METHOD FOR THE PRODUCTION OF OUTER MEMBRANE VESICLES AND IMMUNOGENIC COMPOSITIONS THEREOF
20220175903 · 2022-06-09
Assignee
Inventors
- Guido Grandi (Segrate (MI), IT)
- Alberto Grandi (Siena (SI), IT)
- Laura Fantappie' (Siena, IT)
- Ilaria Zanella (Trento, IT)
- Enrico Koenig (Trento, IT)
- Assunta Gagliardi (Trento, IT)
Cpc classification
A61P31/00
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
The invention relates to gram-negative bacteria carrying gene-inactivating mutations that cause deletion of proteins belonging to the OMV proteome, to Outer Membrane Vesicles (OMVs) produced by these bacteria and immunogenic compositions thereof.
Claims
1. A method for preparing isolated bacterial outer membrane vesicles (OMVs) expressing heterologous proteins, which comprises: (i) culturing a gram-negative bacterium in conditions suitable for vesiculation, wherein said bacterium: (a) carries gene-inactivating mutations at the ompA gene and at one or more of the following genes which encode proteins naturally present in the OMVs: ybis, ais, eco, glpQ, mltA, proX, ydcL, glnH, efeO, bglX, agp, ygdI, yncD, slp, artI, yiaD, ompX, borD, yhiJ, emtA, fecA, nmpC, fhuA, hisJ, lamB, malE, malM, ygiW, cirA, fepA, loiP, yjeI, ecnB, rcsF, phoE, oppA, fkpA, ybaY, tsx, yggE, osmE, ygdR, yceI, bhsA, nlpE, pldA, yghJ, ydeN, ushA, mdoD, treA, bcsC, ftsP, ptrA, fadL, artJ, mlaA; (b) expresses heterologous proteins in the OMVs (ii) separating the OMVs from the bacterial culture, and optionally (iii) purifying the OMVs.
2. The method of claim 1, wherein the bacterium carries gene-inactivating mutations at the ompA gene and at least 5 of the following genes: amB, malE, ompX, fkpA, malM, fepA, yncD, borD, oppA, glpQ, osmE, ycdO, tsx, ydcL, agp, cirA, fecA, ygiW, artI and hisJ.
3. The method of claim 1, wherein the bacterium carries additional gene-inactivating mutations at the msbB and pagP genes.
4. The method of claim 1, wherein the bacterium does not carry gene-inactivating mutations at the following genes: mdoG, yncE, ompN, lpp, gltI, kpsD, degP, mipA, surA, bamC, nlpD, rlpA, pal, potD, ppiA, bamE, skp, yhcN, cpoB, yfeY, ydgH, yajG, yifL, lpoA, prc, slyB, lpoB, yfhG, dsbC, degQ, yraP, bamB, mlaC.
5. The method of claim 1, wherein the bacterium is of the genus Escherichia, Pseudomonas, Neisseria or Shigella.
6. The method of claim 5, wherein the bacterium is E. coli.
7. The method of claim 1, wherein the gene-inactivating mutations are selected from: point mutations which create a stop codon in the reading frame; deletions of one or multiple nucleotides which impair protein functions; complete deletion of the gene; inactivation of the transcription and translation signals.
8. The method of claim 1, wherein the heterologous proteins are localized in the lumen of OMVs or associated to the OMV membrane.
9. The method of claim 8, wherein said heterologous proteins are bacterial, viral, parasitic or cancer proteins.
10. The method of claim 1, wherein the OMVs are separated from the culture medium by filtration.
11. The method of claim 1, wherein the OMVs are purified by centrifugation or ultrafiltration.
12. An isolated outer membrane vesicle (OMV) obtainable by the method of claim 1.
13. An isolated outer membrane vesicle according to claim 12, carrying heterologous proteins which are localized in the lumen or associated to the membrane and which are bacterial, viral, parasitic or cancer proteins.
14. An isolated outer membrane vesicle according to claim 12, which is depleted of the proteins encoded by gene-inactivating mutations at the ompA gene and at one or more of the following genes which encode proteins naturally present in the OMVs: ybis, ais, eco, glpQ, mltA, proX, ydcL, glnH, efeO, bglX, agp, ygdI, yncD, slp, artI, yiaD, ompX, borD, yhiJ, emtA, fecA, nmpC, fhuA, hisJ, lamB, malE, malM, ygiW, cirA, fepA, loiP, yjeI, ecnB, rcsF, phoE, oppA, fkpA, ybaY, tsx, yggE, osmE, ygdR, yceI, bhsA, nlpE, pldA, yghJ, ydeN, ushA, mdoD, treA, bcsC, ftsP, ptrA, fadL, artJ, mlaA, or by gene-inactivating mutations at the msbB and pagP genes.
15. An immunogenic composition comprising an outer membrane vesicle according to claim 12, optionally in combination with pharmaceutically acceptable adjuvants and excipients.
16. A method of stimulating an immune response in a subject in need thereof with an outer membrane vesicle according to claim 12, optionally in combination with pharmaceutically acceptable adjuvants and excipients, said method comprising: administering a pharmaceutically acceptable amount of said outer membrane vesicle to said subject in need thereof.
17. The method according to claim 16, wherein said subject is affected by an infectious or tumoral disease.
18. The method according to claim 16, wherein said administering step is an in in situ vaccination in the tumor site.
19. The method of claim 2, wherein the bacterium carries gene-inactivating mutations at the ompA gene and at least 10 of the following genes: amB, malE, ompX, fkpA, malM, fepA, yncD, borD, oppA, glpQ, osmE, ycdO, tsx, ydcL, agp, cirA, fecA, ygiW, artI and hisJ.
20. The method of claim 2, wherein the bacterium carries gene-inactivating mutations at the ompA gene and all of the following genes: amB, malE, ompX, fkpA, malM, fepA, yncD, borD, oppA, glpQ, osmE, ycdO, tsx, ydcL, agp, cirA, fecA, ygiW, artI and hisJ.
Description
DESCRIPTION OF THE FIGURES
[0049]
[0050] Amount of OMVs (mg of OMV proteins/L of culture) purified from the culture supernatant of E. coli OMV_MUT derivatives. The bars (mg/1) show the mean of three independent experiments and their standard deviations from all E. coli ompA OMV_MUT strains in consecutive order. The starting point was the hypervesiculating E. coli BL21(DE3) ΔompA strain.
[0051]
[0052] Electrophoretic analysis on 2% agarose gels of PCR products obtained by amplifying portions of the 58 inactivated genes using the chromosomal DNA of E. coli BL21(DE3) and E. coli OMV_MUT57 as templates. The primers used for the amplification are reported in Table 5.
[0053]
[0054] SDS-PAGE of OMVs obtained from E. coli BL21(DE3) ΔompA and the 57 E. coli OMV_MUT derivatives. All purified OMVs were normalised for 20 μg of total protein content and loaded onto Criterion TGX any kD SDS-polyacrylamide gels (Bio-Rad Laboratories, Hercules, Calif.). The gels were stained with Coomassie brilliant blue.
[0055]
[0056] 2-DE gels of OMVs from BL21(DE3) ΔompA (A) and E. coli-OMV_MUT57 (B) strains. OMV proteins were first focused on non-linear immobilized pH 3-10 gradient gels and then separated on house-made 9-16% SDS-polyacrylamide gels. Analytical 2-DE gels were stained with ammoniacal silver nitrate. The figure clearly showed that several protein spots present in BL21(DE3) ΔompA (A) disappear in E. coli-OMV_MUT57 (B).
[0057]
[0058] Schematic representation of plasmid pET-LukE expressing lipidated S. aureus LukE antigen
[0059]
[0060] Schematic representation of plasmid pET-FhuD2 expressing lipidated S. aureus FhuD2 antigen
[0061]
[0062] Schematic representation of plasmid pET-FhuD2-D8-hFAT1-3×, expressing lipidated FhuD2 carrying three copies of D8-hFAT1 epitope at its C-terminus.
[0063]
[0064] SDS-PAGE analysis of OMVs from E. coli OMV_MUT57 expressing LukE, FhuD2 and FhuD2-D8-hFAT1 fusion. 20 μs of OMVs purified from the supernatants of E. coli OMV_MUT57 transformed with plasmids pET-LukE pET-FhuD2 pET-FhuD2-D8-hFAT1-3× and pET vector (“Empty”) as control. Arrows indicate the recombinant antigens which accumulate in the OMV preparations.
[0065]
[0066] Schematic representation of plasmid pET-Nm-fHbpvIII expressing lipidated neisserial fHbp carrying three copies of EGFRvIII epitope at its C-terminus.
