COMPOSITION FOR INDUCING DIRECT CONVERSION OF SOMATIC CELL INTO COMMON MYELOID PROGENITOR AND USE THEREOF

Abstract

Provided are: a composition for inducing direct conversion from somatic cells into common myeloid progenitor cells, the composition including a chemical cocktail; a method of direct conversion of somatic cells into common myeloid progenitor cells and macrophages by using the composition; common myeloid progenitor cells or macrophages prepared by the method; a pharmaceutical composition for preventing or treating fibrosis or scars, cell therapeutics, a composition for screening drugs, and a 3D printable biomaterial composition for fabricating artificial tissues, each using the common myeloid progenitor cells or the macrophages.

Claims

1. A composition for inducing direct conversion from somatic cells into common myeloid progenitor (CMP) cells, the composition comprising a TGF-β receptor inhibitor.

2. The composition of claim 1, further comprising a histone deacetylase (HDAC) inhibitor, glycogen synthase kinase 3 (GSK-3) inhibitor, or a combination thereof.

3. The composition of claim 1, wherein the TGF-β receptor inhibitor is 2-[3-(6-methylpyridin-2-yl)-1H-pyrazol-4-y]-1,5-naphthyridine (616452), SB431542, galunisertib (LY2157299), LY3200882, vactosertib (TEW-7197), PF-06952229, or a combination of two or more thereof.

4. The composition of claim 2, wherein the HDAC inhibitor is a valproate, Trichostatin A, phenylbutyrate, sodium butyrate, suberoylanilide hydroxamic acid (SAHA), suberohydroxamic acid (SBHA), or a combination of two or more thereof.

5. The composition of claim 4, wherein the valproate is valproic acid (VPA), sodium valproate, divalproex sodium, or a combination of two or more thereof.

6. The composition of claim 2, wherein the GSK-3 inhibitor is 6-((2-((4-(2,4-dichlorophenyl)-5-(4-methyl-1H-imidazol-2-yl)pyrimidin-2-y1)amino)ethyl)amino)nicotinonitrile (CHIR99021), TD114-2, SB216763, SB415286, or a combination of two or more thereof.

7. The composition of claim 1, further comprising an antioxidant.

8. The composition of claim 7, wherein the antioxidant is ascorbic acid, resveratrol, acetylcysteine, ethylbisiminomethylguaiacol manganese chloride (EUK-134), an NADPH oxidase inhibitor, or a combination of two or more thereof.

9. The composition of claim 1, wherein the somatic cells are one or more selected from fibroblasts, adipose stromal cells, epithelial cells, muscle cells, oral epithelial cells, somatic cells extracted from urine, blood cells, hair follicle stem cells, neural stem cells, hematopoietic stem cells, and mesenchymal stem cells.

10. The composition of claim 1, wherein the CMP cells are able to differentiate into myeloblasts, basophils, neutrophils, eosinophils, monocytes, granulocytes, dendritic cells, or macrophages.

11. A method of direct conversion of somatic cells into common myeloid progenitor (CMP) cells and macrophages, the method comprising preparing the CMP cells by culturing the somatic cells in media comprising the composition of claim 1.

12. The method of claim 11, wherein the media further comprise an HDAC inhibitor, a GSK-3 inhibitor, an antioxidant, or a combination thereof.

13. The method of claim 11, further comprising: conducting first culturing of the somatic cells in media comprising a TGF-β receptor inhibitor; and conducting second culturing of the cultured somatic cells in media comprising a TGF-β inhibitor and a GSK-3 inhibitor.

14. The method of claim 13, wherein one or more of the media of the first culturing or the media of the second culturing further comprise an HDAC inhibitor, an antioxidant, or a combination thereof.

15. The method of claim 11, wherein the somatic cells are one or more selected from fibroblasts, adipose stromal cells, epithelial cells, muscle cells, oral epithelial cells, somatic cells extracted from urine, blood cells, hair follicle stem cells, neural stem cells, hematopoietic stem cells, and mesenchymal stem cells.

16. The method of claim 10, wherein a duration of the culturing is 20 days to 36 days.

17. The method of claim 10, further comprising differentiating the prepared CMP cells into macrophages.

18. The method of claim 16, wherein in the differentiation into macrophages, the CMP cells are cultured in media comprising a macrophage colony stimulating factor (M-CSF), IL-4, or a combination thereof.

19. A composition comprising CMP cells or macrophages prepared by the method of claim 10.

20. The composition of claim 18, wherein the composition is formulated with a carrier for administration to a subject by topical application to the skin, oral administration, injection, in vivo transplantation, or a tissue-engineered matrix.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0125] The above and other aspects, features, and advantages of certain embodiments of the disclosure will be more apparent from the following description taken in conjunction with the accompanying drawings, in which:

[0126] FIG. 1 is a schematic diagram of preparation of macrophages using SOX2 transduction in human fibroblasts;

[0127] FIG. 2A shows flow cytometry results of analyzing the expression of mCitrine-SOX2 in neonatal fibroblasts which were transduced with mCitrine-SOX2 and cultured for 21 days;

[0128] FIG. 2B shows flow cytometry results of analyzing the expression of the blood cell marker CD45 and mCitirine-SOX2 in neonatal fibroblasts which were transduced with mCitrine-SOX2 and cultured for 21 days;

[0129] FIG. 2C shows flow cytometry results of analyzing the expression of the blood cell marker CD45 and mCitirine-SOX2 in neonatal fibroblasts which were transduced with mCitrine-SOX2 and cultured in blood cell maturation culture media;

[0130] FIG. 2D shows results of evaluating phagocytosis of macrophages which were differentiated from CD45-expressing cells after transduction of neonatal fibroblasts with mCitrine-SOX2;

