DEEP MUTATIONAL EVOLUTION OF BIOMOLECULES

20220177872 · 2022-06-09

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided herein are methods of developing biomolecule variants (such as proteins, RNA, or DNA) with improved characteristics, for example by developing libraries of variants with alterations to one or more specific monomer locations and screening said libraries for characteristics of interest. These alterations can include deletion, substitution, and insertion, and variants may comprise one alteration or a combination of alterations. Said methods may include further iterative cycles of library construction and evaluation to develop, for example, a biomolecule variant with improved characteristics compared to a reference biomolecule. The methods can also provide information that may be used in the rational design of variants.

    Claims

    1. A method of selecting an improved biomolecule variant, wherein the biomolecule variant is a protein, RNA, or DNA, comprising: (i) constructing a library comprising a plurality of biomolecule variants; wherein each variant is independently a variant of the same reference biomolecule, wherein each variant comprises an alteration of one or more monomer locations of the reference biomolecule, wherein the monomer is an amino acid of the protein or a ribonucleotide of the RNA or a deoxyribonucleotide of the DNA, wherein each alteration of a monomer location is independently selected from the group consisting of substitution of the monomer, deletion of one or more consecutive monomers beginning at the location, and insertion of one or more consecutive monomers adjacent to the location; and wherein the library represents variants comprising alteration of one or more locations for at least 1% of the monomer locations of the reference biomolecule; (ii) screening the library of (i); (iii) identifying at least a portion of the library of (i) that exhibits one or more improved characteristics compared to the reference biomolecule; and (iv) selecting the improved biomolecule variant from the at least a portion of the library, wherein the improved biomolecule variant exhibits one or more improved characteristics compared to the reference biomolecule.

    2. The method of claim 1, further comprising screening the portion of the library identified in step (iii).

    3-4. (canceled)

    5. A method of selecting an improved biomolecule variant, wherein the biomolecule is a protein, RNA, or DNA, comprising: (i) constructing a library comprising a plurality of biomolecule variants; wherein each variant is independently a variant of the same reference biomolecule, wherein each variant comprises an alteration of one or more monomer locations of the reference biomolecule, wherein the monomer is an amino acid of the protein or ribonucleotide of the RNA or deoxyribonucleotide of the DNA, wherein each alteration of a monomer location is independently selected from the group consisting of substitution of the monomer, deletion of one or more consecutive monomers beginning at the location, and insertion of one or more consecutive monomers adjacent to the location; and wherein the library represents variants comprising alteration of one or more locations of at least 5%, at least 10%, at least 30%, at least 70%, or at least 90% of the monomer locations of the reference biomolecule; (ii) screening the library of (i); (iii) identifying at least a portion of the library of (i) that exhibits one or more improved characteristics compared to the reference biomolecule; (iv) carrying out one or more additional rounds of library construction and screening to produce a final library, wherein construction of each library comprises: altering one or more additional monomer locations of the identified portion of the previous library to produce a subsequent library of biomolecule variants; (v) selecting the improved biomolecule variant from the final library of biomolecule variants, wherein the improved biomolecule variant exhibits one or more improved characteristics compared to the reference biomolecule.

    6. The method of claim 1, wherein the library in step (i) comprises biomolecule variants with a single alteration of a single monomer location, biomolecule variants with a single alteration of two monomer locations, and biomolecule variants with a single alteration of three monomer locations, wherein each alteration is independently selected from the group consisting of substitution of the monomer, deletion of one or more consecutive monomers beginning at the location, and insertion of one or more consecutive monomers adjacent to the location.

    7-16. (canceled)

    17. The method of claim 1, wherein the reference biomolecule is a CRISPR associated protein selected from the group consisting of CasX, CasY, Cas9, Cas12a, Cas12b, Cas12c, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d, Cas14, CASCADE, CSM, and CSY.

    18.-19. (canceled)

    20. The method of claim 17, wherein the one or more improved characteristics are independently selected from the group consisting of improved folding of the variant, improved binding affinity to the guide RNA, improved binding affinity to a target DNA, altered binding affinity to one or more PAM sequences, improved unwinding of a target DNA, increased activity, improved editing efficiency, improved editing specificity, increased activity of the nuclease, increased target strand loading for double strand cleavage, decreased target strand loading for single strand nicking, decreased off-target cleavage, decreased off-target binding/nicking, improved binding of the non-target strand of a DNA, improved protein stability, improved protein:guide-RNA complex stability, improved protein solubility, improved protein:guide NA complex stability, improved protein yield, increased collateral activity, and decreased collateral activity.

    21. (canceled)

    22. The method of claim 1, wherein the reference biomolecule is a CRISPR guide RNA that binds to CasX, CasY, Cas9, Cas12a, Cas12b, Cas12c, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d, Cas14, CASCADE, CSM, or CSY.

    23. (canceled)

    24. The method of claim 22, wherein the one or more improved characteristics are independently selected from the group consisting of improved stability, improved solubility, improved resistance to nuclease activity, improved binding affinity to a reference CRISPR associated protein, improved binding affinity to a target DNA, improved gene editing, and improved specificity.

    25-30. (canceled)

    31. A method of constructing a library of polynucleotide variants of a reference biomolecule, comprising: (a) constructing a polynucleotide that encodes for a variant of the reference biomolecule, wherein the reference biomolecule is a protein or RNA or DNA; wherein the polynucleotide encodes for an alteration of one or more monomer locations of the reference biomolecule, wherein the monomer is an amino acid of the protein or ribonucleotide of the RNA or the deoxyribonucleotide of the DNA, and wherein each alteration of a monomer location is independently selected from the group consisting of substitution of the monomer, deletion of one or more consecutive monomers beginning at the location, and insertion of one or more consecutive monomers adjacent to the location; and (b) repeating the polynucleotide construction of (a) a sufficient number of times such that the library of polynucleotide represents variants comprising a single alteration of a single location for at least of at least 5%, at least 10%, at least 30%, at least 70%, or at least 90%1% of the monomer locations of the biomolecule.

    32-42. (canceled)

    43. The method of claim 31, wherein the reference biomolecule is a protein, and wherein substitution of the monomer comprises replacing the monomer with one of the nineteen other naturally occurring amino acids.

    44-46. (canceled)

    47. The method of claim 31, wherein the reference biomolecule is an RNA, and wherein substitution of the monomer comprises replacing the monomer with one of the three other naturally occurring ribonucleotides.

    48-53. (canceled)

    54. The method of claim 31 wherein the reference biomolecule is a CRISPR associated protein selected from the group consisting of CasX, CasY, Cas9, Cas12a, Cas12b, Cas12c, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d, Cas14, CASCADE, CSM, and CSY.

    55-60. (canceled)

    61. The method of claim 31 wherein the reference biomolecule is a CRISPR guide RNA wherein the CRISPR guide RNA is a guide RNA that binds to CasX, CasY, Cas9, Cas12a, Cas12b, Cas12c, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d, Cas14, CASCADE, CSM, or CSY.

    62-64. (canceled)

    65. A polynucleotide variant library, comprising polynucleotide variants of a reference biomolecule, comprising: a plurality of polynucleotides that independently encode for a variant of the reference biomolecule, wherein the reference biomolecule is a protein or RNA or DNA; wherein each polynucleotide independently encodes an alteration of one or more monomer locations of the reference biomolecule, wherein the monomer is an amino acid of the protein or ribonucleotide of the RNA or deoxyribonucleotide of the DNA, and wherein each alteration of a monomer location is independently selected from the group consisting of substitution of the monomer, deletion of one or more consecutive monomers beginning at the location, and insertion of one or more consecutive monomers adjacent to the location; and wherein the library of polynucleotides represents variants comprising a single alteration of a single location of at least 5%, at least 10%, at least 30%, at least 70%, or at least 90% for at least 1% of the monomer locations.

    66-76. (canceled)

    77. The polynucleotide variant library of claim 65, wherein the reference biomolecule is a protein, and wherein substitution of the monomer comprises replacing the monomer with one of the nineteen other naturally occurring amino acids.

    78-81. (canceled)

    82. The polynucleotide variant library of claim 65, wherein the reference biomolecule is an RNA, and wherein substitution of the monomer comprises replacing the monomer with one of the three other naturally occurring ribonucleotides.

    83-86. (canceled)

    87. The polynucleotide variant library of claim 65, wherein the reference biomolecule is a CRISPR associated protein, and wherein the CRISPR associated protein is CasX, CasY, Cas9, Cas12a, Cas12b, Cas12c, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d, Cas14, CASCADE, CSM, or CSY.

    88-93. (canceled)

    94. The polynucleotide variant library of claim 65, wherein the reference biomolecule is a CRISPR guide RNA, and wherein the CRISPR guide RNA is a guide RNA that binds to CasX, CasY, Cas9, Cas12a, Cas12b, Cas12c, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d, Cas14, CASCADE, CSM, or CSY.

    95-110. (canceled)

    111. A library of variant oligonucleotides, wherein: each variant oligonucleotide independently encodes an alteration of one or more sequential monomer locations of a reference biomolecule, wherein: the reference biomolecule is a protein, RNA, or DNA, the one or more monomers are one or more amino acids of the protein or ribonucleotides of the RNA or one or more deoxyribonucleotides of DNA, and wherein each alteration of a monomer location is independently selected from the group consisting of substitution of the monomer, deletion of one or more consecutive monomers beginning at the location, and insertion of one or more consecutive monomers adjacent to the location; each variant oligonucleotide comprises a pair of homology arms flanking the encoded alteration, wherein the homology arms are homologous to the reference biomolecule sequences flanking the corresponding monomer location alteration, and wherein each homology arm independently comprises between 10 to 100 nucleotides; and the library of variant oligonucleotides represents alteration of a single monomer for at least 80% of monomer locations.

    112. The library of variant oligonucleotides of claim 111, wherein each variant oligonucleotide independently encodes an alteration of one or more monomer locations of the reference biomolecule.

    113. A library comprising a plurality of RNA variants, wherein each variant is independently a variant of the same reference RNA, and each variant comprises a point mutation, deletion, or insertion at one ribonucleotide location of the reference RNA sequence; wherein the library represents variants comprising the single alteration of a single location, for at least 5%, at least 10%, at least 30%, at least 70%, or at least 90% 1% of the ribonucleotide locations of the reference RNA sequence.

    114-116. (canceled)

    117. The library of claim 113, wherein the reference RNA is a CRISPR guide RNA, and wherein the CRISPR guide RNA binds to CasX, CasY, Cas9, Cas12a, Cas12b, Cas12c, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d, Cas14, CASCADE, CSM, or CSY.

    118-120. (canceled)

    121. A library comprising a plurality of protein variants, wherein each variant is independently a variant of the same reference protein, and each variant comprises an amino acid substitution, deletion, or insertion at one amino acid location of the reference protein sequence; wherein the library represents variants comprising the single alteration of a single location, for at least 5%, at least 10%, at least 30%, at least 70%, or at least 90% 1% of the amino acids of the reference protein sequence.

    122-124. (canceled)

    125. The library of 121, wherein the reference protein is a CRISPR associated protein, and wherein the CRISPR associated protein is CasX, CasY, Cas9, Cas12a, Cas12b, Cas12c, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d, Cas14, CASCADE, CSM, or CSY.

    126-131. (canceled)

    132. A library comprising a plurality of DNA variants, wherein each variant is independently a variant of the same reference DNA, and each variant comprises a point mutation, deletion, or insertion at one deoxyribonucleotide location of the reference DNA sequence; wherein the library represents variants comprising the single alteration of a single location, for at least 5%, at least 10%, at least 30%, at least 70%, or at least 90% of the deoxyribonucleotide locations of the reference DNA sequence.

    133-135. (canceled)

    Description

    DESCRIPTION OF THE FIGURES

    [0062] The present application can be understood by reference to the following description taken in conjunction with the accompanying figures.

    [0063] FIG. 1 is a diagram showing an exemplary method of making CasX protein and guide RNA variants of the disclosure using Deep Mutational Evolution (DME). In some exemplary embodiments, DME builds and tests nearly every possible mutation, insertion and deletion in a biomolecule and combinations/multiples thereof, and provides a near comprehensive and unbiased assessment of the fitness landscape of a biomolecule and paths in sequence space towards desired outcomes. As described herein, DME can be applied to both CasX protein and guide RNA.

    [0064] FIG. 2 is a diagram and an example fluorescence activated cell sorting (FACS) plot illustrating an exemplary method for assaying the effectiveness of a reference CasX protein or single guide RNA (sgRNA), or variants thereof. A reporter (e.g. GFP reporter) coupled to a gRNA target sequence, complementary to the gRNA spacer, is integrated into a reporter cell line. Cells are transformed or transfected with a CasX protein and/or sgRNA variant, with the spacer motif of the sgRNA complementary to and targeting the gRNA target sequence of the reporter. Ability of the CasX:sgRNA ribonucleoprotein complex to cleave the target sequence is assayed by FACS. Cells that lose reporter expression indicate occurrence of CasX:sgRNA ribonucleoprotein complex-mediated cleavage and indel formation.

    [0065] FIG. 3A and FIG. 3B are exemplary heat maps showing the results of an exemplary DME mutagenesis of the reference sgRNA encoded by SEQ ID NO: 5, as described in Example 3. FIG. 3A shows the effect of single base pair (single base) substitutions, double base pair (double base) substitutions, single base pair insertions, single base pair deletions, and a single base pair deletion plus at single base pair substitution at each position of the reference sgRNA shown at top. FIG. 3B shows the effect of double base pair insertions and a single base pair insertion plus a single base pair substitution at each position of the improved reference sgRNA. The reference sgRNA sequence is UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCGUA UGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAUAAGAAGCAUCAAAG (SEQ ID NO: 5) and is shown at the top of FIG. 3A and bottom of FIG. 3B. In FIG. 3A and FIG. 3B, Log.sub.2 fold enrichment of the variant in the DME library relative to the reference CasX sgRNA following selection is indicated in grayscale. The results show regions of the reference sgRNA that should not be mutated and key regions that should be targeted for mutagenesis.

    [0066] FIG. 4A shows the results of exemplary DME experiments using a reference sgRNA, as described in Example 3. The improved reference sgNA (an sgRNA) with a sequence of SEQ ID NO: 5 is shown at top, and Log.sub.2 fold enrichment of the variant in the DME library relative to the reference sgRNA following selection is indicated in grayscale. Enrichment is a proxy for activity, where greater enrichment is a more active molecule. The heat map shows an exemplary DME experiment showing four replicates of a library where every base pair in the reference sgRNA has been substituted with every possible alternative base pair.

    [0067] FIG. 4B is a series of 8 plots that compare biological replicates of different DME libraries. The Log.sub.2 fold enrichment of individual variants relative to the reference sgRNA sequence for pairs of DME replicates are plotted against each other. Shown are plots for single deletion, single insertion and single substitution DME experiments, as well as wild type controls, and the plots indicate that there is a good amount of agreement for each replicate.

    [0068] FIG. 4C is a heat map of an exemplary DME experiment showing four replicates of a library where every location in the reference sgRNA has undergone a single base pair insertion. The DME experiment used a reference sgRNA of SEQ ID NO: 5 (at top), and was performed as described in Example 3. Log.sub.2 fold enrichment of the variant in the DME library relative to the reference sgRNA following selection is indicated in grayscale.

    [0069] FIGS. 5A-5E are a series of plots showing that sgNA variants can improve gene editing by greater than two fold in an EGFP disruption assay, as described in Examples 2 and 3. Editing was measured by indel formation and GFP disruption in HEK293 cells carrying a GFP reporter. FIG. 5A shows the fold change in editing efficiency of a CasX sgRNA reference of SEQ ID NO: 4 and a variant of the reference which has a sequence of SEQ ID NO: 5, across 10 targets. When averaged across 10 targets, the editing efficiency of sgRNA SEQ ID NO: 5 improved 176% compared to SEQ ID NO: 4. FIG. 5B shows that further improvement of the sgRNA scaffold of SEQ ID NO: 5 is possible by swapping the extended stem loop sequence for additional sequences to generate the scaffolds whose sequences are shown in Table 3. Fold change in editing efficiency is shown on the Y-axis. FIG. 5C is a plot showing the fold improvement of sgNA variants (including SEQ ID NO: 17) generated by DME mutations normalized to SEQ ID NO: 5 as the CasX reference sgRNA. FIG. 5D is a plot showing the fold improvement of sgNA variants of sequences listed in Table 3, which were generated by appending ribozyme sequences to the reference sgRNA sequence, normalized to SEQ ID NO: 5 as the CasX reference sgRNA. FIG. 5E is a plot showing the fold improvement normalized to the SEQ ID NO: 5 reference sgRNA of variants created by both combining (stacking) scaffold stem mutations showing improved cleavage, DME mutations showing improved cleavage, and using ribozyme appendages showing improved cleavage. The resulting sgNA variants yield 2 fold or greater improvement in cleavage compared to SEQ ID NO: 5 in this assay. EGFP editing assays were performed with spacer target sequences of E6 and E7.

    [0070] FIG. 6 shows a Hepatitis Delta Virus (HDV) genomic ribozyme used in exemplary gNA variants (SEQ ID NOs: 18-22, from top to bottom and left to right).

    [0071] FIGS. 7A-7I are a series of heat maps showing the effect of single amino acid substitutions, single amino acid insertions, and deletions at each amino acid position in a reference CasX protein of SEQ ID NO: 2, as described in Example 4. Data were generated by a DME assay run at 37° C. The Y-axis shows each possible substitution or insertion (from top to bottom: R, H, K, D, E, S, T, N, Q, C, G, P, A, I, L, M, F, W, Y, V; boxes indicate the amino acid identity of the reference protein), the X-axis shows the amino acid position in the reference CasX protein. Grayscale indicates log.sub.2 fold enrichment of the CasX variant protein relative to the reference CasX protein of SEQ ID NO: 2 in a DME library following enrichment. As used herein, “enrichment” is a proxy for activity, where greater enrichment is a more active molecule. (*)s indicate active sites. FIGS. 7A-7D show the effect of single amino acid substitutions. FIGS. 7E-7H show the effect of single amino acid insertions. FIG. 7I shows the effect of single amino acid deletions.

    [0072] FIGS. 8A-8C are a series of heat maps showing the effect of single amino acid substitutions, single amino acid insertions and deletions at each amino acid position in a reference CasX protein of SEQ ID NO: 2, as described in Example 4. Data were generated by a DME assay run at 45° C. FIG. 8A shows the effect of single amino acid substitutions. FIG. 8B shows the effect of single amino acid insertions. FIG. 8C shows the effect of single amino acid deletions. For all of FIGS. 8A-8C, The Y-axis shows each possible substitution or insertion (from top to bottom: R, H, K, D, E, S, T, N, Q, C, G, P, A, 1, L, M, F, W, Y, V; boxes indicate the amino acid identity of the reference protein), the X-axis shows the amino acid position in the reference CasX protein. Grayscale indicates log.sub.2 fold enrichment of the CasX variant protein relative to the reference CasX protein of SEQ ID NO: 2 in a DME library following enrichment. Enrichment may be thought of as a proxy for activity, where greater enrichment is a more active molecule. (*)s indicate active sites. Running this assay at 45° C. enriches for different variants than running the same assay at 37° C. (see FIGS. 7A-7I), thereby indicating which amino acid residues and changes are important for thermostability and folding.

    [0073] FIG. 9 shows a survey of the comprehensive mutational landscape of all single mutations of a reference CasX protein of SEQ ID NO: 2, as described in Example 4. On the Y-axis, fold enrichment of CasX variants relative to the reference CasX protein for single substitutions (top), single insertions (middle) or single deletions (bottom). On the X-axis, amino acid position in the reference CasX protein. Key regions that yield improved CasX variants are the initial helix region and regions in the RuvC domain bordering the target strand loading (TLS) domain, as well as others.

