SYSTEM FOR RAPID ON-SITE TESTING FOR AIRBORNE AND OTHER PATHOGENS

20220186327 · 2022-06-16

    Inventors

    Cpc classification

    International classification

    Abstract

    A simplified system for air sample collection and analysis for the presence of airborne pathogen is disclosed. An extraction device is used for extracting biomaterial previously deposited on the surface of a capture element of a sampling device, the capture element being of a select cross section and size. The extraction device comprises an upwardly opening head being wider at a top and narrower at a central opening at a bottom. An elongate cavity is attached to the enlarged head at the bottom extending downward from the head and closed at a bottom end to define an interior space, the cavity having a cross section corresponding to the cross section of the capture element and of a slightly larger size than the size of the capture element. An extraction fluid is in the cavity interior space. In use, insertion of the capture element through the head into the elongate cavity extrudes the extraction fluid liquid through the interface between the head and the elongate cavity and provides a fluidic shearing force that serves to solubilize biomaterial from the surface of the capture element.

    Claims

    1. An extraction device for extracting biomaterial previously deposited on the surface of a capture element of a sampling device, the capture element being of a select cross section and size, comprising: an upwardly opening head being wider at a top and narrower at a central opening at a bottom; an elongate cavity attached to the enlarged head at the bottom extending downward from the head and closed at a bottom end to define an interior space, the cavity having a cross section corresponding to the cross section of the capture element and of a slightly larger size than the size of the capture element; and an extraction fluid in the cavity interior space, wherein, in use, insertion of the capture element through the head into the elongate cavity extrudes the extraction fluid liquid through the interface between the head and the elongate cavity and provides a fluidic shearing force that serves to solubilize biomaterial from the surface of the capture element.

    2. The extraction device according to claim 1 wherein the head comprises a bowl-shaped head.

    3. The extraction device according to claim 1 wherein the capture element is in the form of a flat strip.

    4. The extraction device according to claim 1 wherein the capture element is cylindrical.

    5. The extraction device according to claim 1 wherein clearance between an internal surface of the cavity and the surface of the capture element is less than about 1 mm.

    6. The extraction device according to claim 1 wherein clearance between an internal surface of the cavity and the surface of the capture element is less than 0.1 mm.

    7. The extraction device according to claim 1 wherein the extraction device is formed of injection molded plastic.

    8. The extraction device according to claim 7 wherein the head and cavity are separate parts which are joined by ultrasonic welding.

    9. The extraction device according to claim 7 wherein the head and cavity are separate parts which are joined by an adhesive.

    10. The extraction device according to claim 1 wherein the extraction device is fabricated by blow-molding.

    11. The extraction device according to claim 1 wherein the extraction device is fabricated by dip-molding.

    12. A method for extracting biomaterial previously deposited on the surface of a capture element of a sampling device, the capture element being of a select cross section and size, comprising: providing an extraction device comprising an upwardly opening head being wider at a top and narrower at a central opening at a bottom, and an elongate cavity attached to the enlarged head at the bottom extending downward from the head and closed at a bottom end to define an interior space, the cavity having a cross section corresponding to the cross section of the capture element and of a slightly larger size than the size of the capture element; filling the cavity interior space with an extraction fluid; inserting the capture element through the head into the elongate cavity thereby extruding the extraction fluid liquid through the interface between the head and the elongate cavity and thereby providing a fluidic shearing force that serves to solubilize biomaterial from the surface of the capture element.

    13. The method according to claim 12 wherein the head comprises a bowl-shaped head.

    14. The method according to claim 12 further comprising extracting a sample of the biomaterial solubilized in the extraction fluid from the extraction device.

    15. The method according to claim 14 further comprising adding the sample to an inactivation reagent and LAMP mix and detergent to define a mixture.

    16. The method according to claim 15 further comprising heating the mixture for a select time and determining the resultant color.

    17. The method according to claim 12 wherein clearance between an internal surface of the cavity and the surface of the capture element is less than about 1 mm.

    18. The method according to claim 12 wherein clearance between an internal surface of the cavity and the surface of the capture element is less than 0.1 mm.

    19. The method according to claim 12 further comprising providing a cap removably received on the head to capture the extraction fluid in the extraction device.

