Variant recombinant dermatophagoides pteronyssinus type 1 allergen protein and its preparation method and application

Abstract

A DNA sequence encoding Der p1 protein having a particular base sequence is codon-optimized for the Pichia pastoris expression system, which is conducive to expressing Der p1 in Pichia pastoris. After gene optimization and adding an activating element to increase the expression of Der p1 in molecular level, it was found that Der p1 is expressed at a higher level as compared with the prior art and has biological activity similar to the natural protein.

Claims

1. A DNA sequence encoding a proDer p1 protein, said DNA having the base sequence as shown in SEQ ID NO: 1.

2. The DNA sequence of claim 1, wherein the DNA sequence is comprised in a vector pAO815, pPIC9, pPIC9K, pPIC3.5, pPIC3.5K, pPICZα A, B, C or pGAPZα A, B, C.

3. A DNA sequence of claim 2, wherein the vector is comprised in Pichia pastoris strain SMD1168, GS115, KM71, X33 or KM71H.

4. The DNA sequence of claim 3, wherein there is a 242 bp interval between the DNA sequence encoding proDer p1 protein and ATG of AOX1 on Pichia pastoris; and the DNA sequence encoding the proDer p1 protein is preceded by a sequence encoding an alpha-factor signal peptide and Kozak sequence GCCACCATGG.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a comparison plot of sequences of the recombinant proDer p1 gene before and after optimization. FIG. 1 discloses SEQ ID NOS 2 and 1, respectively, in order of appearance.

(2) The sequence before optimization corresponds to the nucleotide sequence of the natural proDer p1 gene; the sequence after optimization corresponds to the nucleotide sequence of the recombinant proDer p1 gene of the present invention, that is, the codon-optimized sequence.

(3) FIGS. 2-a and 2-b show the CAI indices of the proDer p1 gene in the Pichia pastoris expression system before and after optimization.

(4) FIG. 2-a shows that the CAI index of the nucleotide sequence of the natural proDer p1 gene in the Pichia pastoris expression system was calculated by a program to be 0.77. FIG. 2-b shows that the CAI index of the optimized proDer p1 codon of the present invention in the Pichia pastoris expression system is calculated by a program to be 0.90.

(5) FIGS. 3-a and 3-b are optimal codon frequency distribution region plots of the proDer p1 gene in the Pichia pastoris expression host before and after codon optimization.

(6) FIG. 3-a is an optimal codon frequency distribution region plot of the nucleotide sequence of natural proDer p1 gene in the Pichia pastoris system, and it can be seen from the figure that the occurrence percentage of low-utilization codon in the nucleotide sequence of natural proDer p1 gene is 9%. FIG. 3-b shows an optimal codon frequency distribution region plot of the optimized proDer p1 codon of the present invention in the Pichia pastoris system, and the occurrence rate of low-utilization codon in the sequence of optimized proDer p1 codon of the present invention is 0.

(7) FIGS. 4-a and 4-b are average GC base content distribution region plots of the proDer p1 gene in the Pichia pastoris expression system before and after codon optimization.

(8) FIG. 4-a shows that the average GC base content of the nucleotide sequence of the natural proDer p1 gene in the Pichia pastoris expression system is 41.68%. FIG. 4-b shows that the average GC base content of optimized proDer p1 codon of the present invention in the Pichia pastoris expression system is 46.22%.

(9) FIG. 5 is an agarose gel electrophoretogram of a PCR product of the codon-optimized proDer p1 gene.

(10) Lane 1 represents 500 bp DNA ladder; lane 2 represents a PCR product of the recombinant proDer p1 gene containing XhoI and XbaI restriction sites at both ends.

(11) FIG. 6 is a diagram showing a construction process of the expression plasmid pPICZα-proDer p1 for codon-optimized proDer p1.

(12) FIG. 7 is a diagram showing the identification of expression of the codon-optimized proDer p1 gene in the host engineering bacteria.