[0131] FIG. 3 shows qRT-PCR results of analyzing the expression of pluripotency markers SOX2, NANOG, and OCT4, mesodermal lineage markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL, in cells obtained by transducing neonatal fibroblasts with mCitirine-SOX2 and culturing the same for 21 days;

[0132] FIG. 4A shows flow cytometry results of analyzing the expression of mCitirine-SOX2 in adult fibroblasts which were transduced with mCitirine-SOX2 and cultured for 21 days;

[0133] FIG. 4B shows flow cytometry results of analyzing the expression of the blood cell marker CD45 and mCitirine-SOX2 in adult fibroblasts which were transduced with mCitirine-SOX2 and cultured for 21 days;

[0134] FIG. 4C shows flow cytometry results of analyzing the expression of the blood cell marker CD45 and mCitirine-SOX2 in adult fibroblasts which were transduced with mCitirine-SOX2 and cultured in blood cell maturation culture media;

[0135] FIG. 4D shows results of evaluating phagocytosis of macrophages which were differentiated from CD45-expressing cells in adult fibroblasts transduced with mCitrine-SOX2;

[0136] FIG. 5 shows qRT-PCR results of analyzing the expression of pluripotency markers SOX2, NANOG, and OCT4, mesodermal lineage markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL, in cells which were obtained by transducing adult fibroblasts with mCitirine-SOX2 and culturing the same for 21 days;

[0137] FIG. 6 shows a schematic diagram of preparation of macrophages from fibroblasts by enhancing SOX2 expression with a chemical cocktail;

[0138] FIG. 7A shows flow cytometry results of analyzing the expression of the hematopoietic stem cell marker CD34 and the blood cell marker CD45 in cells which were obtained by adding a chemical cocktail to neonatal fibroblasts and culturing the same for 28 days;

[0139] FIG. 7B shows flow cytometry results of analyzing the expression of the blood cell marker CD45 and the CMP marker CD14 in cells which were obtained by adding a chemical cocktail to neonatal fibroblasts and culturing the same for 28 days;

[0140] FIG. 7C shows results of evaluating phagocytosis of macrophages which were differentiated from cells obtained by adding a chemical cocktail to neonatal fibroblasts and culturing the same for 28 days;

[0141] FIG. 8 shows qRT-PCR results of analyzing the expression of pluripotency markers SOX2, NANOG, and OCT4, mesodermal lineage markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL, in cells obtained by adding a chemical cocktail to neonatal fibroblasts and culturing the same for 28 days;

[0142] FIG. 9A shows flow cytometry results of analyzing the expression of the hematopoietic stem cell marker CD34 and the blood cell marker CD45 in cells which were obtained by adding a chemical cocktail to adult fibroblasts and culturing the same for 28 days;

[0143] FIG. 9B shows flow cytometry results of analyzing the expression of the blood cell marker CD45 and the CMP marker CD14 in cells which were obtained by adding a chemical cocktail to adult fibroblasts and culturing the same for 28 days;

[0144] FIG. 9C shows results of evaluating phagocytosis of macrophages which were differentiated from cells obtained by adding a chemical cocktail to adult fibroblasts and culturing the same for 28 days;

[0145] FIG. 10 shows qRT-PCR results of analyzing the expression of pluripotency markers SOX2, NANOG, and OCT4, mesodermal lineage markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL, in cells which were obtained by adding a chemical cocktail to adult fibroblasts and culturing the same for 28 days;

[0146] FIG. 11 shows qRT-PCR results of comparatively analyzing the expression of pluripotency markers SOX2, NANOG, and OCT4, mesodermal lineage markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL, in cells (SOX2 OE) obtained by transducing neonatal fibroblasts (HDF-N) with SOX2, and cells (TβRlin) obtained by adding a chemical cocktail to neonatal fibroblasts (HDF-N);

[0147] FIG. 12 shows qRT-PCR results of comparatively analyzing the expression of pluripotency markers SOX2, NANOG, and OCT4; mesodermal lineage markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL, in cells (SOX2 OE) obtained by transducing adult fibroblasts (HDF-A) with SOX2, and cells (TβRlin) obtained by adding a chemical cocktail to adult fibroblasts (HDF-A);

[0148] FIG. 13A shows qRT-PCR results of analyzing an expression level of SOX2 after inducing direct conversion by adding a chemical cocktail to fibroblasts. C (Control): fibroblasts not transduced with Tet-shSOX2; Tet-shSOX2 I and Tet-shSOX2 II: fibroblasts in which SOX2 expression is inhibited by tetracycline treatment in Tet-shSOX2 expressing cells;

[0149] FIG. 13B shows flow cytometry results of analyzing the expression of the blood cell marker CD45 after inducing direct conversion by adding a chemical cocktail to fibroblasts. Control: cells obtained by culturing fibroblasts not transduced with Tet-shSOX2, for 28 days without addition of a chemical cocktail; HDF+TβRlin: cells obtained by inducing direct conversion by adding a chemical cocktail to fibroblasts not transduced with Tet-shSOX2; Tet shSOX2-I+TβRlin and Tet shSOX2-II+TβRlin: cells obtained by inducing direct conversion by adding a chemical cocktail to fibroblasts in which SOX2 expression is inhibited by tetracycline treatment in Tet-shSOX2 expressing cells.