    20. The method according to claim 12 further comprising providing a cap removably, threadably received on the head to capture the extraction fluid in the extraction device.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0063] FIG. 1 is a top view of a funnel-like extraction device;

    [0064] FIG. 2 is a perspective view of the device of FIG. 1;

    [0065] FIG. 3A is a section taken along the line 3A-3A of FIG. 1 together with a capture electrode from an air sampler capture device;

    [0066] FIG. 3B is a view similar to FIG. 3A with the capture electrode inserted in the extraction device;

    [0067] FIG. 4A is a section taken along the line 4A-4A of FIG. 1 together with the capture electrode from an air sampler capture device;

    [0068] FIG. 4B is a view similar to FIG. 4A with the capture electrode inserted in the extraction device;

    [0069] FIG. 5A is a view similar to FIG. 3A with a transport fluid in the extraction device;

    [0070] FIG. 5B is a view similar to FIG. 5A showing displacement of the transport fluid by insertion of the capture device electrode;

    [0071] FIGS. 6A, 6B and 6C are exemplary engineering drawings showing the extraction device molded in two parts; and

    [0072] FIG. 7 is a block diagram illustrating the steps in an exemplary LAMP procedure and including the simplification introduced in the disclosed invention.

    DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

    [0073] A simplified system for air sample collection and analysis for the presence of airborne pathogen is disclosed. The methodology is sufficiently versatile that it may also be adapted for use with human test samples as well as for samples collected from the air. Due to the urgency of the current pandemic, Applicant's patented technology for capture of airborne biomaterial utilizing electrokinetic propulsion is here used to capture biomaterial on stainless steel electrodes. A novel simplified method of collection of samples from the electrodes into an extraction/transport medium is shown. The electrode is simply pushed into the device pre-loaded with the medium where the electrode has limited clearance from the walls of the device and the shearing force of the liquid being forced though this limited clearance results in efficient collection. A similar device for human samples collected on a swab is described, where there is limited clearance between the swab and the vessel walls causes the extrusion of the extraction/collection fluid through the swab to effect efficient collection in one stroke, Further, advances in simplification of the method of reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) are described. Addition of non-ionic detergent helps promote viral lysis and release of RNA without a heating step, and allows direct addition of the lysate to the RT-LAMP reaction mixture. The combination of simple and effective process steps results in an entire process that requires no skilled operator.

    [0074] FIG. 1 shows top view of a funnel or pestle-like extraction device 1 in accordance with the invention. FIG. 2 is a perspective representation of the extraction device 1 of FIG. 1. This and subsequent figures are not drawn to any specific scale but are meant to illustrate the operating principles of the device, and appropriate scaling may be used for specific devices.

    [0075] The extraction device 1 comprises an upwardly opening head 3 in the shape of a bowl. The head 3 is wider at a top end and narrow at a central bottom end which is open. The head 3 opens into an elongate cavity 2. The cavity 2 is of parallelepiped construction closed at a bottom end to define an interior space for receiving an extraction fluid and a capture element, such as an electrode, as described below. The cavity 2 is of rectangular cross section. The head 3 is open at an interface where it is connected to the cavity 2 for the collection of fluid displaced from the cavity 2 by the electrode as will become clear in the following figures. The head 3 includes a threaded outer wall 4 to removably receive a screw cap 8, discussed below, for sealing the extraction device with transport fluid in the cavity 2 for shipping and re-sealing for safe disposal. The invention is not limited to a threaded cap, but may also be a press cap or a stopper according to the desired specifications. The cap may include a gasket or the like to seal the device for transport.

    [0076] The shape of the cavity is designed to conform to the shape of the capture element. If the capture element is cylindrical, then the cavity 2 will have a cylindrical interior cross section.

    [0077] The extraction device 1 is advantageously formed of plastic. It could be formed in one piece by injection molding, blow molding or dip molding. Alternatively, the extraction device could be molded in multiple parts which are joined by ultrasonic welding or using an adhesive.

    [0078] FIG. 3A shows a capture element, in the form of an electrode 5 from an air sampling device, positioned to one side of the extraction device 1. The electrode 5 is in the form of a flat strip, with a double reverse bend at one end and may be formed of metal, as necessary or desired. FIG. 3B shows the electrode 5 inserted in the cavity 2 of the capture device 1.

    [0079] The illustrated electrode 5 is of a type shown in Applicant's ionic capture device, commercialized as AirAnswers® and described in U.S. Pat. No. 9,360,402, the specification of which is incorporated by reference herein. The ionic capture device captures airborne biomaterial utilizing electrokinetic propulsion on stainless steel electrodes. The electrodes are removeable for extraction of the captured biomaterial. As is apparent, the shape of the electrode shown in the drawings is by way of example only. Other shapes and materials may be used.

    [0080] FIG. 3A shows a dimension b1, the width of the electrode 5, and b2, the width of the interior of the cavity 2. The length of the cavity is illustrated by the dimension h. Similar to FIGS. 3A and 3B, FIGS. 4A and 4B show side sections of the capture device 1 and the electrode 5, and show the dimensions w1, the thickness of the electrode 5 and the corresponding interior dimension w2 of the cavity 2.

    [0081] Advantageously, the overall clearance between the electrode 5 and the walls of the cavity 2 should be minimized, but not be so tight that the electrode 5 will jam on insertion. The clearance between the capture element 5 and the interior walls of the cavity 2 should be less than about 1 mm, and advantageously less than 0.1 mm. As will be apparent, the minimization of this clearance is critical for the sample recovery in an extraction process.