(13) FIG. 7-a is a SDS-PAGE gel electrophoretogram of a supernatant of a solution of the host engineering strain containing the codon-optimized proDer p1 gene, after methanol-induced expression for one week. Lane 3 represents pre-stained protein loading markers in the range of 10-250 KD; and lanes 1-10 represent supernatants of cultured solutions of proDer p1 gene-positive monoclonal host engineering strains screened by Zeocin.

(14) FIG. 7-b is a western blot plot of a supernatant of a solution of the host engineering strain containing the codon-optimized proDer p1 gene, after methanol-induced expression for one week. Lane 1 represents pre-stained protein loading markers in the range of 10-250 KD; and lanes 2-10 represent supernatants of cultured solutions of proDer p1 gene-positive monoclonal host engineering strains screened by Zeocin.

(15) FIG. 8 shows a chromatogram of the supernatant of proDer p1 fermentation broth by cation chromatography of the first step, and a gel electrophoretogram.

(16) FIG. 8-a is a chromatogram of the supernatant of proDer p1 fermentation broth by cation chromatography of the first step. FIG. 8-b is a gel electrophoretogram of samples collected by performing cation chromatography of the first step on the supernatant of proDer p1 fermentation broth, wherein lane 1 represents 11-100 KD non-pre-stained protein markers, lane 2 represents the supernatant of the proDer p1 fermentation broth before purification, lane 3 represents the flow-through liquid, and lanes 4-10 represent respective elution tubes.

(17) FIG. 9 is a chromatogram of Der p1 protein by anion chromatography of the second step, and a gel electrophoretogram.

(18) FIG. 9-a is a chromatogram of the supernatant of Der p1 fermentation broth by anion chromatography. FIG. 9-b is a gel electrophoretogram of samples collected by performing anion chromatography on the supernatant of Der p1 fermentation broth, wherein lane 1 represents 11-100 KD non-pre-stained protein markers, lane 2 represents the supernatant before purification of Der p1 protein, lane 3 represents the flow-through liquid of Der p1 protein, and lane 4 represents elution peaks of Der p1 protein.

(19) FIG. 10 shows a chromatogram of Der p1 protein by hydrophobic chromatography of the third step and a gel electrophoretogram.

(20) FIG. 10-a is a chromatogram of Der p1 protein by hydrophobic chromatography of the third step. FIG. 10-b is a gel electrophoretogram of samples collected by performing hydrophobic chromatography on Der p1 protein, wherein lane 1 represents 11-100KD non-pre-stained protein markers, and lane 2-8 represent respective elution tubes.

(21) FIG. 11 is an dot-immunoblot identification plot of recombinant Der p1 and natural Der p1 with positive serum respectively, wherein nDerp1 represents the natural Der p1 protein, rDerp1 represents the recombinant Der p1 protein, and NC represents a PBS solution at pH 7.4.

(22) FIG. 12 is an agarose gel electrophoretogram of a PCR-amplified GAP gene, wherein lane 1 represents 250 bp DNA ladder and lane 2 represents the GAP gene.

(23) FIG. 13 is an agarose gel electrophoretogram for identifying T-vector positive clone of GAP gene through PCR, wherein lane 1 represents 250 bp DNA ladder, lanes 2-11 represent positive clones obtained by blue-white screening, and lane 12 represents a negative clone obtained by blue-white screening.

(24) FIG. 14 is an agarose gel electrophoretogram of a PCR-amplified proDer p1 gene, wherein lane 1 represents 500 bp DNA ladder and lane 2 represents the proDer p1 gene.

(25) FIG. 15 is an agarose gel electrophoretogram for identifying T-vector positive clone of proDer p1 gene through PCR, wherein lane 1 represents 500 bp DNA ladder, lanes 2 and 3 represent negative clones obtained by blue-white screening, lanes 4-16 represent positive clones obtained by blue-white screening, and lane 17 represents a positive control (proDer p1 gene).

(26) FIG. 16 shows amplification curves of a standard plasmid.

