RNA-Guided Human Genome Engineering
20220177913 · 2022-06-09
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N15/01
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/1024
CHEMISTRY; METALLURGY
C12N15/87
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C12N15/8201
CHEMISTRY; METALLURGY
International classification
C12N15/01
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
C12N15/87
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
Abstract
A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
Claims
1-14. (canceled)
15. An RNA-guided system for use in a eukaryotic cell comprising (1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and (2) a Cas protein of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system, wherein the guide RNA sequence comprises a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript of between 100 and 250 nucleotides, wherein the Cas protein of a Type II CRISPR system is a Cas nickase of a Type II CRISPR system or a nuclease null Cas of a Type II CRISPR system.
16. The RNA-guided system of claim 15 wherein the guide RNA has a secondary structure comprising a first hairpin connected to the spacer sequence and a second 3′ hairpin.
17. The RNA-guided system of claim 15 further comprising a regulatory element operable in a eukaryotic cell operably linked to the nucleotide sequence encoding the guide RNA sequence.
18. The RNA-guided system of claim 15 further comprising a human U6 polymerase III promoter operably linked to the nucleotide sequence encoding the guide RNA sequence.
19. The RNA-guided system of claim 15 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid.
20. The RNA-guided genome editing system of claim 15 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid including a nuclear localization signal.
21. The RNA-guided system of claim 15 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid including a C-terminal nuclear localization signal.
22. The RNA-guided system of claim 15 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid including a C-terminal SV40 nuclear localization signal.
23. The RNA-guided system of claim 15 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid comprising a regulatory element operable in a eukaryotic cell.
24. The RNA-guided system of claim 15 wherein the second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system is a human codon optimized nucleic acid comprising a human U6 polymerase III promoter.
25. The RNA-guided system of claim 15 wherein the Cas nickase is a Cas9 nickase and wherein the nuclease null Cas is a nuclease null Cas9.
26. The RNA-guided system of claim 15 wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell or a human cell.
27. The RNA-guided system of claim 15 wherein the eukaryotic cell is a stem cell.
28. The RNA-guided system of claim 15 wherein the eukaryotic cell is a human induced pluripotent stem cell.
29. An ex vivo eukaryotic cell containing the RNA-guided system of claim 15.
30. The eukaryotic cell of claim 29 wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell or a human cell.
31. The eukaryotic cell of claim 29 wherein the eukaryotic cell is a stem cell.
32. The eukaryotic cell of claim 29 wherein the eukaryotic cell is a human induced pluripotent stem cell.
33. An RNA-guided system for use in a eukaryotic cell comprising (1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and (2) a Cas protein of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system, wherein the Cas protein of a Type II CRISPR system is a Cas nickase of a Type II CRISPR system or a nuclease null Cas of a Type II CRISPR system, wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript comprising a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the scaffold sequence comprises GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:46).
34. The RNA-guided system of claim 33 wherein the Cas nickase is a Cas9 nickase and wherein the nuclease null Cas is a nuclease null Cas9.
35. An ex vivo eukaryotic cell containing the RNA-guided system of claim 33.
36. The eukaryotic cell of claim 35 wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell or a human cell.
37. The eukaryotic cell of claim 35 wherein the eukaryotic cell is a stem cell.
38. The eukaryotic cell of claim 35 wherein the eukaryotic cell is a human induced pluripotent stem cell.
39. An RNA-guided system for use in a eukaryotic cell comprising (1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and (2) a Cas protein of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas protein of a Type II CRISPR system, wherein the Cas protein of a Type II CRISPR system is a Cas nickase of a Type II CRISPR system or a nuclease null Cas of a Type II CRISPR system, wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript comprising a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the scaffold sequence comprises GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:45).
40. The RNA-guided system of claim 39 wherein the Cas nickase is a Cas9 nickase and wherein the nuclease null Cas is a nuclease null Cas9.