[0150] FIG. 14 shows results of flow cytometry analyses confirming the expression of the blood cell marker CD45 and the CMP marker CD14 in cells which were obtained after inducing direct conversion by adding a chemical cocktail to normal neonatal fibroblasts (HDF-N) and to neonatal fibroblasts in which wild type (WT), T204D (constitutively active form), or K232R (kinase dead form) of TGF-β type I receptor is overexpressed;

[0151] FIG. 15 shows qRT-PCR results of analyzing the expression of pluripotency markers SOX2, NANOG, and OCT4; mesodermal lineage markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL in cells which were obtained after inducing direct conversion by adding a chemical cocktail to normal neonatal fibroblasts (HDF-N) and to neonatal fibroblasts in which WT, T204D, or K232R is overexpressed;

[0152] FIG. 16 shows results of flow cytometry analyses confirming the expression of the blood cell marker CD45 and the CMP marker CD14 in cells which were obtained after inducing direct conversion by adding a chemical cocktail to normal adult fibroblasts (HDF-A) and to adult fibroblasts in which WT, T204D, or K232R is overexpressed;

[0153] FIG. 17 shows qRT-PCR results of analyzing the expression of pluripotency markers SOX2, NANOG, and OCT4; mesodermal lineage markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL, in cells which were obtained after inducing direct conversion by adding a chemical cocktail to normal adult fibroblasts (HDF-A) and to adult fibroblasts in which WT, T204D, or K232R is overexpressed;

[0154] FIG. 18 shows CD45 expression levels of cells obtained after culturing for 28 days with a different composition of chemical cocktail; and

[0155] FIG. 19 shows CD45 expression levels of cells obtained after culturing for 28 days with or without post-treatment with a GSK-3 inhibitor.

DETAILED DESCRIPTION

[0156] Reference will now be made in detail to embodiments, examples of which are illustrated in the accompanying drawings, wherein like reference numerals refer to like elements throughout. In this regard, the present embodiments may have different forms and should not be construed as being limited to the descriptions set forth herein. Accordingly, the embodiments are merely described below, by referring to the figures, to explain aspects of the present description. As used herein, the term “and/or” includes any and all combinations of one or more of the associated listed items. Expressions such as “at least one of,” when preceding a list of elements, modify the entire list of elements and do not modify the individual elements of the list.

[0157] Herein below, the present disclosure will be described in greater detail with reference to embodiments. However, these embodiments are for illustrative purposes only and are not intended to be a limitation of the present disclosure.

[0158] <Materials and Experiment Methods>

[0159] 1. Preparation of Cell Lines and Vectors

[0160] Human dermal fibroblasts derived from human skin were purchased from ThermoFisher (USA). Human neonatal dermal fibroblasts (HDF-N; neonatal-C0045C) and human adult dermal fibroblasts (HDF-A; adult-C0135C) were purchased, respectively.

[0161] The direct conversion (reprogramming or de-differentiation) factor to be transduced into the fibroblasts was SOX2, and lentiviral vectors (pLM-mCitrin-SOX2) were purchased from Addgene. The tetracycline (Tet)-induced knockdown vector (Tet-shSOX2) of SOX2 which is capable of selectively suppressing the expression of SOX2 by tetracycline treatment, was purchased from Addgene. Vectors (pcDNA3-ALK5 WT, pcDNA3-ALK5 T204D, pcDNA3-ALK5 K232R), which are capable of regulating the expression and activity of TGF-β type I receptor (TGFBR1, ALK5) were purchased from Addgene. In detail, pcDNA3-ALK5 WT is TGFBR1 wild type (WT) expression vector, pcDNA3-ALK5 T204D is constitutively active (CA) TGFBR1 T204D mutant expression vector, and pcDNA3-ALK5 K232R is kinase-dead (KD) TGFBR1 K232R mutant expression vector.

[0162] 2. Evaluation of Functionality of Differentiated Macrophages

[0163] To examine whether the macrophages obtained after inducing macrophage differentiation for one week by SOX2 overexpression or a chemical cocktail have functionality, phagocytosis assay was conducted. In detail, 1 μm-sized latex beads (Sigma) were added to cell culture media and allowed to react for 60-90 minutes. The cells were washed with cold phosphate-buffered saline (PBS) and fixed using 4% paraformaldehyde solution. Cell morphology and phagocytosis of latex beads were observed under a microscope.

[0164] 3. qRT-PCR Analyses for Reprogramming-Related Genes

[0165] To identify reprogramming characteristics of fibroblasts, the expression of pluripotency markers SOX2, NANOG, and OCT4; mesodermal lineage markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL was confirmed by qRT-PCR.

[0166] The pluripotent markers were used to evaluate the stemness of stem cells upon reprogramming or direct conversion. The expression of the pluripotency marker in cells may be seen as an indication that pluripotency is acquired.

[0167] MXIL1 and BRACHY are factors that contribute to differentiation of mesodermal lineages and blood cells. These genes are reported to play a role in determining characteristics of mesodermal lineage and to develop their function. Blood cells are one of the cell types that can be differentiated from the mesoderm.

[0168] Further, C/EBPα is known to be a critical factor involved in differentiation/development of blood cells, and PU.1 is known to be an inducer of differentiation/development of monocytes/macrophages.

[0169] In detail, RNAs in the cells were isolated using Trizol, cDNA was synthesized using 1 μg of RNA, and primers in Table 1 were used to perform qRT-PCR. Analyses were achieved in a relative manner by taking the amount of the marker in normal fibroblasts (HDF-N or HDF-A) as 1.