(27) FIG. 16-a shows amplification curves of the standard plasmid T-GAP, and FIG. 16-b shows amplification curves of the standard plasmid T-proDer p1.

(28) FIG. 17 shows melting curves of a standard plasmid.

(29) FIG. 17-a shows melting curves of the standard plasmid T-GAP, and FIG. 17-b shows melting curves of the standard plasmid T-proDer p1.

(30) FIG. 18 shows a standard curve of a standard plasmid.

(31) FIG. 18-a shows a standard curve of the standard plasmid T-GAP, and FIG. 18-b shows a standard curve of the standard plasmid T-proDer p1.

(32) FIG. 19 shows amplification curves of samples to be tested.

(33) FIG. 19-a shows amplification curves obtained when the samples to be tested are amplified with GAP-1 and GAP-2 as primers, and FIG. 19-b shows amplification curves obtained when the samples to be tested are amplified with 5′AOX and 3′AOX as primers.

(34) FIG. 20 shows melting curves of samples to be tested.

(35) FIG. 20-a shows melting curves obtained when the samples to be tested are amplified with GAP-1 and GAP-2 as primers, and FIG. 20-b shows melting curves obtained when the samples to be tested are amplified with 5′AOX and 3′AOX as primers.

DETAILED DESCRIPTION OF EMBODIMENTS

(36) The invention is further illustrated below in conjunction with specific examples. It should be understood that the examples referred to are merely illustrative of the invention and are not intended to limit the scope of the present invention.

Example 1

Codon Optimization of Recombinant proDer p1

(37) Based on the DNA sequence of proDer p1 disclosed in EMBL-EBI (ENA accession no. FM177224.1), as shown in SEQ ID No: 2, the inventors performed codon optimization of the gene to obtain the proDer p1 gene of the present invention of which the nucleotide sequence is as shown in SEQ ID No: 1 and the amino acid sequence is as shown in SEQ ID No: 3. Comparison of each parameter before and after codon optimization of the proDer p1 is as follows:

(38) 1. Codon Adaptation Index (CAI)

(39) As can be seen from FIG. 2-a, the codon adaptation index (CAI) of the original proDer p1 gene in the Pichia pastoris expression system before codon optimization is 0.77. As can be seen from FIG. 2-b, the proDer p1 gene has a CAI index of 0.9 in the Pichia pastoris expression system after codon optimization. Usually, when CAI=1, it is considered that the gene is in the most ideal expression state in the expression system. The lower the CAI index, the worse the expression level of the gene in the host. Thus, it can be seen the gene sequence obtained by codon optimization can increase the expression level of the proDer p1 gene in the Pichia pastoris expression system.

(40) 2. Optimal Codon Usage Frequency (POP)

(41) As can be seen from FIG. 3-a, based on the Pichia pastoris expression vector, the occurrence percentage of the low-utilization codon (codon with a utilization rate less than 40%) of the proDer p1 gene sequence is 9% before codon optimization. This unoptimized gene uses tandem rare codons that may reduce translation efficiency and even disintegrate a translation assembly. As can be seen from FIG. 3-b, the proDer p1 gene has a low utilization codon frequency of 0 in the Pichia pastoris system after codon optimization.

(42) 3. GC Base Content (GC Curve)

(43) The ideal distribution region of GC content is 30%-70%, and any peak outside this region will affect transcription and translation efficiency to varying degrees. As can be seen from the comparison of the average GC base content distribution region plots of the proDer p1 gene in FIG. 4-a and FIG. 4-b, FIG. 4-a shows the average GC base content of the proDer p1 gene being 41.68%, and FIG. 4-b shows that the peaks of GC content appearing outside the 30%-70% region are removed after optimization, and finally the average GC base content of optimized proDer p1 is 46.22%.