41. An ex vivo eukaryotic cell containing the RNA-guided system of claim 39.
42. The eukaryotic cell of claim 41 wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell or a human cell.
43. The eukaryotic cell of claim 41 wherein the eukaryotic cell is a stem cell.
44. The eukaryotic cell of claim 41 wherein the eukaryotic cell is a human induced pluripotent stem cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. The foregoing and other features and advantages of the present embodiments will be more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawings in which:
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
DETAILED DESCRIPTION
[0026] According to one aspect, a human codon-optimized version of the Cas9 protein bearing a C-terminus SV40 nuclear localization signal is synthetized and cloned into a mammalian expression system (
[0027] According to one aspect, to direct Cas9 to cleave sequences of interest, crRNA-tracrRNA fusion transcripts are expressed, hereafter referred to as guide RNAs (gRNAs), from the human U6 polymerase III promoter. According to one aspect, gRNAs are directly transcribed by the cell. This aspect advantageously avoids reconstituting the RNA processing machinery employed by bacterial CRISPR systems (
[0028] According to one aspect, a GFP reporter assay (
[0029] According to one aspect, a method is provided of homologous recombination (HR). Two gRNAs are constructed, T1 and T2, that target the intervening AAVS1 fragment (
[0030] According to certain aspects, a native locus was modified. gRNAs were used to target the AAVS1 locus located in the PPP1R12C gene on chromosome 19, which is ubiquitously expressed across most tissues (
[0031] Consistent with results for the GFP reporter assay, high numbers of NHEJ events were observed at the endogenous locus for all three cell types. The two gRNAs T1 and T2 achieved NHEJ rates of 10 and 25% in 293Ts, 13 and 38% in K562s, and 2 and 4% in PGP1-iPS cells, respectively (
[0032] According to one aspect, HR is used to integrate either a dsDNA donor construct (see reference (13)) or an oligo donor into the native AAVS1 locus (
[0033] According to one aspect, an RNA-guided genome editing system is provided which can readily be adapted to modify other genomic sites by simply modifying the sequence of the gRNA expression vector to match a compatible sequence in the locus of interest. According to this aspect, 190,000 specifically gRNA-targetable sequences targeting about 40.5% exons of genes in the human genome were generated. These target sequences were incorporated into a 200 bp format compatible with multiplex synthesis on DNA arrays (see reference (14)) (FIGS. 13A-1 and 13A-2). According to this aspect, a ready genome-wide reference of potential target sites in the human genome and a methodology for multiplex gRNA synthesis is provided.
[0034] According to one aspect, methods are provided for multiplexing genomic alterations in a cell by using one or more or a plurality of RNA/enzyme systems described herein to alter the genome of a cell at a plurality of locations. According to one aspect, target sites perfectly match the PAM sequence NGG and the 8-12 base “seed sequence” at the 3′ end of the gRNA. According to certain aspects, perfect match is not required of the remaining 8-12 bases. According to certain aspects, Cas9 will function with single mismatches at the 5′ end. According to certain aspects, the target locus's underlying chromatin structure and epigenetic state may affect efficiency of Cas9 function. According to certain aspects, Cas9 homologs having higher specificity are included as useful enzymes. One of skill in the art will be able to identify or engineer suitable Cas9 homologs. According to one aspect, CRISPR-targetable sequences include those having different PAM requirements (see reference (9)), or directed evolution. According to one aspect, inactivating one of the Cas9 nuclease domains increases the ratio of HR to NHEJ and may reduce toxicity (
[0035] According to certain aspects, a “re-engineerable organism” is provided as a model system for biological discovery and in vivo screening. According to one aspect, a “re-engineerable mouse” bearing an inducible Cas9 transgene is provided, and localized delivery (using adeno-associated viruses, for example) of libraries of gRNAs targeting multiple genes or regulatory elements allow one to screen for mutations that result in the onset of tumors in the target tissue type. Use of Cas9 homologs or nuclease-null variants bearing effector domains (such as activators) allow one to multiplex activate or repress genes in vivo. According to this aspect, one could screen for factors that enable phenotypes such as: tissue-regeneration, trans-differentiation etc. According to certain aspects, (a) use of DNA-arrays enables multiplex synthesis of defined gRNA libraries (refer
[0036] According to one aspect, the lower toxicities observed with “nickases” for genome engineering applications is achieved by inactivating one of the Cas9 nuclease domains, either the nicking of the DNA strand base-paired with the RNA or nicking its complement. Inactivating both domains allows Cas9 to function as a retargetable DNA binding protein. According to one aspect, the Cas9 retargetable DNA binding protein is attached
(a) to transcriptional activation or repression domains for modulating target gene expression, including but not limited to chromatin remodeling, histone modification, silencing, insulation, direct interactions with the transcriptional machinery;
(b) to nuclease domains such as FokI to enable ‘highly specific’ genome editing contingent upon dimerization of adjacent gRNA-Cas9 complexes;
(c) to fluorescent proteins for visualizing genomic loci and chromosome dynamics; or
(d) to other fluorescent molecules such as protein or nucleic acid bound organic fluorophores, quantum dots, molecular beacons and echo probes or molecular beacon replacements;
(e) to multivalent ligand-binding protein domains that enable programmable manipulation of genome-wide 3D architecture.
[0037] According to one aspect, the transcriptional activation and repression components can employ CRISPR systems naturally or synthetically orthogonal, such that the gRNAs only bind to the activator or repressor class of Cas. This allows a large set of gRNAs to tune multiple targets.
