription of a gene, decrease of expression of a gene and increase of expression of a gene.
33. The method of claim 29, which is for identifying functional elements for the protein at single amino acid resolution.
34-36. (canceled)
37. The method of claim 29, wherein each cell of the population contains no more than one guide RNA, and a plurality of guide RNAs introduced to the population of cells comprise guide sequences that are capable of targeting a plurality of genomic sequences within at least one continuous genomic region coding for the protein of interest, wherein the guide RNAs target at least 100 genomic sequences comprising non-overlapping cleavage sites upstream of a PAM sequence for every 1000 base pairs within the continuous genomic region.
38. The method of claim 37, wherein each guide RNA is designed to affect about 10 bp around the DSB site.
39. The method of claim 37, wherein the PAM sequence is specific to at least one Cas protein.
40. The method of claim 29, wherein the CRISPR-Cas system guide RNAs are selected based upon more than one PAM sequence specific to at least one Cas protein.
41. The method of claim 29, wherein the bioinformatic pipeline comprises: Mapping sequencing reads to the reference sequences of the target gene by using bioinformatic tools, Filtering the reads to retain those that carried only missense mutations or in-frame deletions, For fragments containing missense mutations, computing the mutation ratio of each amino acid as follows:
essential score=w.sub.GHIJIKLM*score.sub.GHIJIKLM+w.sub.STUTIKLM*scores.sub.STUTIKLM; (6) ranking the amino acids based on their functional importance according to the essential scores.
42. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWING
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
DETAILED DESCRIPTION OF THE INVENTION
[0080] The methods and tools described herein relate to systematically interrogating genomic regions in order to allow the identification of relevant functional units which can be of interest for genome editing. Accordingly, in one aspect the invention provides methods for interrogating a genomic region said method comprising generating a deep scanning mutagenesis library and interrogating the phenotypic changes within a population of cells modified by introduction of said library.
[0081] One aspect of the invention thus comprises a deep scanning mutagenesis library that may comprise a plurality of CRISPR-Cas system guide RNAs that may comprise guide sequences that are capable of targeting genomic sequences within at least one continuous genomic region. More particularly it is envisaged that the guide RNAs of the library should target a representative number of genomic sequences within the genomic region. For example, the guide RNAs should target at least 50, more particularly at least 100, genomic sequences within the envisaged genomic region.
[0082] The ability to target a genomic region is determined by the presence of a PAM (protospacer adjacent motif); that is, a short sequence recognized by the CRISPR complex. The precise sequence and length requirements for the PAM will differ depending on the CRISPR enzyme which will be used, but PAMs are typically 2-5 base pair sequences adjacent the protospacer (that is, the target sequence). PAM sequences known in the art, and the skilled person will be able to identify PAM sequences for use with a given CRISPR enzyme. In particular embodiments, the PAM sequence can be selected to be specific to at least one Cas protein. In alternative embodiments, the guide sequence RNAs can be selected based upon more than one PAM sequence specific to at least one Cas protein.
[0083] In particular embodiments, the library contains at least 100 genomic sequences comprising non-overlapping cleavage sites upstream of a PAM sequence for every 1000 base pairs within the genomic region. In particular embodiments the library comprises guide RNAs targeting genomic sequences upstream of every PAM sequence within the continuous genomic region.
[0084] This library comprises guide RNAs that target a genomic region of interest of an organism. In some embodiments of the invention the organism or subject is a eukaryote (including mammal, including human) or a non-human eukaryote or a non-human animal or a non-human mammal. In some embodiments, the organism or subject is a non-human animal, and may be an arthropod, for example, an insect, or may be a nematode. In some methods of the invention the organism or subject is a plant. In some methods of the invention the organism or subject is a mammal, for example, a human or non-human mammal. A non-human mammal may be for example a rodent (preferably a mouse or a rat), an ungulate, or a primate. In some methods of the invention the organism or subject is algae, including microalgae, or is a fungus.
[0085] The methods and tools provided herein are particularly advantageous for interrogating a continuous genomic region. Such a continuous genomic region may comprise up to the entire genome, but particularly advantageous are methods wherein a functional element of the genome is interrogated, which typically encompasses a limited region of the genome, such as a region of 50-100 kb of genomic DNA. Of particular interest is the use of the methods for the interrogation of coding genomic regions. A skilled person in the art can understand that the methods of the present invention can also be used for interrogation of non-coding genomic regions, such as regions 5′ and 3′ of the coding region of a gene of interest by modification in protocol to perform PCR amplification on the targeted region on the genome instead of cDNA in the scenario of interrogation of a protein of interest.
[0086] The CRISPR/Cas system can be used in the present invention to specifically target a multitude of sequences within a continuous genomic region of interest. The targeting typically comprises introducing into each cell of a population of cells a vector system of one or more vectors comprising an engineered, non-naturally occurring CRISPR-Cas system comprising: at least one Cas protein and guide RNA. In these methods, the Cas protein and the guide RNA may be on the same or on different vectors of the system and are integrated into each cell, whereby each guide sequence targets a sequence within the continuous genomic region in each cell in the population of cells. The Cas protein is operably linked to a regulatory element to ensure expression in said cell, more particularly a promoter suitable for expression in the cell of the cell population. In particular embodiments, the promoter is an inducible promoter, such as a doxycycline inducible promoter. When transcribed within the cells of the cell population, the guide RNA comprising the guide sequence directs sequence-specific binding of a CRISPR-Cas system to a target sequence in the continuous genomic region. Typically binding of the CRISPR-Cas system induces cleavage of the continuous genomic region by the Cas protein.
[0087] The application provides methods of screening for functional elements associated with a change in a phenotype. The change in phenotype can be detectable at one or more levels including at DNA, RNA, protein and/or functional level of the cell. The change in phenotype can be detectable in cellular survival, growth, immune reaction, resistance to a chemical compound, such as a toxin or drug.
[0088] The methods of screening for genomic sites associated with a change in phenotype comprise introducing the library of guide RNAs targeting the genomic region of interest as envisaged herein into a population of cells. Typically the cells are adapted to contain a Cas protein. However, in particular embodiments, the Cas protein may also be introduced simultaneously with the guide RNA. The introduction of the library into the cell population in the methods envisage herein is such that each cell of the population contains no more than one guide RNA. Hereafter, the cells are typically sorted based on the observed phenotype and the genomic sites associated with a change in phenotype are identified based on whether or not they give rise to a change in phenotype in the cells. Typically, the methods involve sorting the cells into at least two groups based on the phenotype and determining relative representation of the guide RNAs present in each group, and genomic sites associated with the change in phenotype are determined by the representation of guide RNAs present in each group.
[0089] The application similarly provides methods of screening for genomic sites associated with resistance to a chemical compound whereby the cells are contacted with the chemical compound and screened based on the phenotypic reaction to said compound. More particularly such methods may comprise introducing the library of CRISPR/Cas system guide RNAs envisaged herein into a population of cells (that are either adapted to contain a Cas protein or whereby the Cas protein is simultaneously introduced), treating the population of cells with the chemical compound; and determining the representation of guide RNAs after treatment with the chemical compound at a later time point as compared to an early time point. In these methods the genomic sites associated with resistance to the chemical compound are determined by enrichment of guide RNAs.
[0090] In particular embodiments, the methods may further comprise sequencing the region comprising the genomic site or by whole genome sequencing.
[0091] The application further relates to methods for screening for functional elements related to drug resistance using the methods of the present invention.
[0092] Further embodiments described herein relate to therapeutic methods and tools involving genomic disruption of one or more functional regions of a gene identified by the methods herein disclosed. These and Further embodiments described herein are based in part to the discovery of functional regions in a genomic region or a protein of interest.
[0093] In specific methods exemplified in the present application, to maximize the coverage density, both types of protospacer-adjacent motifs (PAMs), NGG and NAG, are encompassed for the design of sgRNAs. After library screening using cancer drugs or toxins, the genomic DNA was extracted for conventional PCR amplification of sgRNA barcodes followed by NGS analysis. Meanwhile, PCR amplification of targeted genes from reverse transcription of RNAs were conducted and the fragmented PCR products around 250-bp in length were subjected to NGS. We then filtered out wild-type sequences or those containing out-of-frame indels or in-frame insertions so that only those sequences containing either point mutation or in-frame deletion were retained for further analysis. For point mutation, we went on filtering out synonymous or nonsense mutation and kept only those containing missense mutation. In case of in-frame deletion, we categorized mutation types by the number of amino acid deletion they caused for each read, and then classified them as either “driver deletions” if they contained only single-amino-acid deletions or “passenger deletions” if they contained multiple-amino-acid deletions. After decoding deletion patterns, the deletion fold changes were computed. Similarly, the fold changes for missense mutations were also calculated. Next, we leveraged all information from filtered reads by applying a window sliding on the target gene to compute weighted average of fold changes for missense mutation, driver deletion and passenger deletion. We then inferred the significant level of the weighted average by permutation and acquired the essential score for each amino acid. The score counted both the in-frame deletion and point mutation scenarios and quantified the essentiality of each amino acid so that we could rank the amino acids based on their functional importance. Meanwhile, we attempted to obtain the amino acid substitution pattern by counting the percentage of missense mutations for each amino acid. This streamlined workflow and a bioinformatics pipeline were designed to enable us to identify critical functional elements of proteins in their native biological contexts.