[0067]
[0068] Flow cytometry analysis of BL21(DE3) ΔompA and E. coli OMV_MUT57 cells expressing heterologous antigens—Surface exposition of FhuD2, FhuD2-hFAT1 and fHbp-EGFRvIII fusion proteins was evaluated on bacterial cells after 2 h induction with 0.1 mM IPTG. Cells were stained with pAb anti-FhuD2 (cells expressing FhuD2), mAb anti-hFAT1 (cells expressing FhuD2-hFAT1) and pAb anti-EGFRvIII (cells expressing fHbp-EGRF-vIII-3x), followed by incubation with FITC secondary antibodies. Fluorescence was measured by flow cytometry. Cells not included in the gates represent the background fluorescence signals obtained incubating the cells with the secondary antibody only.
[0069]
[0070] Immunogenicity against endogenous proteins of E. coli BL21(DE3).
[0071] Endogenous OMV.sub.ΔompA-associated proteins identified by 2-DE coupled to Mass Spectrometry were cloned from E. coli BL21(DE3) and purified as recombinant His6-tagged products by IMAC. Purified proteins were analyzed by SDS-PAGE and Western Blot loading 1 μg of purified proteins. Western Blots were incubated with sera (1:2,000 dilution) from CD1 mice immunized i.p. 3 times at 2-wk interval with 2 μg of either OMV.sub.ΔompA or, OMV.sub.Δ58, or OMV.sub.Δ60. Two proteins (*), which are expressed (not inactivated) in both E. coli BL21(DE3)Δ58 and E. coli BL21(DE3)Δ60 were selected as controls.
[0072]
[0073] Heterologous antigen expression.
[0074] E. coli BL21(DE3)ΔompA and E. coli BL21(DE3)Δ60 strains expressing different heterologous antigens as lipoproteins were grown in LB at 30° C. At OD.sub.600=0.5, 0.1 mM IPTG was added and after 2 h, OMVs were purified from culture supernatants by ultracentrifugation. Aliquots corresponding to 7.5 μg of total OMV proteins were loaded to each lane, which were analysed by densitometry. The ratio between antigen to total protein was calculated for each lane and compared for each antigen (upper panel).
[0075]
[0076] Evaluation of immunogenicity and protection in mice of engineered OMVs from E. coli BL21(DE3)ΔompA and E. coli BL21(DE3)460.
[0077] A) IgG titers in mice immunized with OMVs expressing lipidated heterologous antigens. Groups of 5 female Balb/c mice were immunized i.p. 3 times at 2-wk interval with 2 μg of OMVs formulated with alum as adjuvant expressing lipidated FhuD2, FhuD2-Bp, Hla.sub.H35L, and FhuD2-mFAT1 antigens. Sera were collected 7 d after the third immunization and IgG titers were analyzed by ELISA using plates coated with the corresponding recombinant antigen or peptide (200 ng/well).
[0078] B) CD8 and T-cell
[0079] C) protection HLA
[0080] D) tumor growth/protection OVA in C57 mice
[0081]
[0082] In situ vaccination of BALB/c challenge with CT26 tumour cells.
[0083] A) treatment of mice. CT26 tumor cells were subcutaneously injected at two distal sites. When tumour volume reached 50-100 mm3, one tumour was vaccinated in situ. Then vaccinations were every two days for three vaccinations with PBS, OMVs Δ60 or OMVs Δ60+100 μg pentatope. Tumour volumes of both the injected and later tumour were recorded every two days. B) Analysis of both situ injected tumour volumes and lateral tumour volumes in mice from each group at day 26. D) Analysis of the sum of tumour volumes per mouse in each group at day 26. Human endpoints were always respected therefore in the PBS group some of the mice were sacrificed earlier than day 26 and these mice were assigned single tumour volumes of 2000 mm.sup.3. Statistical significance was calculated using an unpaired one-tailed T-test with Welch's correction. Not significant (ns)=P>0.1; *=P<0.1; **=P<0.01; ***=P<0.001.
DETAILED DESCRIPTION OF THE INVENTION
[0084] Selection of Proteins to be Eliminated from the OMVs
[0085] The OMV proteome includes two classes of proteins: periplasmic proteins and outer membrane (OM) proteins. OM proteins can be subdivided in lipoproteins and transmembrane proteins. Several algorithms and database are available that can predict with a high degree of precision such categories of proteins. We used a number of these bioinformatics tools, including PSORT and PFAM, to ultimately select the list of OMV-associated proteins. The list was further filtered by removing those proteins classified as “indispensable” according to the Keio collection (Baba T. et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Molecular System Biology DOI: 10.1038/msb4100050). At the end, a final list of 91 proteins were selected and reported in Table 1. In particular, the list comprises 45 periplasmic proteins, 14 integral membrane proteins and 32 outer membrane lipoproteins. Many of these proteins (and their homologs) have been described to be present the OMVs by using 2DE coupled to mass spectrometry (Fantappie' et. al (2017) Gram negative promiscuous lipoproteins keep surface topology when transplanted from one species to another and can deliver foreign polypeptides to the bacterial surface. Mol. Cell. Proteomics 16:1348-1364).
TABLE-US-00001 TABLE 1 list of 91 proteins selected for gene inactivation Periplasmic proteins agp, artI, artJ, bcsC, bglX, cirA, degP, degQ, dsbC, eco, fkpA, ftsP, glnH, glpQ, gltI, hisJ, skp, kpsD, malE, malM, mdoG, mdoD, oppA, potD, ppiA, prc, proX, ptrA, surA, treA, ushA, cpoB, ybis, efeO, yceI, bhsA, ydeN, ydgH, yggE, ygiW, yhcN, yhjJ, yncE, yraP, mlaC Outer membrane ais, ecnB, lpp, mltA, emtA, lipoproteins bamC, nlpD, nlpE, osmE, pal, rcsF, rlpA, slp, slyB, bamE, yghJ, mlaA, yajG, ybaY, borD, ipoB, ydcL, yfeY, bamB, yfhG, ygdI, ygdR, loiP, yiaD, yifL, yjeI, lpoA Integral membrane fadL, fecA, fepA, fhuA, lamB, proteins mipA, nmpC, ompA, ompN, ompX, phoE, pldA, tsx, yncD bis-list of inactivated genes ompA (wt: SEQ ID NO: 1; mutated: SEQ ID NO: 59); ybis (wt: SEQ ID NO: 2; mutated: SEQ ID NO: 60), ais (wt: SEQ ID NO: 3; mutated: SEQ ID NO: 61), eco (wt: SEQ ID NO: 4; mutated: SEQ ID NO: 62), glpQ (wt: SEQ ID NO: 5 mutated: SEQ ID NO: 63), mltA (wt: SEQ ID NO: 6 mutated: SEQ ID NO: 64), proX (wt: SEQ ID NO: 7 mutated: SEQ ID NO: 65), ydcL (wt: SEQ ID NO: 8 mutated: SEQ ID NO: 66), glnH (wt: SEQ ID NO: 9 mutated: SEQ ID NO: 67), efeO (wt: SEQ ID NO: 10 mutated: SEQ ID NO: 68), bglX (wt: SEQ ID NO: 11 mutated: SEQ ID NO: 69), agp (wt: SEQ ID NO: 12; mutated: SEQ ID NO: 70), ygdI (wt: SEQ ID NO: 13; mutated: SEQ ID NO: 71), yncD (wt: SEQ ID NO: 14; mutated: SEQ ID NO: 72), slp (wt: SEQ ID NO: 15; mutated: SEQ ID NO: 73), artI (wt: SEQ ID NO: 16; mutated: SEQ ID NO: 74), yiaD (wt: SEQ ID NO: 17, mutated: SEQ ID NO: 75), ompX (wt: SEQ ID NO: 18; mutated: SEQ ID NO: 76), borD (wt: SEQ ID NO: 19; mutated: SEQ ID NO: 77), yhiJ (wt: SEQ ID NO: 20; mutated: SEQ ID NO: 78), emtA (wt: SEQ ID NO: 21; mutated: SEQ ID NO: 79), fecA (wt: SEQ ID NO: 22; mutated: SEQ ID NO: 80), nmpC (wt: SEQ ID NO: 23; mutated: SEQ ID NO: 81), fhuA (wt: SEQ ID NO: 24; mutated: SEQ ID NO: 82), hisJ (wt: SEQ ID NO: 25; mutated: SEQ ID NO: 83), lamB (wt: SEQ ID NO: 26; mutated: SEQ ID NO: 84), malE (wt: SEQ ID NO: 27; mutated: SEQ ID NO: 85), malM (wt: SEQ ID NO: 28; mutated: SEQ ID NO: 86), ygiW (wt: SEQ ID NO: 29; mutated: SEQ ID NO: 87), cirA (wt: SEQ ID NO: 30; mutated: SEQ ID NO: 88), fepA (wt: SEQ ID NO: 31; mutated: SEQ ID NO: 89), loip (wt: SEQ ID NO: 32; mutated: SEQ ID NO: 90), yjeI (wt: SEQ ID NO: 33; mutated: SEQ ID NO: 91), ecnB (wt: SEQ ID NO: 34; mutated: SEQ ID NO: 92), rcsF (wt: SEQ ID NO: 35; mutated: SEQ ID NO: 93), phoE (wt: SEQ ID NO: 36; mutated: SEQ ID NO: 94), oppA (wt: SEQ ID NO: 37; mutated: SEQ ID NO: 95), fkpA (wt: SEQ ID NO: 38; mutated: SEQ ID NO: 96), ybaY (wt: SEQ ID NO: 39; mutated: SEQ ID NO: 97), tsx (wt: SEQ ID NO: 40; mutated: SEQ ID NO: 98), yggE (wt: SEQ ID NO: 41; mutated: SEQ ID NO: 99), osmE (wt: SEQ ID NO: 42; mutated: SEQ ID NO: 100), ygdR (wt: SEQ ID NO: 43; mutated SEQ ID NO: 101), yceI (wt: SEQ ID NO: 44; mutated: SEQ ID NO: 102), bhsA (wt: SEQ ID NO: 45; mutated: SEQ ID NO: 103), nlpE (wt: SEQ ID NO: 46; mutated: SEQ ID NO: 104), pldA (wt: SEQ ID NO: 47; mutated: SEQ ID NO: 105), yghJ (wt: SEQ ID NO: 48; mutated SEQ ID NO: 106), ydeN (wt: SEQ ID NO: 49; mutated: SEQ ID NO: 107), ushA (wt: SEQ ID NO: 50; mutated: SEQ ID NO: 108), mdoD (wt: SEQ ID NO: 51; mutated: SEQ ID NO: 109), treA (wt: SEQ ID NO: 52; mutated: SEQ ID NO: 110), bcsC (wt: SEQ ID NO: 53; mutated: SEQ ID NO: 111), ftsP (wt: SEQ ID NO: 54); mutated: SEQ IID NO: 112), ptrA (wt: SEQ ID NO: 55; mutated: SEQ ID NO: 113), fadL (wt: SEQ ID NO: 56; mutated: SEQ ID NO: 114), artJ (wt: SEQ ID NO: 57; mutated: SEQ ID NO: 115), mlaA (wt: SEQ ID NO: 58; mutated: SEQ ID NO: 116), msbB (wt: SEQ ID NO: 300; mutated: SEQ ID NO: 301), pagP (wt: SEQ ID NO: 302; mutated: SEQ ID NO: 303).