TABLE-US-00001 TABLE 1 Name of Gene Direction Sequence (5′.fwdarw.3′) SEQ ID NO SOX2 Forward GGGGGAAAGTAGTTTGCTGCCTCT SEQ ID NO: 1 Reverse CCTCCTCTGGCCGATCCTGC SEQ ID NO: 2 NANOG Forward CAGCCTCCAGCAGATGCAAGAACT SEQ ID NO: 3 Reverse TGAGGCCTTCTGCGTCACACC SEQ ID NO: 4 Oct4 Forward AGCAAAACCCGGAGGAGTCCC SEQ ID NO: 5 Reverse GCAGATGGTCGTTTGGCTGAATACC SEQ ID NO: 6 MIXL1 Forward AAACTGAGAAGTATCCTCTGCTAA SEQ ID NO: 7 Reverse TCTTCTGCAAGCCTCCCTAACACA SEQ ID NO: 8 BRACHY Forward ATGAGCCTCGAATCCACATAGT SEQ ID NO: 9 Reverse TCCTCGTTCTGATAAGCAGTCA SEQ ID NO: 10 C/EBPα Forward GAGGGACCGGAGTTATGACA SEQ ID NO: 11 Reverse TTCACATTGCACAAGGCACT SEQ ID NO: 12 PU.1 Forward GACAGGCAGCAAGAAGAAG SEQ ID NO: 13 Reverse TTGGACGAGAACTGGAAGG SEQ ID NO: 14 SCL Forward CAAAGTTGTGCGGCGTATCTT SEQ ID NO: 15 Reverse TCATTCTTGCTGAGCTTCTTGTC SEQ ID NO: 16 GAPDH Forward GGAGCGAGATCCCTCCAAAAT SEQ ID NO: 17 Reverse GGCTGTTGTCATACTTCTCATGG SEQ ID NO: 18

[0170] 4. FACS Analyses for Confirming Expression of Specific Proteins

[0171] To confirm direct conversion potential of fibroblasts to CMP cells, flow cytometry (FACS) analyses were performed. Using the antibodies listed below, expression levels of proteins including the hematopoietic stem cell (HSC) membrane marker CD34, the blood cell membrane marker CD45, and the common myeloid progenitor (CMP) membrane marker CD14, were confirmed. The antibodies used are as follows: [0172] FITC conjugated mouse anti-human CD34 monoclonal antibodies, eBioscience [0173] APC conjugated mouse anti-human CD45 monoclonal antibodies, eBioscience [0174] APC-eFluoro780 conjugated mouse anti-human CD14 monoclonal antibodies, eBioscience

[0175] Cells were dissociated into single cells with accutase and then washed with 1% FBS/PBS solution. After treatment with Fc blocker (BD Bioscience) for 10 minutes to prevent non-specific antigen binding, the cells were blocked for 15 minutes using 1% FBS/PBS solution. An antigen-antibody reaction using a specific antibody was performed at room temperature for 1 hour. Normal fibroblasts reacted with APC Mouse IgG1 isotype were used as a control. Subsequent to the reaction, the cells were washed twice with cold PBS solution and analyzed by flow cytometry using CytoFLEX by Beckman, and data were analyzed using the CytExpert program.

EXAMPLE 1

Preparation of Macrophages from Fibroblasts Using SOX2 Overexpression

[0176] To prepare macrophages from fibroblasts, SOX2 was transduced into fibroblasts and overexpressed, such that the fibroblasts were converted into CMP cells. The cultured CMP cells were further differentiated into macrophages.

[0177] FIG. 1 is a diagram illustrating the preparation of macrophages from fibroblasts using SOX2 transduction.

[0178] (1) Reprogramming of Fibroblasts by SOX2 Overexpression

[0179] Fibroblasts were cultured on a geltrex- or matrigel-coated cell culture plate. Using lentiviral vector (pLM-mCitrin-SOX2) for SOX2 transduction, virus was generated from 293T cells, and media containing the generated virus were added to the fibroblasts. For fibroblast culture, Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% penicillin streptomycin (P/S, penicillin), 1% glutamine (glutaMAX™-1), 1% non-essential amino acid (MEAA), and 0.055 mM β-mercaptoethanol were used.

[0180] After treatment with the virus as described above, the fibroblasts were cultured for 21 days with reprogramming media changes every 2-3 days. For the reprogramming media, KnockOut DMEM or DMEM/F-12 supplemented with 15% knockout Serum Replacement (KSR), 1% P/S, 1% glutamine (glutaMAX™-I), 1% NEAA, 30 ng/ml insulin-like growth factor II (IGFII), 20 ng/ml basic fibroblast growth factor (bFGF2), and 0.1 mM β-mercaptoethanol were used.

[0181] (2) Maturation of Blood Cells

[0182] The cells reprogrammed by SOX2 overexpression were dissociated into single cells using accutase and cultured in suspension using an ultra-low attachment culture dish. During the suspension-culture for 14 days, the cells were cultured with blood cell maturation culture media and the media was changes every 2-3 days. For the blood cell maturation culture media, media containing KnockOut DMEM supplemented with 20% bovine calf serum (BCS), 1% P/S, 1% glutamine (glutaMAX™-I), 1% NEAA, 1× Insulin-Transferrin-Selenium, 30 ng/ml thrombopoietin (TPO), 30 ng/ml stem cell factor (SCF), 20 ng/ml epidermal growth factor (EGF), and 0.1 mM β-mercaptoethanol were used.

[0183] (3) Differentiation into Macrophages

[0184] The CMP cells obtained by the above suspension-culture method were dissociated into single cells using accutase and cultured for one week in macrophage differentiation media. For the macrophage differentiation media, media containing RPMI1640 supplemented with 10% fetal bovine serum (FBS), 1% P/S, 10 ng/ml macrophage colony-stimulating factor (M-CSF), 10 ng/ml interleukin-4 (IL-4) and 0.055 mM β-mercaptoethanol were used.

[0185] (4) Characterization of Cells

[0186] FIG. 2A shows flow cytometry results of analyzing mCitrine-SOX2 expression in neonatal fibroblasts that were transduced with mCitrine-SOX2 and cultured for 21 days. As shown in FIG. 2A, SOX2 fluorescence from mCitrine was detected, indicating successful overexpression of SOX2.