Example 2

Construction of an Expression Plasmid Containing the proDer p1 Gene

(44) A sequence of XhoI restriction site was introduced at the 5′ end, and a sequence of XbaI restriction site was introduced at the 3′ end of the codon-optimized proDer p1, and then full gene synthesis was performed. The synthesized gene fragment was constructed into the pUC57 plasmid supplied by GenScript (Nanjing) Co., Ltd., thereby obtaining a plasmid for long-term preservation, denoted as pUC57-proDer p1 plasmid.

(45) PCR amplification was performed using the pUC57-proDer p1 plasmid as a template, and primers of following sequences:

(46) TABLE-US-00001 upstream primer (SEQ ID No: 5): M13 F: TGT AAA ACG ACG GCC AGT downstream primer (SEQ ID No: 6): M13 R: CAG GAA ACA GCT ATG AC

(47) The total volume of the reaction was 50 μL, in which 2.5 μL of each primer at a concentration of 10 μmol/L was added, 1 μL of dNTP at a concentration of 10 mmol/L was added, and 0.5 μL DNA polymerase being Q5 (#M0491L, purchased from New England BioLabs) at 2 U/μL was added. The reaction conditions were 98° C. for 5 seconds, 55° C. for 45 seconds, and 72° C. for 30 seconds. After 25 cycles, the product was analyzed by 1.0% agarose gel electrophoresis. The results showed that the product size was consistent with the expected size (1000 bp) (results as shown in FIG. 5). The product was digested with XhoI (#R0146S, purchased from New England BioLabs) and XbaI (#R01445S, purchased from New England BioLabs), respectively, and electrophoresed on 1% agarose gel to obtain a gene product, which was purified using a DNA gel recovery kit (DP214, purchased from Tiangen Biotech (Beijing) Co., Ltd.). The purified product was ligated to pPICZαA plasmid (V173-20, purchased from Invitrogen) with T4 ligase (#M0202S, purchased from New England BioLabs), and transformed into DH5α competent cells (CB101, purchased from Tiangen Biotech (Beijing) Co., Ltd.) and cultured in an LB solid medium containing bleomycin (purchased from Invitrogen) at 37° C. overnight. On the second day, the positive clones were picked and sequenced, and the sequence was found identical to the expected sequence by alignment, thereby obtaining the expression plasmid of codon-optimized proDer p1, denoted as pPICZα-proDer p1 (the plasmid construction was as shown in FIG. 6).

Example 3

Construction of a Pichia Pastoris Host Engineering Strain Containing a Recombinant proDer p1 Gene

(48) Formulation of YPDS solid medium: the medium was formulated according to the instructions of Easy SelectPichia Expression Kit, Invitrogen, comprising 10 g/L yeast extract, 20 g/L peptone, 20 g/L glucose, 15 g/L agarose, and 182 g/L sorbitol.

(49) 1. Construction of a Host Engineering Strain Containing Codon-Optimized proDer p1

(50) Electrocompetent cells were prepared according to the method of instructions of Easy SelectPichia Expression Kit, Invitrogen. The plasmid pPICZα-proDer p1 obtained in Example 2 was linearized with Sac I restriction endonuclease (#R0156S, purchased from New England Biolabs), and precipitated with ethanol. The linearized vector was electrotransformed into competent cells of Pichia pastoris X33. The cells were plated on YPDS solid media and cultured at 30° C. until the transformants grew.

Example 4

Inducible Expression and Identification of Engineering Strains Containing Codon-Optimized proDer p1 Gene

(51) Formulation of BMGY medium: the medium was formulated according to the instructions of Easy SelectPichia Expression Kit, Invitrogen, comprising 10 g/L yeast extract, 20 g/L peptone, 3 g/L K.sub.2HPO.sub.4, 11.8 g/L KH.sub.2PO.sub.4, 13.4 g/L YNB, 4×10.sup.−4 g/L biotin, and 10 g/L glycerin.