    [0082] FIGS. 5A and 5B are similar to FIGS. 3A and 3B, respectively, but with the addition of a transport fluid 6 filling the cavity 2 as shown in FIG. 5A. The cap 8 is also shown secured to the head 3, such as by threading, which may be used to seal the device for shipping and will be removed for insertion of the electrode 5.

    [0083] FIG. 5A shows the extraction device 1 before removal of the cap 8 and insertion of the electrode 5. FIG. 5B shows at 7 in the head 3 how the transport fluid 6 is displaced into the bowl-shaped head 3. Upon later removal of the cap 8, a sample may be withdrawn with a micropipette dispenser and added to a tube containing LAMP reaction mix for the detection reaction.

    [0084] A is apparent, the clearance between the walls of the cavity 2 and the electrode 5 determine both the magnitude of a shearing effect when the electrode 5 is inserted into the cavity 2, thus ensuring efficient washing of the surface and solubilization of the captured bio-material, and will also maximize the volume of sample that will be recovered. The volume of fluid displaced by the electrode 5 is h*b2*w2−h*b1*w1. An example of this volume calculated from typical dimensions is shown in Table 1.

    TABLE-US-00001 TABLE 1 h w1 b1 w2 b2 Dimension 80.0 0.6 5.0 0.7 5.1 Electrode volume 240.0 Cavity volume 285.6 % displaced 84.0 All dimensions are in mm, volumes in μL.

    [0085] For the case illustrated, using a clearance of 0.1 mm, 84% of sample volume is captured in the head 3 in 240 μL.

    [0086] It is apparent that the same principles described herein can be applied to a plurality of possible sample collection devices. Thus, for swab samples collected nasopharyngeal for patients or swabs used for environmental surface sampling, a circular cross-section device will be used, with the diameter of the circular section cavity designed to minimize the clearance between the swab and the walls of the cavity to provide the described shearing effect.

    [0087] In all cases, the capture of sample into the transport medium may be preferably achieved by one thrust of the sample capture element 5 into the cavity 2. If it is desired to increase efficiency of capture into the transport medium, this may be repeated multiple times. Regardless, repeated insertion into the cavity 2 will give a more objective and reproducible capture than is achieved by current methods of swirling or vortex mixing.

    [0088] FIGS. 6A, 6B and 6C are created from a Solidworks™ design and show a perspective view in FIG. 6A, an exploded view in FIG. 6B and a cross section in FIG. 6C for an extraction device. This embodiment includes an O-ring shown at 9 in FIGS. 6A and 6B, to enable the separation of two halves 10 and 11, see FIG. 6B, of the device that would advantageously be molded as separate parts. The two halves could be secured by an adhesive or ultrasonic welding. The O-ring 9 provides a seal for a removable cap.

    [0089] FIG. 7 is a block diagram illustrating the steps involved in the shows the steps involved in the sample collection in accordance with the invention. As described above, the prior LAMP systems used a heat inactivation step, RNA purification, concentration, and transfer to a master mix for the LAMP reaction. In the disclosed invention, all these steps are reduced to a single liquid transfer from the extractor to the LAMP master mix supplemented with other reagents as will be detailed in the example. In accordance with the invention, a sample is captured on the electrode 5 at a block 18, such as by using the described electrokinetic device. The electrode 5 is removed from the capture device and the sample from the electrode 5 is extracted with water at a step 20. The extraction is added to an inactivation reagent and LAMP mix and detergent at a block 22. There is no lysis step, no purification step, or RNase inactivation step. This mixture is then heated at 65° for 35 minutes at a block 24. The resultant color is read at a block 26.

    Example

    [0090] The electrodes that have samples positive and negative for COVID-19 are extracted with pure RNase free water and an aliquot of that is added to the modified LAMP reaction mix as follows.

    [0091] Inactivation reagent (IR):

    [0092] 0.358 g of Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) in 2.5 mL nuclease free water, 2.2 mL of 1.1 N NaOH, and 1 mL of 0.5 EDTA).

    [0093] 1:10 Inactivation reagent: 90 μl nuclease free water, 10 μl Inactivation reagent.

    [0094] Inactivation solution: Nuclease free water, 1:10 inactivation reagent, 0.1 Tween 20. (100:1:2) ratio for electrode samples and (100:1:1) ratio for nasopharyngeal samples.

    [0095] LAMP Primers (from Integrated DNA Technologies, Coralville, Iowa): Gene N-A FIP 1.6 μM, Gene N-A BIP 1.6 μM, Gene N-A F3 0.2 μM, Gene N-A B3 0.2 μM, Gene N-A LF 0.4 μM, Gene N-A LB 0.4 μM.