[0187] FIG. 2B shows flow cytometry results of analyzing the expression of the blood cell marker CD45 and mCitirine-SOX2 in neonatal fibroblasts that were transduced with mCitrine-SOX2 and cultured for 21 days. As shown in FIG. 2B, it could be confirmed that when mCitirine-SOX2 expression is induced, CD45 is slightly expressed.

[0188] FIG. 2C shows flow cytometry results of analyzing the expression of the blood cell marker CD45 and mCitirine-SOX2 in neonatal fibroblasts that were transduced with mCitrine-SOX2 and cultured in blood cell maturation culture media. As shown in FIG. 2C, after maturation, it could be confirmed that there is a slight increase in percentages of cells expressing CD45.

[0189] FIG. 2D shows results of evaluation of phagocytosis of macrophages that were differentiated from CD45-expressing cells in neonatal fibroblasts transduced with mCitrine-SOX2. As shown in FIG. 2D, the differentiated macrophages exhibit phagocytic ability.

[0190] FIG. 3 shows qRT-PCR results of analyzing the expression of pluripotency markers SOX2, NANOG, and OCT4, mesodermal lineage markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL, in cells obtained by transducing neonatal fibroblasts with mCitirine-SOX2 and culturing the same for 21 days.

[0191] FIG. 4A shows flow cytometry results of analyzing the expression of mCitirine-SOX2 in adult fibroblasts that were transduced with mCitirine-SOX2 and cultured for 21 days. As shown in FIG. 4A, SOX2 fluorescence from mCitrine is detected, indicating a successful overexpression of SOX2.

[0192] FIG. 4B shows flow cytometry results of analyzing the expression of the blood cell marker CD45 and mCitirine-SOX2 in adult fibroblasts that were transduced with mCitirine-SOX2 and cultured for 21 days. As shown in FIG. 4B, it could be confirmed that when mCitirine-SOX2 expression is induced, CD45 is slightly expressed.

[0193] FIG. 4C shows flow cytometry results of analyzing the expression of the blood cell marker CD45 and mCitirine-SOX2 in adult fibroblasts that were transduced with mCitirine-SOX2 and cultured in blood cell maturation media. As shown in FIG. 4C, it could be confirmed that in a similar fashion as in neonatal fibroblasts, after maturation, CD45 expression level is increased, inducing direct conversion. Conversion efficiency is higher than that observed in neonatal fibroblasts.

[0194] FIG. 4D shows results of evaluating phagocytosis of macrophages that were differentiated from CD45-expressing cells in adult fibroblasts transduced with mCitrine-SOX2. As shown in FIG. 4D, the differentiated macrophages exhibit phagocytic ability.

[0195] FIG. 5 shows qRT-PCR results of analyzing the expression of pluripotency markers SOX2, NANOG, and OCT4; mesodermal lineage markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL, in cells obtained by transducing adult fibroblasts with mCitirine-SOX2 and culturing the same for 21 days.

[0196] Taking FIG. 2 to FIG. 5 together, it could be confirmed that the transduction of SOX2 alone results in the overexpression of factors related to blood cell direct conversion. Although the expression of the haematopoietic stem cell marker CD34 was not observed (data not shown), the expression of the blood cell marker CD45 was confirmed, indicating the possibility of reprogramming the fibroblasts to CMP cells. Also, it could be confirmed that the cells obtained by SOX2 overexpression are able to differentiate into macrophages with phagocytotic activity. In this regard, related art document (J. Pulecio et al., “Conversion of human fibroblasts into monocyte-like progenitor cells”, Stem Cells. 2014 Nov;32(11):2923-2938. doi: 10.1002/stem.1800.) reports that when inducing direct conversion in normal fibroblasts by treatment with a combination of SOX2 and miR-125b together, the conversion efficiency was increased. However, SOX2 introduction alone results in a low conversion efficiency.

EXAMPLE 2

Preparation of Macrophages from Fibroblasts Using Chemical Cocktail

[0197] To prepare macrophages from fibroblasts, a compound for enhancing SOX2 expression was added to the fibroblasts, and then the treated cells were matured into CMP cells. The cultured CMP cells were differentiated into macrophages.

[0198] FIG. 6 is a diagram illustrating the preparation of fibroblasts into macrophages by enhancing SOX2 expression using a chemical cocktail.

[0199] (1) Pretreatment of Fibroblasts

[0200] In a process prior to inducing the direct conversion of fibroblasts into CMP, the fibroblasts were pretreated. Pretreatment of fibroblasts is an optional process that may enhance the efficiency of direct conversion of fibroblasts into CMP cells.

[0201] Fibroblasts were cultured on a geltrex- or matrigel-coated cell culture plate. For pretreatment culture media, media containing DMEM supplemented with 10% FBS, 1% P/S, 1% glutamine (glutaMAX™-I), 1% NEAA, 50 μg/ml vitamin C (VitC), and 0.055 mM β-mercaptoethanol were used. 24 hours after culture initiation, valproic acid (VPA, 0.5 mM) was added to the media and cultured for 24 hours.

[0202] (2) Direct Conversion of Fibroblasts to CMP Cells by Addition of Chemical Cocktail

[0203] The pretreated cells were subjected to first culturing in reprogramming media supplemented with a chemical cocktail. In the first culturing, the media was changed every 2-3 days, and cells were subcultured once every weeks for 14 days in total. The chemical cocktail includes a TGF-β receptor inhibitor (616452), VPA, and VitC. VitC, which is an antioxidant, was used to increase conversion efficiency, but is not a substance that is necessary for direct conversion. The detailed media composition is represented in Table 2 below.