[0094] The present invention will be described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto but only by the claims. Any reference signs in the claims shall not be construed as limiting the scope. The drawings described are only schematic and are non-limiting. In the drawings, the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes. Where the term “comprising” is used in the present description and claims, it does not exclude other elements or steps. Where an indefinite or definite article is used when referring to a singular noun e.g. “a” or “an”, “the”, this includes a plural of that noun unless something else is specifically stated.
[0095] The practice of the present invention employs, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which are within the skill of the art. See Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel, et al. eds., (1987)); the series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PGR 2: A PRACTICAL APPROACH (M.J. MacPherson, B.D. Hames and GR. Taylor eds. (1995)), Harlow and Lane, eds. (1988) ANTIBODIES, A LABORATORY MANUAL, and ANIMAL CELL CULTURE (R. L Freshney, ed. (1987)).
[0096] The following terms or definitions are provided solely to aid in the understanding of the invention. Unless specifically defined herein, all terms used herein have the same meaning as they would to one skilled in the art of the present invention. Practitioners are particularly directed to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Plainsview, New York (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999), for definitions and terms of the art. The definitions provided herein should not be construed to have a scope less than understood by a person of ordinary skill in the art.
[0097] In genetics, a “nonsense mutation” is a point mutation in a sequence of DNA that results in a premature stop codon, or a nonsense codon in the transcribed mRNA, and in a truncated, incomplete, and usually nonfunctional protein product. The functional effect of a nonsense mutation depends on the location of the stop codon within the coding DNA. For example, the effect of a nonsense mutation depends on the proximity of the nonsense mutation to the original stop codon, and the degree to which functional subdomains of the protein are affected. A nonsense mutation differs from a “missense mutation”, which is a point mutation where a single nucleotide is changed to cause substitution of a different amino acid.
[0098] A “synonymous substitution or mutation” is the evolutionary substitution of one base for another in an exon of a gene coding for a protein, such that the produced amino acid sequence is not modified. This is possible because the genetic code is “degenerate”, meaning that some amino acids are coded for by more than one three-base-pair codon; since some of the codons for a given amino acid differ by just one base pair from others coding for the same amino acid, a mutation that replaces the “normal” base by one of the alternatives will result in incorporation of the same amino acid into the growing polypeptide chain when the gene is translated.
[0099] A protein contains both dispensable and indispensable regions, mutations on latter parts would abolish its function. On its corresponding DNA-coding sequences, any mutation leading to reading frame shift has high chance of disrupting gene expression hence its function, no matter whether the mutation occurs in the critical or non-critical site. In cases of protein targets of cancer drugs or bacterial toxins, in-frame deletion or point mutation (except for nonsense mutation) does not produce resistance phenotype when such mutation hits the non-critical site. For non-essential gene, disruption of every allele is a necessity to achieve “loss-of-function phenotype”. These recessive mutation types could be one of the following: frameshift indel, in-frame deletion or missense point mutation affecting critical site. For essential gene, the only drug-resistance scenario is either in-frame deletion or missense mutation affecting the critical site for drug targeting without altering protein's expression and thus its essential role for cell viability. These mutations are dominant and thus a proper mutation in one allele is sufficient to achieve “gain-of-function phenotype”.
[0100] In a wild-type diploid cell, there are two wild-type alleles of a gene, both making normal gene product. In heterozygotes (the crucial genotypes for testing dominance or recessiveness), the single wild-type allele may be able to provide enough normal gene product to produce a wild-type phenotype. In such cases, “loss-of-function mutations” are recessive. In some cases, the cell is able to “upregulate” the level of activity of the single wild-type allele so that in the heterozygote the total amount of wild-type gene product is more than half that found in the homozygous wild type. However, mutation events confer some new function on the gene. In a heterozygote, the new function will be expressed, and therefore the “gain-of-function mutation” most likely will act like a dominant allele and produce some kind of new phenotype.
[0101] “Saturation mutagenesis” is a random mutagenesis technique, in which each single codon or set of codons is randomized to produce all possible amino acids at the position.
[0102] A “codon” is a set of three nucleotides, a triplet that code for a certain amino acid. The first codon establishes the reading frame, whereby a new codon begins. A protein's amino acid backbone sequence is defined by contiguous triplets. Codons are key to translation of genetic information for the synthesis of proteins. The “reading frame” is set when translating the mRNA begins and is maintained as it reads one triplet to the next. The reading of the genetic code is subject to three rules the monitor codons in mRNA. First, codons are read in a 5′ to 3′ direction. Second, codons are nonoverlapping and the message has no gaps. The last rule, as stated above, that the message is translated in a fixed “reading frame”.
[0103] A “frameshift mutation”, also called a framing error or a reading frame shift, is a genetic mutation caused by indels (insertions or deletions) of a number of nucleotides in a DNA sequence that is not divisible by three. Due to the triplet nature of gene expression by codons, the insertion or deletion can change the reading frame, resulting in a completely different translation from the original. A frameshift mutation will in general cause the reading of the codons after the mutation to code for different amino acids. The frameshift mutation will also alter the first stop codon (“UAA”, “UGA” or “UAG”) encountered in the sequence. The polypeptide being created could be abnormally short or abnormally long, and will most likely not be functional.
[0104] “Out-of-frame indels” mean the insertions and/or deletions (indels) which cause the reading of the genetic code out of “reading frame”, while “in-frame deletion” means the deletion of a number of nucleotides in a DNA sequence that is divisible by three, and thus the deletion does not change the reading frame.
[0105] “CRISPR system” herein refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans -activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus. In some embodiments, one or more elements of a CRISPR system is derived from a type I, type II, or type III CRISPR system.
[0106] Within an expression vector, “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a target cell when the vector is introduced into the target cell).
[0107] In the context of formation of a CRISPR complex, “target sequence” refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex.
[0108] Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence. Without wishing to be bound by theory, the tracr sequence, which may comprise or consist of all or a portion of a wild-type tracr sequence (e.g. about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of a wild-type tracr sequence), may also form part, of a CRISPR complex, such as by hybridization along at least a portion of the tracr sequence to all or a portion of a tracr mate sequence that is operably linked to the guide sequence.
[0109] In some embodiments, the tracr sequence has sufficient complementarity to a tracr mate sequence to hybridize and participate in formation of a CRISPR complex. As with the target sequence, it is believed that complete complementarity is not needed, provided there is sufficient to be functional. In some embodiments, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned.
[0110] In some embodiments, one or more vectors driving expression of one or more elements of a CRISPR system are introduced into a host cell such that expression of the elements of the CRISPR system direct formation of a CRISPR complex at one or more target sites. In another embodiment, the host cell is engineered to stably express Cas9 and/or OCT1.
[0111] In general, a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith-Waterman algorithm, the Needleman-Wimsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g. the Burrows Wheeler Aligner), ClustalW, Clustai X, BLAT, Novoalign (Novocraft Technologies, ELAND (I!fumma, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). In some embodiments, a guide sequence is about or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, 11, 10 or fewer nucleotides in length. The ability of a guide sequence to direct sequence-specific binding of a CRISPR complex to a target sequence may be assessed by any suitable assay. For example, the components of a CRISPR system sufficient to form a CRISPR complex, including the guide sequence to be tested, may be provided to a host cell having the corresponding target sequence, such as by transfection with vectors encoding the components of the CRISPR sequence, followed by an assessment of preferential cleavage within the target sequence, such as by Surveyor assay as described herein. Similarly, cleavage of a target polynucleotide sequence may be evaluated in a test tube by providing the target sequence, components of a CRISPR complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions. Other assays are possible, and will occur to those skilled in the art.
[0112] In some embodiments, the CRISPR enzyme is part of a fusion protein comprising one or more heterologous protein domains (e.g. about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more domains in addition to the CRISPR enzyme). A CRISPR enzyme fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains. Examples of protein domains that may be fused to a CRISPR enzyme include, without limitation, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, historic modification activity, RNA cleavage activity and nucleic acid binding activity.
[0113] In some aspects, the invention provides methods comprising delivering one or more polynucleotides, such as or one or more vectors as described herein, one or more transcripts thereof, and/or one or proteins transcribed therefrom, to a host cell. The invention serves as a basic platform for enabling targeted modification of DNA -based genomes. It can interface with many delivery systems, including but not limited to viral, liposome, electroporation, microinjection and conjugation. In some aspects, the invention further provides cells produced by such methods, and organisms (such as animals, plants, or fungi) comprising or produced from such cells. In some embodiments, a CRISPR enzyme in combination with (and optionally complexed with) a guide sequence is delivered to a cell. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding components of a CRISPR system to cells in culture, or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g. a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes for delivery to the cell.