    [0074] FIG. 10 is a plot showing that the evaluated CasX variant proteins improved editing greater than three-fold relative to a reference CasX protein in the EGFP disruption assay, as described in Example 5. CasX proteins were tested for their ability to cleave an EGFP reporter at 2 different target sites in human HEK293 cells, and the normalized improvement in genome editing at these sites over the basic reference CasX protein of SEQ ID NO: 2 is shown. Variants, from left to right (indicated by the amino acid substitution, insertion or deletion at the given residue number) are: Y789T, [P793], Y789D, T72S, I546V, E552A, A636D, F536S, A708K, Y797L, L792G, A739V, G791M, {circumflex over ( )}G661, A788W, K390R, A751S, E385A, {circumflex over ( )}P696, {circumflex over ( )}M773, G695H, {circumflex over ( )}AS793, {circumflex over ( )}AS795, C477R, C477K, C479A, C479L, I55F, K210R, C233S, D231N, Q338E, Q338R, L379R, K390R, L481Q, F495S, D600N, T886K, A739V, K460N, I199F, G492P, T1531, R591I, {circumflex over ( )}AS795, {circumflex over ( )}AS796, {circumflex over ( )}L889, E121D, S270W, E712Q, K942Q, E552K, K25Q, N47D, {circumflex over ( )}T696, L685I, N880D, Q102R, M734K, A724S, T704K, P224K, K25R, M29E, H152D, S219R, E475K, G226R, A377K, E480K, K416E, H164R, K767R, I7F, M29R, H435R, E385Q, E385K, I279F, D489S, D732N, A739T, W885R, E53K, A238T, P283Q, E292K, Q628E, R388Q, G791M, L792K, L792E, M779N, G27D, K955R, S867R, R693I, F189Y, V635M, F399L, E498K, E386S, V254G, P793S, K188E, QT945KI, T620P, T946P, TT949PP, N952T, K682E, K975R, L212P, E292R, 1303K, C349E, E385P, E386N, D387K, L404K, E466H, C477Q, C477H, C479A, D659H, T806V, K808S, {circumflex over ( )}AS797, V959M, K975Q, W974G, A708Q, V711K, D733T, L742W, V747K, F755M, M771A, M771Q, W782Q, G791F, L792D, L792K, P793Q, P793G, Q804A, Y966N, Y723N, Y857R, S890R, S932M, L897M, R624G, S603G, N737S, L307K, I658V {circumflex over ( )}PT688, {circumflex over ( )}SA794, S877R, N580T, V335G, T620S, W345G, T280S, L406P, A612D, A751S, E386R, V351M, K210N, D40A, E773G, H207L, T62A, T287P, T832A, A893S, {circumflex over ( )}V14, {circumflex over ( )}AG13, R11V, R12N, R13H, {circumflex over ( )}Y13, R12L, {circumflex over ( )}Q13,V15S, {circumflex over ( )}D17. {circumflex over ( )} indicate insertions, [ ] indicate deletions.

    [0075] FIG. 11 is a plot showing individual beneficial mutations can be combined (sometimes referred to as “stacked”) for even greater improvements in gene editing activity, as described in Example 5. CasX proteins were tested for their ability to cleave at 2 different target sites in human HEK293 cells using the E6 and E7 spacers targeting an EGFP reporter, as described in Example 5. The variants, from left to right, are: S794R+Y797L, K416E+A708K, A708K+[P793], [P793]+P793AS, Q367K+I425S, A708K+[P793]+A793V, Q338R+A339E, Q338R+A339K, S507G+G508R, L379R+A708K+[P793], C477K+A708K+[P793], L379R+C477K+A708K+[P793], L379R+A708K+[P793]+A739V, C477K+A708K+[P793]+A739V, L379R+C477K+A708K+[P793]+A739V, L379R+A708K+[P793]+M779N, L379R+A708K+[P793]+M771N, L379R+A708K+[P793]+D489S, L379R+A708K+[P793]+A739T, L379R+A708K+[P793]+D732N, L379R+A708K+[P793]+G791M, L379R+A708K+[P793]+Y797L, L379R+C477K+A708K+[P793]+M779N, L379R+C477K+A708K+[P793]+M771N, L379R+C477K+A708K+[P793]+D489S, L379R+C477K+A708K+[P793]+A739T, L379R+C477K+A708K+[P793]+D732N, L379R+C477K+A708K+[P793]+G791M, L379R+C477K+A708K+[P793]+Y797L, L379R+C477K+A708K+[P793]+T620P, A708K+[P793]+E386S, E386R+F399L+[P793] and R4581I+A739V of the reference CasX protein of SEQ ID NO: 2. [ ] refer to deleted amino acid residues at the specified position of SEQ ID NO: 2.

    [0076] FIGS. 12A-12B are a pair of plots showing that CasX protein and sgNA variants when combined, can improve activity more than 6-fold relative to a reference sgRNA and reference CasX protein pair. sgNA:protein pairs were assayed for their ability to cleave a GFP reporter in HEK293 cells, as described in Example 5. On the Y-axis, the fraction of cells in which expression of the GFP reporter was disrupted by CasX mediated gene editing are shown. FIG. 12A shows CasX protein and sgNAs that were assayed with the E6 spacer targeting GFP. FIG. 12B shows CasX protein and sgNAs that were assayed with the E7 spacer targeting GFP. iGFP stands for “inducible GFP.”

    [0077] FIGS. 13A-13C show that making and screening DME libraries has allowed for generation and identification of variants that exhibit a 1 to 81-fold improvement in editing efficiency, as described in Examples 1 and 3. FIG. 13A shows an RFP+ and GFP+ reporter in E. coli cells assayed for CRISPR interference repression of GFP with a reference nuclease dead CasX protein and sgNA. FIG. 13B shows the same reporter cells assayed for GFP repression with nuclease dead CasX variants screened from a DME library. FIG. 13C shows improved editing efficiency of a selected CasX protein and sgNA variant compared to the reference with 5 spacers targeting the endogenous B2M locus in HEK 293 human cells. The Y axis shows disruption in B2M staining by HLA1 antibody indicating gene disruption via CasX editing and indel formation. The improved CasX variants improved editing of this locus up to 81-fold over the reference in the case of guide spacer #43. CasX pairs with the reference sgRNA: protein pair of SEQ ID NO: 5 and SEQ ID NO: 2; and CasX variant protein of L379R+A708K+[P793] of SEQ ID NO: 2, assayed with the sgNA variant with a truncated stem loop and a T10C substitution, which is encoded by a sequence of TACTGGCGCCTTTATCTCATTACTTTGAGAGCCATCACCAGCGACTATGTCGTATGG GTAAAGCGCTTACGGACTTCGGTCCGTAAGAAGCATCAAAG (SEQ ID 23), are shown. The following spacer sequences were used: #9: GTGTAGTACAAGAGATAGAA (SEQ ID NO: 24); #14: TGAAGCTGACAGCATTCGGG (SEQ ID NO: 25), #20: tagATCGAGACATGTAAGCA (SEQ ID NO: 26); #37: GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 27) and #43: AGGCCAGAAAGAGAGAGTAG (SEQ ID NO: 28).

    [0078] FIGS. 14A-14F are a series of structural models of a prototypic CasX protein showing the location of mutations in CasX variant proteins of the disclosure which exhibit improved activity, as described in Example 14. FIG. 14A shows a deletion of P at 793 of SEQ ID NO: 2, with a deletion in a loop that may affect folding. FIG. 14B shows a replacement of Alanine (A) by Lysine (K) at position 708 of SEQ ID NO: 2. This mutation is facing the gNA 5′ end plus a salt bridge to the gNA. FIG. 14C shows a replacement of Cysteine (C) by Lysine (K) at position 477 of SEQ ID NO: 2. This mutation is facing the gNA. There is salt bridge to the gNAbb (gNA phosphase backbone) at approximately base 14 that may be affected. This mutation removes a surface exposed cysteine. FIG. 14D shows a replacement of Leucine (L) with Arginine (R) at position 379 of SEQ ID NO: 2. There is a salt bridge to the target DNAbb (DNA phosphate backbone) towards base pairs 22-23 that may be affected. FIG. 14E shows one view of a combination of the deletion of P at 793 and the A708K substitution. FIG. 14F shows an alternate view, that shows that the effects of individual mutants are additive and single mutants can be combined (stacked) for even greater improvements. Arrows indicate the locations of mutations in FIGS. 14E-14F.

    [0079] FIG. 15 is a plot showing the identification of optimal Planctomycetes CasX PAM and spacers for genes of interest, as described in Example 19. On the Y-axis, percent GFP negative cells, indicating cleavage of a GFP reporter, is shown. On the X-axis, different PAM sequences and spacers: ATC PAM, CTC PAM and TTC PAM. GTC, TTT and CTT PAMs were also tested and showed no activity.

    [0080] FIG. 16 is a plot showing that improved CasX variants generated by DME edit both canonical and non-canonical PAMs more efficiently than reference CasX proteins, as described in Example 19. The Y-axis shows the average fold improvement in editing relative to a reference sgRNA: protein pair (SEQ ID NO:2, SEQ ID NO: 5) with 2 targets, N=6. Protein variants, from left to right for each set of bars were: A708K+[P793]+A739V; L379R+A708K+[P793]; C477K+A708K+[P793]; L379R+C477K+A708K+[P793]; L379R+A708K+[P793]+A739V; C477K+A708K+[P793]+A739V; and L379R+C477K+A708K+[P793]+A739V. Reference CasX and protein variants were assayed with a reference sgRNA scaffold of SEQ ID NO: 5 with DNA encoding spacer sequences of, from left to right, E6 (TGTGGTCGGGGTAGCGGCTG; SEQ ID NO: 29) with a TTC PAM; E7 (TCAAGTCCGCCATGCCCGAA; SEQ ID NO: 30) with a TTC PAM; GFP8 (CCAGGGTGTCGCCCTCGAAC; SEQ ID NO: 31) with a TTC PAM; B1 (TGACCACCCTGACCTACGGC; SEQ ID NO: 32) with a CTC PAM and A7 (TGGGGCACAAGCTGGAGTAC; SEQ ID NO: 33) with an ATC PAM.

    [0081] FIGS. 17A-17F are a series of plots showing that a reference CasX protein and a reference sgRNA scaffold pair is highly specific for the target sequence, as described in Example 14. FIG. 17A and FIG. 17D, Streptococcus pyogenes Cas9 (SpyCas9) was assayed with two different gNA spacers and a 5′ PAM site (SEQ ID NOs: 34-65) and (SEQ ID NOs: 136-166) for its ability to edit templates with a target sequence complementary to the spacer sequence (arrow), or with 1, 2, 3 or 4 mutations in the target sequence relative to the spacer sequence. FIG. 17B and FIG. 17E, Staphylococcus aureus Cas9 (SauCas9) was assayed with two different gNA spacers and a 5′ PAM site (SEQ ID NOs: 66-103) and (SEQ ID NOs: 167-204) for its ability to edit templates with a target sequence complementary to the spacer sequence (arrow), or with 1, 2, 3 or 4 mutations in the target sequence relative to the spacer sequence. FIG. 17C and FIG. 17F, the reference Plm CasX protein and sgNA scaffold pair was assayed with two different gNA spacers and a 3′ PAM site (SEQ ID NOs: 104-135) and (SEQ ID NOs: 205-236) for its ability to edit templates with a target sequence complementary to the spacer sequence (arrow), or with 1, 2, 3 or 4 mutations in the target sequence relative to the spacer sequence. In all of FIG. 17A-17F, the X-axis shows the fraction of cells where gene editing at the target sequence occurred.

    [0082] FIG. 18 illustrates a scaffold stem loop of an exemplary reference sgRNA of the disclosure (SEQ ID NO: 237).

    [0083] FIG. 19 illustrates an extended stem loop sequence of an exemplary reference sgRNA of the disclosure (SEQ ID NO: 238).

    [0084] FIGS. 20A-20B are a pair of plots that demonstrate that specific subsets of changes discovered by DME of the CasX are more likely to predict improvements of activity, as described in Example 16. The plots represent data from the experiments described in FIGS. 7A-7I and FIGS. 8A-8C. FIG. 20A shows that changing amino acids within a distance of 10 Angstroms (A) of the guide RNA to hydrophobic residues (A, V, I, L, M, F, Y, W) results in a significantly less active protein. FIG. 20B demonstrates that, in contrast, changing a residue within 10 A of the RNA to a positively charged amino acid (R, H, K) is likely to improve activity.

    [0085] FIG. 21 illustrates an alignment of two reference CasX protein sequences (SEQ ID NO: 1, top; SEQ ID NO: 2, bottom), with domains annotated.

    [0086] FIG. 22 illustrates the domain organization of a reference CasX protein of SEQ ID NO: 1. The domains have the following coordinates: non-target strand binding (NTSB) domain: amino acids 101-191; Helical I domain: amino acids 57-100 and 192-332; Helical II domain: 333-509; oligonucleotide binding domain (OBD): amino acids 1-56 and 510-660; RuvC DNA cleavage domain (RuvC): amino acids 551-824 and 935-986; target strand loading (TSL) domain: amino acids 825-934. Not that the Helical I, OBD and RuvC domains are non-contiguous.

    [0087] FIG. 23 illustrates an alignment of two CasX reference sgRNA scaffolds SEQ ID NO: 5 (top) and SEQ ID NO: 4 (bottom).

    [0088] FIG. 24 is a graph of the results of an assay for the quantification of active fractions of RNP formed by sgRNA174 and the CasX variants 119 and 457, as described in Example 12. Equimolar amounts of RNP and target were co-incubated and the amount of cleaved target was determined at the indicated timepoints. Mean and standard deviation of three independent replicates are shown for each timepoint. The biphasic fit of the combined replicates is shown. “2” refers to the reference CasX protein of SEQ ID NO: 2.

    [0089] FIG. 25 is a graph of the results of an assay for quantification of active fractions of RNP formed by CasX2 and reference guide 2, and the modified sgRNA guides 32, 64, and 174, as described in Example 12. Equimolar amounts of RNP and target were co-incubated and the amount of cleaved target was determined at the indicated timepoints. Mean and standard deviation of three independent replicates are shown for each timepoint. The biphasic fit of the combined replicates is shown. “2” refers to reference gRNAs SEQ ID NO: 5, respectively, and the identifying number of modified sgRNAs are indicated in Table 3.

    [0090] FIG. 26 is a graph of the results of an assay for quantification of cleavage rates of RNP formed by sgRNA174 and the CasX variants 119 and 457, as described in Example 12. Target DNA was incubated with a 20-fold excess of the indicated RNP and the amount of cleaved target was determined at the indicated time points. Mean and standard deviation of three independent replicates are shown for each timepoint. The monophasic fit of the combined replicates is shown.

    [0091] FIG. 27 is a graph of the results of an assay for quantification of cleavage rates of RNP formed by CasX2 and the sgRNA guide variants 2, 32, 64 and 174, as described in Example 12. Target DNA was incubated with a 20-fold excess of the indicated RNP and the amount of cleaved target was determined at the indicated time points. Mean and standard deviation of three independent replicates are shown for each timepoint. The monophasic fit of the combined replicates is shown.

    [0092] FIG. 28 is a graph of the results of an assay for quantification of initial velocities of RNP formed by CasX2 and the sgRNA guide variants 2, 32, 64 and 174, as described in Example 12. The first two time-points of the previous cleavage experiment were fit with a linear model to determine the initial cleavage velocity.

    [0093] FIG. 29 shows the results of an editing assay of 6 target genes in HEK293T cells, as described in Example 15. Each dot represents results using an individual spacer.

    [0094] FIG. 30 shows the results of an editing assay of 6 target genes in HEK293T cells, with individual bars representing the results obtained with individual spacers, as described in Example 15.

    [0095] FIG. 31 shows the results of an editing assay of 4 target genes in HEK293T cells, as described in Example 15. Each dot represents results using an individual spacer utilizing a CTC PAM.

    [0096] FIG. 32 is a schematics showing the steps of Deep Mutational Evolution used to create libraries of genes encoding CasX variants, as described in Example 16. The pSTX1 backbone is minimal, composed of only a high-copy number origin and KanR resistance gene, making it compatible with the recombineering E. coli strain EcNR2. pSTX2 is a BsmbI destination plasmid for aTc-inducible expression in E. coli.

    [0097] FIG. 33 are dot plot graphs showing the results of CRISPRi screens for mutations in libraries D1, D2, and D3, as described in Example 16. In the absence of CRISPRi, E. coli constitutively express both GFP and RFP, resulting in intense fluorescence in both wavelengths, represented by dots in the upper-right region of the plot. CasX proteins resulting in CRISPRi of GFP can reduce green fluorescence by >10-fold, while leaving red fluorescence unaltered, and these cells fall within the indicated Sort Gate 1. The total fraction of cells exhibiting CRISPRi is indicated.

    [0098] FIG. 34 are photographs of colonies grown in the ccdB assay, as described in Example 16. 10-fold dilutions were assayed in the presence of glucose or arabinose to induce expression of the ccdB toxin, resulting in approximately a 1000-fold difference between functional and nonfunctional proteins. When grown in liquid culture, the resolving power was approximately 10,000-fold, as seen on the right-hand side.

    [0099] FIG. 35 is a graph of HEK iGFP genome editing efficiency testing CasX variants with sgRNA 2 (SEQ ID NO: 5), with appropriate spacers, with data expressed as fold-improvement over the wild-type CasX protein (SEQ ID NO: 2) in the HEK iGFP editing assay, as described in Example 16. Single mutations are shown at the top, with groups of mutations shown at the bottom of the graph. Error bars combine internal measurement error (SD) and inter-experimental measurement error (SD across replicate experiments for those variants tested more than once), in at least triplicate assays.

    [0100] FIG. 36 is a scatterplot showing results of the SOD1-GFP reporter assay for CasX variants with sgRNA scaffold 2 utilizing two different spacers for GFP, as described in Example 16.

    [0101] FIG. 37 is a graph showing the results of the HEK293 iGFP genome editing assay assessing editing across four different PAM sequences comparing wild-type CasX (SEQ ID NO:2) and CasX variant 119; both utilizing sgRNA scaffold 1 (SEQ ID NO:4), with spacers utilizing four different PAM sequences, as described in Example 16.

    [0102] FIG. 38 is a graph showing the results of genome editing activity of CasX variant 119 and sgRNA 174 compared to wild-type CasX 2 and guide scaffold 1 in the iGFP lipofection assay utilizing two different spacers, as described in Example 16.

    [0103] FIG. 39 is a graph showing the results of genome editing activity of CasX variant 119 and sgRNA 174 compared to wild-type CasX and guide in the iGFP lentiviral transduction assay, as described in Example 16.

    [0104] FIG. 40 is a graph showing the results of genome editing in the more stringent lentiviral assay to compare the editing activity of four CasX variants (119, 438, 488 and 491) and the optimized sgNA 174 and two different spacers, as described in Example 16. The results show the step-wise improvement in editing efficiency achieved by the additional modifications and domain swaps introduced to the starting-point 119 variant.

    [0105] FIGS. 41A-41B show the results of NGS analyses of the libraries of sgRNA, as described in Example 17. FIG. 41A shows the distribution of substitutions, deletions and insertions. FIG. 41B is a scatterplot showing the high reproducibility of variant representation in two separate library pools after the CRISPRi assay in the unsorted, naive population of cells. (Library pool D3 vs D2 are two different versions of the dCasX protein, and represent replicates of the CRISPRi assay.)

    [0106] FIGS. 42A-42B shows the structure of wild-type CasX and RNA guide (SEQ ID NO:4). FIG. 42A depicts the CryoEM structure of Deltaproteobacteria CasX protein:sgRNA RNP complex (PDB id: 6YN2), including two stem loops, a pseudoknot, and a triplex. FIG. 42B depicts the secondary structure of the sgRNA was identified from the structure shown in (A) using the tool RNAPDBee 2.0 (rnapdbee.cs.put.poznan.pl/, using the tools 3DNA/DSSR, and using the VARNA visualization tool). RNA regions are indicated. Residues that were not evident in the PDB crystal structure file are indicated by plain-text letters (i.e., not encircled), and are not included in residue numbering.

    [0107] FIGS. 43A-43C depicts comparisons between two guide RNA scaffolds. FIG. 43A provides the sequence alignment between the single guide scaffold 1 (SEQ ID NO:4) and scaffold 2 (SEQ ID NO:5). FIG. 43B shows the predicted secondary structure of scaffold 1 (without the 5′ ACAUCU bases which were not in the cryoEM structure). Prediction was done using RNAfold (v 2.1.7), using a constraint that was derived from the base-pairing observed in the cryoEM structure (see FIG. 42A-42B). This constraint required the base pairs observed in the cryoEM structure to be formed, and required the bases involved in triplex formation to be unpaired. This structure has distinct base pairing from the lowest-energy predicted structure at the 5′ end (i.e., the pseudoknot and triplex loop). FIG. 43C shows the predicted secondary structure of scaffold 2. Prediction was done for scaffold 1, using a similar constraint based on the sequence alignment.

    [0108] FIG. 44 shows a graph comparing GFP-knockdown capability of scaffold 1 versus scaffold 2 in GFP-lipofection assay, using four different spacers utilizing different PAM sequences, as described in Example 17. The results demonstrate the greater editing imparted by use of the modified scaffold 2 compared to the wild-type scaffold 1; the latter showing no editing with spacers utilizing GTC and CTC PAM sequences.

    [0109] FIGS. 45A-45C show graphs depicting the enrichment of single variants across the scaffold, revealing mutable regions, as described in Example 17. FIG. 45A depicts substituted bases (A, T, G, or C; top to bottom), FIG. 45B depicts inserted bases (A, T, G, or C; top to bottom), and FIG. 45C depicts deletions at the individual nucleotide position (X-axis) across scaffold 2. Enrichment values were averaged across the three deadCasX versions, relative to the average WT value. Scaffolds with relative log2 enrichment >0 are considered ‘enriched’, as they were more represented in the sorted population relative to the naive population than the wildtype scaffold was represented. Error bars represent the confidence interval across the three catalytically dead CasX experiments.

    [0110] FIG. 46 are scatterplots showing that the enrichment values obtained across different dCasX variants are largely consistent, as described in Example 17. Libraries D2 and DDD have highly correlated enrichment scores, while D3 is more distinct.

    [0111] FIG. 47 shows a bar graph of cleavage activity of several scaffold variants in a more stringent lipofection assay at the SOD1-GFP locus, as described in Example 17.

    [0112] FIG. 48 shows a bar graph of cleavage activity for several scaffold variants using two different spacers; 8.2 and 8.4 that target SOD1-GFP locus (and a non-targeting spacer NT), with low-MOI lentiviral transduction using a p34 plasmid backbone, as described in Example 15.

    [0113] FIG. 49 is a schematic showing the secondary structure of single guide 174 on top and the linear structure on the bottom, with lines joining those segments associating by base-pairing or other non-covalent interactions. The scaffold stem (white, no fill) (and loop) and the extended stem (grey, no fill) (and loop) are adjacent from 5′ to 3′ in the sequence. However, the pseudoknot and extended stems are formed from strands that have intervening regions in the sequence. The triplex is formed, in the case of single guide 174, comprising nucleotides 5′-CUUUG′-3′ AND 5′-CAAAG-3′ that form a base-paired duplex and nucleotides 5′-UUU-3′ that associates with the 5′-AAA-3′ to form the triplex region.

    [0114] FIGS. 50A-50B shows comparisons between the highly-evolved single guide 174 and the scaffolds 1 and 2 that served as the starting points for the DME procedures described in Example 17. FIG. 50A shows a bar graph of cleavage activity of head-to-head comparisons of cleavage activity of the guide scaffolds with five different spacers in a plasmid lipofection assay at the GFP locus in HEK-GFP cells. FIG. 50B shows the sequence alignment between scaffold 2 and guide 174 (SEQ ID NO: 2238). Asterisks indicate point mutations, and the dotted box shows the entire extended stem swap.

    [0115] FIGS. 51A-51B shows scatterplots of HEK-iGFP cleavage assay for scaffolds sequences relative to WT scaffold with 2 spacers; 4.76 (FIG. 51A) and 4.77 (FIG. 51B), as described in Example 17.

    [0116] FIG. 52 shows a scatterplot comparing the normalized cleavage activity of several scaffolds relative to WT with 2 spacers (4.76 and 4.77), as described in Example 17. Error bars combine internal measurement error (SD) and inter-experimental measurement error (SD across replicate experiments for those variants tested more than once), in quadrature.

    [0117] FIG. 53 shows a scatterplot comparing the normalized cleavage activity of multiple scaffolds relative to WT in the HEK-iGFP cleavage assay to the enrichments obtained from the CRISPRi comprehensive screen, as described in Example 17. Generally, scaffold mutations with high enrichment (>1.5) have cleavage activity comparable to or greater than WT. Two variants have high cleavage activity with low enrichment scores (C18G and T17G); interestingly, these substitutions are at the same position as several highly enriched insertions (FIGS. 45A-45C). Labels indicate the mutations for a subset of the comparisons.

    DETAILED DESCRIPTION

    [0118] While exemplary embodiments have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the inventions claimed herein. It should be understood that various alternatives to the embodiments described herein may be employed in practicing the embodiments of the disclosure. It is intended that the claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

    [0119] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

    I. General Methods

    [0120] The practice of the present invention employs, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., HaRBor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (1. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures of which are incorporated herein by reference.

    [0121] Where a range of values is provided, it is understood that endpoints are included and that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included.

    [0122] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.

    [0123] It must be noted that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise.

    [0124] It will be appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. In other cases, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. It is intended that all combinations of the embodiments pertaining to the disclosure are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.

    II. DME Methods for Generation of Improved Gene Editing Molecules

    [0125] Provided herein are methods of generating and selecting improved biomolecule variants, such as RNA, DNA, or protein variants, through Deep Mutational Evolution (DME). Also provided are the biomolecule variants selected from said methods, and libraries of variants which may be used in said methods.

    [0126] In some embodiments, the methods, variants, and libraries described herein may include insertions and/or deletions, in addition to substitution mutations. In some embodiments, the DME methods provided herein include constructing and screening one or more libraries representing a comprehensive set of mutations of a biomolecule, e.g. encompassing all possible substitutions, as well as insertions and deletions of one or more amino acids (in the case of proteins), or one or more ribonucleotides (in the case of RNA), or one or more deoxyribonucleotides (in the case of DNA). In other embodiments, a subset of such mutations is screened. In some embodiments, screening of one or more libraries of biomolecule variants is used to obtain information about how certain mutations (such as insertion and/or deletion and/or substitution, or combinations thereof) or the mutation to certain regions of a reference biomolecule affects the functional properties of said biomolecule, or affect the functional properties of a protein encoded by said biomolecule. In some embodiments, modifications resulting in one or more improved characteristics are then combined in one or more additional rounds of biomolecule modification, either through rational design or randomly, and these second round variants are screened to identify desirable characteristics. Additional libraries may be constructed and screened using information obtained from the previous library, and through such iterative processes, in some embodiments, one or more biomolecule variants are selected. Thus, for example, in some embodiments the methods provided herein comprise a second, third, fourth, fifth, or more rounds of variant construction and screening. In certain embodiments, such biomolecule variants may have one or more improved characteristics, which are described in greater detail herein. In still other embodiments, such biomolecule variants may encode for a protein with one or more improved characteristics, which are described in greater detail herein. Such iterative construction and evaluation of variants may lead, for example, to identification of mutational themes that lead to certain functional outcomes, such as identification of types of mutations or of regions of the protein or RNA that when mutated in a certain way lead to one or more improved or altered functions. Layering of such identified mutations may then further improve function, for example through additive or synergistic interactions. The use of iterative rounds of biomolecule evolution may progressively improve/alter one or more functional characteristics of the variant biomolecules, resulting in a highly functional protein, RNA, or DNA variant that is specialized for a desired application.

    [0127] In some embodiments, these methods include constructing a library comprising a plurality of variants of a reference biomolecule, wherein each variant independently has an alteration of at least one monomer location (e.g., ribonucleotide for RNA, or amino acid for protein, or deoxyribonucleotide for DNA), and wherein the alterations can independently include insertion of one or more monomers, deletion of one or more monomers, or substitution of the monomer. In some embodiments, the library collectively represents alteration of at least 1%, or at least 10%, or up to 100%, of the monomer locations of the reference biomolecule. This may include, for example, libraries wherein each variant only has one alteration of one monomer location, but collectively the library represents alteration of at least 1%, or at least 10%, or up to 100%, of the monomer locations of the reference biomolecule. In certain embodiments, the library collectively represents each possible alteration of at least 1%, or at least 10%, or up to 100%, of the monomer locations of the reference biomolecule.

    [0128] I. Libraries

    [0129] Provided herein are methods and systems for developing variants of biomolecules, such as proteins, RNA, and DNA, that include evaluating insertions and deletions of monomers in addition to substitutions. Such methods include constructing one or more libraries of variants of a reference biomolecule, and evaluating said libraries for change in one or more characteristics of the variants compared to the reference biomolecule. Such information can be used, for example to construct one or more additional variants and/or libraries, such as by layering mutations with a desired effect on certain characteristics, or by selecting a subset of the initial library and subjecting it to a round of random mutation, or by taking information learned from screening of a library and using it to construct a new variant with additional alterations. In some embodiments, an iterative process of library construction, evaluation, and new library construction is used.

    [0130] Proteins, RNA, and DNA are polymers composed of amino acid, ribonucleotide, and deoxyribonucleotide monomers, respectively. For each monomer location, there are three types of variations possible: l) substitution of the original monomer for another monomer; 2) insertion of one or more consecutive monomers; and 3) deletion of one or more consecutive monomers. DME libraries comprising substitutions, insertions, and deletions, alone or in combination, to any one or more monomers within any biomolecule described herein, are considered within the scope of the invention.

    [0131] The complexity of variations is further increased when taking into account the number of different monomers that can be used in substitution or each single insertion—20 different naturally occurring amino acids for proteins, and 4 naturally occurring nucleotides for RNA and DNA. Therefore, with respect to naturally occurring amino acids and naturally occurring ribonucleotides, the number of possible alterations per monomer location for a protein includes: 19 possible monomer (amino acid) substitutions, 20 possible monomer insertions (per single insertion), 1 possible monomer deletion (per single deletion). The number of possible alterations per monomer location for RNA or DNA includes: 3 possible monomer (nucleotide) substitutions, 4 possible monomer insertions (per single insertion), 1 possible monomer deletion (per single deletion).

    [0132] A library used in the methods described herein may, in some embodiments, comprise substitutions, insertions, and deletions, alone or in combination, to one or more monomers within any biomolecule described herein. In some embodiments of the methods, every possible single alteration of every monomer is evaluated. For example, in some embodiments one or more libraries of variants are constructed and evaluated, wherein each variant independently comprises a single alteration compared to the reference biomolecule, and the one or more libraries collectively represent every possible single alteration of every monomer location. In some embodiments, insertion of two or more monomers at every monomer location is evaluated, or deletion of two or more monomers at very monomer location is evaluated, or a combination thereof. For example, for a reference protein of 1000 residues, there are 1000 possible single amino acid deletions, 1.9*10{circumflex over ( )}4 possible amino acid substitutions, and 2*10{circumflex over ( )}4 possible single amino acid insertions. For double amino acid insertions, there are 4*10{circumflex over ( )}5 possible variants; likewise, triples have 8*10{circumflex over ( )}6 variants and so forth. In some embodiments, one or more libraries are built to evaluate the comprehensive set of mutations to a biomolecule, encompassing all possible substitutions, as well as insertions and deletions of, for example, between 1 to 4 amino acids (in the case of proteins) or nucleotides (in the case of RNA or DNA). In some embodiments, one or more libraries are built to evaluate a subset of a comprehensive set of mutations to a biomolecule, encompassing all possible substitutions to a particular region of a biomolecule, as well as insertions and deletions to a particular region of a biomolecule of, for example, between 1 to 4 amino acids (in the case of proteins) or nucleotides (in the case of RNA or DNA).

    [0133] In some embodiments, the library comprises a subset of all possible alterations to monomers. For example, in some embodiments, a library collectively represents a single alteration of one monomer, for at least 1%, or at least 10% of the total monomer locations in a biomolecule, wherein each single alteration is selected from the group consisting of substitution, single insertion, and single deletion. In some embodiments, the library collectively represents the single alteration of one monomer, for at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or up to 100% of the total monomer locations in a starting biomolecule (e.g., each variant comprises one modified monomer, and the collection of variants represent single alteration of one monomer for at least a certain percentage of total locations). In certain embodiments, for a certain percentage of the total monomer locations in a starting biomolecule, the library collectively represents each possible single alteration of one monomer, such as all possible substitutions with the 19 other naturally occurring amino acids (for a protein) or 3 other naturally occurring ribonucleotides (for RNA) or 3 other naturally occurring deoxyribonucleotides (for DNA), insertion of each of the 20 naturally occurring amino acids (for a protein) or 4 naturally occurring ribonucleotides (for RNA) or 4 naturally occurring deoxyribonucleotides (for DNA), or deletion of the monomer. In still further embodiments, insertion at each location is independently greater than one monomer, for example insertion of two or more, three or more, or four or more monomers, or insertion of between one to four, between two to four, or between one to three monomers. In some embodiments, deletion at each location is independently greater than one monomer, for example deletion of two or more, three or more, or four or more monomers, or deletion of between one to four, between two to four, or between one to three monomers. Examples of such libraries of CasX variants and gNA variants are described in Examples 14 and 15, respectively.

    [0134] In some embodiments of the methods and compositions provided herein, the monomers used in substitution and/or insertion are naturally occurring monomers (e.g., the 20 naturally occurring standard amino acids; the 4 ribonucleotides A, U, C, and G; and the 4 deoxyribonucleotides A, T, C, and G). In other embodiments, one or more unnatural monomers is used. Such monomers may include, for example, chemically- or enzymatically-modified monomers, chemically synthesized monomers, monomers obtained commercially, or others. In some embodiments, one or more naturally occurring monomers is modified after being incorporated into a variant. For example, in some embodiments, a protein variant is constructed and then one or more amino acid residues of the protein variant are chemically or enzymatically modified to produce the protein variant to be screened. In other embodiments, an unnatural monomer is incorporated into the variant as-is. For example, in certain embodiments one or more RNA or DNA variants are constructed using unnatural nucleotides, which may be obtained commercially or synthesized through techniques known to one of skill in the art.

    [0135] In some embodiments, the biomolecule is a protein and the individual monomers are amino acids. In those embodiments where the biomolecule is a protein, the number of possible mutations at each monomer (amino acid) position in the protein comprises 19 naturally occurring amino acid substitutions, 20 naturally occurring amino acid insertions and 1 amino acid deletion, leading to a total of 40 possible mutations per amino acid in the protein. In some embodiments, one or more variants comprises substitution of more than one amino acid monomers, wherein each monomer location is independently selected. Thus, for example, in some embodiments a library comprises one or more variants wherein two or more consecutive amino acids are independently substituted. In some embodiments, wherein the library comprises variants independently comprising one or more substitutions, each substitution is a conservative substitution. A conservative substitution replaces the original amino acid with an amino acid that has a similar characteristic. For example, if the original amino acid is glycine, a conservative substitution may be one that replaces the glycine with another aliphatic amino acid, such as alanine, valine, leucine, or isoleucine. If the amino acid is phenylalanine, a conservative substitution may be one that replaces the phenylalanine with another aromatic amino acid, such as tyrosine or tryptophan. In other embodiments of, wherein the library comprises variants independently comprising one or more substitutions, each substitution is a non-conservative substitution (e.g., a substitution with an amino acid that has a different characteristic). In some embodiments, conservative substitution of an amino acid may cause the variant to retain one or more desirable characteristics at that location (e.g., polarity, or charge, or hydrophobic interactions, or another characteristic) while still providing the variability that may lead to one or more improved characteristics of the variant overall. For example, a non-conservative substitution of the original amino acid glycine may be with a charged amino acid, or an aromatic amino acid, or a cyclic amino acid. In still further embodiments, wherein the library comprises variants independently comprising one or more substitutions, each substitution is independently a non-conservative substitution or a conservative substitution.

    [0136] In other embodiments, the biomolecule is RNA and the individual monomers are ribonucleotides. In those embodiments where the biomolecule is RNA, the number of possible mutations at each monomer (ribonucleotide) position in the RNA comprises 3 naturally occurring ribonucleotide substitutions, 4 naturally occurring ribonucleotide insertions, and 1 naturally occurring ribonucleotide deletion, leading to a total of 8 possible mutations per ribonucleotide in the RNA. In some embodiments, one or more variants comprises substitution of more than one ribonucleotide monomers, wherein each monomer location is independently selected. Thus, for example, in some embodiments a library comprises one or more variants wherein two or more consecutive ribonucleotides are independently substituted.

    [0137] In still further embodiments, the biomolecule is DNA and the individual monomers are deoxyribonucleotides. In those embodiments where the biomolecule is DNA, the number of possible mutations at each monomer (deoxyribonucleotide) position in the DNA comprises 3 naturally occurring deoxyribonucleotide substitutions, 4 naturally occurring deoxyribonucleotide insertions, and 1 naturally occurring deoxyribonucleotide deletion, leading to a total of 8 possible mutations per deoxyribonucleotide in the DNA. In some embodiments, one or more variants comprises substitution of more than one deoxyribonucleotide monomers, wherein each monomer location is independently selected. Thus, for example, in some embodiments a library comprises one or more variants wherein two or more consecutive deoxyribonucleotides are independently substituted.

    [0138] In some embodiments, a library of protein variants comprising insertions is a 1 amino acid insertion library, a 2 amino acid insertion library, a 3 amino acid insertion library, a 4 amino acid insertion library, a 5 amino acid insertion library, a 6 amino acid insertion library, a 7 amino acid insertion library, or an 8 amino acid insertion library. In some embodiments, a protein variant library comprises insertions wherein each insertion comprises between 1 and 8 amino acids, between 1 and 7 amino acids, between 1 and 6 amino acids, between 1 and 5 amino acids, between 1 and 4 amino acids, between 1 and 3 amino acids, or 1 or 2 amino acids. In certain embodiments, the library represents insertion of, for example, independently between 1 to 4 amino acids (or 5, or 6, or more) for at least a subset of total monomer locations, such as at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, or up to 90%, or up to 100%. In some embodiments, for each inserted amino acid, the library collectively represents insertion of each of the 20 naturally occurring amino acids at that location. In certain embodiments, for each inserted amino acid, the library collectively represents insertion of at least 1 (e.g., proline scanning), at least 2 (e.g., negative charge scanning), at least 5, at least 10, or at least 15 of the 20 naturally occurring amino acids at that location. Thus, for example, in some embodiments libraries representing the full scope of possible naturally occurring insertions (including variability in the amino acid) for each insertion location are evaluated.

    [0139] In some embodiments, a library of RNA or DNA variants comprising insertions is a 1 nucleotide insertion library, a 2 nucleotide insertion library, a 3 nucleotide insertion library, a 4 nucleotide insertion library, a 5 nucleotide insertion library, a 6 nucleotide insertion library, a 7 nucleotide insertion library, an 8 nucleotide insertion library, a 9 nucleotide insertion library, a 10 nucleotide insertion library, a 11 nucleotide insertion library, a 12 nucleotide insertion library, a 13 nucleotide insertion library, a 14 nucleotide insertion library, a 15 nucleotide insertion library, a 16 nucleotide insertion library, or more. In some embodiments, an RNA or DNA variant library comprises insertions, wherein each insertion is independently between 1 and 16 nucleotides, between 1 and 14 nucleotides, between 1 and 12 nucleotides, 1 and 10 nucleotides, between 1 and 8 nucleotides, between 1 and 6 nucleotides, between 1 and 4 nucleotides, or 1 or 2 nucleotides. In certain embodiments, the library represents insertion of, for example, independently between 1 to 4 nucleotides (or 5, or 6, or 7, or 8, or up to 16) for at least a subset of total monomer locations, such as at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, or up to 90%, or up to 100%. In some embodiments, for each inserted nucleotide, the library collectively represents insertion of each of the 4 naturally occurring nucleotides at that location (e.g., the four naturally occurring ribonucleotides for RNA, or the four naturally occurring deoxyribonucleotides for DNA). In certain embodiments, for each inserted nucleotide, the library collectively represents insertion of at least 1, at least 2, at least 3, or each of 4 naturally occurring nucleotides at that location. Thus, for example, in some embodiments libraries representing the full scope of possible insertions (including variability in the nucleotide) for each insertion location are evaluated.

    [0140] In some embodiments, a library of protein variants comprising deletions is a 1 amino acid deletion library, a 2 amino acid deletion library, a 3 amino acid deletion library, a 4 amino acid deletion library, a 5 amino acid deletion library, a 6 amino acid deletion library, a 7 amino acid deletion library, or an 8 amino acid deletion library. In some embodiments, a protein variant library comprises deletions wherein each deletion is independently between 1 and 8 amino acids, between 1 and 7 amino acids, between 1 and 6 amino acids, between 1 and 5 amino acids, between 1 and 4 amino acids, between 1 and 3 amino acids, or 1 or 2 amino acids. In certain embodiments, the library represents deletions of, for example, independently between 1 to 4 amino acids (or 5, or 6, or more) for at least a subset of total monomer locations, such as at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, or up to 90%, or up to 100%.