(52) Formulation of BMMY medium: the medium was formulated according to the instructions of Easy SelectPichia Expression Kit, Invitrogen, comprising 10 g/L yeast extract, 20 g/L peptone, 3 g/L K.sub.2HPO.sub.4, 11.8 g/L KH.sub.2PO.sub.4, 13.4 g/L YNB, 4×10.sup.−4 g/L biotin, and 5 mL/L methanol.

(53) 1. Methanol-Induced Expression of an Engineering Strain of Codon-Optimized proDer p1

(54) The host monoclonal engineering strain obtained in Example 3 was picked into a 5 mL BMGY medium and cultured in a 50 mL sterile centrifuge tube at 30° C. and 220 rpm until OD.sub.600 reaches 1.0-2.0. 1 mL of the culture was stored, and the remaining strain solution was resuspended and transferred to BMMY for induced expression at a small scale, and methanol was supplemented every 24 hours to a final concentration of 1%. One week later, the supernatant of the strain solution was collected by centrifugation, and analyzed by SDS-PAGE gel electrophoresis and Western blotting. Brightness of expressed product bands was observed. FIGS. 7-a and 7-b are plots of identification of induced expression of gene engineering strains containing Der p1. As seen from FIGS. 7-a and 7-b, the proDer p1 protein was significantly expressed in the engineering strain.

Example 5

Purification of Recombinant Der p1 Protein

(55) The Der p1 constructed in this invention is obtained mainly by ion exchange and hydrophobic chromatography purification methods. HiTrap SP FF, HiTrap Q FF, and HiTrap Phenyl HP were selected as the chromatographic packings. The specific steps are as follows:

(56) 1. Pretreatment of the Fermentation Broth by Impurity Removal

(57) The fermentation broth of host engineering strain containing proDer p1 obtained according to Example 4 was centrifuged by centrifugation at a low temperature at 12000 rpm for 15 minutes to collect a supernatant, and the supernatant was dialyzed in a 5 KD dialysis bag against a 25 mM sodium acetate buffer at pH 4.5 for 48 h, and filtered through a 0.45 μm filter membrane to obtain a supernatant of the treated fermentation broth.

(58) 2. Cation Exchange Chromatography

(59) The treated fermentation broth of the previous step was loaded on a SPFF cation exchange chromatographic column, wherein the equilibration buffer was 50 mM NaAc at pH 4.5, the elution buffer was 50 mM NaAc and 1.0 M NaCl at pH 4.5, isocratic elution was performed at 12%, 25% and 100%, and the sample peaks were mainly concentrated at the 25% elution peak. FIG. 8-a is an ion exchange purification chromatogram of Der p1, and FIG. 8-b is an SDS-PAGE analysis plot of Der p1 after ion exchange chromatography.

(60) 3. Anion Exchange Chromatography

(61) The Der p1 protein peak purified in the previous step was collected, and the sample was ultrafiltered with a 20 mM NaH.sub.2PO.sub.4 solution at pH 6.0, and loaded on a HiTrap Q FF chromatography packing. The equilibration buffer was 20 mM NaH.sub.2PO.sub.4 at pH 6.0, and the elution buffer was 20 mM NaH.sub.2PO.sub.4 and 1.0 M NaCl at pH 6.0. The flow-through peak of Der p1 was collected. The flow-through peak of Der p1 protein was as shown in FIG. 9.

(62) 4. Hydrophobic Chromatography

(63) The flow-through peak of Der p1 from the anion chromatography was collected, and ammonium sulfate was added to a final concentration of 1.5 M. The fermentation broth supernatant treated as above was loaded on a Phenyl HP chromatographic column The equilibration buffer was 20 mM NaH.sub.2PO.sub.4 and 1.5 M (NH.sub.4).sub.2SO.sub.4 at pH 6.0; the elution buffer was 20 mM NaH.sub.2PO.sub.4 at pH 6.0, isocratic elution was performed at 25%, 50%, 70%, and 100%, and the Der p1 protein is mainly concentrated at the 75% elution peak. FIG. 10-a is hydrophobic chromatography purification chromatogram of Der p1, and FIG. 10-b is an SDS-PAGE analysis plot of Der p1 after hydrophobic chromatography. The yield of target protein per liter of fermentation broth is as high as 200 mg or more.