[0038] According to certain aspects, the use of gRNAs provide the ability to multiplex than mRNAs in part due to the smaller size—100 vs. 2000 nucleotide lengths respectively. This is particularly valuable when nucleic acid delivery is size limited, as in viral packaging. This enables multiple instances of cleavage, nicking, activation, or repression—or combinations thereof. The ability to easily target multiple regulatory targets allows the coarse-or-fine-tuning or regulatory networks without being constrained to the natural regulatory circuits downstream of specific regulatory factors (e.g. the 4 mRNAs used in reprogramming fibroblasts into IPSCs). Examples of multiplexing applications include:
1. Establishing (major and minor) histocompatibility alleles, haplotypes, and genotypes for human (or animal) tissue/organ transplantation. This aspect results e.g. in HLA homozygous cell lines or humanized animal breeds—or—a set of gRNAs capable of superimposing such HLA alleles onto an otherwise desirable cell lines or breeds.
2. Multiplex cis-regulatory element (CRE=signals for transcription, splicing, translation, RNA and protein folding, degradation, etc.) mutations in a single cell (or a collection of cells) can be used for efficiently studying the complex sets of regulatory interaction that can occur in normal development or pathological, synthetic or pharmaceutical scenarios. According to one aspect, the CREs are (or can be made) somewhat orthogonal (i.e. low cross talk) so that many can be tested in one setting—e.g. in an expensive animal embryo time series. One exemplary application is with RNA fluorescent in situ sequencing (FISSeq).
3. Multiplex combinations of CRE mutations and/or epigenetic activation or repression of CREs can be used to alter or reprogram iPSCs or ESCs or other stem cells or non-stem cells to any cell type or combination of cell types for use in organs-on-chips or other cell and organ cultures for purposes of testing pharmaceuticals (small molecules, proteins, RNAs, cells, animal, plant or microbial cells, aerosols and other delivery methods), transplantation strategies, personalization strategies, etc.
4. Making multiplex mutant human cells for use in diagnostic testing (and/or DNA sequencing) for medical genetics. To the extent that the chromosomal location and context of a human genome allele (or epigenetic mark) can influence the accuracy of a clinical genetic diagnosis, it is important to have alleles present in the correct location in a reference genome—rather than in an ectopic (aka transgenic) location or in a separate piece of synthetic DNA. One embodiment is a series of independent cell lines one per each diagnostic human SNP, or structural variant. Alternatively, one embodiment includes multiplex sets of alleles in the same cell. In some cases multiplex changes in one gene (or multiple genes) will be desirable under the assumption of independent testing. In other cases, particular haplotype combinations of alleles allows testing of sequencing (genotyping) methods which accurately establish haplotype phase (i.e. whether one or both copies of a gene are affected in an individual person or somatic cell type.
5. Repetitive elements or endogenous viral elements can be targeted with engineered Cas+gRNA systems in microbes, plants, animals, or human cells to reduce deleterious transposition or to aid in sequencing or other analytic genomic/transcriptomic/proteomic/diagnostic tools (in which nearly identical copies can be problematic).
[0039] The following references identified by number in the foregoing section are hereby incorporated by reference in their entireties. [0040] 1. B. Wiedenheft, S. H. Sternberg, J. A. Doudna, Nature 482, 331 (Feb. 16, 2012). [0041] 2. D. Bhaya, M. Davison, R. Barrangou, Annual review of genetics 45, 273 (2011). [0042] 3. M. P. Terns, R. M. Terns, Current opinion in microbiology 14, 321 (Jun, 2011). [0043] 4. M. Jinek et al., Science 337, 816 (Aug. 17, 2012). [0044] 5. G. Gasiunas, R. Barrangou, P. Horvath, V. Siksnys, Proceedings of the National Academy of Sciences of the United States of America 109, E2579 (Sep. 25, 2012). [0045] 6. R. Sapranauskas et al., Nucleic acids research 39, 9275 (November, 2011). [0046] 7. T. R. Brummelkamp, R. Bernards, R. Agami, Science 296, 550 (Apr. 19, 2002). [0047] 8. M. Miyagishi, K. Taira, Nature biotechnology 20, 497 (May, 2002). [0048] 9. E. Deltcheva et al., Nature 471, 602 (Mar. 31, 2011). [0049] 10. J. Zou, P. Mali, X. Huang, S. N. Dowey, L. Cheng, Blood 118, 4599 (Oct. 27, 2011). [0050] 11. N. E. Sanjana et al., Nature protocols 7, 171 (January, 2012). [0051] 12. J. H. Lee et al., PLoS Genet 5, e1000718 (November, 2009). [0052] 13. D. Hockemeyer et al., Nature biotechnology 27, 851 (September, 2009). [0053] 14. S. Kosuri et al., Nature biotechnology 28, 1295 (December, 2010). [0054] 15. V. Pattanayak, C. L. Ramirez, J. K. Joung, D. R. Liu, Nature methods 8, 765 (September, 2011). [0055] 16. N. M. King, O. Cohen-Haguenauer, Molecular therapy: the journal of the American Society of Gene Therapy 16, 432 (March, 2008). [0056] 17. Y. G. Kim, J. Cha, S. Chandrasegaran, Proceedings of the National Academy of Sciences of the United States of America 93, 1156 (Feb. 6, 1996). [0057] 18. E. J. Rebar, C. O. Pabo, Science 263, 671 (Feb. 4, 1994). [0058] 19. J. Boch et al., Science 326, 1509 (Dec. 11, 2009). [0059] 20. M. J. Moscou, A. J. Bogdanove, Science 326, 1501 (Dec. 11, 2009). [0060] 21. A. S. Khalil, J. J. Collins, Nature reviews. Genetics 11, 367 (May, 2010). [0061] 22. P. E. Purnick, R. Weiss, Nature reviews. Molecular cell biology 10, 410 (June, 2009). [0062] 23. J. Zou et al., Cell stem cell 5, 97 (Jul. 2, 2009). [0063] 24. N. Holt et al., Nature biotechnology 28, 839 (August, 2010). [0064] 25. F. D. Urnov et al., Nature 435, 646 (Jun. 2, 2005). [0065] 26. A. Lombardo et al., Nature biotechnology 25, 1298 (November, 2007). [0066] 27. H. Li et al., Nature 475, 217 (Jul. 14, 2011).