    [0141] In some embodiments, a library of RNA or DNA variants comprising deletions is a 1 nucleotide deletion library, a 2 nucleotide deletion library, a 3 nucleotide deletion library, a 4 nucleotide deletion library, a 5 nucleotide deletion library, a 6 nucleotide deletion library, a 7 nucleotide deletions library, an 8 nucleotide deletion library, a 9 nucleotide deletion library, a 10 nucleotide deletion library, a 11 nucleotide deletion library, a 12 nucleotide deletion library, a 13 nucleotide deletion library, a 14 nucleotide deletion library, a 15 nucleotide deletion library, or a 16 nucleotide deletion library. In some embodiments, an RNA or DNA variant library comprises deletions wherein each deletion is independently between 1 and 16 nucleotides, between 1 and 14 nucleotides, between 1 and 12 nucleotides, between 1 and 10 nucleotides, between 1 and 8 nucleotides, between 1 and 6 nucleotides, between 1 and 4 nucleotides, or 1 or 2 nucleotides. In certain embodiments, the library represents deletions of, for example, independently between 1 to 4 nucleotides (or 5, or 6, or more) for at least a subset of total monomer locations, such as at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, or up to 90%, or up to 100%. In some embodiments, wherein the variants are RNA, the nucleotides are ribonucleotides. In other embodiments, wherein the variants are DNA, the nucleotides are deoxyribonucleotides.

    [0142] In some embodiments, a library of protein variants comprising substitution of at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, or up to 90%, or up to 100% of total monomer locations is evaluated. Such libraries may, in some embodiments, further comprise evaluation of variability in the amino acid used for each insertion location. In some embodiments, for each substituted amino acid, the library collectively represents substitution with each of the other 19 naturally occurring amino acids at that location. In certain embodiments, for each substituted amino acid, the library collectively represents substitution with at least 5, at least 10, or at least 15 of the other 19 naturally occurring amino acids at that location.

    [0143] In some embodiments, a library of RNA or DNA variants comprising substitution of at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, or up to 90%, or up to 100% of total monomer locations is evaluated. Such libraries may, in some embodiments, further comprise evaluation of variability in the nucleotide used for each insertion location. In some embodiments, for each substituted nucleotide, the library collectively represents substitution with each of the other 3 naturally occurring nucleotides at that location. In certain embodiments, for each substituted nucleotide, the library collectively represents substitution with at least 1, at least 2, or each of the 3 other naturally occurring nucleotides at that location.

    [0144] It should be further understood that libraries used in the methods described herein may comprise combinations of insertions, substitutions, and deletions, as described herein. Thus, a library representing each possible alteration of at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, or up to 70%, or up to 80%, or up to 90%, or up to 100% of individual monomer locations is, in some embodiments, evaluated. Furthermore, in some embodiments, alterations are layered, such that a single variant may comprise an insertion and a deletion, an insertion and a substitution, a deletion and a substitution, or each of an insertion, a deletion, and a substitution, at different locations of the biomolecule. In certain embodiments, each variant independently comprises between one to sixteen, one to fourteen, one to twelve, one to ten, one to eight, one to six, between one to five, between one to four, between one to three, between one to two, at least one, at least two, at least three, at least four, at least five, or at least six alterations independently selected from the group consisting of substitution, insertion, and deletion.

    [0145] Thus, in some embodiments, the library comprises variants each independently comprising alteration of one or more locations, wherein collectively the library represents alteration of at least 1%, at least 5%, at least 10%, at least 30%, at least 50%, at least 80%, or at least 99% of the total locations of the reference molecule. In certain embodiments, the library comprises variants each independently comprising alteration of two or more locations, three or more locations, four or more locations, between one and ten locations, between one and eight locations, between one and six locations, or between one and four locations; wherein collectively the library represents alteration of at least 1%, at least 5%, at least 10%, at least 30%, at least 50%, at least 80%, or at least 99% of the total locations of the reference molecule.

    [0146] In some embodiments, a reference biomolecule can have at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100 or more monomers that are systematically mutated to produce a library of biomolecule variants. In some embodiments, every monomer in a biomolecule is varied independently. For example, wherein the biomolecule is a protein with two target amino acids, a library design may enumerate the 40 possible mutations at each of the two target amino acids.

    [0147] In some embodiments, each varied monomer of a biomolecule is independently randomly selected; in other embodiments, each varied monomer of a biomolecule is selected by intentional design, or by previous random mutations that had desired characteristics. Thus, in some embodiments, a library comprises random variants, variants that were designed, variants comprising random mutations and designed mutations within a single biomolecule, or any combinations thereof.

    [0148] Further provided herein are methods of selecting an improved biomolecule using one or more libraries as described herein. For example, in some embodiments, provided herein is a method of selecting an improved biomolecule variant, wherein the biomolecule is a protein or RNA, the method comprising: [0149] (i) constructing a library of biomolecule variants as described herein, wherein each variant is independently a variant of the same reference biomolecule; [0150] (ii) screening the library of (i); [0151] (iii) identifying at least a portion of the library of (i) that exhibits one or more improved characteristics compared to the reference biomolecule; and [0152] (iv) selecting the improved biomolecule variant from the identified at least a portion of the library, wherein the improved biomolecule variant exhibits one or more improved characteristics compared to the reference biomolecule.

    [0153] In some embodiments, the library of biomolecule variants of (i) comprises a plurality of biomolecule variants: [0154] wherein each variant is independently a variant of the same reference biomolecule, wherein each variant comprises an alteration of one or more monomer locations of the reference biomolecule, wherein the monomer is an amino acid of the protein or ribonucleotide of the RNA, and [0155] wherein each alteration of a monomer location is independently selected from the group consisting of substitution of the monomer, deletion of one or more consecutive monomers beginning at the location, and insertion of one or more consecutive monomers adjacent to the location; [0156] wherein the library represents variants comprising alteration of one or more locations for at least 1% of the monomer locations of the reference biomolecule.

    [0157] It should be understood that any library as has been described herein may be used in the methods provided herein. For example, in some embodiments the library represents variations comprising alteration of one or more locations for at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or up to 100% of the monomer locations of the reference biomolecule. In certain embodiments the library comprises variants in which each variant has one or more, two or more, three or more, or greater than three alterations, or has at least two different types of alterations, or has only one type of alteration, or any combinations that have been described herein.

    [0158] In some embodiments, the library comprises biomolecule variants with a single alteration of four monomer locations. In certain embodiments, the library comprises variants representing a single alteration of a single location for at least 1% of the total monomer locations, at least 10% of the total monomer locations, at least 30% of the total monomer locations, at least 70% of the total monomer locations, or at least 90% of the total monomer locations. In some embodiments, the library comprises variants representing deletion of one or more monomers beginning at the location, and variants comprising insertion of one or more new monomers adjacent to the location, for at least 30% of monomer locations. In still further embodiments, the library comprises variants representing insertion of each of one, two, three, and four monomers adjacent to the location for at least 80% of the monomer locations. In some embodiments, for each inserted new monomer, the library represents each naturally occurring monomer possibility (e.g., 20 naturally occurring amino acids, or 4 naturally occurring nucleotides). In some embodiments, wherein the library comprises variants with one or more insertions adjacent to a monomer location, each insertion is independently upstream or downstream of the monomer location. In other embodiments, each insertion is downstream of the location (e.g., in some libraries, insertion adjacent to a specified monomer location always indicates the insertion is downstream of that location). In still further embodiments, each insertion is upstream of the location. In some embodiments, deletion of one or more consecutive monomers comprises deletion of between one to four consecutive monomers. In certain embodiments, the library comprises variants representing deletion of each of one, two, three, and four consecutive monomers for at least 80% of the monomer locations. In some embodiments, the substitution of the monomer comprises replacing the monomer with one of the other naturally occurring monomers (e.g., 19 other naturally occurring amino acids, or 3 other naturally occurring nucleotides). In some embodiments, wherein the biomolecule is protein, the library comprises variants that collectively represent in which the same monomer is replaced with each of ten other naturally occurring amino acids, or each of the nineteen other naturally occurring amino acids. In other embodiments, wherein the biomolecule is RNA, library comprises variants that collectively represent in which the same monomer is replaced with each of the three other naturally occurring ribonucleotides. In still further embodiments, wherein the biomolecule is DNA, library comprises variants that collectively represent in which the same monomer is replaced with each of the three other naturally occurring deoxyribonucleotides.

    [0159] In still further embodiments, the library comprises variants for each of following alterations for at least 80% of the monomer locations: [0160] deletion of each of one, two, three, and four consecutive monomers, [0161] insertion of each of one, two three, and four consecutive monomers, and [0162] substitution of the same monomer with each of the other naturally occurring monomers.

    [0163] In some embodiments of said library, each variant independently comprises one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or greater alterations itself, and the library as a collective represents the described alterations for at least 80% of the total monomer locations of the reference biomolecule.

    [0164] In yet further embodiments, provided herein are methods of using the information gained from screening one or more libraries as provided herein to construct one or more additional variants, or libraries. Screening a library may provide information about what types and locations of alterations have a positive, negative, or neutral effect on one or more characteristics of a reference biomolecule. Such information may be used in the construction of one or more additional variants, or in one or more additional libraries. While a variant with a particular improved characteristic may be desired, information regarding what alterations have a neutral or negative effect can also be helpful. For example, screening variants may demonstrate that varying a particular region of a reference biomolecule has little effect on desired characteristics, indicating this region is highly mutable with few negative results and therefore may, without wishing to be bound by any theory, be a flexible region to alter for different purposes. This information could be useful, for example, to inform the location of a handle or tag for a future variant, or to alter the sequence for improved expression or to adapt to a new expression system.

    [0165] In another example, without wishing to be bound by any theory, constructs comprising four or more T nucleotides in row may be difficult to express in human expression systems. Screening a variant library comprising one or more variants in which a 4+ T region has been altered (e.g., by substitution) may demonstrate, in some embodiments, that certain substitutions do not have a detrimental effect on the desired characteristics of the biomolecule (such as solubility or activity). Such information can then be used, for example, to construct a variant in which a 4+ T region has been altered such that it is expected to be better suited to human expression systems, but without negatively affecting desirable positive characteristics. One exemplary such variant described herein includes the sgRNA with T10C alteration, used as the sgRNA in FIGS. 11A-C. The development of this sgRNA variant included information gleaned from the data shown in FIGS. 3A-3B, and 4A-4C, demonstrating that alteration of the T10 location did not have detrimental effects. Thus, this location could be substituted with a C, removing the 4T motif that is believed to have increased termination in human expression systems. Information obtained from the methods of variant and/or library construction and screening provided herein may, therefore, be combined with other information about the biomolecules and/or other alterations to construct new variants. Such additional alterations may include, for example, the addition of one or more functionalities (such as through protein fusions or combination with ribozymes) or removal of one or more regions of the protein (such as a stem truncation). Thus, the methods and compositions provided herein may, in some embodiments, provide information about regions of the biomolecule that are more highly mutable, which can be changed to a larger degree without loss of desirable characteristics, which could be subject to rational alterations (such as to install handles or additional functionality), or which can be removed, or any combinations thereof. The methods and compositions may also provide information about what alterations can be combined (e.g., “stacked”) in one or more additional variants, and/or additional libraries.

    [0166] In some embodiments, the information obtained from the methods and compositions provided herein can be used, for example, to construct a variant nucleic acid (NA). In some embodiments, the variant NA is a guide NA. A guide NA (gNA) refers to a nucleic acid molecule that binds to a Cas protein or variant thereof, forming a nucleic acid-protein complex, and targets the complex to a specific location within a target nucleic acid (e.g., a target DNA). In some embodiments, the gNA is a deoxyribonucleic acid (DNA) molecule (a gDNA). In some embodiments, the gNA is a ribonucleic acid (RNA) molecule (a gRNA). In still further embodiments, the gNA comprises both deoxyribonucleotides and ribonucleotides. In some embodiments a guide NA is constructed based at least in part on information obtained using the methods and compositions described herein (e.g., screening an RNA library, or a DNA library, or both). In some embodiments, the guide NA is a single guide NA (sgNA). In some embodiments, the guide NA is a double guide NA (dgNA). In some embodiments, the guide NA binds to CasX, CasY, Cas9, Cas12a, Cas12b, Cas12c, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d, Cas14, CASCADE, CSM, or CSY. In some embodiments, the guide NA binds to CasX, or CasY.

    [0167] In certain embodiments of the methods provided herein, the method comprises one or more additional screening steps. For example, in some embodiments the at least a portion of the library identified in step (iii) is screened. In certain embodiments, the screen in (ii) and the screen of the at least a portion identified in step (iii) are different screen types (e.g., screen for different characteristics, or by different methods, or a combination thereof). In other embodiments, they are the same screen types. Evaluation of the libraries described herein is described in further detail below.

    [0168] II. Library Evaluation

    [0169] Once a library has been constructed, it is evaluated for one or more characteristics. Any suitable method of evaluation may be used, such that has sufficient throughput so as to map the number of individual mutations in the library (which may include, e.g., up to millions or billions of individual variants overall); and the method links phenotype and genotype. In some embodiments, methods with a low throughput may be used, for example, to evaluate a subpopulation of a library, or a small library targeting certain mutations, or a small library layering certain mutations of interest, or a focused library developed through multiple rounds of mutation and evaluation.

    [0170] In some embodiments, the evaluation method uses living cells. Methods using living cells may, in some embodiments, be desirable because the effect of the genotype on the phenotype can be readily ascertained. Living cells may also be used to directly amplify sub-populations of the overall library.

    [0171] An exemplary, but non-limiting DME screening assay comprises Fluorescence-Activated Cell Sorting (FACS). In some embodiments, FACS may be used to assay millions or up to billions of unique cells in a library. An exemplary FACS screening protocol comprises the following steps:

    [0172] (1) PCR amplifying a purified plasmid library from the library construction phase. Flanking PCR primers can be designed that add appropriate restriction enzyme sites flanking the DNA encoding the biomolecule. Standard oligonucleotides can be used as PCR primers, and can be synthesized commercially. Commercially available PCR reagents can be used for the PCR amplification, and protocols should be performed according to the manufacturer's instructions. Methods of designing PCR primers, choice of appropriate restriction enzyme sites, selection of PCR reagents and PCR amplification protocols will be readily apparent to the person of ordinary skill in the art.

    [0173] (2) The resulting PCR product is digested with the designed flanking restriction enzymes. Restriction enzymes may be commercially available, and methods of restriction enzyme digestion will be readily apparent to the person of ordinary skill in the art.

    [0174] (3) The PCR product is ligated into a new DNA vector. Appropriate DNA vectors may include vectors that allow for the expression of the library in a cell. Exemplary vectors include, but are not limited to, lentiviral vectors, adenoviral vectors, adeno-associated viral (AAV) vectors and plasmids. This new DNA vector can be part of a protocol such as lentiviral integration in mammalian tissue culture, or a simple expression method such as plasmid transformation in bacteria. Any vectors that allow for the expression of the biomolecule, and the library of variants thereof, in any suitable cell type, are considered within the scope of the disclosure. Cell types may include bacterial cells, yeast cells, and mammalian cells. Exemplary bacterial cell types may include E. coli. Exemplary yeast cell types may include Saccharomyces cerevisiae. Exemplary mammalian cell types may include mouse, hamster, and human cell lines, such as HEK293 cells. Choice of vector and cell type will be readily apparent to the person of ordinary skill in the art. DNA ligase enzymes can be purchased commercially, and protocols for their use will also be readily apparent to one of ordinary skill in the art.

    [0175] (4) Once the library has been cloned into a vector suitable for in vivo expression, the library is screened. If the biomolecule has a function which alters fluorescent protein production in a living cell, the biomolecule's biochemical function will be correlated with the fluorescence intensity of the cell overall. By observing a population of millions of cells on a flow cytometer, a library can be seen to produce a broad distribution of fluorescence intensities. Individual sub-populations from this overall broad distribution can be extracted by FACS. For example, if the function of the biomolecule is to repress expression of a fluorescent protein, the least bright cells will be those expressing biomolecules whose function has been improved by DME. Alternatively, if the function of the biomolecule is to increase expression of a fluorescent protein, the brightest cells will be those expressing biomolecules whose function has been improved by DME. Cells can be isolated based on fluorescence intensity by FACS and grown separately from the overall population.

    [0176] (5) After FACS sorting cells expressing a library of biomolecule variants, cultures comprising the original library and/or only highly functional biomolecule variants, as determined by FACS sorting, can be amplified separately. If the cells that were FACS sorted comprise cells that express the library of biomolecule variants from a plasmid (for example, E. coli cells transformed with a plasmid expression vector), these plasmids can be isolated, for example through miniprep. Conversely if the library of biomolecule variants has been integrated into the genomes of the FACs sorted cells, this DNA region can be PCR amplified and, optionally, subcloned into a suitable vector for further characterization using methods known in the art. Thus, the end product of library screening is a DNA library representing the initial, or ‘naive’, library, as well as one or more DNA libraries containing sub-populations of the naive library which comprise highly functional mutant variants of the biomolecule identified by the screening processes described herein.

    [0177] In some embodiments, a biomolecule library that has been screened or selected for one or more variants are further characterized. For example, in some embodiments, a library has one or more highly functional variants which are further characterized to gain insight into possible mutational correlations or relationships that lead to a desired functional change. In some embodiments, further characterizing the library comprises analyzing variants individually through sequencing, such as Sanger sequencing, to identify the specific mutation or mutations that are connected to the change in characteristic (such as a highly functional characteristic). Individual mutant variants of the biomolecule can be isolated through standard molecular biology techniques for later analysis of function.

    [0178] In some embodiments, further characterizing the library comprises high throughput sequencing of both the entire, original library (the “naïve” library, e.g. the library in step (i)) and the one or more sub-populations of highly functional variants (e.g., a library of step (iii)). This approach may, in some embodiments, allow for the rapid identification of mutations that are over-represented in the one or more sub-populations of highly functional variants compared to a naïve library. Without wishing to be bound by any theory, mutations that are over-represented in the one or more sub-populations of highly functional variants may be responsible for the activity of the highly functional variants. In some embodiments, further characterizing the library comprises both sequencing of individual variants and high throughput sequencing of both the naïve library and the one or more sub-populations of highly functional variants.

    [0179] High throughput sequencing can produce high throughput data indicating the functional effect of the library members. In embodiments wherein one or more libraries represents every possible mutation of every monomer location, such high throughput sequencing can evaluate the functional effect of every possible mutation. Such sequencing can also be used to evaluate one or more highly functional sub-populations of a given library, which in some embodiments may lead to identification of mutations that result in improved function. An exemplary protocol for high throughput sequencing of a library with a highly functional sub-population is as follows:

    [0180] (1) High throughput sequence the naïve library (N). High throughput sequence the highly functional sub-population library (F). Any high throughput sequencing platform that can generate a suitable abundance of reads can be used. Exemplary sequencing platforms include, but are not limited to Illumina, Ion Torrent, 454 and PacBio sequencing platforms.

    [0181] (2) Select a particular mutation to evaluate (i). Calculate the total fractional abundance of i in N (i(N)). Calculate the total fractional abundance of i in F, (i(F)).

    [0182] (3) Calculate the following: [(i(F)+1)/(i(N)+1)]. This value, the ‘enrichment ratio’, is correlated with the function of the particular mutant variant i of the biomolecule. Other methods of calculating enrichment may also be used (e.g., pseudocount).

    [0183] (4) Calculate the enrichment ratio for each of the mutations observed in deep sequencing of the library.

    [0184] (5) The set of enrichment ratios for the entire library can be converted to a log scale and rescaled such that all values range between −1 and 1, where a value of 0 represents no enrichment (i.e. an enrichment ratio of 1). These rescaled values can be referred to as the relative ‘fitness’ of any particular mutation. These fitness values quantitatively indicate the effect a particular mutation has on the biochemical function of the biomolecule.

    [0185] (6) The set of calculated fitness values can be mapped to visually represent the fitness landscape of all possible mutations to a biomolecule. The fitness values can also be rank ordered to determine the most beneficial mutations contained within the library. Other analysis methods could also be used separately or in combination. For example, machine learning could be used to predict the effects of untested mutations or to determine specification locations and/or mutations that have the greatest effect.