Example 6

Analysis of Der p1 Protein Activity

(64) The purified Der p1 protein was dialyzed against a PBS buffer at pH 7.4, and the protein concentration was determined by a BCA protein concentration assay kit (Cat No: 23225, purchased from Pierce), and fold-diluted to 250 ng, 125 ng, 62.5 ng, 31.25 ng, and 15.625 ng. Using the dot immunoblotting method, the obtained solution was detected for the reactivity with sera of patients allergic to Dermatophagoides pteronyssinus by comparing with natural Der p2 as the control. FIG. 11 shows a dot immunoblot plot of recombinant Der p1 and natural Der p1 (NA-DP1-1, purchased from Indoor Biotechnologies) with positive serum, and the results indicate that the recombinant Der p1 has substantially identical reactivity with the sera as compared with the natural Der p1, showing that the recombinant Der p1 has a similar biological activity as the natural Der p1.

Example 7

Determination of Gene Copy Number of Recombinant proDer p1 Engineering Strain

(65) 1. Inoculation in X33 strain: the strains were cultured in YPD media for 24 h, the X33 genome was extracted by a genomic extraction kit (purchased from Tiangen Biotech (Beijing) Co., Ltd.), and GAP gene was amplified using the X33 genome as a template, and GAP-1 and GAP-2 as primers of which the sequences are as follows:

(66) TABLE-US-00002 upstream primer (SEQ ID No: 7) GAP-1: GGTATTAACGGTTTCGGACGTATTG downstream primer (SEQ ID No: 8) GAP-2: GATGTTGACAGGGTCTCTCTCTTGG

(67) The total volume of the reaction was 50 μL, in which 2.5 μL of each primer at a concentration of 10 μmol/L was added, 1 μL of dNTP at a concentration of 10 mmol/L was added, and 0.5 μL DNA polymerase being Taq DNA Polymerase (M0267S, purchased from New England BioLabs) at 2 U/μL was added. The reaction conditions were 94° C. for 10 minutes, 94° C. for 30 seconds, 55° C. for 30 seconds, 68° C. for 60 seconds, and 68° C. for 5 minutes. After 30 cycles, the product was analyzed by 1.0% agarose gel electrophoresis. The results showed that the product size was consistent with the expected size (400 bp) (results as shown in FIG. 12). The obtained gene product was purified by DNA gel recovery kit (DP214, purchased from Tiangen Biotech (Beijing) Co., Ltd.) and ligated into pGM-T vector kit (VT202-01, purchased from Tiangen Biotech (Beijing) Co., Ltd.). The Top10 competent cells (CB101, purchased from Tiangen Biotech (Beijing) Co., Ltd.) were transformed with the vector, and cultured at 37° C. overnight on blue-white screening media. On the next day, white clones were picked and identified by PCR for which the primers used were GAP-1 and GAP-2. The PCR reaction conditions were consistent with the above-mentioned conditions. The obtained product was analyzed by 1.0% agarose gel electrophoresis, and the results showed that the product size is consistent with the expected size (400 bp) (results as shown in FIG. 13). The positive clones were sent to GenScript (Nanjing) Co., Ltd. for sequencing, and the sequence was found completely identical to the expected sequence by alignment, thereby obtaining the T vector clone of GAP gene, denoted as T-GAP. The T-GAP clone having a correct sequence was inoculated in an LB liquid medium at 37° C. overnight, and the plasmid was extracted (using a plasmid mini-extract kit DP103, purchased from Tiangen Biotech (Beijing) Co., Ltd.) to obtain a standard plasmid for real-time quantitative PCR.