[0114] CRISPR/Cas9 is used in the present invention for screening experiments, due to the relative ease of designing gRNAs and the ability of Cas9 to modify virtually any genetic locus. In the screening experiments, CRISPR pooled libraries or CRISPR libraries consist of thousands of plasmids, each containing a gRNA toward a different target sequence spanning the full length of the protein of the interest. Specifically, to achieve saturation mutagenesis on the protein of interest, the sgRNAs are designed to encompass both types of protospacer-adjacent motifs (PAMs), NGG and NAG, and each sgRNA is designed to affect 10-bp around the DSB site for maximizing the coverage density. The CRISPR screening experiment can be forward genetic screening, where the desired phenotype is known, but the critical amino acids of the protein are not. Typically, CRISPR-based screens are carried out by using lentivirus to deliver a “pooled” gRNA library to a mammalian Cas9 expressing cell line. Following transduction with the gRNA library, mutant cells are screened for a phenotype of interest (e.g., survival, drug or toxin resistance, growth or proliferation) to identify amino acids critical for the function of the protein and the desired phenotype.
[0115] The pooled lentiviral gRNA library is a heterogeneous mixture of lentiviral transfer vectors with each vector encoding an individual gRNA for a specific sequence and with several gRNAs targeting each sequence present in the library.
[0116] Performing a screen using a pooled lentiviral CRISPR library is a multi-step processes including library amplification, cellular transduction, genetic screening and data analysis. In brief, the initial stock of gRNA-containing plasmids are “amplified” to increase the total amount of DNA, and the amplified library is then used to generate lentivirus containing either the gRNA alone or gRNA +Cas9. For single-vector libraries, mutant cells are generated in one step by transducing wild-type cells with lentivirus containing both a single gRNA and Cas9. In most cases, for multi-vector libraries, cells expressing Cas9 are transduced with the gRNA library. In both cases, transduced cells are selected to enrich those containing both gRNA and Cas9 and the resulting population of mutant cells are screened for the particular phenotype of interest. Next-generation sequencing (NGS) is carried out on genomic DNA from the final population to identify gRNAs that are enriched or depleted during screening. Lastly, a bioinformatic pipeline is designed to analyze the retrieved data.
[0117] Library Amplification
[0118] Pooled lentiviral CRISPR gRNA libraries are often delivered as a DNA aliquot and in most cases the quantity of DNA is insufficient to be used in an experiment. In such cases, the first step is to “amplify” the library, meaning to increase the amount of plasmid DNA while maintaining the relative proportion of each individual gRNA plasmid within the total population. Amplification is carried out by transforming the library DNA into bacteria and harvesting the plasmid DNA after a period of bacterial growth. For most libraries, electroporation is used rather than chemical transformation due to the increased transformation efficiency using electroporation. In most cases, transformed bacteria are grown on LB agar plates containing the appropriate antibiotic, as growth on plates helps maintain library representation and reduces the probability that fast-growing plasmids will become enriched during amplification. An estimation of the number of gRNA plasmids that were transformed and amplified can be obtained by performing a dilution plating assay. To do this, a sample of the transformation is diluted and plated onto LB plates containing antibiotic and the number of colonies that grow on the plates is used as an indirect measure of the total number of gRNA plasmids present in the amplified library. This analysis serves as an important control to know what is in the final amplified library before it is used in a functional screen.
[0119] Cellular Transduction
[0120] Once the library has been amplified and the representation confirmed, the next step is to generate lentivirus containing the pooled gRNA library. Generally, HEK293T cells are transfected with the CRISPR library and appropriate packaging and envelope vectors (e.g., psPAX2; Addgene, plasmid #12260 from Didier Trono's lab, pMD2.G; Addgene, plasmid #12259 from Didier Trono's lab, pVSVG and pR8.74 from Addgene). Alternatively, a lentiviral packaging cell type can be transfected with the gRNA library alone. Most protocols recommend collecting the medium >48 hours after transfection, but some optimization may be required as maximal viral titer will vary depending on the specific library in question.
[0121] The goal of the transduction step is to generate a population of mutant cells that stably co-expresses Cas9 and a single gRNA. Single-vector libraries containing both gRNA and Cas9 are easier to use than multi-vector systems since mutant cells can be generated directly from wild-type cells in a single step. Afterwards, selection is carried out after lentiviral transduction to isolate a population of cells positive for Cas9 and a gRNA. If antibiotic selection is used, a kill curve should be performed to determine the optimum antibiotic concentration to select only those cells that contain Cas9 and gRNA.
[0122] In theory, any cell type can be used for screening, but the final population of cells must be in sufficient quantity to maintain library representation prior to screening. The exact number of cells required for a screen will vary based on the specific library in question. The easiest way to understand this is to work backwards from the final, mutant cell population and determine the exact number of cells required at the beginning of a screen. Take, for example, a hypothetical library of 10,000 gRNAs that is to be used at 100× representation. The bare minimum of cells required to conduct a screen using this library would be 10,000 gRNAs×100 cells/gRNA=10.sup.6 cells (not including control conditions for screening). Each cell in the final population must contain only one gRNA, as delivery of multiple gRNAs to a single cell could result in multiple genetic alterations, making it unclear which mutation actually leads to the observed phenotype. Thus, most protocols recommend transducing cells with the lentiviral gRNA library at a multiplicity of infection (MOI) of <1 (i.e., less than one viral particle per cell).
[0123] Genetic Screening
[0124] Genetic screens can be broadly defined as either positive, which reveal gRNAs that are enriched during screening, or negative, which reveal gRNAs that are depleted during screening. CRISPR libraries can be used in positive selection drug screens to search for genes that, when mutated, confer resistance to chemotherapeutic drugs. In positive-selection drug screens, it may be important to determine the optimum concentration to kill all wild-type cells (kill-curve), such that treating a population of mutant cells selectively enriches cells whose genetic modification promotes drug resistance. Furthermore, it is essential to compare the final gRNA counts within the genomic DNA to a control condition (such as a vehicle control) that is run in parallel, to control for drug-independent changes in gRNA distribution, such as the effect of a given gRNA on cell growth in the absence of drug or effects of the vehicle itself. Negative screens, on the other hand, seek to identify gRNAs that drop out of the population during screening, indicating that they are at a selective disadvantage relative to the rest of the population. A straightforward example of a negative selection screen is to allow mutant cells to grow for a defined period of time, and then compare the gRNA distribution at a later time point to an initial time point.
[0125] Data Analysis
[0126] The end result of any successful screen is to obtain a population of mutant cells that are either enriched (positive selection) or depleted (negative selection) in gRNAs whose target sequences or elements are essential for the observed phenotype. Therefore, the goal of the data analysis step is to identify the gRNAs and sequences or elements that have been depleted or enriched in the experimental group. Since the end population of cells could conceivably contain thousands of different gRNAs, analysis of the genomic sequence requires the use of next-generation sequencing (NGS). Each individual gRNA plasmid contains a barcode that differentiates that gRNA from all others present in the genomic DNA. Thus, the first step in analyzing data from a CRISPR screen is to amplify the gRNA relative to the genomic DNA using PCR and perform NGS to identify which gRNAs are present in the final mutant cell population. The end result of NGS is a raw count of all barcodes, from which the gRNA sequence and target gene can be deduced.
[0127] One way to determine whether a sequence or element is a “hit” is by qualitatively comparing how many gRNAs targeting that sequence or element are enriched, or depleted, within a given sample. As pointed out in earlier sections, libraries typically contain multiple different gRNAs per gene and consistent enrichment or depletion across multiple gRNAs for a specific gene is strong evidence that a particular sequence is important for the observed phenotype. Having several gRNAs also serves as an internal control for off-target effects, since it is unlikely that two different gRNAs toward the same target will have the same off-target effect. However, setting arbitrary thresholds to define hits (e.g., two out of six gRNAs qualifies as a “hit”) can be a potential source of bias or lead to false positive or negative results. To circumvent this, various statistical analyses can also be used to determine hits in an unbiased manner. Since each screen will be different, it is important to understand which statistical approach is best suited for a particular screen.
[0128] In the process of data analysis of the present invention, those data are to be filtered out with respect of wild-type sequences or sequences containing out-of-frame indels or in-frame insertions so that only sequences containing either point mutation or in-frame deletion are retained for further analysis. For point mutation, filtering out synonymous or nonsense mutation and kept only those containing missense mutation. For in-frame deletion, mutations need to be categorized by the number of amino acid deletion they caused for each read as either driver deletions if they contained only single-amino-acid deletions or passenger deletions if they contained multiple-amino-acid deletions. The bioinformatical analysis specifically comprises:
[0129] computing the mutation ratio of each amino acid as follows for fragments containing mis sense mutations:
[0130] computing the deletion ratio of each amino acid as follows for fragments containing in-frame deletions:
[0131] Computing the essential score for each amino acid as follows:
[0132] for the mutation fold change, a null distribution is built based on all fold changes, and score.sub.mutation=−log10(P-value) was computed for each amino acid,
[0133] For the deletion fold change, a tunable parameter, α, is first applied to weight the driver deletion and passenger deletion as follows:
[0134] deletion fold change=driver fold change+α*passenger fold change, and then a null distribution is built via permutation 100 times, and score.sub.deletion=−log10(P-value) is computed for each amino acid,
[0135] score.sub.mutatjon and score.sub.deletion are normalized as follows:
[0136] computing the weights of score.sub.mutation and score.sub.deletion as follows:
[0137] computing the essential score as follows:
essential score=w.sub.GHIJIKLM*score.sub.GHIJIKLM+W.sub.STUTIKLM*score.sub.STUTIKLM.