    [0186] III. Iterating DME

    [0187] In some embodiments, a highly functional variant produced by DME has more than one mutation. For example, combinations of different mutations can in some embodiments produce optimized biomolecules whose function is further improved by the combination of mutations. In some embodiments, the effect of combining mutations on the function of a biomolecule is additive. As used herein, a combination of mutations that is additive refers to a combination whose effect on function is equal to the sum of the effects of each individual mutation when assayed in isolation. In some embodiments, the effect of combining mutations on function of the biomolecule is synergistic. As used herein, a combination of mutations that is synergistic refers to a combination whose effect on function is greater than the sum of the effects of each individual mutation when assayed in isolation. Other mutations may exhibit additional unexpected nonlinear additive effects, or even negative effects; this phenomenon is referred to herein as epistasis.

    [0188] Epistasis can be unpredictable, and can be a significant source of variation when combining mutations. Epistatic effects can, in some embodiments, be addressed through additional high throughput experimental methods in library construction and evaluation. In some embodiments, the entire library construction and evaluation protocol can be iterated, returning to the library construction step and selecting only mutations identified as having desired effects (such as increased functionality) from an initial library screen. Thus, in some embodiments, library construction and screening is iterated, with one or more cycles focusing the library on a sub-population or sub-populations of mutations having one or more desired effects. In such embodiments, layering of selected mutations may lead to improved variants. In certain embodiments, mutations that lead to different improved effects are layered, such that a variant may have two or more improved characteristics compared to the reference biomolecule. In some alternative embodiments, the process can be repeated with the full set of mutations, but targeting a novel, pre-mutated version of the biomolecule. For example, one or more highly functional variants identified in a first round of library construction, evaluation, and characterization can be used as the target for further rounds using a broad, unfocused set of further mutations (such as every possible mutation, or a subset thereof), and the process repeated. Any number, type of iterations or combinations of iterations are envisaged as within the scope of the disclosure.

    [0189] Thus, in some aspects, provided herein is an iterative method of selecting an improved biomolecule variant, wherein the biomolecule is a protein, DNA, or RNA, comprising: [0190] (i) constructing a library comprising a plurality of biomolecule variants, wherein each variant is independently a variant of the same reference biomolecule; [0191] (ii) screening the library of (i); [0192] (iii) identifying at least a portion of the library of (i) that exhibits one or more improved characteristics compared to the reference biomolecule; [0193] (iv) carrying out one or more additional rounds of library construction and screening, wherein construction of each library comprises: [0194] altering one or more additional monomer locations of the identified portion of the previous library to produce a subsequent library of biomolecule variants; and [0195] (iv) selecting the improved biomolecule variant from the final library of biomolecule variants, wherein the improved biomolecule variant exhibits one or more improved characteristics compared to the reference biomolecule.

    [0196] The library of (i) may be any variant library described herein, such as: [0197] wherein each variant comprises an alteration of one or more monomer locations of the reference biomolecule, wherein the monomer is an amino acid of the protein or nucleotide of the RNA or DNA, and [0198] wherein each alteration of a monomer location is independently selected from the group consisting of substitution of the monomer, deletion of one or more consecutive monomers beginning at the location, and insertion of one or more consecutive monomers adjacent to the location; [0199] wherein the library represents variants comprising alteration of one or more locations for at least 10% of the monomer locations of the reference biomolecule

    [0200] In some embodiments, an iterative method comprises one additional round, two additional rounds, three additional rounds, four additional rounds, five additional rounds, or more of library construction and screening. In certain embodiments, each subsequent library is smaller than the previous library, for example wherein evolution of the variants is directed to a particular mutation or theme of mutations. In other embodiments, each library is of approximately the same size, for example within about 1%, within about 5%, within about 10%, or within about 15% of the previous or subsequent, or both, libraries. In still further embodiments, each library is of an independent size.

    [0201] In certain embodiments, one or more alterations of the biomolecule variants in the variant library being screened, or, if more than one library is screened (e.g., in multiple rounds, and/or iterative processes), one or more alterations of biomolecule variants in one or more libraries, is independently an alteration deriving from rational design. In some embodiments, one or more alterations is random. In certain embodiments, a combination of rational alterations (e.g., altering, including removing, one or more motifs present in the reference sequence based on a specific structural or functional analysis or theory).

    [0202] In some embodiments, the DME methods provided herein comprise further modification to one or more variants of a library using rational mutagenesis, and then optionally evaluating said modifications. For example, in some embodiments, without wishing to be bound by any theory, four T ribonucleotides in a row may cause termination in a human cell expression system. Thus, for example, in some embodiments one or more variants is selected through the methods provided herein, and then the one or more variants is evaluated for the presence of four T ribonucleotides in the sequence, and identified variants are modified to remove such repeats. In some embodiments, these further modified variants are evaluated.

    [0203] IV. Reference Biomolecule

    [0204] Any suitable reference protein, RNA, or DNA may be used as the reference biomolecule in the methods and compositions described herein. In some embodiments, the reference biomolecule is a naturally occurring protein, RNA, or DNA. In other embodiments, the reference biomolecule is not naturally occurring.

    [0205] In some embodiments, the reference biomolecule is a protein. In certain embodiments, the reference biomolecule is a CRISPR/Cas family endonuclease (Cas protein), for example one that interacts with a guide RNA (gRNA) to form a ribonucleoprotein (RNP) complex. In some embodiments, the RNP is capable of cleaving DNA. In some embodiments, the RNP is capable of cleaving RNA. In certain embodiments, the RNP complex can be targeted to a particular site in a target nucleic acid via base pairing between the gRNA and a target sequence in the target nucleic acid.

    [0206] In some embodiments, the CRISPR/Cas protein is a Class 1 protein, e.g. a Type I, Type III, or Type IV protein. In some embodiments, the CRISPR/Cas protein is a Class II protein, e.g., a Type II, Type V, or Type VI protein.

    [0207] Any suitable Cas protein may be used. For example, in some embodiments, the Cas protein is CasX, CasY, Cas9, Cas12a, Cas12b, Cas12c, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d, Cas14, CASCADE, CSM, or CSY. In some embodiments, the Cas protein is CasX. In certain embodiments, the Cas protein is CasY.

    [0208] In some embodiments, the reference CasX protein is a naturally-occurring protein. For example, reference CasX proteins can, in some embodiments, be isolated from naturally occurring prokaryotic cells, such as cells of Deltaproteobacter, Planctomycetes, or Candidatus Sungbacteria species. In other embodiments, the reference CasX protein is not a naturally-occurring protein.

    [0209] In some embodiments, the reference biomolecule is a CasX protein isolated or derived from Deltaproteobacter. In some embodiments, the reference biomolecule is a CasX protein isolated or derived from Planctomycetes. In some embodiments, the reference biomolecule is a CasX protein isolated or derived from Candidatus Sungbacteria. In some embodiments, the reference biomolecule comprises a sequence at least 60% identical, at least 65% identical, at least 70% identical, at least 75% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical, at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, at least 99.5% identical or 100% identical to a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

    TABLE-US-00001 (SEQ ID NO: 1)   1 MEKRINKIRK KLSADNATKP VSRSGPMKTL LVRVMTDDLK KRLEKRRKKP EVMPQVISNN  61 AANNLRMLLD DYTKMKEAIL QVYWQEFKDD HVGLMCKFAQ PASKKIDQNK LKPEMDEKGN 121 LTTAGFACSQ CGQPLFVYKL EQVSEKGKAY TNYFGRCNVA EHEKLILLAQ LKPEKDSDEA 181 VTYSLGKFGQ RALDFYSIHV TKESTHPVKP LAQIAGNRYA SGPVGKALSD ACMGTIASFL 241 SKYQDIIIEH QKVVKGNQKR LESLRELAGK ENLEYPSVTL PPQPHTKEGV DAYNEVIARV 301 RMWVNLNLWQ KLKLSRDDAK PLLRLKGFPS FPVVERRENE VDWWNTINEV KKLIDAKRDM 361 GRVFWSGVTA EKRNTILEGY NYLPNENDHK KREGSLENPK KPAKRQFGDL LLYLEKKYAG 421 DWGKVFDEAW ERIDKKIAGL TSHIEREEAR NAEDAQSKAV LTDWLRAKAS FVLERLKEMD 481 EKEFYACEIQ LQKWYGDLRG NPFAVEAENR VVDISGFSIG SDGHSIQYRN LLAWKYLENG 541 KREFYLLMNY GKKGRIRFTD GTDIKKSGKW QGLLYGGGKA KVIDLTFDPD DEQLIILPLA 601 FGTRQGREFI WNDLLSLETG LIKLANGRVI EKTIYNKKIG RDEPALFVAL TFERREVVDP 661 SNIKPVNLIG VDRGENIPAV IALTDPEGCP LPEFKDSSGG PTDILRIGEG YKEKQRAIQA 721 AKEVEQRRAG GYSRKFASKS RNLADDMVRN SARDLFYHAV THDAVLVFEN LSRGFGRQGK 781 RTFMTERQYT KMEDWLTAKL AYEGLTSKTY LSKTLAQYTS KTCSNCGFTI TTADYDGMLV 841 RLKKTSDGWA TTLNNKELKA EGQITYYNRY KRQTVEKELS AELDRLSEES GNNDISKWTK 901 GRRDEALFLL KKRFSHRPVQ EQFVCLDCGH EVHADEQAAL NIARSWLFLN SNSTEFKSYK 961 SGKQPFVGAW QAFYKRRLKE VWKPNA. (SEQ ID NO: 2)   1 MQEIKRINKI RRRLVKDSNT KKAGKTGPMK TLLVRVMTPD LRERLENLRK KPENIPQPIS  61 NTSRANLNKL LTDYTEMKKA ILHVYWEEFQ KDPVGLMSRV AQPAPKNIDQ RKLIPVKDGN 121 ERLTSSGFAC SQCCQPLYVY KLEQVNDKGK PHTNYFGRCN VSEHERLILL SPHKPEANDE 181 LVTYSLGKFG QRALDFYSIH VTRESNHPVK PLEQIGGNSC ASGPVGKALS DACMGAVASF 241 LTKYQDIILE HQKVIKKNEK RLANLKDIAS ANGLAFPKIT LPPQPHTKEG IEAYNNVVAQ 301 IVIWVNLNLW QKLKIGRDEA KPLQRLKGFP SFPLVERQAN EVDWWDMVCN VKKLINEKKE 361 DGKVFWQNLA GYKRQEALLP YLSSEEDRKK GKKFARYQFG DLLLHLEKKH GEDWGKVYDE 421 AWERIDKKVE GLSKEIKLEE ERRSEDAQSK AALTDWLRAK ASFVIEGLKE ADKDEFCRCE 481 LKLQKWYGDL RGKPFAIEAE NSILDISGFS KQYNCAFIWQ KDGVKKLNLY LIINYFKGGK 541 LRFKKIKPEA FEANRFYTVI NKKSGEIVPM EVNFNFDDPN LIILPLAFGK RQGREFIWND 601 LLSLETGSLK LANGRVIEKT LYNRRTRQDE PALFVALTFE RREVLDSSNI KPMNLIGIDR 661 GENIPAVIAL TDPEGCPLSR FKDSLGNPTH ILRIGESYKE KQRTIQAAKE VEQRRAGGYS 721 RKYASKAKNL ADDMVRNTAR DLLYYAVTQD AMLIFENLSR GFGRQGKRTF MAERQYTRME 781 DWLTAKLAYE GLPSKTYLSK TLAQYTSKTC SNCGFTITSA DYDRVLEKLK KTATGWMTTI 841 NGKELKVEGQ ITYYNRYKRQ NVVKDLSVEL DRLSEESVNN DISSWTKGRS GEALSLLKKR 901 FSHRPVQEKF VCLNCGFETH ADEQAALNIA RSWLFLRSQE YKKYQTNKTT GNTDKRAFVE 961 TWQSFYRKKL KEVWKPAV. (SEQ ID NO: 3)   1 MDNANKPSTK SLVNTTRISD HFGVTPGQVT RVESEGIIPT KRQYAIIERW FAAVEAARER  61 LYGMLYAHFQ ENPPAYLKEK FSYETFFKGR PVLNGLRDID PTIMTSAVFT ALRHKAEGAM 121 AAFHTNHRRL FEEARKKMRE YAECLKANEA LLRGAADIDW DKIVNALRTR LNTCLAPEYD 181 AVIADFGALC AFRALIAETN ALKGAYNHAL NQMLPALVKV DEPEEAEESP RLRFFNGRIN 241 DLPKFPVAER ETPPDTETII RQLEDMARVI PDTAEILGYI HRIRHKAARR KPGSAVPLPQ 301 RVALYCAIRM ERNPEEDPST VAGHFLGEID RVCEKRRQGL VRTPFDSQIR ARYMDIISFR 361 ATLAHPDRWT EIQFLRSNAA SRRVRAETIS APFEGFSWTS NRTNPAPQYG MALAKDANAP 421 ADAPELCICL SPSSAAFSVR EKGGDLIYMR PTGGRRGKDN PGKEITWVPG SFDEYPASGV 481 ALKLRLYFGR SQARRMLTNK TWGLLSDNPR VFAANAELVG KKRNPQDRWK LFFHMVISGP 541 PPVEYLDFSS DVRSRARTVI GINRGEVNPL AYAVVSVEDG QVLEEGLLGK KEYIDQLIET 601 RRRISEYQSR EQTPPRDLRQ RVRHLQDTVL GSARAKIHSL IAFWKGILAI ERLDDQFHGR 661 EQKIIPKKTY LANKTGFMNA LSFSGAVRVD KKGNPWGGMI EIYPGGISRT CTQCGTVWLA 721 RRPKNPGHRD AMVVIPDIVD DAAATGFDNV DCDAGTVDYG ELFTLSREWV RLTPRYSRVM 781 RGTLGDLERA IRQGDDRKSR QMLELALEPQ PQWGQFFCHR CGFNGQSDVL AATNLARRAI 841 SLIRRLPDTD TPPTP.

    [0210] A polynucleotide or polypeptide can have a certain percent “sequence identity” to another polynucleotide or polypeptide, meaning that, when aligned, that percentage of bases or amino acids are the same, and in the same relative position, when comparing the two sequences. Sequence similarity can be determined in a number of different manners. To determine sequence identity, sequences can be aligned using the methods and computer programs, including BLAST, available over the world wide web at ncbi.nlm.nih.gov/BLAST.

    [0211] In other embodiments, the reference biomolecule is RNA. In some embodiments, the reference biomolecule is a CRISPR guide RNA. CRISPR guide RNAs (gRNA) include ribonucleic acid molecules that bind to a Cas protein, forming a ribonucleoprotein complex (RNP), and targets the complex to a specific location within a target nucleic acid (e.g., a target DNA or target RNA). In some embodiments, the gRNA is naturally occurring. In other embodiments, the gRNA is not naturally occurring.

    [0212] The “spacer”, also sometimes referred to as “targeting” sequence of a gRNA, can in some embodiments be modified so that the gRNA can target a Cas protein to any desired sequence of any desired target nucleic acid, with the exception (e.g., as described herein) that the PAM sequence can be taken into account. Thus, for example, a gRNA may in some embodiments have a spacer sequence with complementarity to (e.g., can hybridize to) a sequence in a nucleic acid in a eukaryotic cell, e.g., a eukaryotic nucleic acid (e.g., a eukaryotic chromosome, chromosomal sequence, a eukaryotic RNA, etc.) that is adjacent to a sequence complementary to a PAM sequence. In some embodiments, the spacer of a gRNA has between 14 and 35 consecutive nucleotides. In some embodiments, the spacer has 14, 15, 16, 18, 18, 19, 20, 21, 22, 23 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 consecutive nucleotides. In some embodiments, the spacer sequence can comprise 0 to 5, 0 to 4, 0 to 3, or 0 to 2 mismatches relative to the target nucleic acid sequence and retain sufficient binding specificity such that the RNP comprising the gRNA comprising the spacer sequence can form a complementary bond with respect to the target nucleic acid.

    [0213] In some embodiments, a gRNA can include two segments, a targeting segment and a protein-binding segment (constituting the scaffold discussed below); in some embodiments, the segments are fused. The targeting segment of a gRNA includes a nucleotide sequence (a guide sequence) that is complementary to (and therefore hybridizes with) a specific sequence (a target site) within a target nucleic acid (e.g., a target ssRNA, a target ssDNA, the complementary strand of a double stranded target DNA, etc.). The protein-binding segment (or “protein-binding sequence”) interacts with (e.g., binds to) a Cas protein. In those embodiments where the gRNA includes two segments, the protein-binding segment of the gRNA includes two complementary stretches of nucleotides that hybridize to one another to form a double stranded RNA duplex (dsRNA duplex). Site-specific binding and/or cleavage of a target nucleic acid (e.g., genomic DNA) can occur at one or more locations (e.g., target sequence of a target nucleic acid) determined by base-pairing complementarity between the gRNA (the guide sequence of the g RNA) and the target nucleic acid. A gRNA and a Cas protein may form a complex (e.g., bind via non-covalent interactions), and the gRNA may provide target specificity to the complex by including a guide sequence (a nucleotide sequence that is complementary to a sequence of a target nucleic acid). The guide sequence is sometimes referred to herein as the “spacer” or “spacer sequence.” The Cas protein of the complex may provide the site-specific activity (e.g., cleavage activity provided by the Cas protein). In other words, in some embodiments the Cas protein is guided to a target nucleic acid sequence (e.g. a target sequence) by virtue of its association with the Cas gRNA.

    [0214] In some embodiments, a gRNA includes an “activator” and a “targeter” (e.g., an “activator-RNA” and a “targeter-RNA,” respectively). When the “activator” and a “targeter” are two separate molecules, the reference gRNA may be referred to, for example, as a “dual guide RNA”, a “dgRNA,” a “double-molecule guide RNA”, or a “two-molecule guide RNA”. The term “targeter” or “targeter RNA” is used herein to refer to a crRNA-like molecule (crRNA: “CRISPR RNA”) of a Cas guide RNA (e.g., a dgRNA; or, when the “activator” and the “targeter” are linked together, a single guide RNA (sgRNA)). Thus, for example, a reference gRNA (dgRNA or sgRNA) comprises a guide sequence and a duplex-forming segment (e.g., a duplex forming segment of a crRNA, which can also be referred to as a crRNA repeat). Because the sequence of a guide sequence (the segment that hybridizes with a target sequence of a target nucleic acid) of a targeter may be modified by a user to hybridize with a desired target nucleic acid, the sequence of a targeter may be a non-naturally occurring sequence. A targeter comprises both the guide sequence (aka spacer sequence) of the gRNA and a stretch of nucleotides that forms one half of the dsRNA duplex of the protein-binding segment of the gRNA. A corresponding trans-activating crRNA (tracrRNA)-like molecule (activator) comprises a stretch of nucleotides (a duplex-forming segment) that forms the other half of the dsRNA duplex of the protein-binding segment of the gRNA. In some embodiments, a targeter and an activator (as a corresponding pair) hybridize to form a dsRNA. In some embodiments, the activator and targeter of a gRNA are covalently linked to one another (e.g., via intervening nucleotides) and the gRNA is referred to herein as a “single guide RNA”, an “sgRNA,” a “single-molecule guide RNA,” or a “one-molecule guide RNA”. Thus, a sgRNA, in some embodiments, comprises a targeter (e.g., targeter-RNA) and an activator (e.g., activator-RNA) that are linked to one another (e.g., covalently by intervening nucleotides), and hybridize to one another to form the double stranded RNA duplex (dsRNA duplex) of the protein-binding segment of the guide RNA, resulting in a stem-loop structure. In some embodiments, the targeter and the activator each have a duplex-forming segment, where the duplex forming segment of the targeter and the duplex-forming segment of the activator have complementarity with one another and hybridize to one another.