(68) 2. The proDer p1 gene was amplified using the pPICZα-proDer p1 plasmid of Example 2 as a template, and 5′ AOX and 3′ AOX primers with the following sequences:

(69) TABLE-US-00003 upstream primer (SEQ ID No: 9): 5′ AOX: GACTGGTTCCAATTGACAAGC downstream primer (SEQ ID No: 12): 3′ AOX: GGCAAATGGCATTCTGACAT

(70) The total volume of the reaction was 50 μL, in which 2.5 μL of each primer at a concentration of 10 μmol/L was added, 1 μL of dNTP at a concentration of 10 mmol/L was added, and 0.5 μL DNA polymerase being Taq DNA Polymerase (#M0267S, purchased from New England BioLabs) at 2 U/μL was added. The reaction conditions were 94° C. for 10 minutes, 94° C. for 30 seconds, 49° C. for 30 seconds, and 68° C. for 60 seconds, and 68° C. for 5 minutes. After 30 cycles, the product was analyzed by 1.0% agarose gel electrophoresis. The results showed that the product size was consistent with the expected size (1500 bp) (results as shown in FIG. 14). The obtained gene product was purified by DNA gel recovery kit (DP214, purchased from Tiangen Biotech (Beijing) Co., Ltd.) and ligated into pGM-T vector kit (VT202-01, purchased from Tiangen Biotech (Beijing) Co., Ltd.). The Top10 competent cells (CB104, purchased from Tiangen Biotech (Beijing) Co., Ltd.) were transformed with the vector, and cultured at 37° C. overnight on blue-white screening media. On the next day, white clones were picked and identified by PCR for which the primers used were 5′AOX and 3′AOX. The PCR reaction conditions were consistent with the above-mentioned conditions. The obtained product was analyzed by 1.0% agarose gel electrophoresis, and the results showed that the product size is consistent with the expected size (1500 bp) (results as shown in FIG. 15). The positive clones were sent to GenScript (Nanjing) Co., Ltd. for sequencing, and the sequence was found completely identical to the expected sequence by alignment, thereby obtaining the T vector clone of proDer p1, denoted as T-proDer p1. The T-proDer p1 clone having a correct sequence was inoculated in an LB liquid medium at 37° C. overnight, and the plasmid was extracted using a plasmid mini-extract kit (DP103, purchased from Tiangen Biotech (Beijing) Co., Ltd.) to obtain a standard plasmid for real-time quantitative PCR.

(71) 3. Calculation of Gene Copy Number:

(72) The concentration (ng/μL) of the standard plasmid was determined by a nucleic acid microanalyzer (Nanodrop2000, ThermoFisher). Copy numbers of GAP and proDer p1 were calculated according to the following formula:
Copies/u=(6.02×10.sup.23)×(ng/μl×10.sup.−9)/(DNA length×660)

(73) 4. Processing Samples to be Tested

(74) The pPICZα-proDer p1-X33 engineering strain was inoculated in YPD liquid media at 30° C. overnight; and the genome was extracted the next day, and its concentration (ng/μL) and purity were determined by a nucleic acid quantitative microanalyzer.

(75) 5. Establishment of a Standard Curve

(76) The standard plasmids of T-GAP and T-proDer p1 with known copy numbers were gradiently diluted to 10.sup.8, 10.sup.7, 10.sup.6, 10.sup.5, 10.sup.4, and 10.sup.3 copies/μl, respectively. The fluorescent quantitative PCR were performed using GAP-1 and GAP-2, 5′ AOX and 3′ AOX as primers, respectively. FIG. 16-a shows amplification curves of the standard plasmid T-GAP, FIG. 16-b shows amplification curves of the standard plasmid T-proDer p1, FIG. 17-a shows melting curves of the standard plasmid T-GAP, and FIG. 17-b shows melting curves of the standard plasmid T-proDer p1. Each gradient was assayed 3 times to verify the repeatability of the standard curve. Standard curves were established with the Ct values as the ordinate and the starting template copy numbers as the abscissa. FIG. 18-a shows a standard curve of the standard plasmid T-GAP, and FIG. 18-b shows a standard curve of the standard plasmid T-proDer p1.

