MOLECULAR MARKER RELATED TO WOOL YIELD OF LONG-HAIRED RABBIT AND USE THEREOF
20220186289 · 2022-06-16
Assignee
- Shandong Agricultural University (Tai'an City, CN)
- Mengyin Yida Rabbit Industry Co., Ltd (Linyi City, CN)
Inventors
- Xinzhong FAN (Tai'an City, CN)
- Liang SONG (Tai'an City, CN)
- Xibo QIAO (Tai'an City, CN)
- Aiguo YANG (Tai'an City, CN)
- Yuanfeng YANG (Tai'an City, CN)
- Lu ZHANG (Tai'an City, CN)
- Zhaolu WANG (Tai'an City, CN)
Cpc classification
C12Q1/6888
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure relates to the technical field of molecular marker breeding of rabbits, in particular to a molecular marker related to a wool yield of a long-haired rabbit and use thereof in breeding. The molecular marker includes a mutant of a keratin 26 gene (KRT26 gene), where the KRT26 gene is as shown in SEQ ID NO: 1, the mutant of the KRT26 gene is formed by mutation of a base G at position 41844263 of a KRT26 gene locus to a base A. In the present disclosure, the wool yield trait of the long-haired rabbit and the KRT26 gene are subjected to association study and population verification, and it is found that an individual long-haired rabbit with an allele G has a higher wool yield, with an additive gene effect of 15.59 g; the base substitution can control an overall genetic variation of the wool yield by 1.51%.
Claims
1. A molecular marker related to a wool yield of a long-haired rabbit, comprising a mutant of a keratin 26 gene (KRT26 gene), wherein the KRT26 gene is as shown in SEQ ID NO: 1, and the mutant of the KRT26 gene is formed by mutation of a base G at position 41844263 of a KRT26 gene locus to a base A.
2. An amplification primer of the molecular marker according to claim 1, comprising primers as shown in SEQ ID NO: 2 and SEQ ID NO: 3, for amplifying the KRT26 gene.
3. (canceled)
4. A screening method of the molecular marker according to claim 1, comprising the following steps: conducting polymerase chain reaction (PCR) amplification on a genomic DNA of an individual sample of a long-haired rabbit to be tested using the primers according to claim 2 to obtain PCR products, selecting a gene single nucleotide polymorphism (SNP) site based on the PCR products, and conducting SNP typing using a flight mass spectrometry method to determine whether a base at position 41844263 of a KRT26 gene locus is a base G or mutated to a base A.
5. The screening method according to claim 4, wherein the PCR products have a length of 250 bp.
6. The screening method according to claim 4, wherein the SNP typing using a flight mass spectrometry method specifically comprises the following steps: S1, according to SNP site information, designing PCR reaction and single-base amplification primers, and conducting quality control on genomic DNA samples to obtain qualified genomic DNA samples; S2, subjecting the qualified genomic DNA samples to PCR reaction, and conducting SAP digestion and extension to obtain a reaction product; and S3, diluting the reaction product, desalting by a resin, spotting a desalted sample on a sample target, crystallizing naturally, and conducting mass spectrometry detection to collect data.
7. The screening method according to claim 4, wherein the selecting a gene SNP site is conducted by DNA pooling sequencing, specifically comprising the following steps: S1, DNA pooling construction: randomly selecting 100 genomic DNA samples from individuals of long-haired rabbits to be tested, and mixing each 20 genomic DNA samples in equal volume into a DNA pooling; and S2, according to a rabbit KRT26 gene sequence on a database, conducting PCR amplification with the primers according to claim 2 at an annealing temperature of 45-55° C.
8. The screening method according to claim 7, wherein in step S2, the annealing temperature is 53° C.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0026]
[0027]
[0028]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0029] To better explain the objectives, technical solutions, and advantages of the present disclosure, the present disclosure will be further explained below with reference to accompanying drawings and specific examples. It should be emphasized that, unless otherwise specified, the technical means used in these examples are conventional means well known to those skilled in the art, and the reagents used are all commercially-available chemical reagents.