[0138] Finally, the amino acids are ranked based on their functional importance according to the essential scores.
EXAMPLES
Materials and Methods
Cells and Reagents
[0139] Stably Cas9-expressing HeLa cells and HEK293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Corning) containing 10% fetal bovine serum (FBS, CellMax) under 5% CO.sub.2 at 37° C.
[0140] Plasmid Construction
[0141] The sgRNA vector (pLenti-sgRNA-GFP) was cloned by replacing the U6 promoter in pLL3.7 (Addgene) with the human U6 promoter, ccdB cassette and sgRNA scaffold. The Cas9 expression vector (pLenti-OC-IRES-BSD) has been previously reportedl. pcDNA-HBEGF was cloned by replacing the KRAB-dCas9 element of pHR-SFFVKRAB-dCas9-P2A-mCherry (Addgene) with the human HBEGF coding sequence and 3 ×FLAG. Vectors expressing cDNA of HBEGF with single amino acid deletions were constructed via PCR site-directed mutagenesis (PfuUltraII Fusion HS DNA Polymerase, STRATAGENE). The primers used to generate different deletion mutants for HBEGF are listed as follows.
TABLE-US-00001 (SEQ ID NO: 1) HBEGF-29-F 5′-GACCGGAAAGTCCGTTTGCAAGAGGCAG-3′ (SEQ ID NO: 2) HBEGF-29-R 5′-CTAGCCCTCTCCGCCGCTCCAGGCTC-3′ (SEQ ID NO: 1) HBEGF-63-F 5′-GACCGGAAAGTCCGTTTGCAAGAGGCAG-3′ (SEQ ID NO: 3) HBEGF-63-R 5′-CTGCCTCTTGCAAACGGACTTTCCGGTC-3′ (SEQ ID NO: 4) HBEGF-70-F 5′-GCAAGAGGCAGATCTGCTTTTGAGAGTC-3′ (SEQ ID NO: 5) HBEGF-70-R 5′-GACTCTCAAAAGCAGATCTGCCTCTTGC-3′ (SEQ ID NO: 6) HBEGF-115-F 5′-CGGAAATACAAGGACTGCATCCATGGAG-3′ (SEQ ID NO: 7) HBEGF-115-R 5′-CTCCATGGATGCAGTCCTTGTATTTCCG-3′ (SEQ ID NO: 8) HBEGF-119-F 5′-GGACTTCTGCATCCATGAATGCAAATATGTG-3′ (SEQ ID NO: 9) HBEGF-119-R 5′-CACATATTTGCATTCATGGATGCAGAAGTCC-3′ (SEQ ID NO: 10) HBEGF-125-F 5′-GAATGCAAATATGTGGAGCTCCGGGCTCC-3′ (SEQ ID NO: 11) HBEGF-125-R 5′-GGAGCCCGGAGCTCCACATATTTGCATTC-3′ (SEQ ID NO: 12) HBEGF-127-F 5′-ATGTGAAGGAGCGGGCTCCCTCCTGC-3′ (SEQ ID NO: 13) HBEGF-127-R 5′-GCAGGAGGGAGCCCGCTCCTTCACAT-3′ (SEQ ID NO: 14) HEBGF-133-F 5′-GCTCCCTCCTGCTGCCACCCGGGTTAC-3′ (SEQ ID NO: 15) HBEGF-133-R 5′-GTAACCCGGGTGGCAGCAGGAGGGAGC-3′ (SEQ ID NO: 16) HEBGF-134-F 5′-CCCTCCTGCATCCACCCGGGTTACC-3′ (SEQ ID NO: 17) HBEGF-134-R 5′-GGTAACCCGGGTGGATGCAGGAGGG-3′ (SEQ ID NO: 18) HEBGF-138-F 5′-CTGCCACCCGGGTCATGGAGAGAGGTGTC-3′ (SEQ ID NO: 19) HBEGF-138-R 5′-GACACCTCTCTCCATGACCCGGGTGGCAG-3′ (SEQ ID NO: 20) HEBGF-141-F 5′-CCGGGTTACCATGGAAGGTGTCATGGGC-3′ (SEQ ID NO: 21) HBEGF-141-R 5′-GCCCATGACACCTTCCATGGTAACCCGG-3′ (SEQ ID NO: 22) HEBGF-152-F 5′-GCCTCCCAGTGGAACGCTTATATACCTATG-3′ (SEQ ID NO: 23) HBEGF-152-R 5′-CATAGGTATATAAGCGTTCCACTGGGAGGC-3′ (SEQ ID NO: 24) HEBGF-153-F 5′-CCTCCCAGTGGAAAATTTATATACCTATGACC-3′ (SEQ ID NO: 25) HBEGF-153-R 5′-GGTCATAGGTATATAAATTTTCCACTGGGAGG-3
sgRNA Library Design
[0142] The hg19 CDS sequences of target genes were downloaded from the UCSC genome browser (https://genome.ucsc.edu/), and all potential sgRNAs with the NAG or NGG PAM sequence were designed using a homemade script to build the library.
Construction of the CRISPR/Cas9 sgRNA Library
[0143] Two libraries were constructed to include 1,236 and 3,712 sgRNAs targeting three drug-associated proteins and three toxin receptors, respectively. Array-based oligos encoding sgRNAs were synthesized and amplified via PCR with corresponding primers that included the BsmBI recognition site at the 5′ end. Those primers used for PCR amplification of the array-based oligos encoding sgRNAs (primer for amplifying sgRNA oligos targeting drug-associated proteins) are listed as follows.
TABLE-US-00002 Drug library F (SEQ ID NO: 26) 5′-TTGTGGAAAGGACGAAACCG-3′ Drug library R (SEQ ID NO: 27) 5′-TGCTGTCTCTAGCTCTACGT-3′ Toxin library F (SEQ ID NO: 28) 5′-TCTTCATATCGTATCGTGCG-3′ Toxin library R (SEQ ID NO: 29) 5′-TAGTCGCTAGGCTATAACGT-3′
[0144] The amplified DNA products were ligated into the vector using the Golden Gate method. The ligation mixture was then transformed into Transl-T1 competent cells (Transgen) to generate the plasmid library. The sgRNA plasmid library was subsequently transfected into HEK293T cells, together with two viral packaging plasmids, pVSVG and pR8.74 (Addgene), using the X-tremeGENE HP DNA transfection reagent (Roche). HeLa cells were then infected with a low MOI (˜0.3) of lentivirus, and EGFP.sup.+ cells were collected 48 hour after infection via FACS.
Library Screening
[0145] For BI2536 and bortezomib screening, each experimental replicate consisted of two 150 mm dishes with 3.5×10.sup.6 cells each. The cells were treated with drugs at an appropriate concentration at 24 hour after seeding. For the first round of screening, the library cells were cultured with BI2536 at 4 ng/ml for 1.5 days or bortezomib at 4 ng/ml for 3 days, followed by culturing in fresh DMEM. The resistant cells were re-seeded and cultured for 5-10 days for a subsequent round of drug screening. For the second round of screening, the library cells were incubated with BI2536 at 5 ng/ml for 4 days or with bortezomib at 8 ng/ml for 5 days. For the third round of screening, the library cells were incubated with BI2536 at 6 ng/ml for 3 days. For 6-TG screening, a total of 1.8×10.sup.7 library cells were plated onto 150 mm Petri dishes at 3 x10.sup.6 cells per plate. Three plates of cells were grouped together as one replicate. The cells were treated with 6-TG at 250 ng/ml for 6 days, and surviving cells were re-seeded for growth and subjected to the next round of screening. For the second and third rounds, the library cells were incubated with 6-TG at 250 ng/ml and 300 ng/ml, respectively, for 4 days. For TcdB screening, four 150 mm dishes were plated with 3.5×10.sup.6 cells each as one experimental replicate. For each round of screening, the cells were treated with an appropriate concentration: 70 ng/ml for the first round and 100 ng/ml for the second and third rounds. The details of the HBEGF and ANTXR1 screening were the same as described in our previous report.sup.(1).
[0146] The resistant cells from each screening were collected for genomic DNA and total RNA extraction, followed by reverse transcription. The sgRNA coding regions and cDNAs of the targeted genes obtained through PCR amplification were then subjected to next-generation sequencing (NGS) analysis.