[0067] The following examples are set forth as being representative of the present disclosure. These examples are not to be construed as limiting the scope of the present disclosure as these and other equivalent embodiments will be apparent in view of the present disclosure, figures and accompanying claims.
Example I
The Type II CRISPR-Cas System
[0068] According to one aspect, embodiments of the present disclosure utilize short RNA to identify foreign nucleic acids for activity by a nuclease in a eukaryotic cell. According to a certain aspect of the present disclosure, a eukaryotic cell is altered to include within its genome nucleic acids encoding one or more short RNA and one or more nucleases which are activated by the binding of a short RNA to a target DNA sequence. According to certain aspects, exemplary short RNA/enzyme systems may be identified within bacteria or archaea, such as (CRISPR)/CRISPR-associated (Cas) systems that use short RNA to direct degradation of foreign nucleic acids. CRISPR (“clustered regularly interspaced short palindromic repeats”) defense involves acquisition and integration of new targeting “spacers” from invading virus or plasmid DNA into the CRISPR locus, expression and processing of short guiding CRISPR RNAs (crRNAs) consisting of spacer-repeat units, and cleavage of nucleic acids (most commonly DNA) complementary to the spacer.
[0069] Three classes of CRISPR systems are generally known and are referred to as Type I, Type II or Type III). According to one aspect, a particular useful enzyme according to the present disclosure to cleave dsDNA is the single effector enzyme, Cas9, common to Type II. (See reference (1)). Within bacteria, the Type II effector system consists of a long pre-crRNA transcribed from the spacer-containing CRISPR locus, the multifunctional Cas9 protein, and a tracrRNA important for gRNA processing. The tracrRNAs hybridize to the repeat regions separating the spacers of the pre-crRNA, initiating dsRNA cleavage by endogenous RNase III, which is followed by a second cleavage event within each spacer by Cas9, producing mature crRNAs that remain associated with the tracrRNA and Cas9. According to one aspect, eukaryotic cells of the present disclosure are engineered to avoid use of RNase III and the crRNA processing in general. See reference (2).
[0070] According to one aspect, the enzyme of the present disclosure, such as Cas9 unwinds the DNA duplex and searches for sequences matching the crRNA to cleave. Target recognition occurs upon detection of complementarity between a “protospacer” sequence in the target DNA and the remaining spacer sequence in the crRNA. Importantly, Cas9 cuts the DNA only if a correct protospacer-adjacent motif (PAM) is also present at the 3′ end. According to certain aspects, different protospacer-adjacent motif can be utilized. For example, the S. pyogenes system requires an NGG sequence, where N can be any nucleotide. S. thermophilus Type II systems require NGGNG (see reference (3)) and NNAGAAW (see reference (4)), respectively, while different S. mutans systems tolerate NGG or NAAR (see reference (5)). Bioinformatic analyses have generated extensive databases of CRISPR loci in a variety of bacteria that may serve to identify additional useful PAMs and expand the set of CRISPR-targetable sequences (see references (6, 7)). In S. thermophilus, Cas9 generates a blunt-ended double-stranded break 3 bp prior to the 3′ end of the protospacer (see reference (8)), a process mediated by two catalytic domains in the Cas9 protein: an HNH domain that cleaves the complementary strand of the DNA and a RuvC-like domain that cleaves the non-complementary strand (See
[0071] According to one aspect, the specificity of gRNA-directed Cas9 cleavage is used as a mechanism for genome engineering in a eukaryotic cell. According to one aspect, hybridization of the gRNA need not be 100 percent in order for the enzyme to recognize the gRNA/DNA hybrid and affect cleavage. Some off-target activity could occur. For example, the S. pyogenes system tolerates mismatches in the first 6 bases out of the 20 bp mature spacer sequence in vitro. According to one aspect, greater stringency may be beneficial in vivo when potential off-target sites matching (last 14 bp) NGG exist within the human reference genome for the gRNAs. The effect of mismatches and enzyme activity in general are described in references (9), (2), (10), and (4).