[0030] Example I Detection of a KRT26 gene mutant in a long-haired rabbit
[0031] 1. Selection of test materials: in the present disclosure, 757 long-haired rabbit samples in total were used as test materials, which were jointly bred by Shandong Mengyin Vida Rabbit Industry Co., Ltd. and Shandong Agricultural University. On the 283th day after birth (fourth shearing), the rabbits were raised for wool growth under uniform conditions for 73 d, and an individual wool yield and fiber quality indicators were measured. Wool samples were cut on a center of a side of the rabbit body using scissors, a piece of ear tissue with a size of a soybean grain was cut using surgical scissors; the ear tissue was put into a 1.5 mL centrifuge tube containing 75% alcohol, and taken back to the laboratory, stored at −20° C. for subsequent genomic DNA extraction. The reagents used in the experiment were purchased from companies such as TaKaRa.
[0032] 2. Experimental method: a genomic DNA was extracted from the ear tissue sample by high-salt method, and DNA concentration and quality were detected with a spectrophotometer. The extracted DNA was stored at -20° C.
[0033] S1. DNA pooling construction: 100 genomic DNA samples were randomly selected from the above individuals of long-haired rabbits to be tested, and each 20 genomic DNA samples were mixed in equal volume into a DNA pooling.
[0034] S2. Candidate gene primer design: according to a rabbit KRT26 gene sequence on an ensemble database (such as SEQ ID NO: 1), primers of an exon coding region of the above gene was designed using Primer 5.0, where the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and a primer sequence information was shown in the table below.
TABLE-US-00001 TABLE 1 Primers for amplifying genomic DNA Annealing Primer Length temperature name Sequence (5′-′) bp (° C.) KRT26 F AAAGAGTCCTACGAGAGCTC 250 53.0 R CTGTCTTGGCCGTCGAGTAA
TABLE-US-00002 the following components were added in to a PCR tube: KRT26 gene sequence (50 μg/ml) 1.0 μL Primer F (10 μmol/ml) 1.0 μL Primer R (10 μmol/ml) 1.0 μL Taq enzyme mixed solution 12.5 μL adding ddH.sub.2O to make up to: 25 μL PCR amplification is conducted by: pre-denaturation at 95° C. for 10 min; conducting 35 cycles: denaturation at 95° C. for 45 sec annealing at 53° C. extension at 72° C. for 30 sec; extension at 72° C. for 10 min
[0035] After the reaction was complete, PCR products were stored in a refrigerator at 4° C. for sample loading detection and subsequent test analysis.
[0036] PCR amplification results were detected using 1% agarose gel electrophoresis. Electrophoresis detection shows that the KRT26 gene sequence is specific to all PCR products of the primer, and a fragment size is consistent with expectations, and there is no non-specific amplified band (referring to the electrophoresis diagram in
[0037] The qualified PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for cloning sequencing, and gene SNP sites were selected; SNP typing was conducted by a flight mass spectrometry method; after the cloning sequencing was completed, sequencing results were analyzed using a DNAMAN software and a Chrotnas software to find SNPs. The results are shown in
[0038] Through sequence alignment, it was found that a base G at position 41844263 of the KRT26 gene locus was mutated to a base A, or a mutation point was selected using a peak map. The result is shown in
Example 2 SNP Typing
[0039] SNP typing was conducted using flight mass spectrometry by Beijing Compass Biotechnology Co., Ltd., and specific steps were as follows:
[0040] (1) Primer design: according to SNP site information, a PCR reaction and single-base extension primers were designed using a software AssayDesignSuitev2.0 designed by MassARRAY, and a specificity of primers was tested online through University of California-Santa Cruz (UCSC) Genome Browser.
[0041] (2) Genomic DNA quality inspection: DNA concentration, purity and degree of degradation were detected by agarose gel electrophoresis, where an interpretation standard of test results was: in a gel image of the electrophoresis, the DNA band was single, clear, free of impurities, and there was no dispersion or tailing.
[0042] (3) Electrophoresis conditions:
[0043] 1) 0.8% agarose gel. 170V and 25 min,
[0044] 2) sample loading volume: 500 ng of a sample+3 μl of a Loading Buffer; and
[0045] 3) Marker: 3 μl of a Trans2000 Plus.