Identification of Candidate sgRNA Sequences
[0147] Genomic DNA was extracted from an appropriate number of library cells using the DNeasy Blood and Tissue kit (Qiagen). The appropriate number of library cells was different for different drug/toxin treatments: 6.25×10.sup.5 for ANTXR1, 3×10.sup.6 for CSPG4, 2.5×10.sup.5 for HBEGF, 1.75×10.sup.5 for HPRT1, 6.3×10.sup.5 for PLK1 and 3×10.sup.5 for PSMB5. sgRNA regions were amplified via 26 cycles of PCR using primers' annealing to the flanking sequences of the sgRNAs. The PCR products from each replicate were pooled and purified with DNA Clean & Concentrator-5 (Zymo Research Corporation), indexed with different barcodes (NEB #7370, #7335, #7500) and analyzed via NGS.
cDNA Preparation and Sequencing
[0148] Total RNA was extracted from the library cells using the RNAprep Pure Cell/Bacteria Kit (TIANGEN), and cDNA was synthesized using the Quantscript RT Kit (TIANGEN). A two-step method was employed to construct libraries for NGS. The first step consisted of PCR amplification of the cDNA (26 cycles; PrimeSTAR HS DNA Polymerase, Takara). The primers used for the different genes (Primer for cDNA amplification) are listed in Table 1:
TABLE-US-00003 Gene Primer Sequence SEQ ID NO. ANTXR1 F1.sup.ANTXR1 5′-AACAGCATCGGAGCGGAAA-3′ SEQ ID NO: (Transcript 1) 30 R1.sup.ANTXR1 5′-TGGGCTTTATCACCACTCCTC-3′ SEQ ID NO: 31 ANTXR1 F2.sup.ANTXR1 5′-AATAAAGGACCCGCGAGGAAG-3′ SEQ ID NO: (Transcript 3) 32 R2.sup.ANTXR1 5′-TTTTCAGGAGTGTGCTGTCCG-3′ SEQ ID NO: 33 CSPG4 F1.sup.CSPG4 5′-TCCCAGCTCCCAGGACTC-3′ SEQ ID NO: 34 R1.sup.CSPG4 5′-GGGTGTTCTGAGTGTGCAGT-3′ SEQ ID NO: 35 F2.sup.CSPG4 5′-AGAGAGCCACTGTGTGGATGC-3′ SEQ ID NO: 36 R2.sup.CSPG4 5′-GGAAGTGTGCTCGCCGTCAG-3′ SEQ ID NO: 37 F3.sup.CSPG4 5′-GGGCTCGTGCTGTTCTCAC-3′ SEQ ID NO: 38 R3.sup.CSPG4 5′-GCACCAGGCATGGAAGCAAT-3′ SEQ ID NO: 39 HBEGF F1.sup.HBEGF 5′-CGAAAGTGACTGGTGCCTCG-3′ SEQ ID NO: 40 R1.sup.HBEGF 5′-GGTCCCAATGGCAGATCCCT-3′ SEQ ID NO: 41 HPRT1 F1.sup.HPRT1 5′-AGGCGAACCTCTCGGCTTT-3′ SEQ ID NO: 42 R1.sup.HPRT1 5′-CAATCCGCCCAAAGGGAAC-3′ SEQ ID NO: 43 PLK1 F1.sup.PLK1 5′-CTCTGCTCGGATCGAGGTCT-3′ SEQ ID NO: 44 R1.sup.PLK1 5′-GATGCAGGTGGGAGTGAGG-3′ SEQ ID NO: 45 PSMB5 F1.sup.PSMB5 5′-TTCCCCGACCCCCTTCAGTG-3′ SEQ ID NO: (Transcript 46 1 and 3) R1.sup.PSMB5 5′-AGGATGGGTCACTGTGTCCGT-3′ SEQ ID NO: 47 PSMB5 F2.sup.PSMB5 5′-TGGCCGACCTCACTTCC-3′ SEQ ID NO: (Transcript 2) 48 R2.sup.PSMB5 5′-AAGTAAAACAAATAGTCACCTCTGC-3′ SEQ ID NO: 49
[0149] The coding sequence of CSPG4 was approximately 6.9 kb in length, and three amplification reactions were employed to obtain overlapping fragments (˜50 bp) encompassing its full length. The PCR products from each cDNA fragment were pooled together and purified (DNA Clean & Concentrator-5, Zymo Research Corporation). Then, 1 μg of cDNA from each gene was sheared to ˜250 bp using the Covaris S2 system. The resulting sheared product was purified and concentrated using the DNA Clean & Concentrator-5 kit (Zymo Research Corporation) and indexed with different barcodes (NEB #7370, #7335, #7500) for NGS analysis.
Computational Methods for Identifying Functional Domains
[0150] The sequencing reads were mapped to the reference sequences of target genes using Bowtie2 2.3.2 and sorted using SAMtools 1.3.1. Next, we filtered the reads to retain those that carried only missense mutations or in-frame deletions. For fragments containing missense mutations, we computed the mutation ratio of each amino acid as follows:
[0151] For fragments containing in-frame deletions, we computed the deletion ratio of each amino acid as follows:
[0152] We then categorized the mutation types based on the number of amino acid deletions that they generated, and we classified them as either “driver deletions”, if they contained only single amino acid deletions, or “passenger deletions”, if they contained multiple amino acid deletions. After determining the mutation/deletion ratios and decoding the deletion patterns, the fold changes between the experimental and control groups were computed.
[0153] Next, the essential score for each amino acid was computed as follows: for the mutation fold change, a null distribution was built based on all fold changes, and score.sub.mutation=−log 10(P-value) was computed for each amino acid. For the deletion fold change, we first applied a tunable parameter, α, to weight the driver mutation and passenger mutation as follows:
deletion fold change=driver fold change+α*passenger fold change.
[0154] Subsequently, a null distribution was built via permutation 100 times, and score.sub.deletion=−log10(P-value) was computed for each amino acid. Next, score.sub.mutation and score.sub.deletion were normalized as follows:
[0155] We then computed the weights of score.sub.mutation and score.sub.deletion as follows:
[0156] Finally, the essential score was computed as follows:
essential score=w.sub.GHIJIKLM*score.sub.GHIJIKLM+w.sub.STUTIKLM*score.sub.STUTIKLM
Validation of the Screening Results
[0157] For the validation of critical mutations of PSMB5 and PLK1, sgRNAs were designed near the mutation site, and each 119 nt ssODN donor encoded one amino acid substitution for a validated residue. All sgRNAs (sgRNA sequences for the validation of critical mutations) and ssODN donor sequences (ssODN donors encoded one amino acid substitution for a validated residue) are listed in Table 2 as follows.
TABLE-US-00004 Amino SEQ ID SEQ ID Gene acid sgRNA NO. ssODN NO. PSMB5 R78 5′-GTAA SEQ ID 5′-TTTTTGTGGTCTTATGTGGCCTGTTTTGTG SEQ GCACC NO: 50 TTTTCCTCTGATCTTAACAGTTCCGCCATG NO: 61 CGCTGT GAGTCATAGTTGCAGCTGACAGCAACGC AGCCC-3′ TACAGCGGGTGCTTACATTGCCTCCCAGA CG-3′ PSMB5 T80 5′-GTAA SEQ ID 5′-TTTTTGTGGTCTTATGTGGCCTGTTTTGTG SEQ ID GCACC NO: 50 TTTTCCTCTGATCTTAACAGTTCCGCCATG NO: 62 CGCTGT GAGTCATAGTTGCAGCTGACAGCAGGGC AGCCC-3′ TGCCGCGGGTGCTTACATTGCCTCCCAGA CG-3′ PSMB5 V90 5′-CTAT SEQ ID 5′-TTTCCTCTGATCTTAACAGTTCCGCCATG SEQ ID CACCTT NO: 51 GAGTCATAGTTGCAGCTGACTCCAGGGCT NO: 63 CTTCAC ACAGCGGGTGCTTACATTGCCTCACAGA CGTC-3′ CGGCCAAGAAGGTGATAGAGATCAACCC ATACC-3′ PSMB5 M104 5′-CCTG SEQ ID 5′-AGATGCGTTCCTTATTTCGAAGCTCATA SEQ ID CTAGG NO: 52 GATTCGACATTGCCGAGCCAACAGCCGTT NO: 64 CACCAT CCCAGAAGCTGCAATCCGCTGCGCCGCCA GGCTG-3′ GCGATGGTGCCTAGCAGGTATGGGTTGAT CTCT-3′ PSMB5 A108 5′-AATC SEQ ID 5′-ACTCCAGGGCTACAGCGGGTGCTTAC SEQ ID CGCTG NO: 53 ATTGCCTCCCAGACGGTGAAGAAGGTGA NO: 65 CGCCC TAGAGATCAACCCATACCTGCTAGGCACA CCAGC ATGGCTGGGGGCACCGCGGATTGCAGCT CA-3′ TCTGGGAA-3′ PSMB5 D110 5′-GCGC SEQ ID 5′-CAGTTTGGAGGCAGCTGCTACAGAGAT SEQ ID AGCGG NO: 54 GCGTTCCTTATTTCGAAGCTCATAGATTC NO: 66 ATTGC GACATTGCCGAGCCAACAGCCGTTCCCA AGCTTC-3′ GAAGCTGCAGGCCGCTGCGCCCCCAGCC ATGGTGC-3′ PSMB5 C111 5′-GCGC SEQ ID 5′-CAGTTTGGAGGCAGCTGCTACAGAGAT SEQ ID AGCGG NO: 54 GCGTTCCTTATTTCGAAGCTCATAGATTC NO: 67 ATTGC GACATTGCCGAGCCAACAGCCGTTCCCA AGCTTC-3′ GAAGCTGGCATCCGCTGCGCCCCCAGCC ATGGTGC-3′ PSMB5 C122 5′-TCTG SEQ ID 5′-ATACACCATGTTGGCAAGCAGTTTGG SEQ ID GGAAC NO: 55 AGGCAGCTGCTACAGAGATGCGTTCCTT NO: 68 GGCTGT ATTTCGAAGCTCATAGATTCGGAATTGG TGGCT-3′ CGAGCCAACAGCCGTTCCCAGAAGCTGC AATCCGCTG-3′ PSMB5 G242 5′-TCCA SEQ ID 5′-GCAGGCCTATGATCTGGCCCGTCGAG SEQ ID GCCATC NO: 56 CCATCTACCAAGCCACCTACAGAGATGC NO: 69 CTCCCG CTACTCAGGAGGTGCAGTCAACCTCTAT CACG-3′ CACGTGCGGGAGGATGACTGGATCCGAG TCTCCAGTG-3′ PSMB5 Negative 5′-TCTT SEQ ID 5′-CGCAGCCTCGCCCACCAGCACGTCGTAG SEQ ID AGCTG NO: 57 GATTCCACGGCTTTTTCGAGGACAACGACT NO: 70 ACTAC TCGTGTTCGTGGTGTTGGAGCTCTGTAGCA GCGTA GGGTGAGTGTCGCTGCTGGGGAACTGGAAC A-3′ T-3′ PLK1 C67 5′-GTCC SEQ ID 5′-AAGAGATCCCGGAGGTCCTAGTGGACCC SEQ ID GAGAT NO: 58 ACGCAGCCGGCGGCGCTATGTGCGGGGCC NO: 71 CTCGA GCTTTTTGGGCAAGGGCGGCTTTGCAAA AGCAC GGTGTTCGAGATCTCGGACGCGGACACC T-3′ AAGGAG-3′ PLK1 R136 5′-CAGC SEQ ID 5′-CAGCCTCGCCCACCAGCACGTCGTAGGA SEQ ID GACAC NO: 59 TTCCACGGCTTTTTCGAGGACAACGACTTC NO: 72 TCACCC GTGTTCGTGGTGTTGGAGCTCTGTAGGCG TCCGG-3′ GGGCGTGAGTGTCGCTGCTGGGGAACTG GAAC-3′ PLK1 F183 5′-CCTT SEQ ID 5′-CTCCCAGCCTCCTCCAAATTCCAGCCT SEQ ID TTCCTG NO: 60 OCTTGTAGTGATGTCAAGCACCCCTGCAGG NO: 73 AATGA CTCAGCAACTCACCTATTTTCACCTCGAGAT AGATC-3′ CTTCATTCAGCAGAAGGTTGCCCAGCTTG AGG-3′ PLK1 Negative 5′-TCTT SEQ ID 5′-ACTCCAGGGCTACAGCGGGTGCTTAC SEQ ID AGCTG NO: 57 ATTGCCTCCCAGACGGTGAAGAAGGTGA NO: 74 ACTAC TAGAGATCAACCCATACCTGCTAGGCACA GCGTA ATGGCTGGGGGCGCGGATTGCAGCTTCT A-3′ GGGAACGG-3′
[0158] HeLa cells were transfected with 1 μg of sgRNA and 2 μg of the ssODN donor in six-well plates. Fourteen days after transfection, 1.5×10.sup.5 cells were seeded in six-well plates 24 hour before drug selection. Cells were treated with drugs at the proper dosages for 72 hour: bortezomib (8 ng/ml); BI2536 (10 ng/ml). The genomes of drug-resistant cells were extracted using the TIANamp Genomic DNA Kit (TIANGEN).
[0159] The mutated loci were amplified using TransTaq DNA Polymerase High Fidelity (Transgen) and purified using a Universal DNA Purification Kit (TIANGEN). The primers (primers for amplification of mutated loci in PSMB5 gene) are listed in Table 3.
TABLE-US-00005 Name of SEQ Primers Sequence ID NO. Description PSMB5-F1 5′-GTGTTTTTGTGGTCTTATGTGGCC-3′ SEQ ID For PCR NO: 75 amplification of PSMB5-R1 5′-CATGTGGTTGCAGCTTAACTCAC-3′ SEQ ID sgRNA targeted NO: 76 region of PSMB5 PSMB5-F2 5′-GATGTGAAGCTCGGGTGACATT-3′ SEQ ID gene locus for NO: 77 Sanger sequencing PSMB5-R2 5′-TCAGCATTGACACCAAGCCCTTT-3′ SEQ ID (R78, T80, M104, NO: 78 A108). PSMB5-F3 5′-CTGCTAACCTCATCTCCCTTTCCAG-3 SEQ ID For PCR NO: 79 amplification of PSMB5-R3 5′-CAAGCAGCTGCATCCACCCTCTT-3 SEQ ID sgRNA targeted NO: 80 region of PSMB5 gene locus for Sanger sequencing (G242).
[0160] PCR fragments were cloned into the pEASY-T5 Zero Cloning Kit (Transgen) for sequencing.
Cytotoxicity Assay
[0161] Cells were seeded in 96-well plates 24 hour before drug or toxin treatment (5,000 cells for diphtheria toxin (DT) and 3,000 cells for bortezomib), and different concentrations of bortezomib or DT were added. Cells were incubated at 37° C. for 48 hour (DT) or 72 hour (bortezomib) before the addition of 1 mg/ml of MTT (3-[4,5 -dimethylthiazol-2-yl]-2,5 -diphenyltetrazolium bromide). Spectrophotometer readings at 570 nm were collected using BioTek Cytation5 (BioTek Instruments).
Results
[0162] To test CRESMAS approach in mapping functional elements of proteins, we selected three genes encoding bacterial toxin receptors (ANTXR1, CSPG4 and HBEGF) and three genes encoding cancer drug targets (HPRT1, PLK1 and PSMBS) (Table 4 as follows).
TABLE-US-00006 Critical a.a. or Size of domain for Selection Target gene protein target function of screen Drug/Toxin (essentiality) (a.a.) (known) Bacterial Anthrax toxin ANTXR1 (No) 564 56-67 a.a., toxin 154-160 a.a. TcdB of CSPG4 (No) 2,322 401-560 a.a. Clostridum difficile Diphtheria HBEGF (No) 208 F115, L127, toxin E141 Cancer 6-TG HPRT1 (No) 218 NA drug BI2536 PLK1 (Yes) 603 G63, C67, R136 Bortezomib PSMB5 (Yes) 263 R78, A79, T80, M104, A108, C111, C122, G242
[0163] We chose HeLa cells to construct the CRISPR library for screening because we have determined the appropriate killing conditions in this line for toxins.sup.(8, 11) and drugs, e.g., 6-TG (6-Thioguanine) targeting HPRT1.sup.(12), BI2536 targeting PLK1.sup.(13) and Bortezomib targeting PSMBS.sup.(14) (
[0164] For targeted genes, sgRNAs were designed in silico and synthesized on a chip as pools to construct a saturation CRISPR library covering the full length of three receptor coding genes, and another library covering three drug targets (
[0165] We performed two replicates of functional screens for each of six treatments in addition to a control screen with no treatment. The sgRNA coverage of six genes was approximately 0.99 assuming that each sgRNA would affect 10-bp around the DSB site.sup.(15) (
[0166] Meanwhile, these harvested resistant cells were subjected to total RNA isolation and reverse transcription to obtain cDNAs, which were subsequently used as templates for PCR amplification. Full length cDNAs of target genes were obtained through amplification using specific primers. For large-sized gene, such as CSPG4, three pairs of primers were used for amplification of three overlapping fragments in order to cover its full length. For genes with alternative splicing, specific primer pairs were designed to ensure all alternative transcripts were included (
[0167] The percentages of mutations in control libraries were at low level for all six targets, and these numbers increased significantly after screening, especially the indels generated by CRISPR libraries. The relatively higher rates of point mutations in all controls were likely due to errors generated in PCR amplification and NGS. Nevertheless, reads of point mutation after all six screenings increased, suggesting certain point mutations did contribute to resistance phenotypes (
[0168] Applying CRESMAS strategy with streamlined algorithms, we could obtain the function-related amino acid maps. We purposely assigned solid line to driver deletions because there is no ambiguity for the significance of this one-amino-acid-deletion type, while we assigned grey lines (10% scale) to those passenger deletions. We also merged the single missense mutation data with deletion data into one plot for easy visualization. Similar to single-amino-acid-deletion, loss of protein function due to missense point mutation demonstrated that the affected amino acid was essential for protein's function.