[0086] Inactivation of Selected OMV Proteins
[0087] There are three main protocols for the manipulation of chromosomal DNA in E. coli, all utilizing phage recombinase-mediated homologous recombination (recombineering), using either the Rac prophage system [Zhang, Y., et al., A new logic for DNA engineering using recombination in Escherichia coli. Nat Genet, 1998. 20(2): p. 123-8; Datta, S., N. Costantino, and D. L. Court, A set of recombineering plasmids for gram-negative bacteria. Gene, 2006. 379: p. 109-15) or the bacteriophage λ Red proteins, Exo, Beta, and Gam (Murphy, K. C., Use of bacteriophage lambda recombination functions to promote gene replacement in Escherichia coli. J Bacteriol, 1998. 180(8): p. 2063-71; Muyrers, J. P., et al., Rapid modification of bacterial artificial chromosomes by ET-recombination. Nucleic Acids Res, 1999. 27(6): p. 1555-7; Ellis, H. M., et al., High efficiency mutagenesis, repair, and engineering of chromosomal DNA using single-stranded oligonucleotides. Proc Natl Acad Sci USA, 2001. 98(12): p. 6742-6).
[0088] According to the first protocol, gene knockout mutants are created by inserting antibiotic resistance markers (or other selection markers) between double-stranded DNA (ds-DNA) PCR products derived from the upstream and downstream regions of the target gene. Mutant colonies are isolated in the appropriate selective medium after transformation with linear or circular constructs and, when necessary, the selection marker is subsequently eliminated by counter-selection, leaving a “scarless” chromosomal mutation.
[0089] The second protocol was described by Court and co-workers who demonstrated that chromosomal gene mutations can be achieved without the need of selection markers and using synthetic single stranded DNAs (ss-DNAs) or ds-DNAs, which anneal to their complementary chromosomal regions during replication and mediate recombination and gene modification (Yu, D., et al., An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci USA, 2000. 97(11): p. 5978-83; Yu, D., et al., Recombineering with overlapping single-stranded DNA oligonucleotides: testing a recombination intermediate. Proc Natl Acad Sci USA, 2003. 100(12): p. 7207-12).
[0090] The third approach, proposed for the first time by Jiang and co-workers (Jiang, W., et al., RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol. 31(3): p. 233-9), makes use of the CRISPR/Cas9 technology (Doudna, J. A. and E. Charpentier, Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science, 2014. 346(6213): p. 1258096; Sternberg, S. H. and J. A. Doudna, Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell, 2015. 58(4): p. 568-74; Singh, V., D. Braddick, and P. K. Dhar, Exploring the potential of genome editing CRISPR-Cas9 technology. Gene, 2017. 599: p. 1-18. Briefly, the strain to be modified is first genetically manipulated to express the Cas9 nuclease and the λ Red machinery, and subsequently the strain is co-transformed with (i) a plasmid (pCRISPR) encoding the guide RNA, which anneals with the chromosomal region to be modified and promotes a site-specific DNA cleavage by the Cas9, and (ii) a donor DNA (PCR-derived or chemically synthesized) partially homologous to the cleaved extremities, which promotes the repair of the double stranded break through λ Red-mediated recombination thereby introducing the desired mutation.
[0091] The “classical” gene KO method, which involves the use of PCR products flaking a selective marker, is usually very efficient to obtain large deletions but is more laborious. The Court's approach is theoretically the simplest one since only a synthetic oligonucleotide carrying the desired mutation is needed. By following the detailed procedure described by Sawitzke J. and co-workers (Sawitzke J. et al. (2013) Recombineering: highly efficient in vivo genetic engineering using single-strand oligos. Methods Enzymol. 533:157-77) good gene inactivation efficiencies can be obtained. However the method might require the screening of several colonies (recommended from 40 to 100) to identify the one carrying the desired mutations. Finally, the CRISPR/Cas9-based methods are extremely efficient but requires the preparation of recombinant plasmids expressing the guide RNA and the synthesis of “donor” oligonucleotides. Both have to be properly selected to guarantee consistent mutagenesis efficiencies.