[0072] According to certain aspects, specificity may be improved. When interference is sensitive to the melting temperature of the gRNA-DNA hybrid, AT-rich target sequences may have fewer off-target sites. Carefully choosing target sites to avoid pseudo-sites with at least 14 bp matching sequences elsewhere in the genome may improve specificity. The use of a Cas9 variant requiring a longer PAM sequence may reduce the frequency of off-target sites. Directed evolution may improve Cas9 specificity to a level sufficient to completely preclude off-target activity, ideally requiring a perfect 20 bp gRNA match with a minimal PAM. Accordingly, modification to the Cas9 protein is a representative embodiment of the present disclosure. As such, novel methods permitting many rounds of evolution in a short timeframe (see reference (11) and envisioned. CRISPR systems useful in the present disclosure are described in references (12, 13).
Example II
Plasmid Construction
[0073] The Cas9 gene sequence was human codon optimized and assembled by hierarchical fusion PCR assembly of 9 500 bp gBlocks ordered from IDT.
[0074] The vectors for the HR reporter assay involving a broken GFP were constructed by fusion PCR assembly of the GFP sequence bearing the stop codon and 68 bp AAVS1 fragment (or mutants thereof; see
Example III
Cell Culture
[0075] PGP1 iPS cells were maintained on Matrigel (BD Biosciences)-coated plates in mTeSR1 (Stemcell Technologies). Cultures were passaged every 5-7 d with TrypLE Express (Invitrogen). K562 cells were grown and maintained in RPMI (Invitrogen) containing 15% FBS. HEK 293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Invitrogen) high glucose supplemented with 10% fetal bovine serum (FBS, Invitrogen), penicillin/streptomycin (pen/strep, Invitrogen), and non-essential amino acids (NEAA, Invitrogen). All cells were maintained at 37° C. and 5% CO.sub.2 in a humidified incubator.
Example IV
Gene Targeting of PGP1 iPS, K562 and 293Ts
[0076] PGP1 iPS cells were cultured in Rho kinase (ROCK) inhibitor (Calbiochem) 2 h before nucleofection. Cells were harvest using TrypLE Express (Invitrogen) and 2×10.sup.6 cells were resuspended in P3 reagent (Lonza) with 1 μg Cas9 plasmid, 1 μg gRNA and/or 1 μg DNA donor plasmid, and nucleofected according to manufacturer's instruction (Lonza). Cells were subsequently plated on an mTeSR1-coated plate in mTeSR1 medium supplemented with ROCK inhibitor for the first 24 h. For K562s, 2×10.sup.6 cells were resuspended in SF reagent (Lonza) with 1 μg Cas9 plasmid, 1 μg gRNA and/or 1 μg DNA donor plasmid, and nucleofected according to manufacturer's instruction (Lonza). For 293Ts, 0.1×10.sup.6 cells were transfected with 1 μg Cas9 plasmid, 1 μg gRNA and/or 1 μg DNA donor plasmid using Lipofectamine 2000 as per the manufacturer's protocols. The DNA donors used for endogenous AAVS1 targeting were either a dsDNA donor (
[0077] The targeting efficiency was assessed as follows. Cells were harvested 3 days after nucleofection and the genomic DNA of ˜1×10.sup.6 cells was extracted using prepGEM (ZyGEM). PCR was conducted to amplify the targeting region with genomic DNA derived from the cells and amplicons were deep sequenced by MiSeq Personal Sequencer (Illumina) with coverage >200,000 reads. The sequencing data was analyzed to estimate NHEJ efficiencies. The reference AAVS1 sequence analyzed is:
TABLE-US-00001 (SEQ ID NO: 1) CACTTCAGGACAGCATGTTTGCTGCCTCCAGGGATCCTGTGTCCCCGA GCTGGGACCACCTTATATTCCCAGGGCCGGTTAATGTGGCTCTGGTTC TGGGTACTTTTATCTGTCCCCTCCACCCCACAGTGGGGCCACTAGGGA CAGGATTGGTGACAGAAAAGCCCCATCCTTAGGCCTCCTCCTTCCTAG TCTCCTGATATTGGGTCTAACCCCCACCTCCTGTTAGGCAGATTCCTT ATCTGGTGACACACCCCCATTTCCTGGA
The PCR primers for amplifying the targeting regions in the human genome are:
TABLE-US-00002 AAVS1-R (SEQ ID NO: 2) CTCGGCATTCCTGCTGAACCGCTCTTCCGATCTacaggaggtgggggttagac AAVS1-F.1 (SEQ ID NO: 3) ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGTGATtatattcccagggccggtta AAVS1-F.2 (SEQ ID NO: 4) ACACTCTTTCCCTACACGACGCTCTTCCGATCTACATCGtatattcccagggccggtta AAVS1-F.3 (SEQ ID NO: 5) ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCCTAAtatattcccagggccggtta AAVS1-F.4 (SEQ ID NO: 6) ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGGTCAtatattcccagggccggtta AAVS1-F.5 (SEQ ID NO: 7) ACACTCTTTCCCTACACGACGCTCTTCCGATCTCACTGTtatattcccagggccggtta AAVS1-F.6 (SEQ ID NO: 8) ACACTCTTTCCCTACACGACGCTCTTCCGATCTATTGGCtatattcccagggccggtta AAVS1-F.7 (SEQ ID NO: 9) ACACTCTTTCCCTACACGACGCTCTTCCGATCTGATCTGtatattcccagggccggtta AAVS1-F.8 (SEQ ID NO: 10) ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCAAGTtatattcccagggccggtta AAVS1-F.9 (SEQ ID NO: 11) ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTGATCtatattcccagggccggtta AAVS1-F.10 (SEQ ID NO: 12) ACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGCTAtatattcccagggccggtta AAVS1-F.11 (SEQ ID NO: 13) ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTAGCCtatattcccagggccggtta AAVS1-F.12 (SEQ ID NO: 14) ACACTCTTTCCCTACACGACGCTCTTCCGATCTTACAAGtatattcccagggccggtta To analyze the HR events using the DNA donor in FIG. 2C, the primers used were: HR_AAVS1-F (SEQ ID NO: 15) CTGCCGTCTCTCTCCTGAGT HR_Puro-R (SEQ ID NO: 16) GTGGGCTTGTACTCGGTCAT