TABLE-US-00002 TABLE 2 Reprogramming Media Composition Classification Supplemented with Chemical Cocktail Base KnockOut DMEM Reprogramming 15% KSR (Knockout Serum Replacement) Media 1% penicillin streptomycin (P/S, penicillin) 1% glutamine (glutaMAXTM-I) 1% NEAA (non-essential amino acids) 30 ng/ml IGFII (insulin-like growth factor II) 20 ng/ml bFGF2 (basic fibroblast growth factor 2) 0.1 mM β-mercaptoethanol Chemical Cocktail TGFβRI inhibitor (616452, 10 μM) 0.5 mM VPA 100 μg/ml VitC

[0204] Subsequently, in second culturing, cells were cultured in media containing the above media composition with additionally supplement of a glycogen synthase kinase 3 (GSK-3) inhibitor (CHIR99021). The concentration of the GSK-3 inhibitor in the media was 3 μM. The cells were subcultured once every weeks for 14 days in total, while the media was changed every 2-3 days.

[0205] (3) Differentiation into Macrophages

[0206] The CMP cells obtained by direct conversion above were cultured in macrophage differentiation media for one week. For the macrophage differentiation media, media containing RPMI1640 supplemented with 10% fetal bovine serum (FBS), 1% P/S, 10 ng/ml macrophage colony-stimulating factor (M-CSF), 10 ng/ml interleukin-4 (IL4), and 0.055 mM β-mercaptoethanol were used.

[0207] (4) Characterization of Cells

[0208] FIG. 7A shows flow cytometry results of analyzing the expression of the hematopoietic stem cell marker CD34 and the blood cell marker CD45 in cells that were obtained by adding a chemical cocktail to neonatal fibroblasts and culturing the same for 28 days. As shown in FIG. 7A, CD34 was not expressed, indicating that the cultured cells were not hematopoietic stem cells. Meanwhile, the number of cells expressing CD45 was increased.

[0209] FIG. 7B shows flow cytometry results of analyzing the expression of the blood cell marker CD45 and the CMP marker CD14 in cells that were obtained by adding a chemical cocktail to neonatal fibroblasts and culturing the same for 28 days. As shown in FIG. 7B, the expression of CD45 and CD14 was confirmed, indicating that the fibroblasts were differentiated into CMP lineage cells, not into hematopoietic stem cells.

[0210] FIG. 7C shows results of evaluating phagocytosis of macrophages differentiated from cells that were obtained by adding a chemical cocktail to neonatal fibroblasts and culturing the same for 28 days. As shown in FIG. 7C, the differentiated macrophages exhibited phagocytic activity.

[0211] FIG. 8 shows qRT-PCR results of analyzing the expression of pluripotency markers SOX2, NANOG, and OCT4; mesodermal lineage markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL, in cells obtained by adding a chemical cocktail to neonatal fibroblasts and culturing the same for 28 days.

[0212] FIG. 9A shows flow cytometry results of analyzing the expression of the hematopoietic stem cell marker CD34 and the blood cell marker CD45 in cells that were obtained by adding a chemical cocktail to adult fibroblasts and culturing the same for 28 days. As shown in FIG. 9A, in a similar fashion as observed with the neonatal fibroblasts, as CD34 was not expressed, the number of cells expressing CD45 was increased; and since CD34 was not expressed in these cells, it could be confirmed that the cultured cells were not hematopoietic stem cells. Meanwhile, the percentage of cells expressing CD45 was noticeably increased compared with the neonatal fibroblasts.

[0213] FIG. 9B shows flow cytometry results of analyzing the expression of the blood cell marker CD45 and the CMP marker CD14 in cells that were obtained by adding a chemical cocktail to adult fibroblasts and culturing the same for 28 days. As shown in FIG. 9B, the percentages of cells expressing CD45 and CD14 were noticeably increased compared with the neonatal fibroblasts. In other words, it could be confirmed that there is an increase in conversion efficiency toward CMP lineage cells in human adult fibroblasts, compared with that observed in neonatal fibroblasts.

[0214] FIG. 9C shows results of evaluating phagocytosis of macrophages differentiated from cells that were obtained by adding a chemical cocktail to adult fibroblasts and culturing the same for 28 days. As shown in FIG. 9C, the differentiated macrophages exhibited phagocytic activity.

[0215] FIG. 10 shows qRT-PCR results of analyzing the expression of pluripotency markers SOX2, NANOG, and OCT4, mesodermal markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL in cells that were obtained by adding a chemical cocktail to adult fibroblasts and culturing the same for 28 days.

[0216] Taking FIG. 7 to FIG. 10 together, the cells obtained by the direct conversion method using the chemical cocktail showed a negligible level of CD34 expression and demonstrated the expression of CD45 and CD14. Thus, it could be confirmed that the cells were differentiated into CMP lineage cells, not into hematopoietic stem cells. Further, it could be confirmed that the cells obtained by direct conversion using the chemical cocktail were able to differentiate into macrophages with phagocytic activity. These results could be also confirmed by analyzing related genes.

[0217] Further, since the CMP cells obtained by the direct conversion method using the chemical cocktail as described in Example 2 exhibited a higher level of CD45 expression compared with that observed in CMP cells obtained by the direct conversion method using SOX2 overexpression as described in Example 1, it could be confirmed that the method in Example 2 has superior conversion efficiency.

EXPERIMENTAL EXAMPLE 1

Comparison Between SOX2 Overexpression-Based Direct Conversion and Direct Conversion Using Chemical Cocktail

[0218] FIG. 11 shows qRT-PCR results of comparatively analyzing the expression of pluripotency markers SOX2, NANOG, and OCT4, mesodermal lineage markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL, in cells (SOX2 OE) that were obtained by transducing neonatal fibroblasts (HDF-N) with SOX2; and in cells (TβRlin) that were obtained by adding a chemical cocktail to neonatal fibroblasts (HDF-N).