[0092] By using any of these approaches, which those skilled in the art can apply following published protocols, the progressive inactivation of the 91 genes was attempted following the order reported in
[0093] In total 57 E. coli BL21(DE3) ΔompA derivatives were obtained, named E. coli OMV_MUT 1 throughout 57, whose genotypes are reported in Table 3. In essence, the 58 strains carry a progressive number of mutations, E. coli OMV_MUT1 having the inactivation of one gene (ybis) (in addition to ompA inactivation) and E. coli OMV_MUT57, having 57 mutations (in addition to ompA). It was found that when 33 out of the 91 attempted deletions added up to some of the 58-gene mutations here reported, the growth of the mutant strains was reduced (Table 4). These 33 mutations were thus classified as non-compatible (
TABLE-US-00002 TABLE 2 List of genes subjected gene deletion attempts in chronological order ompA, ybis, ais, eco, glpQ, mdoG, mltA, proX, ydcL, glnH, efeO, bglX, agp, ygdI, yncD, yncE, slp, artI, yiaD, ompX, borD, yhjJ, emtA, fecA, nmpC, ompN, lpp, fhuA, gltI, hisJ, lamB, malE, malM, ygiW, cirA, fepA, loiP, kpsD, degP, yjeI, mipA, ecnB, surA, bamC, nlpD, rcsF, rlpA, phoE, pal, potD, oppA, fkpA, ppiA, ybaY, bamE, tsx, yggE, skp, osmE, yhcN, ygdR, yceI, cpoB, bhsA, yfeY, ydgH, yajG, yifL, IpoA, nlpE, pldA, yghJ, ydeN, prc, slyB, lpoB, yfhG, ushA, mdoD, treA, bcsC, ftsP, ptrA, dsbC, fadL, degQ, artJ, yraP, bamB, mlaC, mlaA
TABLE-US-00003 TABLE 3 List of mutant strains Name genotype E.coli OMV_MUT1 ompA, ybis E.coli OMV_MUT2 ompA, ybis, ais E.coli OMV_MUT3 ompA, ybis, ais, eco E.coli OMV_MUT4 ompA ybis ais eco glpQ E.coli OMV_MUT5 ompA ybis ais eco glpQ mltA E.coli OMV_MUT6 ompA ybis ais eco glpQ mltA proX E.coli OMV_MUT7 ompA ybis ais eco glpQ mltA proX ydcL E.coli OMV_MUT8 ompA ybis ais eco glpQ mltA proX ydcL glnH E.coli OMV_MUT9 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO E.coli OMV_MUT10 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX E.coli OMV_MUT11 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp E.coli OMV_MUT12 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI E.coli OMV_MUT13 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD E.coli OMV_MUT14 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp E.coli OMV_MUT15 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI E.coli OMV_MUT16 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD E.coli OMV_MUT17 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX E.coli OMV_MUT18 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD E.coli OMV_MUT19 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ E.coli OMV_MUT20 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA E.coli OMV_MUT21 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA E.coli OMV_MUT22 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC E.coli OMV_MUT23 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA E.coli OMV_MUT24 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ E.coli OMV_MUT25 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB E.coli OMV_MUT26 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE E.coli OMV_MUT27 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM E.coli OMV_MUT28 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW E.coli OMV_MUT29 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA E.coli OMV_MUT30 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA E.coli OMV_MUT31 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP E.coli OMV_MUT32 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI E.coli OMV_MUT33 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB E.coli OMV_MUT34 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF E.coli OMV_MUT35 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE E.coli OMV_MUT36 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA E.coli OMV_MUT37 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD borD yhjJ emtA fecA slp artI yiaD ompX nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA E.coli OMV_MUT38 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY E.coli OMV_MUT39 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx E.coli OMV_MUT40 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE E.coli OMV_MUT41 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE E.coli OMV_MUT42 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR E.coli OMV_MUT43 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI E.coli OMV_MUT44 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA E.coli OMV_MUT45 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE E.coli OMV_MUT46 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA E.coli OMV_MUT47 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ E.coli OMV_MUT48 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN E.coli OMV_MUT49 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA E.coli OMV_MUT50 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA mdoD E.coli OMV_MUT51 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA mdoD treA E.coli OMV_MUT52 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA mdoD treA bcsC E.coli OMV_MUT53 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA mdoD treA bcsC ftsP E.coli OMV_MUT54 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA mdoD treA bcsC ftsP ptrA E.coli OMV_MUT55 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA mdoD treA bcsC ftsP ptrA fadL E.coli OMV_MUT56 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA mdoD treA bcsC ftsP ptrA fadL artJ E.coli OMV_MUT57 ompA ybis ais eco glpQ mltA proX ydcL glnH efeO bglX agp ygdI yncD slp artI yiaD ompX borD yhjJ emtA fecA nmpC fhuA hisJ lamB malE malM ygiW cirA fepA loiP yjeI ecnB rcsF phoE oppA fkpA ybaY tsx yggE osmE ygdR yceI bhsA nlpE pldA yghJ ydeN ushA mdoD treA bcsC ftsP ptrA fadL artJ mlaA
TABLE-US-00004 TABLE 4 List of genes whose inactivation may affect viability (chronological order) mdoG, yncE, ompN, lpp, gltI, kpsD, degP, mipA, surA, bamC, nlpD, rlpA, pal, potD, ppiA, bamE, skp, yhcN, cpoB, yfeY, ydgH, yajG, yifL, lpoA, prc, slyB, lpoB, yfhG, dsbC, degQ, yraP, bamB, mlaC
TABLE-US-00005 TABLE 5 Primers used for the analysis of gene mutations Ybis F tctcaacccaatggcctgcca (SEQ ID NO: 117) R ctccagcggctgagtgttac (SEQ ID NO: 118) Ais F Actggcgctcgctgcaattgc (SEQ ID NO: 119) R actggcgctcgctgcaattgc (SEQ ID NO: 120) Eco F acctgcagtattgtttgccgc (SEQ ID NO: 121) R ttcccgccgagacgatgcaa (SEQ ID NO: 122) glPQ F ctgcaaaaacgcaacggaggc (SEQ ID NO: 123) R agataatccgctccctgcgca (SEQ ID NO: 124) mdoG F tgcgttggttgagtgctgcag (SEQ ID NO: 125) R gtcttcagattgttccagtacgc (SEQ ID NO: 126) mltA F gaaaggacgttgggtaaagtacc (SEQ ID NO: 127) R cagacgcggtgacgaattacg (SEQ ID NO: 128) proX F acttttgctgccgatctgccg (SEQ ID NO: 129) R ttcacggcggtgaaggttgca (SEQ ID NO: 130) ydcL F cggcttattggctctgtctgg (SEQ ID NO: 131) R cgacggtttcggtaccggata (SEQ ID NO: 132) glnH F tgcggtttcttctcatgccgc (SEQ ID NO: 133) R gcgccagatcgacgtttttgg (SEQ ID NO: 134) efeO F cattaacttccgccgtaacgca (SEQ ID NO: 135) R cactccagcgccttctggct (SEQ ID NO: 136) bglX F taggaatcgcggtgagtctggc (SEQ ID NO: 137) R -gccccaacctgaccgtctttg (SEQ ID NO: 138) agp F cgcaactgtggcagggatagt (SEQ ID NO: 139) R cacttcgagcacgccaccttt (SEQ ID NO: 140) ygdI F gactgccgcaattatttctgcct (SEQ ID NO: 141) R ctgatccagttcgaccatctctt (SEQ ID NO: 142) yncD F tccgtccgacagaccgttttg (SEQ ID NO: 143) R aaaccaggcacgctggtcagt (SEQ ID NO: 144) yncE F caagagcgtaacgatgattacgc (SEQ ID NO: 145) R cgtaggcacctttacctaccg (SEQ ID NO: 146) slp F ggtgcactcatcctcagcctt (SEQ ID NO: 147) R cagcgatttctaacaacgtatccg (SEQ ID NO: 148) artI F tcttccgccacagctgccga (SEQ ID NO: 149) R acggcttctacgcgacggaatt (SEQ ID NO: 150) yiaD F agtggtgctctggcggtatct (SEQ ID NO: 151) R atgtaataacccacgccgccg (SEQ ID NO: 152) ompX F gcatgtctttcagcactggcc (SEQ ID NO: 153) R gcagtacggcttttctcggtg (SEQ ID NO: 154) borD F ctgccgctctggcaatgctta (SEQ ID NO: 155) R ccgagcaatccatttacgaatgt (SEQ ID NO: 156) yhjJ F gcggtttgctgatgatggcca (SEQ ID NO: 157) R gcgtgactgtaaccgctctgt (SEQ ID NO: 158) emtA F catgactatacgaacccgccg (SEQ ID NO: 159) R cacgtccggaggttgaagctt (SEQ ID NO: 160) fecA F ctcgttcgactcatagctgaacacaac (SEQ ID NO: 161) R cgtccagcagttgttgcaggcc (SEQ ID NO: 162) nmpC F ggcaatttctgctgtagctgca (SEQ ID NO: 163) R gaccgaaaccagtcagttgatc (SEQ ID NO: 164) ompN F taattcctgccctgctcgcc (SEQ ID NO: 165) R tgtattcccattgaccgtagcca (SEQ ID NO: 166) lpp F gcgttcgatgcttctttgagcg (SEQ ID NO: 167) R acgcgtgacgcagtagcggtaaac (SEQ ID NO: 168) fhuA F gcgcgttccaaaactgctcag (SEQ ID NO: 169) R gtgccggtagctgactgtcg (SEQ ID NO: 170) gltI F ctcacaacgggtatccatgcg (SEQ ID NO: 171) R ctgaagattcacggtgaccgac (SEQ ID NO: 172) hisJ F ctggtgctatcgctctctctg (SEQ ID NO: 173) R cgcatccagcggattttcgac (SEQ ID NO: 174) lamB F tgtctgctcaggcaatggctg (SEQ ID NO: 175) R ggccacgttagtgtcgaaatag (SEQ ID NO: 176) malE F cgcatcctcgcattatccgca (SEQ ID NO: 177) R gccgcaacctgtgggaatttc (SEQ ID NO: 178) malM F agcgcgcctggaattagcctt (SEQ ID NO: 179) R agttcgccaatgtttgccggg (SEQ ID NO: 180) ygiW F taatcgcagtaatggccctgtg (SEQ ID NO: 181) R gaacacgtagagatcgtcagaga (SEQ ID NO: 182) cirA F gggctgtgtttgtccgctatttc (SEQ ID NO: 183) R cgtcagttgtacgccaggcac (SEQ ID NO: 184) fepA F cattccctggccttgttggtc (SEQ ID NO: 185) R tggcatggtacggatgatctc (SEQ ID NO: 186) loiP F tggcaacggtactgaccggtt (SEQ ID NO: 187) R tgttgcctagcgcattggcaata (SEQ ID NO: 188) kpsD F tactgattgccgcctgtcacg (SEQ ID NO: 189) R cgctggtgccgttgaaaagttg (SEQ ID NO: 190) degP F gcgttatctgttaatcgagact (SEQ ID NO: 191) R ccttctacgttaatgctgaccac (SEQ ID NO: 192) yjeI F caacgaattgagtgctgccgg (SEQ ID NO: 193) R ccataaatcacgttaccgcccatt (SEQ ID NO: 194) mipA F cgtagcgcacgctgaaggtaa (SEQ ID NO: 195) R gtaaagcggcgaccagtaagc (SEQ ID NO: 196) ecnB F tctcccgcgctgccagctaat (SEQ ID NO: 197) R cacgcgtggtgttgcaggcag (SEQ ID NO: 198) surA F ccacgtaatccgcagtgcgg (SEQ ID NO: 199) R gttgctgccttgcctgagcag (SEQ ID NO: 200) bamC F ctggcaaaggttgcgggtgtt (SEQ ID NO: 201) R atgtccagcgccttaccgaca (SEQ ID NO: 202) nlpD F gcccaaaattcaccgttcgcc (SEQ ID NO: 203) R ggctgctgtaccggctgaatt (SEQ ID NO: 204) rcsF F aatatcattcaggacgggcgctt (SEQ ID NO: 205) R ttcggttttgcaggctccgct (SEQ ID NO: 206) rlpA F atctgcatcgcggcaggaatg (SEQ ID NO: 207) R cgagacggatcctgcacgatt (SEQ ID NO: 208) phoE F aagagcactctggcattagtggt (SEQ ID NO: 209) R ccataaccagtcagttgatcgttaa (SEQ ID NO: 210) pal F caggtcaaattccctgcctgg (SEQ ID NO: 211) R ttcgcatccataccagtgccg (SEQ ID NO: 212) potD F tgatggttattgccagccagctt (SEQ ID NO: 213) R ccggtttctttggtgaactgttc (SEQ ID NO: 214) oppA F agagaagtttagtagcagctggc (SEQ ID NO: 215) R tcgctgaccagtaagccttcaaa (SEQ ID NO: 216) fkpA F acaatggccgttgccctgcat (SEQ ID NO: 217) R tcctgaacaccagcgatcagc (SEQ ID NO: 218) ppiA F gatggctgctgttttcgctcttt (SEQ ID NO: 219) R aagccaggaatgacgcggtga (SEQ ID NO: 220) ybaY F gttggcggcttgcgcagataa (SEQ ID NO: 221) R tgacggtgcatcggctaacg (SEQ ID NO: 222) bamE F tggcatgacgcaacaacaagttg (SEQ ID NO: 223) R gttaccactcagcgcaggtttg (SEQ ID NO: 224) tsx F acattactggcagccggtgc (SEQ ID NO: 225) R cataaccatagaagtcgaaccag (SEQ ID NO: 226) yggE F aagcttgcctccagaggtcct (SEQ ID NO: 227) R gcaagagtggcaatgtctggc (SEQ ID NO: 228) skp F aggcgatcaatataagatcgccg (SEQ ID NO: 229) R accggttttctgcgctacctg (SEQ ID NO: 230) osmE F gaacaagaatatggcaggaattctg (SEQ ID NO: 231) R caggatgtaggtctggcaagta (SEQ ID NO: 232) yhcN F ccactgttgctgcattaagcgta (SEQ ID NO: 233) R caccgctacgagcttcagtaat (SEQ ID NO: 234) ygdR F aacagactattatcataggtgagcc (SEQ ID NO: 235) R cttgctgatcgtgataactcacc (SEQ ID NO: 236) yceI F tcgcgtccctgatgttctctg (SEQ ID NO: 237) R gtgattagtatcgacgctggtg (SEQ ID NO: 238) cpoB F gtcgtgcggtactggtttact (SEQ ID NO: 239) R tcagaaagttgttgctggagttg (SEQ ID NO: 240) bhsA F aacgtaaaaaccctcatcgctgc (SEQ ID NO: 241) R gtaatacggaaagattttgcgccc (SEQ ID NO: 242) yfeY F tgcactccaagcaacgttattga (SEQ ID NO: 243) R tgcagtggtgtggacgccgt (SEQ ID NO: 244) ydgH F agcttaagaacaccctcctgg (SEQ ID NO: 245) R gtcgacaacataaaaagaggcgg (SEQ ID NO: 246) yajG F cgttagttgctctgtttatgcttg (SEQ ID NO: 247) R ggaggcggtcagggtaacg (SEQ ID NO: 248) yifL F cgccttctcctgcgatgatag (SEQ ID NO: 249) R ccgtggattgcgtttgcgtct (SEQ ID NO: 250) lpoA F cgtttgaaagccgcgcgttgt (SEQ ID NO: 251) R cccggttttaccttctttcacca (SEQ ID NO: 252) nlpE R caggctggcatcgaaagcaca (SEQ ID NO: 253) F gcatcggtttcagttcggcag (SEQ ID NO: 254) pldA F ggactctgcagggctggttgt (SEQ ID NO: 255) R cgctggtttgggtgtaaatgagg (SEQ ID NO: 256) yghJ F gcggctattttgagcgcaacc (SEQ ID NO: 257) R caggatcaggtatcggttctggc (SEQ ID NO: 258) ydeN F ctggcatctggtatggctgca (SEQ ID NO: 259) R gggtcaaaagatcccttatcaaaagg (SEQ ID NO: 260) prc F cgcgtgctgatcaaattccgg (SEQ ID NO: 261) R tcgcgaactgttcaacatcgctt (SEQ ID NO: 262) slyB F gtcggttgtgttaataacgacacc (SEQ ID NO: 263) R gttccgccaccaacagtattcc (SEQ ID NO: 264) lpoB F gcgcacaaagtcagactttatct (SEQ ID NO: 265) R cgggatcgtcggcaccgag (SEQ ID NO: 266) yfhG F cattgctgggttgcgtgcaga (SEQ ID NO: 267) R gcgactgcgcaggcattaaac (SEQ ID NO: 268) ushA F ggcgtggcgttagcgctgtta (SEQ ID NO: 269) R cagccgcaacctctttgcggat (SEQ ID NO: 270) mdoD F ccagaaggactcactttcaggtatgg (SEQ ID NO: 271) R gtttgcgctaagtcgtgcgcc (SEQ ID NO: 272) treA F gcagctagtgcgatcctgaacta (SEQ ID NO: 273) R cggctgtggtgttaccggtgt (SEQ ID NO: 274) bcsC F ccctgtttggacaaggctggg (SEQ ID NO: 275) R tcgcttcgcctaaccgaacttgc (SEQ ID NO: 276) ftsP F ggggaacactttcctgcacgg (SEQ ID NO: 277) R taaacagcggttgcccacggc (SEQ ID NO: 278) ptrA F gggcacccttaagtcaggcag (SEQ ID NO: 279) R gatcttccagcgacccaacgg (SEQ ID NO: 280) dsbC F ctttgttagcggcgttttcagg (SEQ ID NO: 281) R agccgtgccgctaacgtcata (SEQ ID NO: 282) fadL F cctacacttcgcgctcctgtt (SEQ ID NO: 283) R tgcgccttcccctgaataagc (SEQ ID NO: 284) degQ F tcattcaggtacgagagcagg (SEQ ID NO: 285) R ttccttccacccgtacgctca (SEQ ID NO: 286) artJ F gacagacgggagttccatcatg (SEQ ID NO: 287) R cattctgcctgcatttgtttgcacaag (SEQ ID NO: 288) yraP F tgggtaccaaagccgcaactg (SEQ ID NO: 289) R ttggcaccgtctacgcccata (SEQ ID NO: 290) bamB F tactgctgccaggactgctttc (SEQ ID NO: 291) R gtccgctgcatagacaacgttgt (SEQ ID NO: 292) mlaC F cagctgctgcgccaggtaataa (SEQ ID NO: 293) R geggttgctcattcttcaggc (SEQ ID NO: 294) mlaA F agcttcgcctgtcggcgctt (SEQ ID NO: 295) R caaaccgttacgcgccggttg (SEQ ID NO: 296)
[0094] Quantification of the OMVs Released in the Culture Supernatant by Each Mutant Strain
[0095] To establish the amount of OMVs released by each mutant, each strain was grown in triplicate in 200 ml LB medium (starting OD.sub.600=0.05) and, when the cultures had reached an OD.sub.600=1, OMVs were collected from culture supernatants by filtration through a 0.22 μm pore size filter (Millipore) followed by high-speed centrifugation (200,000×g for 2 hours). Pellets containing OMVs were finally resuspended in 1×PBS and quantified by using nanodrop (Thermo Fisher).