Example V
Bioinformatics Approach for Computing Human Exon CRISPR Targets and Methodology for their Multiplexed Synthesis
[0078] A set of gRNA gene sequences that maximally target specific locations in human exons but minimally target other locations in the genome were determined as follows. According to one aspect, maximally efficient targeting by a gRNA is achieved by 23 nt sequences, the 5′-most 20 nt of which exactly complement a desired location, while the three 3′-most bases must be of the form NGG. Additionally, the 5′-most nt must be a G to establish a pol-III transcription start site. However, according to (2), mispairing of the six 5′-most nt of a 20 bp gRNA against its genomic target does not abrogate Cas9-mediated cleavage so long as the last 14 nt pairs properly, but mispairing of the eight 5′-most nt along with pairing of the last 12 nt does, while the case of the seven 5-most nt mispairs and 13 3′ pairs was not tested. To be conservative regarding off-target effects, one condition was that the case of the seven 5′-most mispairs is, like the case of six, permissive of cleavage, so that pairing of the 3′-most 13 nt is sufficient for cleavage. To identify CRISPR target sites within human exons that should be cleavable without off-target cuts, all 23 bp sequences of the form 5′-GBBBB BBBBB BBBBB BBBBB NGG-3′ (form 1) were examined, where the B's represent the bases at the exon location, for which no sequence of the form 5′-NNNNN NNBBB BBBBB BBBBB NGG-3′ (form 2) existed at any other location in the human genome. Specifically, (i) a BED file of locations of coding regions of all RefSeq genes the GRCh37/hg19 human genome from the UCSC Genome Browser (15-17) was downloaded. Coding exon locations in this BED file comprised a set of 346089 mappings of RefSeq mRNA accessions to the hg19 genome. However, some RefSeq mRNA accessions mapped to multiple genomic locations (probable gene duplications), and many accessions mapped to subsets of the same set of exon locations (multiple isoforms of the same genes). To distinguish apparently duplicated gene instances and consolidate multiple references to the same genomic exon instance by multiple RefSeq isoform accessions, (ii) unique numerical suffixes to 705 RefSeq accession numbers that had multiple genomic locations were added, and (iii) the mergeBed function of BEDTools (18) (v2.16.2-zip-87e3926) was used to consolidate overlapping exon locations into merged exon regions. These steps reduced the initial set of 346089 RefSeq exon locations to 192783 distinct genomic regions. The hg19 sequence for all merged exon regions were downloaded using the UCSC Table Browser, adding 20 bp of padding on each end. (iv) Using custom perl code, 1657793 instances of form 1 were identified within this exonic sequence. (v) These sequences were then filtered for the existence of off-target occurrences of form 2: For each merged exon form 1 target, the 3′-most 13 bp specific (B) “core” sequences were extracted and, for each core generated the four 16 bp sequences 5′-BBB BBBBB BBBBB NGG-3′ (N=A, C, G, and T), and searched the entire hg19 genome for exact matches to these 6631172 sequences using Bowtie version 0.12.8 (19) using the parameters −l 16 −v 0 −k 2. Any exon target site for which there was more than a single match was rejected. Note that because any specific 13 bp core sequence followed by the sequence NGG confers only 15 bp of specificity, there should be on average ˜5.6 matches to an extended core sequence in a random ˜3 Gb sequence (both strands). Therefore, most of the 1657793 initially identified targets were rejected; however 189864 sequences passed this filter. These comprise the set of CRISPR-targetable exonic locations in the human genome. The 189864 sequences target locations in 78028 merged exonic regions (˜40.5% of the total of 192783 merged human exon regions) at a multiplicity of ˜2.4 sites per targeted exonic region. To assess targeting at a gene level, RefSeq mRNA mappings were clustered so that any two RefSeq accessions (including the gene duplicates distinguished in (ii)) that overlap a merged exon region are counted as a single gene cluster, the 189864 exonic specific CRISPR sites target 17104 out of 18872 gene clusters (˜90.6% of all gene clusters) at a multiplicity of ˜11.1 per targeted gene cluster. (Note that while these gene clusters collapse RefSeq mRNA accessions that represent multiple isoforms of a single transcribed gene into a single entity, they will also collapse overlapping distinct genes as well as genes with antisense transcripts.) At the level of original RefSeq accessions, the 189864 sequences targeted exonic regions in 30563 out of a total of 43726 (˜69.9%) mapped RefSeq accessions (including distinguished gene duplicates) at a multiplicity of ˜6.2 sites per targeted mapped RefSeq accession.