[0219] FIG. 12 shows qRT-PCR results of comparatively analyzing the expression of pluripotency markers SOX2, NANOG, and OCT4, mesodermal lineage markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL, in cells (SOX2 OE) that were obtained by transducing adult fibroblasts (HDF-A) with SOX2; and in cells (TβRlin) that were obtained by adding a chemical cocktail to adult fibroblasts (HDF-A).

[0220] Taking FIG. 11 to FIG. 12 together, in all cells obtained by direct conversion, either by SOX2 overexpression or using the chemical cocktail, the expression of pluripotency markers SOX2, NANOG, and OCT4, mesodermal lineage markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL, was enhanced in a similar fashion. However, it could be confirmed that there is a further increase in the expression of NANOG and OCT4 in the direct conversion conditions using the chemical cocktail. Further, it could be confirmed that there is a further increase in the expression of mesodermal lineage markers MIXL1 and Brachy, and markers essential for hematopoiesis C/EBPα and PU.1 in the direct conversion conditions using the chemical cocktail.

[0221] Accordingly, it could be confirmed that the direct conversion method using the chemical cocktail has a superior conversion efficiency compared to that of the direct conversion method using SOX2 overexpression.

EXPERIMENTAL EXAMPLE 2

Confirmation of SOX2 Dependency of Direct Conversion Using Chemical Cocktail

[0222] To understand the correlation of whether SOX2 enhancement by a chemical cocktail has an effect on conversion efficiency, the following experiments were prepared.

[0223] By transducting Tet-shSOX2 vector using lentiviral delivery, two batches of Tet-shSOX2 expressing cell lines; SOX2-I and SOX2-II, were established. Each cell lines were treated with doxycycline to suppress SOX2 expression. The cells were supplemented with a chemical cocktail in an identical manner as shown in Example 2 (1) and (2) and cultured for 28 days to induce direct conversion.

[0224] FIG. 13A shows qRT-PCR results of analyzing an expression level of SOX2 after inducing direct conversion by adding a chemical cocktail to fibroblasts.

[0225] FIG. 13B shows flow cytometry results of analyzing the expression of the blood cell marker CD45 after inducing direct conversion by adding a chemical cocktail to fibroblasts.

[0226] As shown in FIGS. 13A and 13B, it could be confirmed that direct conversion from fibroblasts into CMP lineage cells using the chemical cocktail occurs in a manner dependent on SOX2 expression enhancement.

EXPERIMENTAL EXAMPLE 3

Correlation Between SOX2 Enhancement Effect by Chemical Cocktail and TGF-B Receptor Type I Activity Status, and Identification of Their Effect on Conversion Efficiency

[0227] To confirm that SOX2 enhancement effect by a chemical cocktail is mediated from inhibition of TGF-β type I receptor, experiments were performed as follows.

[0228] By transducing vectors pcDNA3-ALK5 WT, pcDNA3-ALK5 T204D, or pcDNA3-ALK5 K232R into fibroblasts, cell lines expressing wild type (WT) of TGFβRI, constitutively active mutant (CA, T204D), and inactive mutant (KD, K232R) were established. Each of the cell lines was supplemented with a chemical cocktail in a manner identical to the method shown in Example 2 (1) and (2), and was cultured for 28 days to induce direct conversion.

[0229] FIG. 14 shows flow cytometry results of analyzing the expression of the blood cell marker CD45 and the CMP marker CD14 in cells that were obtained after inducing direct conversion by adding a chemical cocktail to normal neonatal fibroblasts (HDF-N) and to neonatal fibroblasts in which WT, T204D, or K232R is overexpressed.

[0230] FIG. 15 shows qRT-PCR results of analyzing the expression of pluripotency markers SOX2, NANOG, and OCT4; mesodermal lineage markers MIXL1 and BRACHY; and genes essential for hematopoiesis C/EBPα, PU.1, and SCL in cells that were obtained after inducing direct conversion by adding a chemical cocktail to normal neonatal fibroblasts (HDF-N) and to neonatal fibroblasts in which WT, T204D, or K232R is overexpressed.

[0231] FIG. 16 shows results of flow cytometry analyses confirming the expression of the blood cell marker CD45 and the CMP marker CD14 in cells that were obtained after inducing direct conversion by adding a chemical cocktail to normal adult fibroblasts (HDF-A) and to adult fibroblasts in which WT, T204D, or K232R is overexpressed.

[0232] FIG. 17 shows qRT-PCR results of analyzing the expression of pluripotency markers SOX2, NANOG, and OCT4; mesodermal lineage markers MIXL1 and BRACHY, and genes essential for hematopoiesis C/EBPα, PU.1, and SCL, in cells that were obtained after inducing direct conversion by adding a chemical cocktail to normal adult fibroblasts (HDF-A) and to adult fibroblasts in which WT, T204D, or K232R is overexpressed.

[0233] Taking FIG. 14 to FIG. 17 together, as there is a noticeable increase in the expression of CD45 and CD14 proteins in the K232R cells in which suppressed TGF-β receptor type I function in the neonatal fibroblasts and the adult fibroblasts, the effect of the chemical cocktail on direct conversion could be confirmed. Further, it could be confirmed that there is a further increase in the expression of BRACHY and SCL in K232T cells after inducing direct conversion using a chemical cocktail, compared with that observed in normal neonatal fibroblasts. Further, it could be confirmed that there is a further increase in SOX2 expression in KD cells after inducing direct conversion using the chemical cocktail, compared with that observed in normal adult fibroblasts.

[0234] Therefore, it was confirmed that fibroblasts could be directly converted into CMP cells by inhibiting TGF-β activity, thereby increasing SOX2 expression.