    [0096] LAMP primers stock: Gene N-A FIP 16 μL, Gene N-A BIP 16 μL, Gene N-A F3 2 μL, Gene N-A B3 2 μL, Gene N-A LF 4 μL, Gene N-A LB 4 μL, filled up to a 100 μl with Nuclease free water.

    [0097] Reaction mix: 5 μl master mix (WarmStart® colorimetric LAMP 2X Master Mix, New England Biolabs, Ipswich, Mass.) and 3 μl of primers.

    [0098] Pre-mix 10 ul sample with 1 ul inactivation solution by pipetting up and down the pipette together and add this to reaction mix tube.

    [0099] Place sample in preheated heating block for 35 minutes at 65° C. and inspect color change. A typical result is shown in Table 2.

    TABLE-US-00002 TABLE 2 Sample Result Human Positive Sample Orangish Human negative sample Pink S17 - Cartridge positive sample Yellow S33 - Cartridge negative sample Pink S41 - Cartridge negative sample Pink Positive Control Yellow Negative Control Pink

    [0100] Note that all positive samples, human and cartridge had Ct 25 for the human positive sample and 24 for the cartridge positive sample by conventional PCR. It will be apparent to one skilled in the art that the above procedure can be rapidly performed with multiple samples in parallel. Because of availability of positive samples, the above was performed on 10 μl. By lyophilization of master mix and primers, sample volume may be increased to 18 μl with corresponding increase in sensitivity. Methods using lyophilized reagents are described in the prior art section. The simplification of the procedure described, with omission of RNA purification and omitting a separate heat inactivation/lysis step, means that for the user, all that is required is dispensing sample into a tube containing inactivation solution and immediate transfer of that to the tube containing master mix and primers, then placing this tube in a heating block.

    [0101] This simplified protocol resulted from the addition of Tween® 20 to the inactivation solution. This is not known from any known prior art. The Tween® may be replaced by any other of the non-ionic detergent, comprising the Tween®, Triton, and the Brij series. Unlike prior art systems, here we show that the presence of detergent and sulfhydryl reducing agent permits the viral lysis and RNA release, as is the presence of TCEP. The TCEP may be replaced by other sulphydryl reducing compounds that will break viral S—S bonds, such as di-thiothreitol or β-mercaptoethanol. Stability of such solutions may be improved by removal of dissolved oxygen from all buffers or water in which they will be dissolved. The method is also compatible with different variant transport media. The human samples here had been collected by conventional nasopharyngeal swap in buffered saline, or pure water for the samples from the samples collected from the air on stainless steel electrodes. An alternative would be to include ionic detergent in the transport/extraction medium for the electrode such that the final concentration in the mixture with inactivation solution will approximate that in the example. The detergent level may not be so high as to inhibit the final LAMP reaction. Limits to possible detergent concentrations are described in the prior art section.

    [0102] There are thus innumerable variations and possible improvements that will be apparent to one skilled in the art within the scope of the invention.

    [0103] The following sequences are used in this document:

    TABLE-US-00003 SEQ ID NO: 1 Gene N-A FIP/ TCTGGCCCAGTTCCTAGGTAGTCCAGACGAATTCGT GGTGG/ SEQ ID NO: 2 Gene N-A BIP/ AGACGGCATCATATGGGTTGCACGGGTGCCAATGTG ATCT/ SEQ ID NO: 3 Gene N-A F3/ TGGCTACTACCGAAGAGCT/ SEQ ID NO: 4 Gene N-A B3/ TGCAGCATTGTTAGCAGGAT/ SEQ ID NO: 5 Gene N-A LF/ GGACTGAGATCTTTCATTTTACCGT/ SEQ ID NO: 6 Gene N-A LB/ ACTGAGGGAGCCTTGAATACA/

    [0104] Thus, there is disclosed herein a system wherein a sample of pathogen is collected on a sampling device, the sample is efficiently eluted from the sampling device by an extraction device, whereby the limited clearance between sampling device and walls of extraction device results in extrusion of the sample into a collection zone, wherein the sample can be transferred from the collection zone to an inactivation/lysis mixture and thence to an isothermal amplification mixture with no other steps, and the amplification mixture is heated until color development indicates presence of nucleic acid sequence of original pathogen.

    [0105] It will be appreciated by those skilled in the art that there are many possible modifications to be made to the specific forms of the features and components of the disclosed embodiments while keeping within the spirit of the concepts disclosed herein. Accordingly, no limitations to the specific forms of the embodiments disclosed herein should be read into the claims unless expressly recited in the claims. Although a few embodiments have been described in detail above, other modifications are possible. Other steps may be provided, or steps may be eliminated, from the described flows, and other components may be added to, or removed from, the described systems. Other embodiments may be within the scope of the following claims.

    [0106] The foregoing disclosure of specific embodiments is intended to be illustrative of the broad concepts comprehended by the invention.