[0079] According to one aspect, the database can be refined by correlating performance with factors, such as base composition and secondary structure of both gRNAs and genomic targets (20, 21), and the epigenetic state of these targets in human cell lines for which this information is available (22).
Example VI
Multiplex Synthesis
[0080] The target sequences were incorporated into a 200 bp format that is compatible for multiplex synthesis on DNA arrays (23, 24). According to one aspect the method allows for targeted retrieval of a specific or pools of gRNA sequences from the DNA array based oligonucleotide pool and its rapid cloning into a common expression vector (
Example VII
RNA-Guided Genome Editing Requires Both Cas9 and Guide RNA for Successful Targeting
[0081] Using the GFP reporter assay described in
Example VIII
Analysis of gRNA and Cas9 Mediated Genome Editing
[0082] The CRISPR mediated genome editing process was examined using either (A) a GFP reporter assay as described earlier results of which are shown in
Example IX
RNA-Guided Genome Editing is Target Sequence Specific
[0083] Similar to the GFP reporter assay described in
Example X
Guide RNAs Targeted to the GFP Sequence Enable Robust Genome Editing
[0084] In addition to the 2 gRNAs targeting the AAVS1 insert, two additional gRNAs targeting the flanking GFP sequences of the reporter described in
Example XI
RNA-Guided Genome Editing is Target Sequence Specific, and Demonstrates Similar Targeting Efficiencies as ZFNs or TALENs
[0085] Similar to the GFP reporter assay described in
Example XII
RNA-Guided NHEJ in Human iPS Cells
[0086] Human iPS cells (PGP1) were nucleofected with constructs indicated in the left panel of
Example XIII
RNA-Guided NHEJ in K562 Cells
[0087] K562 cells were nucleated with constructs indicated in the left panel of
Example XIV
RNA-Guided NHEJ in 293T Cells
[0088] 293T cells were transfected with constructs indicated in the left panel of
Example XV
HR at the Endogenous AAVS1 Locus Using Either a dsDNA Donor or a Short Oligonucleotide Donor
[0089] As shown in
Example XVI
Methodology for Multiplex Synthesis, Retrieval and U6 Expression Vector Cloning of Guide RNAs Targeting Genes in the Human Genome
[0090] A resource of about 190k bioinformatically computed unique gRNA sites targeting ˜40.5% of all exons of genes in the human genome was generated. As shown in
Example XVII
CRISPR Mediated RNA-Guided Transcriptional Activation
[0091] The CRISPR-Cas system has an adaptive immune defense system in bacteria and functions to ‘cleave’ invading nucleic acids. According to one aspect, the CRISPR-CAS system is engineered to function in human cells, and to ‘cleave’ genomic DNA. This is achieved by a short guide RNA directing a Cas9 protein (which has nuclease function) to a target sequence complementary to the spacer in the guide RNA. The ability to ‘cleave’ DNA enables a host of applications related to genome editing, and also targeted genome regulation. Towards this, the Cas9 protein was mutated to make it nuclease-null by introducing mutations that are predicted to abrogate coupling to Mg2+(known to be important for the nuclease functions of the RuvC-like and HNH-like domains): specifically, combinations of D10A, D839A, H840A and N863A mutations were introduced. The thus generated Cas9 nuclease-null protein (as confirmed by its ability to not cut DNA by sequencing analysis) and hereafter referred to as Cas9R—H—, was then coupled to a transcriptional activation domain, here VP64, enabling the CRISPR-cas system to function as a RNA guided transcription factor (see
Example XVIII
gRNA Sequence Flexibility and Applications Thereof
[0092] Flexibility of the gRNA scaffold sequence to designer sequence insertions was determined by systematically assaying for a range of the random sequence insertions on the 5′, middle and 3′ portions of the gRNA: specifically, 1 bp, 5 bp, 10 bp, 20 bp, and 40 bp inserts were made in the gRNA sequence at the 5′, middle, and 3′ ends of the gRNA (the exact positions of the insertion are highlighted in ‘red’ in
[0093] The following references identified in the Examples section by number are hereby incorporated by reference in their entireties for all purposes.