[0096] To evaluate the quality of the OMVs, 20 μg of each OMV preparation were added to sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) Laemli buffer and heated at 100° C. for 5 minutes. Proteins were separated by 4-12% or 10% SDS-PAGE (Invitrogen), run in MES buffer (Invitrogen) and finally stained with Coomassie Blue. As shown in
[0097] Gene Inactivation Results in the Reduction of OMV Protein Content
[0098] Since the inactivated genes encode proteins belonging to the periplasmic and outer membrane compartment, the successful inactivation of each gene should result in the progressive reduction of OMV protein content. The disappearance of proteins from the OMV compartment can be appreciated by comparing the total protein content of the OMVs purified from the different mutants and run on the SDS-PAGE shown in
[0099] In
[0100] In order to detect the statistically significant quantitative and qualitative differences, image analysis was performed on three different spot maps from three OMVs preparations using the ImageMaster 2D Platinum v.6.0 software (GE Healthcare). Quantitative differences were considered significant only when the ratio of mean percentage relative volume (% V=V single spot/V total spots), between the two sample sets, was at least ±2 fold and satisfied statistical analysis with two-tailed Student's t-test score less than 0.05. As shown in Table 6 and Table 7 a considerable number of proteins spots emerged as significantly different in either quantitative or qualitative terms between the two OMVs preparations. The tables also report the names of the proteins as identified by Mass Spectrometry analysis, performed as already described (Fantappie' et. al (2017) Mol. Cell. Proteomics 16:1348-1364) using an Ultraflex III MALDI-TOF/TOF mass spectrometer (Bruker Daltonics, Billerica, Mass.), equipped with a 200 Hz Smartbeam™ I laser. Mass spectra were acquired in reflector positive mode with a laser frequency set to 100 Hz and protein identification was carried out in SwissProt database using the on-line available Mascot software (Matrix Science Ltd., London, UK, http://www.matrixscience.com).
TABLE-US-00006 TABLE 6 MS identified protein spots that significantly change in abundance between E. coli ΔOmpA and E. coli-OMV_MUT57 Mascot search results N. of Sequence Spot matched coverage N. Protein description UniProt name.sup.a Score peptides (%) 583 Outer membrane protein TolC TOLC_ECOLI 253 20/30 44 617 Periplasmic pH-dependent serine endoprotease DegQ DEGQ_ECOLI 169 10/10 30 622 Outer membrane protein ToIC TOLC_ECOLI 102 8/13 22 654 Chaperone SurA SURA_ECOLI 139 10/13 27 655 Chaperone SurA SURA_ECOLI 98 7/9 17 658 Chaperone SurA SURA_ECOLI 99 6/6 14 659 Chaperone SurA SURA_ECOLI 343 34/60 65 762 Bifunctional polyhydroxybutyrate synthase/ABC YDCS_ECOLI 134 9/13 37 transporter periplasmic binding protein 783 Minor capsid protein E WP_024748468.1 204 16/27 48 843 Outer membrane protein assembly factor BamC BAMC_ECOLI 165 13/21 47 874 Sulfate-binding protein SUBI_ECOLI 97 6/7 14 878 Outer membrane protein assembly factor BamC BAMC_ECOLI 100 9/20 40 970 ABC transporter periplasmic-binding protein YphF YPHF_ECOLI 100 7/13 33 991 ABC transporter periplasmic-binding protein YtfQ YTFQ_ECOLI 81 8/24 23 1028 Glutamate/aspartate import solute-binding protein GLTI_ECOLI 221 18/31 69 1031 Glutamate/aspartate import solute-binding protein GLTI_ECOLI 170 14/18 38 1076 Lysine/arginine/ornithine-binding periplasmic ARGT_ECOLI 145 10/18 41 protein 1104 Outer membrane protein assembly factor BamD BAMD_ECOLI 124 9/13 31 1124 MltA-interacting protein MIPA_ECOLI 99 8/11 35 1135 Probable phospholipid-binding protein MlaC MLAC_ECOLI 162 12/24 45 1177 Class B acid phosphatase APHA_ECOLI 70 4/5 13 1182 Class B acid phosphatase APHA_ECOLI 70 4/5 14 1321 Outer-membrane lipoprotein carrier protein LOLA_ECOLI 167 10/12 49 1322 Lipopolysaccharide export system protein LptA LPTA_ECOLI 126 8/15 37 1358 Major outer membrane prolipoprotein Lpp LPP_ECOLI 69 5/11 48 1379 Thioesterase 1/protease 1/lysophospholipase L1 TESA_ECOLI 92 5/6 29 1381 Outer membrane protein YfaZ YFAZ_ECOLI 91 7/16 51 Mean %V ± SD × 10.sup.−4b E. coli Fold change N. BL21(DE3)ΔompA OMV_MUT57 ΔOmpA/MUT57 T-test.sup.c 583 3515 ± 261 11613 ± 1819 −3.30 0,001582012 617 1399 ± 206 3800 ± 260 −2.15 0,001102484 622 7511 ± 368 99 ± 78 7.55 0,039899155 654 635 ± 45 3408 ± 420 −5.37 0,000342421 655 330 ± 129 2551 ± 149 −7.73 4,09376E−05 658 145 ± 45 2512 ± 348 −17.31 0,000308088 659 5517 ± 498 11507 ± 828 −2.08 0,000427214 762 226 ± 33 588 ± 61 −2.60 0,000819979 783 2976 ± 388 622 ± 76 4.78 0,000499047 843 1063 ± 260 6852 ± 1497 −6.45 0,002729187 874 749 ± 59 1854 ± 94 −2.47 6,71282E−05 878 3732 ± 501 11443 ± 536 −3.07 5,36343E−05 970 226 ± 46 725 ± 156 −3.20 0,006016959 991 1351 ± 232 4170 ± 133 −3.09 5,31535E−05 1028 1564 ± 383 5611 ± 2600 −3.59 0,055956672 1031 1464 ± 149 4543 ± 1278 −3.10 0,014344153 1076 1944 ± 418 5045 ± 637 −2.59 0,00213518 1104 288 ± 100 1727 ± 628 −5.99 0,017244485 1124 1693 ± 584 7607 ± 2039 −4.49 0,008470313 1135 497 ± 74 224 ± 144 2.22 0,043301085 1177 224 ± 21 1210 ± 3 −5.41 1,34924E−07 1182 129 ± 17 1363 ± 35 −10.58 6,92073E−07 1321 1515 ± 100 3242 ± 896 −2.14 0,029400485 1322 2409 ± 139 4937 ± 388 −2.05 0,000445675 1358 404 ± 16 1434 ± 348 −3.55 0,006870082 1379 495 ± 24 1097 ± 111 −2.21 0,000778907 1381 584 ± 71 3423 ± 524 −5.86 0,00074402 .sup.aUmProt entry name. .sup.bEach value represents the mean ± SD of individually computed %V in spot maps from OMVs of BL21(DE3)ΔompA and from OMVs of E. coli OMV_MUT57. .sup.cOnly protein spots showing both statistical reliability according two-tailed T-test (p ≤ 0.05) and, at least, 2 fold change in abundance are listed as significant differences.