    [0215] In some embodiments, the linker covalently attaching the targeter and the activator is a stretch of nucleotides. Exemplary linkers may include, but are not limited to GAAA, GAGAAA, and CUUCGG. In some embodiments, the linker is CUUCGG. In some cases, the targeter and activator of a sgRNA are linked to one another by intervening nucleotides, and the linker has a length of from 3 to 20 nucleotides (nt) (e.g., from 3 to 15, 3 to 12, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 4 to 20, 4 to 15, 4 to 12, 4 to 10, 4 to 8, 4 to 6, or 4 to 5 nt). In some embodiments, the linker of a sgRNA has a length of from 3 to 100 nucleotides (nt) (e.g., from 3 to 80, 3 to 50, 3 to 30, 3 to 25, 3 to 20, 3 to 15, 3 to 12, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 4 to 100, 4 to 80, 4 to 50, 4 to 30, 4 to 25, 4 to 20, 4 to 15, 4 to 12, 4 to 10, 4 to 8, 4 to 6, or 4 to 5 nt). In some embodiments, the linker of a sgRNA has a length of from 3 to 10 nucleotides (nt) (e.g., from 3 to 9, 3 to 8, 3 to 7, 3 to 6, 3 to 5, 3 to 4, 4 to 10, 4 to 9, 4 to 8, 4 to 7, 4 to 6, or 4 to 5 nt).

    [0216] In some embodiments, the reference CRISPR guide RNA is a single guide RNA (sgRNA), for example a sgRNA that binds to CasX, CasY, Cas9, Cas12a, Cas12b, Cas12c, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d, Cas14, CASCADE, CSM, or CSY. In certain embodiments, the CRISPR guide RNA is a single guide RNA that binds CasX. In some embodiments, the CasX is of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In other embodiments, the CRISPR guide RNA is an sgRNA that binds CasY.

    [0217] In some embodiments, the reference gRNA comprises a sequence of a naturally-occurring gRNA. In some embodiments, the reference biomolecule is a guide RNA comprising sequence isolated or derived from Deltaproteobacter. In some embodiments, the sequence is a tracrRNA sequence, for example a CasX tracrRNA sequence. Exemplary CasX reference tracrRNA sequences isolated or derived from Deltaproteobacter may include:

    TABLE-US-00002 (SEQ ID NO: 239) UUAUUCCAUUACUUUGGAGCCAGUCCCAGCGACUAUGUCGUAUGGACGA AGCGCUUAUUUAUCGGAGA and (SEQ ID NO: 240) UUAUUCCAUUACUUUGGAGCCAGUCCCAGCGACUAUGUCGUAUGGACGA AGCGCUUAUUUAUCGG.

    [0218] Exemplary crRNA sequences isolated or derived from Deltaproteobacter may comprise a sequence of:

    TABLE-US-00003 (SEQ ID NO: 241) CCGAUAAGUAAAACGCAUCAAAG.

    [0219] In some embodiments, the reference biomolecule is a gRNA comprising a sequence isolated or derived from Planctomycetes. In some embodiments, the sequence is a tracrRNA sequence, such as a CasX tracrRNA sequence. Exemplary CasX reference tracrRNA sequences isolated or derived from Planctomycetes may include:

    TABLE-US-00004 (SEQ ID NO: 242) UUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCGUAUGGGUA AAGCGCUUAUUUAUCGGAGA and (SEQ ID NO: 243) UUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCGUAUGGGUA AAGCGCUUAUUUAUCGG.

    [0220] Exemplary crRNA sequences isolated or derived from Planctomycetes may comprise a sequence of:

    TABLE-US-00005 (SEQ ID NO: 244) UCUCCGAUAAAUAAGAAGCAUCAAAG

    [0221] In some embodiments, the reference biomolecule is a gRNA comprising a sequence isolated or derived from Candidatus Sungbacteria. In some embodiments, the sequence is a tracrRNA sequence, such as a CasX tracrRNA sequence. Exemplary CasX tracrRNA sequences isolated or derived from Candidatus Sungbacteria may include:

    TABLE-US-00006 (SEQ ID NO: 245) UAAAUUUUUUGAGCCCUAUCUCCGCGAGGAAGACAGGGCUCUUUUCAUG AGAGGAAGCUUUUAUACCCGACCGGUAAUCCGGUCGGGGGAUUGGCCGU UGAAACGAUUUUAAAGCGGCCAAUGGGCCCCUCUAUAUGGAUACUACUU AUAUAAGGAGCUUGGGGAAGAAGAUAGCUUAAUCCCGCUAUCUUGUCAA GGGGUUGGGGGAGUAUCAGUAUCCGGCAGGCGCC.

    [0222] Exemplary crRNA sequences isolated or derived from Candidatus Sungbacteria may comprise sequences of

    TABLE-US-00007 (SEQ ID NO: 10) GUUUACACACUCCCUCUCAUAGGGU, (SEQ ID NO: 11) GUUUACACACUCCCUCUCAUGAGGU, (SEQ ID NO: 12) UUUUACAUACCCCCUCUCAUGGGAU and (SEQ ID NO: 13) GUUUACACACUCCCUCUCAUGGGGG, and (SEQ ID NO: 246) GUUUACACACUCCCUCUCAUAGGG

    [0223] In some embodiments, the reference biomolecule is a gRNA comprising a sequence at least 60% identical, at least 65% identical, at least 70% identical, at least 75% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical, at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, at least 99.5% identical or 100% identical to a sequence isolated or derived from Deltaproteobacter, Candidatus Sungbacteria, or Planctomycetes.

    [0224] In some embodiments, the reference biomolecule is a reference gRNA that is a capable of forming a complex with Cas12a.

    [0225] In some embodiments, the reference biomolecule is a reference gRNA comprising a sequence that is not naturally occurring, for example a chimeric or fusion sequence.

    [0226] In some embodiments, the reference biomolecule is a CasX sgRNA comprising a sequence of:

    TABLE-US-00008 (SEQ ID NO: 4) ACAUCUGGCGCGUUUAUUCCAUUACUUUGGAGCCAGUCCCAGCGACUAU GUCGUAUGGACGAAGCGCUUAUUUAUCGGAGAgaaaCCGAUAAGUAAAA CGCAUCAAAG.

    [0227] In some embodiments, the reference biomolecule is a CasX sgRNA comprising the sequence of:

    TABLE-US-00009 (SEQ ID NO: 5) UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUG UCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAUAAGA AGCAUCAAAG.

    [0228] In some embodiments, the reference biomolecule is a CasX sgRNA comprising a sequence at least 60% identical, at least 65% identical, at least 70% identical, at least 75% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical, at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, at least 99.5% identical or 100% identical to SEQ ID NO: 4, or SEQ ID NO: 5.

    [0229] V. Variants

    [0230] In still further aspects, also provided herein are variants selected by the methods described herein. In some embodiments, the variant has one or more improved characteristics compared to the reference biomolecule.

    [0231] In some embodiments, the variant is a protein, and the one or more improved characteristics are independently selected from the group consisting of improved folding, improved stability, improved activity, improved protein solubility, improved binding to a binding partner, improved stability of a protein:binding partner complex, and improved yield.

    [0232] In certain embodiments, the variant is a CRISPR associated protein, (e.g., a CasX variant protein) and the one or more improved characteristics are independently selected from the group consisting of improved folding of the variant, improved binding affinity to the guide RNA, improved binding affinity to a target DNA, altered binding affinity to or ability to utilize one or more PAM sequences for the editing of a target DNA, improved unwinding of a target DNA, increased activity, improved editing efficiency, improved editing specificity, increased activity of the nuclease, increased target strand loading for double strand cleavage, decreased target strand loading for single strand nicking, decreased off-target cleavage, decreased off-target binding/nicking, improved binding of the non-target strand of a DNA, improved protein stability, improved protein:guide NA complex stability, improved protein solubility, improved protein:guide RNA complex stability, improved protein yield, increased collateral activity, and decreased collateral activity. In some embodiments, a target DNA is dsDNA. In other embodiments, a target DNA is ssDNA.

    [0233] In a particular feature, the methods of the disclosure result in CasX variant protein with the ability to utilize a larger spectrum of PAM sequences for the editing of a target DNA. As used herein, the PAM is a nucleotide sequence proximal to the protospacer that, in conjunction with the targeting sequence of the gNA, helps the orientation and positioning of the CasX for the potential cleavage of the protospacer strand(s). Herein, the protospacer is defined as the DNA sequence complementary to the targeting sequence of the guide RNA and the DNA complementary to that sequence, referred to as the target strand and non-target strand, respectively. PAM sequences may be degenerate, and specific RNP constructs may have different preferred and tolerated PAM sequences that support different efficiencies of cleavage. Following convention, unless stated otherwise, the disclosure refers to both the PAM and the protospacer sequence and their directionality according to the orientation of the non-target strand. This does not imply that the PAM sequence of the non-target strand, rather than the target strand, is determinative of cleavage or mechanistically involved in target recognition. For example, when reference is to a TTC PAM, it may in fact be the complementary GAA sequence that is required for target cleavage, or it may be some combination of nucleotides from both strands. In the case of the CasX proteins disclosed herein, the PAM is located 5′ of the protospacer with a single nucleotide separating the PAM from the first nucleotide of the protospacer. Thus, in the case of reference CasX, a TTC PAM should be understood to mean a sequence following the formula 5′- . . . NNTTCN(protospacer)NNNNNN . . . 3′ (SEQ ID NO: 247) where ‘N’ is any DNA nucleotide and ‘(protospacer)’ is a DNA sequence having identity with the targeting sequence of the guide RNA. In the case of a CasX variant with expanded PAM recognition, a TTC, CTC, GTC, or ATC PAM should be understood to mean a sequence following the formulae: 5′- . . . NNTTCN(protospacer)NNNNNN . . . 3′ (SEQ ID NO: 247); 5′- . . . NNCTCN(protospacer)NNNNNN . . . 3′ (SEQ ID NO: 248); 5′- . . . NNGTCN(protospacer)NNNNNN . . . 3′ (SEQ ID NO: 249); or 5′- . . . NNATCN(protospacer)NNNNNN . . . 3′ (SEQ ID NO: 250). Alternatively, a TC PAM should be understood to mean a sequence following the formula 5′- . . . NNNTCN(protospacer)NNNNNN . . . 3′ (SEQ ID NO: 251). In some embodiments, a CasX variant has improved editing of a PAM sequence exhibits greater editing efficiency and/or binding of a target sequence in the target DNA when any one of the PAM sequences TTC, ATC, GTC, or CTC is located 1 nucleotide 5′ to the non-target strand of the protospacer having identity with the targeting sequence of the gNA in a cellular assay system compared to the editing efficiency and/or binding of an RNP comprising a reference CasX protein in a comparable assay system. In some embodiments, the PAM sequence is TTC. In some embodiments, the PAM sequence is ATC. In some embodiments, the PAM sequence is CTC. In some embodiments, the PAM sequence is GTC.

    [0234] In some embodiments, the variant is a CRISPR associated protein, wherein the variant has one or more altered activities compared to a reference. For example, in some embodiments, the variant has altered target specificity, for example specificity for RNA instead of DNA, compared to a reference. In some embodiments, the variant is a nickase Cas protein, or a dead Cas protein, compared to a reference protein which cleaves double stranded DNA.

    [0235] In some embodiments, wherein the variant is a CasX variant, the one or more improved characteristics are improved compared to a reference CasX of SEQ ID NO: 1. In other embodiments, wherein the variant is a CasX variant, the one or more improved characteristics are improved compared to a reference CasX of SEQ ID NO: 2. In still further embodiments, wherein the variant is a CasX variant, the one or more improved characteristics are improved compared to a reference CasX of SEQ ID NO: 3.

    [0236] In some embodiments, the CasX variant protein has least 60% identity, at least 70% identity, at least 80% identity, at least 85% identity, at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, at least 99.5% identity, at least 99.6% identity, at least 99.7% identity, at least 99.8% identity or at least 99.9% identity to one of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In some embodiments, the CasX variant protein comprises or consists of a sequence that has at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 30, at least 40 or at least 50 mutations relative to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. These mutations can be insertions, deletions, amino acid substitutions, or any combinations thereof.

    [0237] In some embodiments, the CasX variant protein has sequence identity to SEQ ID NO: 2 or a portion thereof.

    [0238] In some embodiments of the CasX variants described herein, the at least one modification comprises: (a) a substitution of 1 to 100 consecutive or non-consecutive amino acids in the CasX variant; (b) a deletion of 1 to 100 consecutive or non-consecutive amino acids in the CasX variant; (c) an insertion of 1 to 100 consecutive or non-consecutive amino acids in the CasX; or (d) any combination of (a)-(c). In some embodiments, the at least one modification comprises: (a) a substitution of 5-10 consecutive or non-consecutive amino acids in the CasX variant; (b) a deletion of 1-5 consecutive or non-consecutive amino acids in the CasX variant; (c) an insertion of 1-5 consecutive or non-consecutive amino acids in the CasX; or (d) any combination of (a)-(c).

    [0239] In some embodiments, the CasX variant protein comprises a substitution of Y789T of SEQ ID NO: 2, a deletion of P793 of SEQ ID NO: 2, a substitution of Y789D of SEQ ID NO: 2, a substitution of T72S of SEQ ID NO: 2, a substitution of I546V of SEQ ID NO: 2, a substitution of E552A of SEQ ID NO: 2, a substitution of A636D of SEQ ID NO: 2, a substitution of F536S of SEQ ID NO:2, a substitution of A708K of SEQ ID NO: 2, a substitution of Y797L of SEQ ID NO: 2, a substitution of L792G SEQ ID NO: 2, a substitution of A739V of SEQ ID NO: 2, a substitution of G791M of SEQ ID NO: 2, a insertion of A at position 661 ({circumflex over ( )}G661A) of SEQ ID NO: 2, a substitution of A788W of SEQ ID NO: 2, a substitution of K390R of SEQ ID NO: 2, a substitution of A751S of SEQ ID NO: 2, a substitution of E385A of SEQ ID NO: 2, an insertion of P at position 696 of SEQ ID NO: 2, an insertion of M at position 773 of SEQ ID NO: 2, a substitution of G695H of SEQ ID NO: 2, an insertion of AS at position 793 of SEQ ID NO: 2, an insertion of AS at position 795 of SEQ ID NO: 2, a substitution of C477R of SEQ ID NO: 2, a substitution of C477K of SEQ ID NO: 2, a substitution of C479A of SEQ ID NO: 2, a substitution of C479L of SEQ ID NO: 2, a substitution of I55F of SEQ ID NO: 2, a substitution of K210R of SEQ ID NO: 2, a substitution of C233S of SEQ ID NO: 2, a substitution of D231N of SEQ ID NO: 2, a substitution of Q338E of SEQ ID NO: 2, a substitution of Q338R of SEQ ID NO: 2, a substitution of L379R of SEQ ID NO: 2, a substitution of K390R of SEQ ID NO: 2, a substitution of L481Q of SEQ ID NO: 2, a substitution of F495S of SEQ ID NO:2, a substitution of D600N of SEQ ID NO: 2, a substitution of T886K of SEQ ID NO: 2, a substitution of A739V of SEQ ID NO: 2, a substitution of K460N of SEQ ID NO: 2, a substitution of I199F of SEQ ID NO: 2, a substitution of G492P of SEQ ID NO: 2, a substitution of T1531 of SEQ ID NO: 2, a substitution of R591I of SEQ ID NO: 2, an insertion of AS at position 795 of SEQ ID NO: 2, an insertion of AS at position 796 of SEQ ID NO:2, an insertion of L at position 889 of SEQ ID NO: 2, a substitution of E121D of SEQ ID NO: 2, a substitution of S270W of SEQ ID NO: 2, a substitution of E712Q of SEQ ID NO: 2, a substitution of K942Q of SEQ ID NO: 2, a substitution of E552K of SEQ ID NO:2, a substitution of K25Q of SEQ ID NO: 2, a substitution of N47D of SEQ ID NO: 2, an insertion of T at position 696 of SEQ ID NO: 2, a substitution of L685I of SEQ ID NO: 2, a substitution of N880D of SEQ ID NO: 2, a substitution of Q102R of SEQ ID NO: 2, a substitution of M734K of SEQ ID NO: 2, a substitution of A724S of SEQ ID NO: 2, a substitution of T704K of SEQ ID NO: 2, a substitution of P224K of SEQ ID NO: 2, a substitution of 1(25R of SEQ ID NO: 2, a substitution of M29E of SEQ ID NO: 2, a substitution of H152D of SEQ ID NO: 2, a substitution of S219R of SEQ ID NO: 2, a substitution of E475K of SEQ ID NO: 2, a substitution of G226R of SEQ ID NO: 2, a substitution of A377K of SEQ ID NO: 2, a substitution of E480K of SEQ ID NO: 2, a substitution of K416E of SEQ ID NO: 2, a substitution of H164R of SEQ ID NO: 2, a substitution of K767R of SEQ ID NO: 2, a substitution of I7F of SEQ ID NO: 2, a substitution of M29R of SEQ ID NO: 2, a substitution of H435R of SEQ ID NO: 2, a substitution of E385Q of SEQ ID NO: 2, a substitution of E385K of SEQ ID NO: 2, a substitution of I279F of SEQ ID NO: 2, a substitution of D489S of SEQ ID NO: 2, a substitution of D732N of SEQ ID NO: 2, a substitution of A739T of SEQ ID NO: 2, a substitution of W885R of SEQ ID NO: 2, a substitution of E53K of SEQ ID NO: 2, a substitution of A238T of SEQ ID NO: 2, a substitution of P283Q of SEQ ID NO: 2, a substitution of E292K of SEQ ID NO: 2, a substitution of Q628E of SEQ ID NO: 2, a substitution of R388Q of SEQ ID NO: 2, a substitution of G791M of SEQ ID NO: 2, a substitution of L792K of SEQ ID NO: 2, a substitution of L792E of SEQ ID NO: 2, a substitution of M779N of SEQ ID NO: 2, a substitution of G27D of SEQ ID NO: 2, a substitution of K955R of SEQ ID NO: 2, a substitution of S867R of SEQ ID NO: 2, a substitution of R693I of SEQ ID NO: 2, a substitution of F189Y of SEQ ID NO: 2, a substitution of V635M of SEQ ID NO: 2, a substitution of F399L of SEQ ID NO: 2, a substitution of E498K of SEQ ID NO: 2, a substitution of E386R of SEQ ID NO: 2, a substitution of V254G of SEQ ID NO: 2, a substitution of P793S of SEQ ID NO: 2, a substitution of K188E of SEQ ID NO: 2, a substitution of QT945KI of SEQ ID NO: 2, a substitution of T620P of SEQ ID NO: 2, a substitution of T946P of SEQ ID NO: 2, a substitution of TT949PP of SEQ ID NO: 2, a substitution of N952T of SEQ ID NO: 2, a substitution of K682E of SEQ ID NO: 2, a substitution of K975R of SEQ ID NO: 2, a substitution of L212P of SEQ ID NO: 2, a substitution of E292R of SEQ ID NO: 2, a substitution of 1303K of SEQ ID NO: 2, a substitution of C349E of SEQ ID NO: 2, a substitution of E385P of SEQ ID NO: 2, a substitution of E386N of SEQ ID NO: 2, a substitution of D387K of SEQ ID NO: 2, a substitution of L404K of SEQ ID NO: 2, a substitution of E466H of SEQ ID NO: 2, a substitution of C477Q of SEQ ID NO: 2, a substitution of C477H of SEQ ID NO: 2, a substitution of C479A of SEQ ID NO: 2, a substitution of D659H of SEQ ID NO: 2, a substitution of T806V of SEQ ID NO: 2, a substitution of K808S of SEQ ID NO: 2, an insertion of AS at position 797 of SEQ ID NO: 2, a substitution of V959M of SEQ ID NO: 2, a substitution of K975Q of SEQ ID NO: 2, a substitution of W974G of SEQ ID NO: 2, a substitution of A708Q of SEQ ID NO: 2, a substitution of V711K of SEQ ID NO: 2, a substitution of D733T of SEQ ID NO: 2, a substitution of L742W of SEQ ID NO: 2, a substitution of V747K of SEQ ID NO: 2, a substitution of F755M of SEQ ID NO: 2, a substitution of M771A of SEQ ID NO: 2, a substitution of M771Q of SEQ ID NO: 2, a substitution of W782Q of SEQ ID NO: 2, a substitution of G791F, of SEQ ID NO: 2 a substitution of L792D of SEQ ID NO: 2, a substitution of L792K of SEQ ID NO: 2, a substitution of P793Q of SEQ ID NO: 2, a substitution of P793G of SEQ ID NO: 2, a substitution of Q804A of SEQ ID NO: 2, a substitution of Y966N of SEQ ID NO: 2, a substitution of Y723N of SEQ ID NO: 2, a substitution of Y857R of SEQ ID NO: 2, a substitution of S890R of SEQ ID NO: 2, a substitution of S932M of SEQ ID NO: 2, a substitution of L897M of SEQ ID NO: 2, a substitution of R624G of SEQ ID NO: 2, a substitution of 5603G of SEQ ID NO: 2, a substitution of N737S of SEQ ID NO: 2, a substitution of L307K of SEQ ID NO: 2, a substitution of I658V of SEQ ID NO: 2, an insertion of PT at position 688 of SEQ ID NO: 2, an insertion of SA at position 794 of SEQ ID NO: 2, a substitution of S877R of SEQ ID NO: 2, a substitution of N580T of SEQ ID NO: 2, a substitution of V335G of SEQ ID NO: 2, a substitution of T620S of SEQ ID NO: 2, a substitution of W345G of SEQ ID NO: 2, a substitution of T280S of SEQ ID NO: 2, a substitution of L406P of SEQ ID NO: 2, a substitution of A612D of SEQ ID NO: 2, a substitution of A75I S of SEQ ID NO: 2, a substitution of E386R of SEQ ID NO: 2, a substitution of V351M of SEQ ID NO: 2, a substitution of K210N of SEQ ID NO: 2, a substitution of D40A of SEQ ID NO: 2, a substitution of E773G of SEQ ID NO: 2, a substitution of H207L of SEQ ID NO: 2, a substitution of T62A SEQ ID NO: 2, a substitution of T287P of SEQ ID NO: 2, a substitution of T832A of SEQ ID NO: 2, a substitution of A893S of SEQ ID NO: 2, an insertion of V at position 14 of SEQ ID NO: 2, an insertion of AG at position 13 of SEQ ID NO: 2, a substitution of R11V of SEQ ID NO: 2, a substitution of R12N of SEQ ID NO: 2, a substitution of R13H of SEQ ID NO: 2, an insertion of Y at position 13 of SEQ ID NO: 2, a substitution of R12L of SEQ ID NO: 2, an insertion of Q at position 13 of SEQ ID NO: 2, an substitution of V15S of SEQ ID NO: 2, an insertion of D at position 17 of SEQ ID NO: 2, or a combination thereof.