[0169] For the functional screening of HBEGF, which encodes a receptor for diphtheria toxin (DT), most of the resistant cells carried deletions in EGF-like domain (
TABLE-US-00007 Amino Essen Amino Essen Amino Essen Acid Score Acid Score Acid Score 1 0.921289 151 0.062539 301 0.177932 2 0.077758 152 0.052577 302 0.059038 3 0.086672 153 0.276565 303 0.046487 4 0.030951 154 0.269416 304 0.363141 5 0.003633 155 0.572413 305 0.000961 6 0.0312 156 0.328178 306 0.005788 7 0.001443 157 0.115233 307 0.015109 8 0.028691 158 0.104132 308 0.05581 9 0.006644 159 0.199057 309 0.029554 10 0.027314 160 0.063618 310 0.046642 11 0.006079 161 0.006956 311 0.007768 12 0.010719 162 0.009137 312 0.005467 13 0.004849 163 0.011146 313 0.012518 14 0.088955 164 0.010824 314 0.011814 15 0.07926 165 0.271294 315 0.103653 16 0.130578 166 0.001678 316 0.18333 17 0.192124 167 0.013849 317 0.015036 18 0.349262 168 0.035756 318 0.000936 19 0.305694 169 0.051211 319 0.012339 20 0.116694 170 0.036975 320 0.017882 21 0.042397 171 0.004485 321 0.019732 22 0.044853 172 0.021169 322 0.002919 23 0.04109 173 0.014891 323 0.024174 24 0.004683 174 0.000763 324 0.130319 25 0.023049 175 0.002948 325 0.006415 26 0.028083 176 0.224824 326 0.034959 27 0.001495 177 0.07841 327 0.132617 28 0.238243 178 0.004323 328 0.043679 29 0.195796 179 0.013199 329 0.003153 30 0.178247 180 0.053144 330 0.024623 31 0.186536 181 0.001314 331 0.085095 32 0.059505 182 0.005609 332 0.124583 33 0.059277 183 0.181 333 0.112557 34 0.100536 184 0.052822 334 0.009904 35 0.168163 185 0.064335 335 0.061706 36 0.00512 186 0.124621 336 0.017791 37 0.008151 187 0.038382 337 0.117336 38 0.022264 188 0.036751 338 0.350896 39 0.008815 189 0.039762 339 0.353281 40 0.007937 190 0.377817 340 0.67822 41 0.022392 191 0.366091 341 0.335075 42 0.007437 192 0.385377 342 0.278946 43 0.032757 193 0.295004 343 0.106537 44 0.006877 194 0.230583 344 0.106189 45 0.010666 195 0.075909 345 0.014963 46 0.432089 196 0.002861 346 0.03399 47 0.095925 197 0.006228 347 0.036004 48 0.093355 198 0.068803 348 0.058405 49 0.009278 199 0.001086 349 0.167458 50 0.009091 200 0.038828 350 0.052496 51 0.000592 201 0.206937 351 0.05739 52 0.00868 202 0.350939 352 0.003421 53 0.009757 203 0.101272 353 0.012579 54 0.002353 204 0.041299 354 0.007356 55 0.059413 205 0.000986 355 0.081875 56 0.061114 206 0.020376 356 0.106963 57 0.904081 207 0.011871 357 0.21742 58 0.351311 208 0.155582 358 0.204816 59 0.355816 209 0.036448 359 0.247954 60 0.033665 210 0.040254 360 0.17757 61 0.035069 211 0.005573 361 0.040373 62 0.034171 212 0.006378 362 0.033457 63 0.135284 213 0.015866 363 0.106205 64 0.383144 214 0.153485 364 0.178173 65 0.202795 215 0.040539 365 0.165964 66 0.098151 216 0.040157 366 0.163801 67 0.090015 217 0.004259 367 0.004291 68 0.304371 218 0.004068 368 0.004816 69 0.004716 219 0.08122 369 0.016422 70 0.008457 220 0.014676 370 0.023599 71 0.045809 221 0.006153 371 0.02346 72 0.033796 222 0.007234 372 0.119106 73 0.529036 223 0.002215 373 0.141732 74 0.010153 224 0.00781 374 0.034062 75 0.055612 225 0.017701 375 0.013262 76 0.585654 226 0.082144 376 0.018157 77 0.32799 227 0.004551 377 0.023741 78 0.087957 228 0.016668 378 0.005824 79 0.086384 229 0.247671 379 0.021644 80 0.039652 230 0.248948 380 0.049295 81 0.061864 231 0.331271 381 0.034753 82 0.080595 232 0.357889 382 0.00052 83 0.003182 233 0.661655 383 0.001238 84 0.004518 234 0.012161 384 0.007194 85 0.005155 235 0.008635 385 0.017004 86 0.026239 236 0.00495 386 0.034225 87 0.025733 237 0.001011 387 0.084803 88 0.258091 238 0.00634 388 0.033432 89 0.045798 239 0.157889 389 0.096853 90 0.011092 240 0.442781 390 0.068293 91 0.074874 241 0.383787 391 0.001391 92 0.053676 242 0.115636 392 0.198336 93 0.477454 243 0.016835 393 0.087909 94 0.072754 244 0.002833 394 0.084606 95 0.107263 245 0.041855 395 0.014256 96 0.060908 246 0.003242 396 0.003602 97 0.062028 247 0.184554 397 0.031453 98 0.39954 248 0.069235 398 0.051013 99 0.00798 249 0.030231 399 0.076964 100 0.00568 250 0.043042 400 0.003818 101 0.005896 251 0.006265 401 0.002188 102 0.349741 252 0.352596 402 0.038386 103 0.493395 253 0.196369 403 0.0127 104 0.314871 254 0.013651 404 0.095579 105 0.353984 255 0.012398 405 0.005644 106 0.016101 256 0.019525 406 0.007074 107 0.00676 257 0.019219 407 0.009515 108 0.007114 258 0.014464 408 0.017435 109 0.299805 259 0.003542 409 0.009855 110 0.235559 260 0.003511 410 0.004453 111 0.195588 261 0.003572 411 0.008022 112 0.372971 262 0.072078 412 0.004036 113 0.481531 263 0.168776 413 0.022651 114 0.043335 264 0.016181 414 0.065987 115 0.019422 265 0.014325 415 0.033228 116 0.017175 266 0.003271 416 0.024776 117 0.055276 267 0.017973 417 0.00289 118 0.00465 268 0.033743 418 0.010931 119 0.00859 269 0.014119 419 0.005224 120 0.036676 270 0.001917 420 0.004917 121 0.071107 271 0.060375 421 0.033383 122 0.1135 272 0.565878 422 0.021286 123 0.123012 273 0.058195 423 0.028485 124 0.332336 274 0.06159 424 0.006799 125 0.220644 275 0.097638 425 0.000616 126 0.012103 276 0.003006 426 0.003036 127 0.044348 277 0.003301 427 0.073299 128 0.059597 278 0.001263 428 0.01051 129 0.0881 279 0.00181 429 0.01142 130 0.027129 280 0.084217 430 0.037141 131 0.000911 281 0.067185 431 0.016751 132 0.001783 282 0.076735 432 0.000496 133 0.002436 283 0.231922 433 0.007685 134 0.005362 284 0.209038 434 0.019628 135 0.206245 285 0.003849 435 0.007275 136 0.006567 286 0.001469 436 0.109582 137 0.005538 287 0.001111 437 0.076183 138 0.030466 288 0.003451 438 0.089329 139 0.004782 289 0.035848 439 0.08851 140 0.015944 290 0.060992 440 0.011255 141 0.094307 291 0.00966 441 0.003212 142 0.026068 292 0.000886 442 0.035817 143 0.014187 293 0.128379 443 0.015183 144 0.01339 294 0.117505 444 0.033089 145 0.006453 295 0.455059 445 0.003391 146 0.033381 296 0.150777 446 0.012045 147 0.047499 297 0.01131 447 0.005752 148 0.073985 298 0.020823 448 0.00442 149 0.006006 299 0.292619 449 0.062092 150 0.003911 300 0.331777 450 0.011365 451 0.010103 501 0.00216 551 0.006302 452 0.016919 502 0.000163 552 0.012947 453 0.000448 503 4.64E-05 553 0.128804 454 0.021766 504 0.000281 554 0.007478 455 0.009372 505 0.00014 555 0.022138 456 0.048329 506 0.016586 556 0.007396 457 0.127086 507 0.103799 557 0.027693 458 0.014819 508 0.000116 558 0.336684 459 0.018726 509 0.009611 559 0.006683 460 0.378648 510 6.96E-05 560 0.002242 461 0.133893 511 0.000328 561 0.021524 462 0.094774 512 0.000352 562 0.229858 463 0.072621 513 0.000376 563 0.020486 464 0.086148 514 0.045227 564 0.040766 465 0.294546 515 0.050857 565 0.054081 466 0.003331 516 0.121957 467 0.032521 517 0.086478 468 0.026765 518 0.087591 469 0.012823 519 0.040593 470 0.032246 520 0.000837 471 0.010771 521 0.001161 472 0.031976 522 0.001521 473 0.029329 523 0.0402 474 0.370677 524 0.033928 475 0.235764 525 0.010407 476 0.08083 526 0.011532 477 0.082251 527 0.000861 478 0.023321 528 0.00189 479 0.02493 529 0.000738 480 0.057346 530 0.050739 481 0.020158 531 0.032326 482 0.006491 532 0.004005 483 0.007727 533 0.0004 484 0.014051 534 0.001547 485 0.017612 535 0.002381 486 0.006916 536 0.00877 487 0.022915 537 0.000787 488 0.054246 538 0.010614 489 0.093727 539 0.013455 490 0.002804 540 0.000471 491 0.01352 541 0.034782 492 0.010254 542 0.120919 493 0.046589 543 0.032185 494 0.00252 544 0.03742 495 0.009184 545 0.000568 496 0.010003 546 0 497 0.015634 547 0.06634 498 0.000424 548 0.088198 499 0.000257 549 0.073901 500 0.030706 550 0.005052
[0170] By computing the essential scores (Table 6), we found that the amino acids with the highest scores were indeed enriched in the EGF-like domain, further confirmed the essentiality of this domain in mediating toxin binding. The three known amino acids essential for DT-HBEGF interaction, F115, L127 and E141.sup.(17), were top ranked (21th, 15th and 28th) among all amino acids. Importantly, CRESMAS approach revealed a number of novel sites besides these three that appeared important for receptor function (
[0171] For anthrax toxin's receptor, ANTXR1, all resistant cells carried variety of deletions across the whole coding region except that encoding the cytoplasmic domain (
[0172] For CSPG4, the receptor of Clostridium difficile toxin B (TcdB), the peaks of mutants were mainly located in the first and last two CSPG repeats (
[0173] As for the three genes encoding cancer drug targets, HPRT1 is a nonessential gene, while PLK1 and PSMB5 are two essential genes.sup.(19). For nonessential target HPRT1, 6-TG screening of the library showed that most of sgRNAs were enriched and evenly distributed (