REFERENCES
[0094] 1. K. S. Makarova et al., Evolution and classification of the CRISPR-Cas systems. Nature reviews. Microbiology 9, 467 (June, 2011). [0095] 2. M. Jinek et al., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816 (Aug. 17, 2012). [0096] 3. P. Horvath, R. Barrangou, CRISPR/Cas, the immune system of bacteria and archaea. Science 327, 167 (Jan. 8, 2010). [0097] 4. H. Deveau et al., Phage response to CRISPR-encoded resistance in Streptococcus thermophilus. Journal of bacteriology 190, 1390 (February, 2008). [0098] 5. J. R. van der Ploeg, Analysis of CRISPR in Streptococcus mutans suggests frequent occurrence of acquired immunity against infection by M102-like bacteriophages. Microbiology 155, 1966 (June, 2009). [0099] 6. M. Rho, Y. W. Wu, H. Tang, T. G. Doak, Y. Ye, Diverse CRISPRs evolving in human microbiomes. PLoS genetics 8, e1002441 (2012). [0100] 7. D. T. Pride et al., Analysis of streptococcal CRISPRs from human saliva reveals substantial sequence diversity within and between subjects over time. Genome research 21, 126 (January, 2011). [0101] 8. G. Gasiunas, R. Barrangou, P. Horvath, V. Siksnys, Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proceedings of the National Academy of Sciences of the United States of America 109, E2579 (Sep. 25, 2012). [0102] 9. R. Sapranauskas et al., The Streptococcus thermophilus CRISPR/Cas system provides immunity in Escherichia coli. Nucleic acids research 39, 9275 (November, 2011). [0103] 10. J. E. Garneau et al., The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468, 67 (Nov. 4, 2010). [0104] 11. K. M. Esvelt, J. C. Carlson, D. R. Liu, A system for the continuous directed evolution of biomolecules. Nature 472, 499 (Apr. 28, 2011). [0105] 12. R. Barrangou, P. Horvath, CRISPR: new horizons in phage resistance and strain identification. Annual review of food science and technology 3, 143 (2012). [0106] 13. B. Wiedenheft, S. H. Sternberg, J. A. Doudna, RNA-guided genetic silencing systems in bacteria and archaea. Nature 482, 331 (Feb. 16, 2012). [0107] 14. N. E. Sanjana et al., A transcription activator-like effector toolbox for genome engineering. Nature protocols 7, 171 (January, 2012). [0108] 15. W. J. Kent et al., The human genome browser at UCSC. Genome Res 12, 996 (June, 2002). [0109] 16. T. R. Dreszer et al., The UCSC Genome Browser database: extensions and updates 2011. Nucleic Acids Res 40, D918 (January, 2012). [0110] 17. D. Karolchik et al., The UCSC Table Browser data retrieval tool. Nucleic Acids Res 32, D493 (Jan. 1, 2004). [0111] 18. A. R. Quinlan, I. M. Hall, BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841 (Mar. 15, 2010). [0112] 19. B. Langmead, C. Trapnell, M. Pop, S. L. Salzberg, Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10, R25 (2009). [0113] 20. R. Lorenz et al., ViennaRNA Package 2.0. Algorithms for molecular biology: AMB 6, 26 (2011). [0114] 21. D. H. Mathews, J. Sabina, M. Zuker, D. H. Turner, Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. Journal of molecular biology 288, 911 (May 21, 1999). [0115] 22. R. E. Thurman et al., The accessible chromatin landscape of the human genome. Nature 489, 75 (Sep. 6, 2012). [0116] 23. S. Kosuri et al., Scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips. Nature biotechnology 28, 1295 (December, 2010). [0117] 24. Q. Xu, M. R. Schlabach, G. J. Hannon, S. J. Elledge, Design of 240,000 orthogonal 25mer DNA barcode probes. Proceedings of the National Academy of Sciences of the United States of America 106, 2289 (Feb. 17, 2009).