    [0240] In some embodiments, a CasX variant protein comprises more than one substitution, insertion and/or deletion of a reference CasX protein amino acid sequence. In some embodiments, the reference CasX protein comprises or consists essentially of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of S794R and a substitution of Y797L of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of K416E and a substitution of A708K of SEQ ID NO: 2. In some embodiments, a CasX variant comprises a substitution of A708K and a deletion of P793 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a deletion of P793 and a substitution of P793AS SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of Q367K and a substitution of I425S of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of A708K, a deletion of P position 793 and a substitution A793V of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of Q338R and a substitution of A339E of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of Q338R and a substitution of A339K of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of S507G and a substitution of G508R of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K and a deletion of P at position 793 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of C477K, a substitution of A708K and a deletion of P at position 793 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K and a deletion of P at position of 793 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution A739V of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of A739V of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of A739V of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution of M779N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution of M771N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of 708K, a deletion of P at position 793 and a substitution of D489S of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution of A739T of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution of D732N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution of G791M of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of 708K, a deletion of P at position 793 and a substitution of Y797L of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of M779N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of M771N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of D489S of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of A739T of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of D732N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of G791M of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of Y797L of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of T620P of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of A708K, a deletion of P at position 793 and a substitution of E386S of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of E386R, a substitution of F399L and a deletion of P at position 793 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of R581I and A739V of SEQ ID NO: 2.

    [0241] In some embodiments, a CasX variant protein comprises more than one substitution, insertion and/or deletion of a reference CasX protein amino acid sequence. In some embodiments, the reference CasX protein comprises or consists essentially of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of S794R and a substitution of Y797L of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of K416E and a substitution of A708K of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of A708K and a deletion of P793 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a deletion of P793 and an insertion of AS at position 795 SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of Q367K and a substitution of I425S of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of A708K, a deletion of P position 793 and a substitution A793V of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of Q338R and a substitution of A339E of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of Q338R and a substitution of A339K of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of S507G and a substitution of G508R of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K and a deletion of P at position 793 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of C477K, a substitution of A708K and a deletion of P at position 793 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K and a deletion of P at position of 793 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution A739V of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of A739V of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of A739V of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution of M779N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution of M771N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of 708K, a deletion of P at position 793 and a substitution of D489S of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution of A739T of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution of D732N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution of G791M of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of 708K, a deletion of P at position 793 and a substitution of Y797L of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of M779N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of M771N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of D489S of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of A739T of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of D732N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of G791M of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of Y797L of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of T620P of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of A708K, a deletion of P at position 793 and a substitution of E386S of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of E386R, a substitution of F399L and a deletion of P at position 793 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of R581I and A739V of SEQ ID NO: 2. In some embodiments, a CasX variant comprises any combination of the foregoing embodiments of this paragraph.

    [0242] In some embodiments, a CasX variant protein comprises more than one substitution, insertion and/or deletion of a reference CasX protein amino acid sequence. In some embodiments, a CasX variant protein comprises a substitution of A708K, a deletion of P at position 793 and a substitution of A739V of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K and a deletion of P at position 793 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of C477K, a substitution of A708K and a deletion of P at position 793 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K and a deletion of P at position 793 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution of A739V of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of A739 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of A739V of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of T620P of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of M771A of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution of D732N of SEQ ID NO: 2. In some embodiments, a CasX variant comprises any combination of the foregoing embodiments of this paragraph.

    [0243] In some embodiments, a CasX variant protein comprises a substitution of W782Q of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of M771Q of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of R458I and a substitution of A739V of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution of M771N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution of A739T of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of D489S of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of D732N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of V711K of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of Y797L of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K and a deletion of P at position 793 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K, a deletion of P at position 793 and a substitution of M771N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of A708K, a substitution of P at position 793 and a substitution of E386S of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477K, a substitution of A708K and a deletion of P at position 793 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L792D of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of G791F of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of A708K, a deletion of P at position 793 and a substitution of A739V of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of A708K, a deletion of P at position 793 and a substitution of A739V of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of C477K, a substitution of A708K and a substitution of P at position 793 of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L249I and a substitution of M771N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of V747K of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of L379R, a substitution of C477, a substitution of A708K, a deletion of P at position 793 and a substitution of M779N of SEQ ID NO: 2. In some embodiments, a CasX variant protein comprises a substitution of F755M. In some embodiments, a CasX variant comprises any combination of the foregoing embodiments of this paragraph.

    [0244] In some embodiments, the CasX variant comprises at least one modification in the NTSB domain.

    [0245] In some embodiments, the CasX variant comprises at least one modification in the TSL domain. In some embodiments, the at least one modification in the TSL domain comprises an amino acid substitution of one or more of amino acids Y857, S890, or S932 of SEQ ID NO: 2.

    [0246] In some embodiments, the CasX variant comprises at least one modification in the helical I domain. In some embodiments, the at least one modification in the helical I domain comprises an amino acid substitution of one or more of amino acids S219, L249, E259, Q252, E292, L307, or D318 of SEQ ID NO: 2.

    [0247] In some embodiments, the CasX variant comprises at least one modification in the helical II domain. In some embodiments, the at least one modification in the helical II domain comprises an amino acid substitution of one or more of amino acids D361, L379, E385, E386, D387, F399, L404, R458, C477, or D489 of SEQ ID NO: 2.

    [0248] In some embodiments, the CasX variant comprises at least one modification in the OBD domain. In some embodiments, the at least one modification in the OBD comprises an amino acid substitution of one or more of amino acids F536, E552, T620, or 1658 of SEQ ID NO: 2.

    [0249] In some embodiments, the CasX variant comprises at least one modification in the RuvC DNA cleavage domain. In some embodiments, the at least one modification in the RuvC DNA cleavage domain comprises an amino acid substitution of one or more of amino acids K682, G695, A708, V711, D732, A739, D733, L742, V747, F755, M771, M779, W782, A788, G791, L792, P793, Y797, M799, Q804, 5819, or Y857 or a deletion of amino acid P793 of SEQ ID NO: 2.

    [0250] In some embodiments, a CasX variant protein comprises at least one modification compared to the reference CasX sequence of SEQ ID NO:2, wherein the at least one modification is selected from one or more of: an amino acid substitution of L379R; an amino acid substitution of A708K; an amino acid substitution of T620P; an amino acid substitution of E385P; an amino acid substitution of Y857R; an amino acid substitution of I658V; an amino acid substitution of F399L; an amino acid substitution of Q252K; an amino acid substitution of L404K; and an amino acid deletion of [P793]. In another embodiment, a CasX variant protein comprises any combination of the foregoing substitutions or deletions compared to the reference CasX sequence of SEQ ID NO:2. In another embodiment, the CasX variant protein can, in addition to the foregoing substitutions or deletions, further comprise a substitution of an NTSB and/or a helical 1b domain from the reference CasX of SEQ ID NO:1.

    [0251] In some embodiments, a CasX variant protein comprises a sequence set forth in Table 1. In other embodiments, a CasX variant protein comprises a sequence at least 60% identical, at least 65% identical, at least 70% identical, at least 75% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical, at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, at least 99.5% identical to a sequence set forth in Table 1. In other embodiments, a CasX variant protein comprises a sequence set forth in Table 1, and further comprises one or more NLS disclosed herein on either the N-terminus, the C-terminus, or both. It will be understood that in some cases, the N-terminal methionine of the CasX variants of the Table is removed from the expressed CasX variant during post-translational modification.

    TABLE-US-00010 TABLE 1 CasX Variant Sequences Description* SEQ ID NO TSL, Helical I, Helical II, OBD and RuvC domains from SEQ ID NO: 2 252 and an NTSB domain from SEQ ID NO: 1 NTSB, Helical I, Helical II, OBD and RuvC domains from SEQ ID NO: 2 253 and a TSL domain from SEQ ID NO: 1. TSL, Helical I, Helical II, OBD and RuvC domains from SEQ ID NO: 1 254 and an NTSB domain from SEQ ID NO: 2 NTSB, Helical I, Helical II, OBD and RuvC domains from SEQ ID NO: 1 255 and an TSL domain from SEQ ID NO: 2. NTSB, TSL, Helical I, Helical II and OBD domains SEQ ID NO: 2 and an 256 exogenous RuvC domain or a portion thereof from a second CasX protein. No description 257 NTSB, TSL, Helical II, OBD and RuvC domains from SEQ ID NO: 2 and 258 a Helical I domain from SEQ ID NO: 1 NTSB, TSL, Helical I, OBD and RuvC domains from SEQ ID NO: 2 and a 259 Helical II domain from SEQ ID NO: 1 NTSB, TSL, Helical I, Helical II and RuvC domains from a first CasX 260 protein and an exogenous OBD or a part thereof from a second CasX protein No description 261 No description 262 substitution of L379R, a substitution of C477K, a substitution of A708K, a 263 deletion of P at position 793 and a substitution of T620P of SEQ ID NO: 2 substitution of M771A of SEQ ID NO: 2. 264 substitution of L379R, a substitution of A708K, a deletion of P at position 265 793 and a substitution of D732N of SEQ ID NO: 2. substitution of W782Q of SEQ ID NO: 2. 266 substitution of M771Q of SEQ ID NO: 2 267 substitution of R458I and a substitution of A739V of SEQ ID NO: 2. 268 L379R, a substitution of A708K, a deletion of P at position 793 and a 269 substitution of M771N of SEQ ID NO: 2 substitution of L379R, a substitution of A708K, a deletion of P at position 270 793 and a substitution of A739T of SEQ ID NO: 2 substitution of L379R, a substitution of C477K, a substitution of A708K, a 271 deletion of P at position 793 and a substitution of D489S of SEQ ID NO: 2. substitution of L379R, a substitution of C477K, a substitution of A708K, a 272 deletion of P at position 793 and a substitution of D732N of SEQ ID NO: 2. substitution of V711K of SEQ ID NO: 2. 273 substitution of L379R, a substitution of C477K, a substitution of A708K, a 274 deletion of P at position 793 and a substitution of Y797L of SEQ ID NO: 2. 119, substitution of L379R, a substitution of A708K and a deletion of P at 275 position 793 of SEQ ID NO: 2. substitution of L379R, a substitution of C477K, a substitution of A708K, a 276 deletion of P at position 793 and a substitution of M771N of SEQ ID NO: 2. substitution of A708K, a deletion of P at position 793 and a substitution of 277 E386S of SEQ ID NO: 2. substitution of L379R, a substitution of C477K, a substitution of A708K 278 and a deletion of P at position 793 of SEQ ID NO: 2. substitution of L792D of SEQ ID NO: 2. 279 substitution of G791F of SEQ ID NO: 2. 280 substitution of A708K, a deletion of P at position 793 and a substitution of 281 A739V of SEQ ID NO: 2. substitution of L379R, a substitution of A708K, a deletion of P at position 282 793 and a substitution of A739V of SEQ ID NO: 2. substitution of C477K, a substitution of A708K and a deletion of P at 283 position 793 of SEQ ID NO: 2. substitution of L249I and a substitution of M771N of SEQ ID NO: 2. 284 substitution of V747K of SEQ ID NO: 2. 285 substitution of L379R, a substitution of C477K, a substitution of A708K, a 286 deletion of P at position 793 and a substitution of M779N of SEQ ID NO: 2. L379R, F755M 287 429, L379R, A708K, P793_, Y857R 288 430, L379R, A708K, P793_, Y857R, I658V 289 431, L379R, A708K, P793_, Y857R, I658V, E386N 290 432, L379R, A708K, P793_, Y857R, I658V, L404K 291 433, L379R, A708K, P793_, Y857R, I658V, {circumflex over ( )}V192 292 434, L379R, A708K, P793_, Y857R, I658V, L404K, E386N 293 435, L379R, A708K, P793_, Y857R, I658V, F399L 294 436, L379R, A708K, P793_, Y857R, I658V, F399L, E386N 295 437, L379R, A708K, P793_, Y857R, I658V, F399L, C477S 296 438, L379R, A708K, P793_, Y857R, I658V, F399L, L404K 297 439, L379R, A708K, P793_, Y857R, I658V, F399L, E386N, C477S, L404K 298 440, L379R, A708K, P793_, Y857R, I658V, F399L, Y797L 299 441, L379R, A708K, P793_, Y857R, I658V, F399L, Y797L, E386N 300 442, L379R, A708K, P793_, Y857R, I658V, F399L, Y797L, E386N, 301 C477S, L404K 443, L379R, A708K, P793_, Y857R, I658V, Y797L 302 444, L379R, A708K, P793_, Y857R, I658V, Y797L, L404K 303 445, L379R, A708K, P793_, Y857R, I658V, Y797L, E386N 304 446, L379R, A708K, P793_, Y857R, I658V, Y797L, E386N, C477S, L404K 305 447, L379R, A708K, P793_, Y857R, E386N 306 448, L379R, A708K, P793_, Y857R, E386N, L404K 307 449, L379R, A708K, P793_, D732N, E385P, Y857R 308 450, L379R, A708K, P793_, D732N, E385P, Y857R, I658V 309 451, L379R, A708K, P793_, D732N, E385P, Y857R, I658V, F399L 310 452, L379R, A708K, P793_, D732N, E385P, Y857R, I658V, E386N 311 453, L379R, A708K, P793_, D732N, E385P, Y857R, I658V, L404K 312 454, L379R, A708K, P793_, T620P, E385P, Y857R, Q252K 313 455, L379R, A708K, P793_, T620P, E385P, Y857R, I658V, Q252K 314 456, L379R, A708K, P793_, T620P, E385P, Y857R, I658V, E386N, Q252K 315 457, L379R, A708K, P793_, T620P, E385P, Y857R, I658V, F399L, Q252K 316 458, L379R, A708K, P793_, T620P, E385P, Y857R, I658V, L404K, Q252K 317 459, L379R, A708K, P793_, T620P, Y857R, I658V, E386N 318 460, L379R, A708K, P793_, T620P, E385P, Q252K 319 278 320 279 321 280 322 285 323 286 324 287 325 288 326 290 327 291 328 293 329 300 330 492 331 493 332 387 333 395 334 485 335 486 336 487 337 488 338 489 339 490 340 491 341 494 342 387 343 395 344 485 345 486 346 487 347 488 348 489 349 490 350 491 351 494 352 328, S867G 4229 388, L379R + A708K + [P793] + X1 Helical2 swap 4230 389, L379R + A708K + [P793] + X1 RuvC1 swap 4231 390, L379R + A708K + [P793] + X1 RuvC2 swap 4232 *Strain indicated numerically; changes, where indicated, are relative to SEQ ID NO: 2

    [0252] In some embodiments, the CasX variant protein comprises between 400 and 2000 amino acids, between 500 and 1500 amino acids, between 700 and 1200 amino acids, between 800 and 1100 amino acids or between 900 and 1000 amino acids.

    [0253] In other embodiments, the variant is RNA, and the one or more improved characteristics are independently selected from the group consisting of improved stability, improved solubility, improved resistance to nuclease activity, and improved binding to a binding partner.

    [0254] In some embodiments, the variant is a guide RNA that binds to a CRISPR associated protein, and the one or more improved characteristics are independently selected from the group consisting of improved stability, improved solubility, improved resistance to nuclease activity, improved binding affinity to a Cas protein, improved binding affinity to a target DNA, improved gene editing, and improved specificity. In some embodiments, the variant is a guide RNA, wherein the variant has one or more altered activities compared to a reference. In some embodiments, the variant guide RNA has altered PAM specificity compared to a reference gRNA, for example has specificity for a different PAM sequence than the reference guide RNA.

    [0255] In some embodiments, wherein the variant is a guide RNA variant, the one or more improved characteristics are improved compared to a reference gRNA of SEQ ID NO: 4. In other embodiments, wherein the variant is a guide RNA variant, the one or more improved characteristics are improved compared to a reference gRNA of SEQ ID NO: 5.

    [0256] In still further embodiments, the variant is DNA. In some embodiments, the DNA variant encodes an RNA variant or protein variant. In certain embodiments, the encoded RNA or DNA has one or more improved characteristics as described herein.

    [0257] In some embodiments, a biomolecule variant produced by the methods disclosed herein (e.g., protein variant, RNA variant, or DNA variant) has improved stability relative to a reference biomolecule. In some embodiments, improved stability of the variant results in expression of a higher steady state of the variant, or a larger fraction of expressed variant that remains folded in a functional conformation. In some embodiments, increased stability relative to the reference results in needing a lower concentration of the variant for use in a functional context, for example in gene editing. Thus, in some embodiments, the variant has improved efficiency compared to a reference in one or more functional contexts, which may include gene editing. In some embodiments, wherein the biomolecule is a Cas protein or guide RNA, the variant has improved stability of the variant Cas protein:guide-NA complex (e.g., a Cas protein:guide-RNA complex) relative to the reference biomolecule. Improved stability of the complex may, in some embodiments, lead to improved editing efficiency. In some embodiments, improved stability includes faster folding kinetics, or slower unfolding kinetics, or a larger free energy release upon folding, or a higher temperature at which 50% of the biomolecule is unfolded (Tm), or any combinations thereof, relative to the reference biomolecule. In some embodiments, folding kinetics of the biomolecule variant are improved relative to a reference biomolecule by at least about 1 kJ/mol, at least about 5 kJ/mol, at least about 10 kJ/mol, at least about 20 kJ/mol, at least about 30 kJ/mol, at least about 40 kJ/mol, at least about 50 kJ/mol, at least about 60 kJ/mol, at least about 70 kJ/mol, at least about 80 kJ/mol, at least about 90 kJ/mol, at least about 100 kJ/mol, at least about 150 kJ/mol, at least about 200 kJ/mol, at least about 250 kJ/mol, at least about 300 kJ/mol, at least about 350 kJ/mol, at least about 400 kJ/mol, at least about 450 kJ/mol, or at least about 500 kJ/mol. In some embodiments, improved stability of comprises a higher Tm relative to a reference biomolecule. In some embodiments, the Tm of the biomolecule protein variant is between about 20° C. to about 30° C., between about 30° C. to about 40° C., between about 40° C. to about 50° C., between about 50° C. to about 60° C., between about 60° C. to about 70° C., between about 70° C. to about 80° C., between about 80° C. to about 90° C. or between about 90° C. to about 100° C.