EXAMPLE 3

Direct conversion From Fibroblasts to CMP Cells With the Addition of a Compound From a Chemical Cocktail

[0235] To determine the effect of addition of individual compound from the chemical cocktail, direct conversion from fibroblasts to CMP cells was induced by adding various combinations of compounds.

[0236] In detail, neonatal fibroblasts (HDF-N) were cultured in reprogramming media containing chemical compositions shown in Table 3. The reprogramming media were composed of base reprogramming media and a chemical composition, and the composition of the base reprogramming media is the same as that of the base reprogramming media described in Table 2 in Example 2. With media changes every 2-3 days and sub-culturing performed once a week, cells were cultured over 28 days in total.

[0237] Cells cultured with the base reprogramming media without addition of the compounds were used as a negative control group (Cnt).

[0238] CD45 expression level in the cells obtained after culturing for 28 day was used to determine direct conversion capability. Relative CD45-expressing cells (%) in each experiment group in comparison with the negative control group were shown in Table 3.

TABLE-US-00003 TABLE 3 CD45-expressing cell (%) compared to Experiment Chemical negative control groups compositions group (Cnt) Example 3-1 10 μM TGFβRI inhibitor (616452) 6.36% Example 3-2 10 μM TGFβRI inhibitor 3.26% (616452) + 100 μg/ml VitC Example 3-3 10 μM TGFβRI inhibitor 9.13% (616452) + 0.5 mM VPA Example 3-4 10 μM TGFβRI inhibitor   15% (616452) + 0.5 mM VPA + 100 μg/ml VitC

[0239] FIG. 18 shows CD45 expression levels of cells obtained after culturing for 28 days according to chemical compositions.

[0240] As shown in Table 3 and FIG. 18, it was found that the use of TGF-β receptor inhibitor alone led to an increase in the expression of the blood cell marker CD45. Accordingly, it could be confirmed that from the chemical cocktail, the TGF-β receptor inhibitor alone can be used for the direct conversion of somatic cells to CMP cells.

[0241] Also, it was found that using the TGF-β receptor inhibitor and a HDAC inhibitor (e.g., VPA) together leads to an increase in conversion efficiency. It was also found that using the TGF-β receptor inhibitor and an antioxidant (e.g., VitC) together leads to an increase in cell viability. It was also found that using the TGF-β receptor inhibitor, the HDAC inhibitor, and the antioxidant all together leads to not only an increase in cell viability but also an increase in direct conversion capability.

EXAMPLE 4

Effect of Post-treatment of GSK-3 Inhibitor on the Conversion Efficiency

[0242] Experiments were performed to determine the effect of post-treatment of GSK-3 inhibitor on the conversion efficiency.

[0243] In detail, neonatal fibroblasts (HDF-N) were cultured in reprogramming media containing chemical compositions shown in Table 4. The reprogramming media were composed of base reprogramming media and a chemical composition, and the composition of the base reprogramming media was the same as that of the base reprogramming media described in Table 2 in Example 2.

[0244] Cells were cultured for 28 days using a combination of a TGF-β receptor inhibitor, an HDAC inhibitor, and an antioxidant in Example 4-1. Cells in Example 4-2 were obtained by performing a first culture for 14 days using a combination of a TGF-β receptor inhibitor, an HDAC inhibitor, and an antioxidant, and then a second culture for 14 days using a combination of a TGF-β receptor inhibitor, an HDAC inhibitor, an antioxidant, and a GSK-3 inhibitor. In Examples 4-1 and 4-2, the media were changed once every 2-3 days, and the cells were sub-cultured once a week.

[0245] Cells cultured using the base reprogramming media without addition of the compounds were used as a negative control group (Cnt).

[0246] CD45 expression level in the cells obtained after culturing for 28 day was used to determine direct conversion capability. CD45-expressing cells in each experiment group in comparison with the negative control group were shown in Table 4.

TABLE-US-00004 TABLE 4 CD45-expressing cell (%) compared to Chemical negative control group Examples Compositions (Cnt) Example 4-1 10 μM TGFβRI inhibitor (616452) + 9.13% (cultured for 0.5 mM VPA + 100 μg/ml VitC 28 days) Example 4-2 First culture (14 days): 10 μm 54.6% (cultured for TGFβRI inhibitor (616452) + 0.5 mM 28 days) VPA + 100 μg/ml VitC Second culture (14 days): 10 μM TGFβRI inhibitor (616452) + 0.5 mM VPA + 100 μg/ml VitC + 3 μM GSK-3 inhibitor (CHIR99021)

[0247] FIG. 19 shows CD45 expression levels of cells obtained after culturing for 28 days, with or without post-treatment with a GSK-3 inhibitor.

[0248] As shown in Table 4 and FIG. 19, it was found that cells post-treated with the GSK-3 inhibitor showed an increased conversion efficiency compared to the cells treated with only a TGF-β receptor inhibitor, an HDAC inhibitor, and an antioxidant.

[0249] According to a composition for inducing direct conversion of somatic cells into CMP cells, according to one aspect, the composition including a chemical cocktail, it is possible to prepare CMP cells and macrophages with a higher yield within a shorter period of time, compared with existing methods using gene transduction. Further, by using drugs that are actually clinically applied, it is possible to directly convert somatic cells into CMP cells and macrophages without genetic manipulation or modification. Accordingly, the composition, or CMP cells and macrophages prepared using the composition may be used for preventing or treating diseases associated with fibroblasts, for example, chronic-refractory conditions, such as fibrosis and scars.

[0250] It should be understood that embodiments described herein should be considered in a descriptive sense only and not for purposes of limitation. Descriptions of features or aspects within each embodiment should typically be considered as available for other similar features or aspects in other embodiments. While one or more embodiments have been described with reference to the figures, it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the disclosure as defined by the following claims.