(77) 6. Determination of Copy Number of ProDer p1 Gene in Recombinant Strains

(78) The genome sample of extracted pPICZα-proDer p1-X33 was serially 10-fold-diluted to obtain four gradients of stock solution, 10.sup.−1, 10.sup.−2, and 10.sup.−3. Fluorescent quantitative PCR was performed using GAP-1 and GAP-2, 5′ AOX and 3′ AOX as primers, and each gradient was assayed three times. FIG. 19-a shows amplification curves of the samples to be tested with GAP-1 and GAP-2 as primers, FIG. 19-b shows amplification curves of the samples to be tested with 5′ AOX and 3′ AOX as primers, FIG. 20-a shows melting curves of the samples to be tested with GAP-1 and GAP-2 as primers, and FIG. 20-b shows melting curves of the samples to be tested with 5′ AOX and 3′ AOX as primers. The GAP gene exists in Pichia pastoris in a single copy. Therefore, the copy number of the GAP gene can be used to characterize the initial copy number of the genome in the template. The ratio of the copy number of the proDer p1 gene to the copy number of the GAP gene is the copy number of proDer p1 gene in the Pichia pastoris genome. Table 1 shows the detection results of copy number of the proDer p1 gene in the Pichia pastoris gene engineering strain, the detected copy number is between 4.98 and 5.46, and finally the copy number of the proDer p1 gene in the recombinant strain was averaged to eliminate the system error and determined to be 5.

(79) TABLE-US-00004 TABLE 1 Results of copy number of proDer p1 in the genome detected by real-time fluorescent quantitative PCR Average Ct value gene copy number (10.sup.N)Copy number of proDer p1 gene in Pichia pastoris genome Copy number of the proDer p1 gene/copy DNA GAP proDer p1 proDer p1 number of the concentration gene gene GAP gene gene GAP gene Stock 17.41 23.18 7.02 5.87 5.46 solution 10.sup.−1 20.29 24.32 6.11 5.59 5.31 10.sup.−2 23.63 24.35 5.10 5.41 5.22 10.sup.−3 28.23 24.39 3.82 5.28 4.98

Example 9

Analysis of the Acting Elements in the proDer p1 Genome

(80) There is no stable additional plasmid in Pichia pastoris, the expression vector is homologously recombined with the host chromosome, and the exogenous gene expression framework is fully integrated into the chromosome to realize the expression of the exogenous gene; the typical Pichia pastoris expression vector contains a regulatory sequence of alcohol oxidase gene, and contains the main structures comprising AOX promoter, multiple cloning site, transcription termination and polyA formation gene sequence (TT), screening markers and the like. The promoter is a cis-element for gene expression regulation and an important element for the genetically engineered expression vector. The important role of the promoter at the transcriptional level determines the gene expression level.

(81) The proDer p1 genome was extracted according to the method of Example 8, and the proDer p1 gene was amplified from the genome using 5′ AOX and 3′ AOX as primers according to the method in Step 2 of Example 8. The obtained samples were sent to GenScript (Nanjing) Co., Ltd. to detect the acting element before and after the proDer p1 gene which was inserted into the genome. The results of genome sequencing indicated that the proDer p1 gene expression framework was integrated into the chromosome of Pichia pastoris by a single cross-insertion, which enabled the proDer p1 gene to express the gene using the AOX promoter on the yeast chromosome, and thus the expression level was higher.

(82) Generally, the closer the first ATG of the exogenous coding sequence to the ATG of AOX1, the better the expression effect. In the gene construction, the inventors chose an enzyme cleavage site closest to the ATG of AOX1, and found that the proDer p1 gene was away from ATG of AOX1 only by 242 bp. In addition, the alpha-factor signal peptide and Kozak sequence GCCACCATGG (SEQ ID NO: 11) were added in front of proDer p1 gene, and the signal peptide and the sequence can greatly improve transcription and translation efficiency and increase expression efficiency of proDer p1 gene in eukaryotes.