TABLE-US-00007 TABLE 7 MS identified protein spots detected in OMVs from E. coli ΔOmpA and not in OMVs from E. coli-OMV_MUT57 Mascot search results N. of Sequence Mean %V ± SD × 10.sup.−4b Spot matched coverage BL21(DE3) E. coli N. Protein description UniProt name.sup.a Score peptides (%) ΔompA OMV_MUT57 128 Cellulose synthase operon protein C BCSC_ECOLI 161 15/19 18 999 ± 216 — 190 Protease 3 PTRA_ECOLI 316 29/34 27 2401 ± 453 — 253 Ferrienterobactin receptor FEPA_ECOLI 318 34/67 56 10761 ± 1466 — 258 Maltoporin LAMB_ECOLI 214 20/29 47 14837 ± 7060 — 264 Ferrienterobactin receptor FEPA_ECOLI 104 13/29 21 1183 ± 336 — 265 Ferrienterobactin receptor FEPA_ECOLI 319 27/36 46 3287 ± 594 — 273 Periplasmic beta-glucosidase BGLX_ECOLI 100 8/10 13 827 ± 110 — 274 Periplasmic beta-glucosidase BGLX_ECOLI 155 13/17 20 3334 ± 259 — 284 Ferrienterobactin receptor FEPA_ECOLI 144 12/16 21 1429 ± 280 — 317 Fe(3+) dicitrate transport protein FecA FECA_ECOLI 144 10/10 15 785 ± 371 — 319 Tail-specific protease PRC_ECOLI 186 16/18 20 2739 ± 247 — 320 Fe(3+) dicitrate transport protein FecA FECA_ECOLI 318 32/48 50 4054 ± 823 — 321 Fe(3+) dicitrate transport protein FecA FECA_ECOLI 112 10/14 13 487 ± 218 — 323 Ferrichrome outer membrane transporter/phage FHUA_ECOLI 111 9/12 16 742 ± 243 — receptor 325 Ferrienterobactin receptor FEPA_ECOLI 191 23/52 43 2413 ± 852 — Ferrichrome outer membrane transporter/phage FHUA_ECOLI 121 17/52 28 receptor 331 Probable TonB-dependent receptor YncD YNCD_ECOLI 109 13/34 24 8452 ± 500 — Ferrichrome outer membrane transporter/phage FHUA_ECOLI 79 11/34 18 receptor 332 Ferrichrome-iron receptor FHUA_ECOLI 136 10/11 18 1264 ± 352 — 394 Colicin I receptor CIRA_ECOLI 290 28/40 42 3503 ± 889 — 395 Colicin I receptor CIRA_ECOLI 106 8/8 13 1893 ± 630 — 514 Uncharacterized sulfatase YdeN YDEN_ECOLI 140 10/13 26 2505 ± 185 — 517 Uncharacterized sulfatase YdeN YDEN_ECOLI 93 9/22 23 1827 ± 587 — Protein UshA USHA_ECOLI 86 9/22 20 519 Periplasmic trehalase TREA_ECOLI 131 10/14 22 724 ± 244 — 520 Periplasmic oligopeptide-binding protein OPPA_ECOLI 103 8/12 19 198 ± 57 — 524 Periplasmic oligopeptide-binding protein OPPA_ECOLI 182 14/21 34 1509 ± 315 — 526 Periplasmic oligopeptide-binding protein OPPA_ECOLI 194 21/50 43 5891 ± 554 — 527 Periplasmic oligopeptide-binding protein OPPA_ECOLI 168 14/24 31 344 ± 24 — 529 Polysialic acid transport protein KpsD KPSD1_ECOLX 110 8/10 15 123 ± 111 — 535 Glucans biosynthesis protein D OPGD_ECOLI 125 8/8 16 150 ± 27 — 536 Glucans biosynthesis protein D OPGD_ECOLI 255 23/41 53 1640 ± 159 — 541 Glucans biosynthesis protein D OPGD_ECOLI 116 9/8 16 78 ± 7 — 589 Protein YhjJ YHJJ_ECOLI 235 19/27 45 2507 ± 539 — 651 Maltoporin LAMB_ECOLI 196 21/47 60 13889 ± 2535 — 652 Maltoporin LAMB_ECOLI 128 10/17 31 814 ± 353 — 660 Maltoporin LAMB_ECOLI 110 11/19 28 1338 ± 402 — 662 Maltoporin LAMB_ECOLI 190 22/49 51 2346 ± 119 — 688 Glucose-1-phosphatase AGP_ECOLI 75 6/11 18 1397 ± 469 — 690 Glucose-1-phosphatase AGP_ECOLI 138 17/37 34 4007 ± 578 — 695 Deferrochelatase/peroxidase EfeB EFEB_ECOLI 109 7/8 15 328 ± 76 — 752 Glycerophosphoryl diester phosphodiesterase GLPQ_ECOLI 141 14/29 37 6232 ± 1129 — 757 Glycerophosphoryl diester phosphodiesterase GLPQ_ECOLI 154 12/18 34 1471 ± 548 — 766 Maltose-binding periplasmic protein MALE_ECOLI 229 23/54 56 17912 ± 3142 — 771 Maltose-binding periplasmic protein MALE_ECOLI 149 11/18 36 6318 ± 1352 — 777 Maltose-binding periplasmic protein MALE_ECOLI 62 4/5 13 1323 ± 908 — 778 Maltose-binding periplasmic protein MALE_ECOLI 128 10/17 26 1742 ± 1093 — 779 Maltose-binding periplasmic protein MALE_ECOLI 104 7/9 18 2209 ± 1168 — 806 Iron uptake system component EfeO EFEO_ECOLI 199 13/16 35 6455 ± 730 — 895 Maltose operon periplasmic protein MALM_ECOLI 133 10/15 28 17803 ± 3060 — 927 Uncharacterized protein YggE YGGE_ECOLI 107 8/11 22 340 ± 20 — 969 FKBP-type peptidyl-prolyl cis-trans isomerase FkpA FKBA_ECOLI 123 8/11 20 1849 ± 406 — 975 FKBP-type peptidyl-prolyl cis-trans isomerase FkpA FKBA_ECO57 154 10/15 44 2269 ± 488 — 985 FKBP-type peptidyl-prolyl cis-trans isomerase FkpA FKBA_ECOLI 233 18/36 61 12068 ± 3760 — 988 Probable L,D-transpeptidaseYbiS YBIS_ECOLI 154 12/20 49 4323 ± 166 — 989 FKBP-type peptidyl-prolyl cis-trans isomerase FkpA FKBA_ECOLI 199 7/8 21 5716 ± 801 — 992 Glutamate/aspartate import solute-binding protein GLTI_ECOLI 100 6/7 21 424 ± 50 — 998 Phospholipase A1 PAl_ECOLI 101 9/21 39 2198 ± 446 — 1017 Histidine-binding periplasmic protein HISJ_ECOLI 286 24/48 86 4447 ± 1143 — 1067 Nucleoside-specific channel-forming protein tsx TSX_ECOLI 101 10/30 31 6298 ± 3313 — 1091 Putative ABC transporter arginine-binding protein 2 ARTI_ECOLI 292 22/39 70 4637 ± 144 — 1115 ABC transporter arginine-binding protein 1 ARTJ_ECOLI 232 14/17 59 3102 ± 301 — 1125 Metalloprotease LoiP LOIP_ECOLI 175 13/18 38 1530 ± 162 — 1136 Glutamine-binding periplasmic protein GLNH_ECOLI 208 20/46 67 4330 ± 493 — 1144 Lipoprotein NlpE NLPE_ECOLI 66 8/26 42 2099 ± 317 — 1153 Probable phospholipid-binding lipoprotein MlaA MLAA_ECOLI 108 9/13 21 2138 ± 426 — 1250 Uncharacterized lipoprotein YdcL YDCL_ECOLI 183 17/27 66 5619 ± 564 — 1275 Protein YceI YCEI_ECOLI 148 8/11 48 1728 ± 458 — 1307 Outer membrane protein X OMPX_ECOLI 180 12/28 56 2560 ± 2232 — 1308 Outer membrane protein X OMPX_ECOLI 151 11/33 54 8131 ± 1583 — 1378 Outer membrane protein slp SLP_ECOLI 85 7/17 45 574 ± 79 — 1408 Ecotin ECOT_ECOLI 156 13/26 45 3757 ± 118 — 1412 Osmotically-inducible putative lipoprotein OsmE OSME_ECOLI 67 5/11 37 6520 ± 970 — 1417 Outer membrane protein X OMPX_ECOLI 186 12/25 54 13979 ± 5761 — 1483 Protein YgiW YGIW_ECOLI 87 6/18 49 4883 ± 414 — 1591 Lipoprotein bor, partial WP_033556683.1 108 5/9 92 8198 ± 1436 — 2007 Long-chain fatty acid transport protein FADL_ECOLI 130 13/35 32 4436 ± 895 — 2010 Glycine betaine/prolinebetaine-binding PROX_ECOLI 124 10/23 43 4210 ± 484 — periplasmic protein .sup.aUniProt entry name. .sup.bEach value represents the mean ± SD of individually computed %V in spot maps from OMVs of BL21(DE3)ΔompA and from OMVs of E. coli OMV_MUT57.
[0101] Heterologous Antigens Efficiently Accumulate in the OMVs Deprived of Endogenous Proteins
[0102] As already pointed out one important property of OMVs it that they can be manipulated in their protein content by genetic engineering. This feature was demonstrated for the first time by Kesty and Kuehn (N. C. Kesty and Kuhen M. J. (2004) J. Biol. Chem. 279, 2069-2076) and subsequently an increasing number of heterologous proteins have been successfully delivered to OMVs using a variety of strategies. For instance, heterologous antigens from Group A Streptococcus and Group B Streptococcus were delivered to the lumen of E. coli vesicles by fusing their coding sequences to the leader peptide of E. coli OmpA. (Fantappiè et al., (2014) Journal of Extracellular Vesicles, 3, 24015). More recently, we have shown that heterologous antigens can be delivered to the vesicular compartment by expressing them as lipoproteins in the OMV-producing strain (WO2015/144691, WO2006/024954, Fantappie' et. al (2017) Mol. Cell. Proteomics 16:1348-1364). Interestingly, lipoproteins can also serve as chaperones to deliver foreign polypeptides to the OMVs compartment, thus allowing the decoration of vesicles with a variety of polypeptides and their exploitation in different biotechnological applications, including vaccines and immunotherapy.