[0046] (4) PCR reaction:
[0047] 1) A PCR reaction system was shown in Table 2 below:
TABLE-US-00003 TABLE 2 PCR reaction system Reagent Concentration Volume(μl) Water, HPLCgrade NA 927.5 PCRBufferwith15mMMgCl2 10 x 331.25 MgCl2 25 mM 172.25 dNTPMix 25 mM 53 PrimerMix 0.5 uM 530 HotStarTaq 5 U/μl 106 DNAtemplate 10 ng/μl 1/well Total 5/well
[0048] 2) Cycle parameters of the PCR reaction were shown in Table 3 below:
TABLE-US-00004 TABLE 3 PCR reaction cycle parameters Temperature (° C.) Time(second) Cycle 94 120 1 94 20 56 30 45 72 60 72 180 1 4 ∞ 1
[0049] (5) SAP digestion
[0050] 1) A SAP digestion reaction system was shown in Table 4:
TABLE-US-00005 TABLE 4 SAP digestion reaction system Reagent Concentration Volume(ul) Water NA 810.9 SAPBUffer 10 x 90.1 SAP 1.7 U/ul 159.0 Total 2/well
[0051] 2) Cycle parameters of the SAP digestion were shown in Table 5:
TABLE-US-00006 TABLE 5 SAP digestion cycle parameters Temperature(° C.) Time(minute) Cycle 37 40 1 85 5 1 4 ∞ 1
[0052] (6) Extension reaction
[0053] 1) An extension reaction system was shown in Table 6 below:
TABLE-US-00007 TABLE 6 Extension reaction system Reagent Concentration Volume(ul) Water NA 400.2 iPLEXbufferplus 10x 106 iPLEXterminator NA 106 PrimerMix 0.6-1.3 uM 426.1 iPlexenzyme NA 21.7 total 2/well
[0054] 2) Cycle parameters of the extension reaction were shown in Table 7 below:
TABLE-US-00008 TABLE 7 Extension reaction cycle parameters Temperature (° C.) Time (sec) Cycle 94 30 1 94 5 1 52 5 80 5 40 72 180 1 4 ∞
[0055] (7) Detection on machines:
[0056] 1) the reaction product (9 ul in total) was diluted by 3 times and desalted using a resin;
[0057] 2) a desalted sample was spotted on a sample target and crystallized naturally; and
[0058] 3) mass spectrometry detection was conducted to collect data.
[0059] According to typing results, population genetic analysis of SNPs and an association analysis of the SNPs with a wool fiber diameter trait of the long-haired rabbit were conducted using an R software and a SAS software.
[0060] Association analysis of the examples, the wool yield trait of the long-haired rabbit and the KR 126 gene
[0061] An analysis of variance was conducted by a general linear model (GLM) procedure using SAS9.2, and an association analysis between each genotype of the polymorphic sites and the wool yield trait of the long-haired rabbit was conducted. A best linear unbiased predictor (BLUP) model was:
Y=Xb+Za+e
[0062] Y: a phenotypic value of wool production trait; X: an individual number matrix related to a fixed effect; b: a fixed effect (SNP site, and gender effect); Z: an individual number matrix of an individual additive genetic effect; a: individual additive genetic effect; and e: a random error; according to KRT26 gene SNPs, allele and genotype frequencies were calculated separately, and genotypes AA, AG and GG were obtained. Association analysis results of each genotype corresponding to the wool yield were shown in Table 8.
TABLE-US-00009 TABLE 8 Association analysis results of KRT26 gene and wool yield trait of long-haired rabbit Genotype Trait AA (596) AG (85) GG (76) P Wool yield 300.79 ± 2.65.sup.B 313.53 ± 6.86.sup.b 330.86 ± 9.02.sup.A <0.05
[0063] From the data in Table 8, it can be shown that the position 41844263 of KRT26 gene locus has a significant effect on the wool yield trait of the long-haired rabbit (P<0.05), where a. wool yield of a genotype GG long-haired rabbit is 30.07 g and 17.33 g higher than that of genotype AA and genotype AG long-haired rabbits, respectively. An additive gene effect of the GG is 15.59 g, such that this base substitution can control an overall genetic variation of wool yield by 1.51%.
[0064] The base G at the position 41844263 of the KRT26 gene locus in the long-haired rabbit is mutated to the base A; a long-haired rabbit with an allele G has a higher wool yield, while a long-haired rabbit with an allele A has a lower wool yield. Therefore, in breeding work, the gene frequency of the allele G in a long-haired rabbit population is increased by marker-assisted selection, to establish an allele G homozygous population, thereby significantly increasing the wool yield of the long-haired rabbit.
[0065] Finally, it should be noted that the above examples are provided merely to describe the technical solutions of the present disclosure, rather than to limit the protection scope of the present disclosure. Although the present disclosure is described in detail with reference to preferred examples, a person of ordinary skill in the art should understand that modifications or equivalent replacements may be made to the technical solutions of the present disclosure without departing from the spirit and scope of the technical solutions of the present disclosure.