[0174] For essential targets, PLK1 and PSMB5, sgRNA sequencing did provide the approximate locations of certain critical amino acids where sgRNAs generated in-frame mutations (
[0175] Because missense point mutations were the predominant formats conferring drug resistance for both PSMB5 and PLK1, we decided to employ ssODN-mediated method.sup.(24) to create specific point mutations instead of deletions for validation. We selected nine amino acid residues (R78, T80, V90, M104, A108, D110, C111, C122 and G242) in PSMB5, among which D110 and C111 were included as controls. To choose a proper amino acid for point mutation, the mutant types from screening results or previous reports were preferential choices. For the rest, we made all the substitution to alanine (Table 2). Cells transfected with donors containing one of the following mutations, R78N, T80A, V90A, M104A, A108T, C122F and G242D, produced variable number of Bortezomib resistant colonies (
[0176] For PLK1, we validated two top ranking residues (R136 and F183) and one potential false negative site (C67). It has been reported R136 is a critical amino acid for BI2536 and F183 is structurally important when PLK1 binds to BI2536.sup.(22, 23). Point mutation on either one of these three sites conferred BI2536 resistance in the pooled assay (
[0177] For missense mutation, each amino acid has 19 kinds of nonsynonymous substitutions. We hypothesized that different substitutions might have distinct effects, and some changes might not produce any phenotypic difference. To examine whether CRESMAS strategy could generate such details, we retrieved missense mutation data of top 10 hits from each of PSMB5 and PLK1 screenings, and performed amino acid pattern analysis. We revealed the clear pattern preference for these amino acids, indicating that only certain substitutions could confer cell resistance to drugs (
[0178] In sum, CRESMAS is a powerful method to generate sequence-to-function maps. It is often very laborious to use truncation mutagenesis to identify potential functional domain, and this becomes increasingly difficult if the protein size is too big. It is also technically difficult, if not impossible, to assess the significance of each and every amino acid spanning the full length of the protein of interest. Gill and colleagues have recently described a method to map functional relevant mutations in protein of interest in bacterium or yeast, however, this method heavily relies on homologous recombination rate, preventing its effective application in higher eukaryotes.sup.(28). CRESMAS is particularly powerful when dealing with large-sized protein. What's more, one could scan multiple genes simultaneously to obtain functional elements for their corresponding proteins.
[0179] The CRISPR saturation mutagenesis provided multiplex mutations covering every amino acid. Different from many other methods, only small percentages of NGS data in respect of in-frame or point mutations were useful reads for CRESMAS. Although we filtered a large number of reads during data preprocessing, we found that our bioinformatics pipeline was sensitive enough to map functional elements from the remaining reads for a moderate sequencing depth. The fact that we could identify most amino acids critical for protein function in all six trials indicates that CRESMAS has low false negative rate.
[0180] CRESMAS approach could potentially uncover all residues whose mutations would abolish protein function. However, this does not mean that every hit obtained from CRESMAS screening is directly relevant to protein function. Some residues are important for overall structure of a given protein, but may not directly mediate protein's enzymatic activity or its contact to interaction partner. For instance, we did identify a number of hits located within the transmembrane domain of ANTXR1 (
[0181] CRESMAS strategy is not limited to only study proteins. It is well suited to acquire functional maps of regulatory elements, such as noncoding RNA, promotors and enhancers. The modification in protocol is to perform PCR amplification on the targeted region on the genome instead of cDNA described above.
REFERENCES
[0182] 1. M. Jinek et al., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821 (2012). [0183] 2. M. E. Burkard, A. Santamaria, P. V. Jallepalli, Enabling and disabling polo-like kinase 1 inhibition through chemical genetics. ACS chemical biology 7, 978-981 (2012). [0184] 3. L. Cong et al., Multiplex Genome Engineering Using CRISPR/Cas Systems. Science 339, 819-823 (2013). [0185] 4. P. Mali et al., RNA-guided human genome engineering via Cas9. Science 339, 823-826 (2013). [0186] 5. O. Shalem et al., Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343, 84-87 (2014). [0187] 6. T. Wang, J. J. Wei, D. M. Sabatini, E. S. Lander, Genetic screens in human cells using the CRISPR-Cas9 system. Science 343, 80-84 (2014). [0188] 7. H. Koike-Yusa, Y. Li, E. P. Tan, C. Velasco-Herrera Mdel, K. Yusa, Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol 32, 267-273 (2014). [0189] 8. Y. Zhou et al., High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature 509, 487-491 (2014). [0190] 9. G. M. Findlay, E. A. Boyle, R. J. Hause, J. C. Klein, J. Shendure, Saturation editing of genomic regions by multiplex homology-directed repair. Nature 513, 120-123 (2014). [0191] 10. M. C. Canver et al., BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis. Nature 527, 192-197 (2015). [0192] 11. P. Yuan et al., Chondroitin sulfate proteoglycan 4 functions as the cellular receptor for Clostridium difficile toxin B. Cell Res 25, 157-168 (2015). [0193] 12. J. Duan, L. Nilsson, B. Lambert, Structural and functional analysis of mutations at the human hypoxanthine phosphoribosyl transferase (HPRT1) locus. Human mutation 23, 599-611 (2004). [0194] 13. M. Steegmaier et al., BI 2536, a potent and selective inhibitor of polo-like kinase 1, inhibits tumor growth in vivo. Curr Biol 17, 316-322 (2007). [0195] 14. D. Chen, M. Frezza, S. Schmitt, J. Kanwar, Q. P. Dou, Bortezomib as the first proteasome inhibitor anticancer drug: current status and future perspectives. Curr Cancer Drug Targets 11, 239-253 (2011). [0196] 15. M. van Overbeek et al., DNA Repair Profiling Reveals Nonrandom Outcomes at Cas9-Mediated Breaks. Mol Cell 63, 633-646 (2016). [0197] 16. S. Zhu et al., Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library. Nat Biotechnol 34, 1279-1286 (2016). [0198] 17. T. Mitamura et al., Structure-function analysis of the diphtheria toxin receptor toxin binding site by site-directed mutagenesis. J Biol Chem 272, 27084-27090 (1997). [0199] 18. S. Fu et al., The structure of tumor endothelial marker 8 (TEM8) extracellular domain and implications for its receptor function for recognizing anthrax toxin. PLoS One 5, e11203 (2010). [0200] 19. T. Hart et al., High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell 163, 1515-1526 (2015). [0201] 20. S. Lu, J. Wang, The resistance mechanisms of proteasome inhibitor bortezomib. Biomark Res 1, 13 (2013). [0202] 21. N. E. Franke et al., Impaired bortezomib binding to mutant beta5 subunit of the proteasome is the underlying basis for bortezomib resistance in leukemia cells. Leukemia 26, 757-768 (2012). [0203] 22. S. A. Wacker, B. R. Houghtaling, 0. Elemento, T. M. Kapoor, Using transcriptome sequencing to identify mechanisms of drug action and resistance. Nat Chem Biol 8, 235-237 (2012). [0204] 23. R. N. Murugan et al., Plkl-targeted small molecule inhibitors: molecular basis for their potency and specificity. Mol Cells 32, 209-220 (2011). [0205] 24. C. D. Richardson, G. J. Ray, M. A. DeWitt, G. L. Curie, J. E. Corn, Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol, (2016). [0206] 25. L. H. de Wilt et al., Proteasome-based mechanisms of intrinsic and acquired bortezomib resistance in non-small cell lung cancer. Biochem Pharmacol 83, 207-217 (2012). [0207] 26. E. Suzuki et al., Molecular mechanisms of bortezomib resistant adenocarcinoma cells. PLoS One 6, e27996 (2011). [0208] 27. G. T. Hess et al., Directed evolution using dCas9-targeted somatic hypermutation in mammalian cells. Nat Methods, (2016). [0209] 28. A. D. Garst et al., Genome-wide mapping of mutations at single-nucleotide resolution for protein, metabolic and genome engineering. Nat Biotechnol 35, 48-55 (2017).