[0103] Therefore, it is important to demonstrate that the elimination of endogenous proteins has not affected the capacity of OMVs to be decorated with foreign antigens. To this aim three heterologous proteins, S. aureus LukE, FhuD2 and FhuD2-hFAT1 (WO2006/024954) were selected and their expression profile was analyzed in E. coli OMV_MUT57, the strain that carries all 58 gene inactivations. LukE is a S. aureus (Alonzo et al., (2013) PLoS Pathog.; 9:e1003143; Reyes-Robles et al., (2013) Cell Host Microbe. October 16; 14(4):453-9, Alonzo & Torres, (2014) Microbiol Mol Biol Rev. 2014 June; 78(2):199-230), FhuD2 is a S. aureus antigen used vaccine studies (Bagnoli F. et al. (2015) Proc Natl Acad Sci USA 112:3680-5). FhuD2-FAT1 is a fusion constituted by FhuD2 and an immunogenic epitope of FAT1 protein found overexpressed in most colon cancers (Pileri et al. (2016) Br J Cancer 115:40-51). The construction of the plasmids pET_LukE, pET-FhuD2 and pET-FhuD2-D8-hFAT1-x3, encoding the LukE, FhuD2 and FhuD2-FAT1 fusion, respectively have been already described (WO2006/024954). The maps of the three plasmids is schematically reported in
[0104] Heterologous Antigens Expressed as Lipoproteins in E. coli OMV_MUT57 Accumulate on the Surface of OMVs with High Efficiency
[0105] We have recently found that a number of heterologous proteins expressed in E. coli BL21(DE3)ΔompA as fusions to a lipoprotein leader sequence are lipidated and reach the outer membrane. More surprisingly, we discovered that some of these lipidated heterologous proteins not only reach the outer membrane but are also exposed on the surface of the cells and of OMVs. This is for example the case of fHbp from Neisseria meningitidis and of fHbp carrying passenger polypeptides fused at its C-terminus (Fantappie' et. al (2017) Mol. Cell. Proteomics 16:1348-1364; Grandi A. et al. (2017) Frontiers in Oncology, 7:253. doi: 10.3389/fonc.2017.00253). Also, fhuD2 from S. aureus and of FhuD2 carrying passenger polypeptides fused to its C-terminus were also transported to the surface of E. coli BL21(DE3)ΔompA (WO2006/024954). We tested whether the gene inactivations had somehow influenced the surface localization of lipidated heterologous proteins. To this aim the surface localization of three heterologous lipoproteins, FhuD2 and FhuD2-D8-hFAT1 described in the previous section, and fHbp-vIII was analyzed in E. coli OMV_MUT57. fHbp-vIII is a fusion protein constituted by the neisserial fHbp and the vIII variant peptide from EGFR receptor expressed in several tumors. The construction of fHbpvIII fusion has been described (Grandi A. et al. (2017) Frontiers in Oncology, 7:253. doi: 10.3389/fonc.2017.00253) and the map of the plasmid encoding the fusion is schematically reported in
[0106] Properties of OMVs.sub.Δ58 and of its Derivative OMVs.sub.Δ60
[0107] OMVs.sub.ΔompA carry more than hundred endogenous proteins visible in the 2-DE map. Several of these proteins have been deleted in OMVs.sub.Δ58 with the aim to reduce the immune responses toward the OMV endogenous proteins, thus avoiding dilution and/or interference of the immune responses toward the recombinant antigens/epitopes expressed in OMVs. To test this, ten of the proteins deleted in E. coli BL21(DE3)Δ58 and visible in the OMVs.sub.ΔompA 2-DE map, were selected and expressed in, and purified from E. coli BL21(DE3). Purified proteins were separated by SDS-PAGE and analysed by Western Blot using sera from mice immunized with either OMVs.sub.Δ58 or OMVs.sub.ΔompA. As shown in
[0108] We also repeated this experiment, using OMVs from a derivative of E. coli BL21(DE3)Δ58, named E. coli (BL21(DE3)Δ60, in which two additional genes, msbB and pagP, were inactivated. These genes are involved in the biosynthesis of lipopolysaccharide (LPS) and their inactivation results in the production of a LPS carrying a pentaacylated Lipid A, which is less reactogenic with respect to wt LPS (Irene et al., (2020) PNAS 116: 21780). OMVs (OMVs.sub.Δ60) were purified from the new derivative named E. coli BL21(DE3)Δ60 and used to immunize mice. Mouse sera was used in Western Blot experiments as described above. As a control, two proteins not deleted in E. coli BL21(DE3)Δ60, but visible the 2-DE map (the products of cpoB and pal genes), were also purified and analyzed in Western Blot. Again, five out of the ten proteins were recognized by the sera from OMV.sub.ΔompA-immunized mice while none of the proteins were positive to sera from animals immunized with OMVs.sub.Δ60. On the other hand, both control proteins were recognized by both anti-OMVs.sub.Δ60 and anti-OMVs.sub.ΔompA sera (
[0109] Engineering of OMVs.sub.Δ60 with Heterologous Proteins
[0110] We next addressed the question as to whether the removal of the OMV endogenous proteins could have positively or negatively affected the loading capacity of OMVs. Several strategies are available for OMV engineering with foreign antigens and epitopes. One of our preferred approaches is to express them as membrane-associated lipoproteins (Fantappié et al., 2017; Irene et al., 2019), by fusing their coding sequences either directly to a lipoprotein leader sequence (in the case of full-length proteins/protein domains) or to the end of an OMV-associated lipoprotein (Grandi et al., 2017; 2018). Therefore, we selected ten heterologous proteins and epitopes, we expressed them as lipidated antigens in both E. coli BL21(DE3)ΔompA and in E. coli BL21(DE3)Δ60 and we purified the vesicles from each recombinant strain. Purified vesicles were analyzed by SDS-PAGE and the amount of recombinant protein in each vesicle preparation was determined by densitometry analysis (
[0111] OMVs.sub.Δ60 as Vaccine Platform
[0112] We finally asked the question as to whether OMVs.sub.Δ60 decorated with different heterologous antigens/epitopes could elicit antigen/epitope-specific immune responses.
[0113] First, we selected four engineered OMVs.sub.Δ60 decorated with lipidated FhuD2, Hla.sub.H35L, FhuD2-mFAT1 fusion and FhuD2-Bp fusion and we used them to immunize groups of BALB/c mice. After immunization (three doses (2 μg/dose) given two weeks apart), sera from animals of each group were collected, pooled together and antigen-specific antibody titers were measured by ELISA. As shown in
[0114] We also tested the capacity of OMVs.sub.Δ60 to induce cytotoxic CD8.sup.+ T cell responses. To this aim, 2 μg of synthetic peptides corresponding to either OVA or SV40 epitopes were absorbed to 10 μg of OMVs.sub.Δ60 and used to immunize C57BL/6 mice. Animals were given two doses, one week apart, and five days after the second immunization splenocytes were stimulated with the corresponding peptide and the frequency of IFNγ-producing CD8.sup.+ T cells was determined by flow cytometry. As shown in
[0115] Finally, to establish the effector function of OVA-specific CD8.sup.+ T cells, C57BL/6 mice were challenged with a s.c. injection of 2×10.sup.5 OVA-B16F10 cells and subsequently animals were vaccinated with either “empty” OMVs.sub.Δ60 or OVA peptide+OMVs.sub.Δ60. As shown in
[0116] In Situ Vaccination with OMVs Inhibits Tumor Growth
[0117] In situ vaccination is an effective strategy applied for the first time by Dr Coley at the end of the nineteenth century (Coley's toxin) and currently in use for bladder cancer patients with BGC. The main principle is to inject adjuvants directly into the tumour and tumour microenvironment, thus stimulating an immune response at the tumour site. The rationale is that tumour-specific antigens at the tumor site are phagocytosed by the dendritic cells, which in the presence of the adjuvant promote anti-tumour T and B cell response (Sagiv-Barfi L. et al., (2018) Sci. Transl. Med. 10: eaan4488).
[0118] Considering the potent adjuvanticity of OMVs, we tested their effectiveness in in situ immunization using the syngeneic mouse model, BALB/c with CT-26 colon carcinoma cells (Grandi A. et al. (2018) Frontiers in Oncology 8, article 481). CT26 cells were injected subcutaneously at sites on both the right and left flank of the mice. When tumour size reached 50-100 mm.sup.3 mice were vaccinated in situ in just one of the tumours. Mice were given a total of 3 vaccinations every 2 days, into the same tumour. There were three treatment groups: PBS control, OMVs.sub.Δ60 (the OMVs from E. coli BL21(DE3)Δ60), and OMVs.sub.Δ60+100 μs (20 μg each) of five synthetic peptides (pentatope) corresponding to 5 immunogenic neoepitopes identified in CT26 cell line (Kreiter S. et al. (2015) Nature, 520, 692-696). The amino acid sequences of the peptides were as follows:
TABLE-US-00008 M03: (SEQ ID NO: 304) DKPLRRNNSYTSYIMAICGMPLDSFRA M20: (SEQ ID NO: 305) PLLPFYPPDEALEIGLELNSSALPPTE; M26: (SEQ ID NO: 306) VILPQAPSGPSYATYLQPAQAQMLT PP; M27: (SEQ ID NO: 307) EHIHRAGGLFVADAIQVGFGRIGKHFW, and M68: (SEQ ID NO: 308) VTSIPSVSNALNWKEFSFIQSTLGYVA (Grandi A. et al.
(2018) Frontiers in Oncology 8, article 481). Mice were sacrificed when the tumour volume of one tumour reached≥2000 mm.sup.3, or the sum of tumour volume reached 3000 mm.sup.3. In the PBS control group, after vaccination, both the in situ vaccinated tumour and the lateral tumour continued to grow as expected (
[0119] These results (