    [0258] In some embodiments, a biomolecule variant has improved thermostability relative to a reference biomolecule. In some embodiments, a biomolecule variant as described herein has improved thermostability compared to a reference biomolecule at a temperature of at least 20° C., at least 22° C., at least 24° C., at least 26° C., at least 28° C., at least 30° C., at least 32° C., at least 34° C., at least 35° C., at least 36° C., at least 37° C., at least 38° C., at least 39° C., at least 40° C., at least 41° C., at least 42° C., at least 43° C., at least 44° C., at least 45° C., at least 46° C., at least 47° C., at least 48° C., at least 49° C., at least 50° C., at least 52° C., or greater, or between 10° C. to 60° C., between 10° C. to 50° C., between 10° C. to 40° C., between 20° C. to 40° C., or between 30° C. to 40° C. In certain variations, improved thermostability includes a higher proportion of the biomolecule remains soluble, a higher proportion of the biomolecule remains in a folded state, a higher proportion of the biomolecule retains activity, or a higher proportion of the biomolecule has a greater level of activity, or any combinations thereof, relative to the reference. In some embodiments, wherein the biomolecule is a Cas protein or guide RNA, a biomolecule variant has improved thermostability of a Cas protein:guide-NA complex compared to the reference biomolecule (e.g., a Cas protein:guide-RNA complex).

    [0259] Methods of measuring characteristics of protein stability such as Tm and the free energy of unfolding are known to persons of ordinary skill in the art, and can be measured using standard biochemical techniques in vitro. For example, Tm may be measured using Differential Scanning calorimetry, a thermoanalytical technique in which the difference in the amount of heat required to increase the temperature of a sample and a reference is measured as a function of temperature. Alternatively, or in addition, biomolecule Tm may be measured using commercially available methods such as the ThermoFisher Protein Thermal Shift system. Alternatively, or in addition, circular dichroism may be used to measure the kinetics of folding and unfolding, as well as the Tm. Circular dichroism (CD) relies on the unequal absorption of left-handed and right-handed circularly polarized light by asymmetric molecules such as proteins. Certain structures of proteins, for example alpha-helices and beta-sheets, have characteristic CD spectra. Accordingly, in some embodiments, CD may be used to determine the secondary structure of a biomolecule.

    [0260] Exemplary amino acid changes that can increase the stability of a protein variant relative to a reference protein may include, but are not limited to, amino acid changes that increase the number of hydrogen bonds within the protein variant, increase the number of disulfide bridges within the protein variant, increase the number of salt bridges within the protein variant, strengthen interactions between parts of the protein variant, increase the number of electrostatic interactions, or any combinations thereof, relative to the reference protein.

    [0261] In some embodiments, the biomolecule variant has improved solubility compared to a reference biomolecule. In certain embodiments, wherein the biomolecule is a protein, an improvement in protein solubility leads to higher yield of protein from protein purification techniques such as purification from E. coli. Improved solubility of protein variants may, in some embodiments, enable more efficient activity in cells, as a more soluble protein may be less likely to aggregate in cells. Protein aggregates can in certain embodiments be toxic or burdensome on cells, and, without wishing to be bound by any theory, increased solubility of a protein variant may ameliorate this result of protein aggregation. Further, improved solubility of protein variants (such as CasX variants) may allow for the delivery of a higher effective dose of functional protein, for example in a desired gene editing application. In some embodiments, improved solubility of a protein variant relative to a reference protein results in improved yield of the protein variant during purification of a factor of at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 250, at least about 500, or at least about 1000. In some embodiments, improved solubility of a protein variant relative to a reference protein improves activity of the protein variant in cells by a factor of at least about 1.1, at least about 1.2, at least about 1.3, at least about 1.4, at least about 1.5, at least about 1.6, at least about 1.7, at least about 1.8, at least about 1.9, at least about 2, at least about 2.1, at least about 2.2, at least about 2.3, at least about 2.4, at least about 2.5, at least about 2.6, at least about 2.7, at least about 2.8, at least about 2.9, at least about 3, at least about 3.5, at least about 4, at least about 4.5, at least about 5, at least about 5.5, at least about 6, at least about 6.5, at least about 7.0, at least about 7.5, at least about 8, at least about 8.5, at least about 9, at least about 9.5, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, or at least about 15. In some embodiments, the activity in cells of the variant relative to the CasX reference protein is improved by a factor of about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10. In some embodiments, the protein variant is a CasX variant.

    [0262] Methods of measuring protein solubility, and improvements thereof in protein variants, will be readily apparent to the person of ordinary skill in the art. For example, protein variant solubility can in some embodiments be measured by taking densitometry readings on a gel of the soluble fraction of lysed E. coli. Alternatively, or addition, improvements in protein variant solubility can be measured by measuring the maintenance of soluble protein product through the course of a full protein purification. For example, soluble protein product can be measured at one or more steps of gel affinity purification, tag cleavage, cation exchange purification, and/or running the protein on a sizing column. In some embodiments, the densitometry of every band of protein on a gel is read after each step in the purification process. Variant proteins with improved solubility may, in some embodiments, maintain a higher concentration at one or more steps in the protein purification process when compared to the reference protein, while an insoluble protein variant may be lost at one or more steps due to buffer exchanges, filtration steps, interactions with a purification column, and the like.

    [0263] In some embodiments, improving the solubility of protein variants results in a higher yield in terms of mg/L of protein during protein purification when compared to a reference protein.

    [0264] In some embodiments, improving the solubility of CasX variant proteins enables a greater amount of editing events compared to a less soluble protein when assessed in editing assays such as the EGFP disruption assays described herein.

    [0265] In some embodiments, a biomolecule variant has improved resistance to degradative activity compared to a reference biomolecule, such as an improved resistance to nuclease (e.g., when the biomolecule is RNA) or protease (e.g., when the biomolecule is a protein) activity. In some such embodiments, increased resistance to degradative activity may result in improved functional activity.

    [0266] In some embodiments, a biomolecule variant has improved affinity for a binding partner relative to a reference biomolecule. For example, in some embodiments, the biomolecule is a Cas protein, and the Cas protein variant has greater affinity for a gRNA than the reference Cas protein. In other embodiments, the biomolecule is a gRNA, and the gRNA variant has greater affinity for a Cas protein binding partner than the reference gRNA. In some embodiments, increased affinity of a biomolecule variant for a binding partner results in increased stability of the binding complex, such as when delivered to human cells. This increased stability can affect function and utility of the complex (e.g., in the cells of a subject, or intravenously). In some embodiments, increased affinity of a biomolecule variant and the resulting increased stability of the target complex results in lower levels of complex being needed to achieve the same functional outcome as when using the reference biomolecule. In certain embodiments, for example wherein the biomolecule is a gRNA or a Cas protein, the binding partner is DNA. In certain embodiments, a ribonucleoprotein complex comprising a gRNA variant or Cas protein variant has improved affinity for target nucleic acid (e.g., DNA or RNA), relative to the affinity of an RNP comprising a reference biomolecule. In some embodiments, the target nucleic acid is DNA, such as dsDNA or ssDNA. In other embodiments, the target nucleic acid is RNA. In some embodiments, the improved affinity of the RNP for the target nucleic acid comprises improved affinity for the target sequence, improved affinity for the PAM sequence, improved ability of the RNP to search the nucleic acid for the target sequence, or any combinations thereof. In some embodiments, the improved affinity for the target nucleic acid is the result of increased overall nucleic acid binding affinity. In some embodiments, wherein the biomolecule variant is a gRNA variant, one or more mutations in the gRNA variant may result in an increase of affinity of a Cas protein partner for the protospacer adjacent motif (PAM), thereby increasing affinity of the Cas protein partner for target nucleic acid, when complexed with the gRNA. In some embodiments, the protein variant has an altered PAM specificity (e.g., specificity for a different PAM) compared to a reference gRNA. Methods of evaluating biomolecule affinity for a binding partner are readily known to one of skill in the art, and may include, for example, fluorescence polarization, biolayer interferometry, electrophoretic mobility shift assays (EMSAs), filter binding, isothermal calorimetry (ITC), and surface plasmon resonance (SPR). In some embodiments, the K.sub.d of a Cas protein variant for a gRNA (for example, a CasX variant protein for a gRNA) is increased relative to a reference Cas protein by a factor of at least about 1.1, at least about 1.2, at least about 1.3, at least about 1.4, at least about 1.5, at least about 1.6, at least about 1.7, at least about 1.8, at least about 1.9, at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100.

    [0267] In some embodiments, a Cas protein variant has improved specificity for a target nucleic acid (e.g., DNA such as dsDNA or ssDNA, or RNA) relative to a reference Cas protein. Improved specificity may include, for example, the degree to which a CRISPR/Cas system ribonucleoprotein complex cleaves off-target sequences that are similar, but not identical to the target nucleic acid. In some embodiments, a Cas protein variant has improved specificity for a target site within the target sequence that is complementary to the Spacer sequence of the gRNA. Methods of evaluating Cas protein (such as variant or reference) target specificity may include guide and Circularization for In vitro Reporting of Cleavage Effects by Sequencing (CIRCLE-seq); and assays used to detect and quantify indels (insertions and deletions) formed at selected off-target sites, such as mismatch-detection nuclease assays and next generation sequencing (NGS).

    [0268] In some embodiments, wherein the biomolecule is a Cas protein, the Cas protein variant has improved ability of unwinding DNA relative to a reference Cas protein. In some embodiments, a Cas protein variant has enhanced DNA unwinding characteristics. Methods of measuring the ability of Cas proteins (such as variant or reference) to unwind DNA include, but are not limited to, in vitro assays that observe increased on rates of dsDNA targets in fluorescence polarization or biolayer interferometry. In some embodiments, affinity of a Cas protein variant (such as a CasX variant protein) for a target DNA molecule is increased relative to a reference Cas protein by a factor of at least about 1.1, at least about 1.2, at least about 1.3, at least about 1.4, at least about 1.5, at least about 1.6, at least about 1.7, at least about 1.8, at least about 1.9, at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100.

    [0269] In some embodiments, a ribonucleoprotein complex comprising a biomolecule variant as described herein has improved catalytic activity compared to a reference biomolecule. For example, wherein the biomolecule is a catalytic protein (such as a Cas protein), in certain embodiments the biomolecule variant has improved catalytic efficiency, specificity, or activity, compared to a reference biomolecule. Such catalytic activity may include cleavage of a nucleic acid sequence (e.g., DNA such as dsDNA or ssDNA, or RNA) wherein the biomolecule is a Cas protein. In some embodiments, improved affinity for nucleotides of a Cas protein variant also improves the function of catalytically inactive versions of the Cas protein variant (such as a CasX variant protein). In some embodiments, the catalytically inactive version of the Cas protein variant comprises one or mutations the DED motif in the RuvC. Catalytically dead Cas protein variants can, in some embodiments, be used for base editing or epigenetic modifications. With a higher affinity for nucleotides, in some embodiments catalytically dead Cas protein variants can find their target nucleic acid faster, remain bound to target nucleic acid for longer periods of time, bind target nucleic acid in a more stable fashion, or a combination thereof, thereby improving the function of the catalytically dead Cas protein variant.

    [0270] In some embodiments, wherein a reduction of a certain characteristic is a desired trait, a biomolecule variant obtained through the methods described herein has said desired reduction. Such embodiments may result in a biomolecule variant that is better suited for a certain task.

    [0271] In some embodiments, the one or more improved characteristics of the variant have an improvement by a factor of at least 1.1, at least 1.2, at least 1.3, at least 1.4, at least 1.5, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 125, at least 150, at least 175, or at least 200 fold compared to the reference biomolecule. In some embodiments, the improvement is between 1.1 to 5, between 1.1 to 10, between 1.1 to 20, between 5 to 10, between 5 to 20, between 5 to 50, between 10 to 20, between 10 to 30, between 10 to 50, between 10 to 100, between 50 to 100, between 50 to 150, between 50 to 200, between 70 to 100, between 70 to 150, between 100 to 150, between 100 to 200, or between 150 to 200 fold compared to the reference biomolecule. In still further embodiments, the one or more improved characteristics of the variant have an improvement of greater than 1.1, greater than 1.2, greater than 1.3, greater than 1.4, greater than 1.5, greater than 5, greater than 10, greater than 20, greater than 30, greater than 40, greater than 50, greater than 60, greater than 70, greater than 80, greater than 90, greater than 100, greater than 125, greater than 150, greater than 175, or greater than 200, compared to the reference biomolecule.

    [0272] In some embodiments, the variant comprises at least one improved characteristic. In other embodiments, the variant comprises at least two improved characteristics. In further embodiments, the variant comprises at least three improved characteristics. In some embodiments, the variant comprises at least four improved characteristics. In still further embodiments, the variant comprises at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, or more improved characteristics.

    [0273] In certain embodiments, wherein the variant is a protein, the variant comprises between 2 and 10,000 amino acids, between 100 and 10,000 amino acids, between 100 and 8,000 amino acids, between 100 and 6,000 amino acids, between 100 and 5,000 amino acids, between 100 and 4,000 amino acids, between 100 and 3,000 amino acids, between 100 and 2,000 amino acids, between 100 and 1,000 amino acids, between 100 and 1,500 amino acids, between 500 and 1,000 amino acids, between 500 and 1,500 amino acids, between 500 and 2,000 amino acids, between 1,000 and 3,000 amino acids, between 1,000 and 2,000 amino acids, between 2,000 and 10,000 amino acids, between 4,000 and 10,000 amino acids, between 6,000 and 10,000 amino acids, or between 8,000 and 10,000 amino acids.

    [0274] In certain embodiments, wherein the variant is RNA or DNA, the variant comprises between 2 and 10,000 nucleotides, between 2 to 5,000 nucleotides, between 2 to 2,000 nucleotides, between 2 to 1,000 nucleotides, between 2 to 500 nucleotides, between 2 to 300 nucleotides, between 2 to 200 nucleotides, between 2 to 150 nucleotides, between 50 to 300 nucleotides, between 50 to 200 nucleotides, between 50 to 150 nucleotides, between 50 to 100 nucleotides, between 100 and 10,000 nucleotides, between 100 and 8,000 nucleotides, between 100 and 6,000 nucleotides, between 100 and 5,000 nucleotides, between 100 and 4,000 nucleotides, between 100 and 3,000 nucleotides, between 100 and 2,000 nucleotides, between 100 and 1,000 nucleotides, between 100 and 150 nucleotides, between 100 and 200 nucleotides, between 500 and 1,000 nucleotides, between 500 and 1,500 nucleotides, between 500 and 2,000 nucleotides, between 1,000 and 3,000 nucleotides, between 1,000 and 2,000 nucleotides, between 2,000 and 10,000 nucleotides, between 4,000 and 10,000 nucleotides, between 6,000 and 10,000 nucleotides, or between 8,000 and 10,000 nucleotides. In some embodiments, the variant is RNA. In certain embodiments, the RNA is a CRISPR associated guide RNA, the size of the variant excludes the size of the spacer region.

    [0275] Table 2 provides the sequences of reference gRNAs tracr, cr and scaffold sequences. In some embodiments, the disclosure provides gNA sequences wherein the gNA has a scaffold comprising a sequence having at least one nucleotide modification relative to a reference gNA sequence having a sequence of any one of SEQ ID NOS: 4-16 of Table 2. It will be understood that in those embodiments wherein a vector comprises a DNA encoding sequence for a gNA, or where a gNA is a gDNA or a chimera of RNA and DNA, that thymine (T) bases can be substituted for the uracil (U) bases of any of the gNA sequence embodiments described herein.

    TABLE-US-00011 TABLE 2 Reference gRNA tracr, cr and scaffold sequences SEQ ID NO. Nucleotide Sequence  4 ACAUCUGGCGCGUUUAUUCCAUUACUUUGGAGCCAGUCCCAGCGACUAUGUCG UAUGGACGAAGCGCUUAUUUAUCGGAGAGAAACCGAUAAGUAAAACGCAUCAA AG  5 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCGU AUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAUAAGAAGCAUCAA AG  6 ACAUCUGGCGCGUUUAUUCCAUUACUUUGGAGCCAGUCCCAGCGACUAUGUCG UAUGGACGAAGCGCUUAUUUAUCGGAGA  7 ACAUCUGGCGCGUUUAUUCCAUUACUUUGGAGCCAGUCCCAGCGACUAUGUCG UAUGGACGAAGCGCUUAUUUAUCGG  8 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCGU AUGGGUAAAGCGCUUAUUUAUCGGAGA  9 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCGU AUGGGUAAAGCGCUUAUUUAUCGG 10 GUUUACACACUCCCUCUCAUAGGGU 11 GUUUACACACUCCCUCUCAUGAGGU 12 UUUUACAUACCCCCUCUCAUGGGAU 13 GUUUACACACUCCCUCUCAUGGGGG 14 CCAGCGACUAUGUCGUAUGG 15 GCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAUAAGAAGC 16 GGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCGUAUGG GUAAAGCGCUUAUUUAUCGGA

    [0276] In another aspect, the disclosure relates to guide nucleic acid variants (referred to herein alternatively as “gNA variant” or “gRNA variant”), which comprise one or more modifications relative to a reference gRNA scaffold. As used herein, “scaffold” refers to all parts to the gNA necessary for gNA function with the exception of the spacer sequence.

    [0277] In some embodiments, a gNA variant comprises one or more nucleotide substitutions, insertions, deletions, or swapped or replaced regions relative to a reference gRNA sequence of the disclosure. In some embodiments, a mutation can occur in any region of a reference gRNA to produce a gNA variant. In some embodiments, the scaffold of the gNA variant sequence has at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70%, at least 80%, at least 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to the sequence of SEQ ID NO: 4 or SEQ ID NO: 5.

    [0278] In some embodiments, a gNA variant comprises one or more nucleotide changes within one or more regions of the reference gRNA that improve a characteristic of the reference gRNA. Exemplary regions include the RNA triplex, the pseudoknot, the scaffold stem loop, and the extended stem loop. In some cases, the variant scaffold stem further comprises a bubble. In other cases, the variant scaffold further comprises a triplex loop region. In still other cases, the variant scaffold further comprises a 5′ unstructured region. In one embodiment, the gNA variant scaffold comprises a scaffold stem loop having at least 60% sequence identity to SEQ ID NO: 14. In another embodiment, the gNA variant comprises a scaffold stem loop having the sequence of CCAGCGACUAUGUCGUAGUGG (SEQ ID NO: 353).

    [0279] All gNA variants that have one or more improved functions or characteristics, or add one or more new functions when the variant gNA is compared to a reference gRNA described herein, are envisaged as within the scope of the disclosure. A representative example of such a gNA variant created by the methods described herein is guide 174 (SEQ ID NO: 2238), the design of which is described in the Examples. In some embodiments, the gNA variant adds a new function to the RNP comprising the gNA variant. In some embodiments, the gNA variant has an improved characteristic selected from: improved stability; improved solubility; improved transcription of the gNA; improved resistance to nuclease activity; increased folding rate of the gNA; decreased side product formation during folding; increased productive folding; improved binding affinity to a CasX protein; improved binding affinity to a target DNA when complexed with a CasX protein; improved gene editing when complexed with a CasX protein; improved specificity of editing when complexed with a CasX protein; and improved ability to utilize a greater spectrum of one or more PAM sequences, including ATC, CTC, GTC, or TTC, in the editing of target DNA when complexed with a CasX protein, or any combination thereof. In some cases, the one or more of the improved characteristics of the gNA variant is at least about 1.1 to about 100,000-fold improved relative to the reference gNA of SEQ ID NO: 4 or SEQ ID NO: 5. In other cases, the one or more of the improved characteristics of the gNA variant is at least about 1.1, at least about 10, at least about 100, at least about 1000, at least about 10,000, at least about 100,000-fold or more improved relative to the reference gNA of SEQ ID NO: 4 or SEQ ID NO: 5. In other cases, the one or more of the improved characteristics of the gNA variant is about 1.1 to 100,00×, about 1.1 to 10,00×, about 1.1 to 1,000×, about 1.1 to 500×, about 1.1 to 100×, about 1.1 to 50×, about 1.1 to 20×, about 10 to 100,00×, about 10 to 10,00×, about 10 to 1,000×, about 10 to 500×, about 10 to 100×, about 10 to 50×, about 10 to 20×, about 2 to 70×, about 2 to 50×, about 2 to 30×, about 2 to 20×, about 2 to 10×, about 5 to 50×, about 5 to 30×, about 5 to 10×, about 100 to 100,00×, about 100 to 10,00×, about 100 to 1,000×, about 100 to 500×, about 500 to 100,00×, about 500 to 10,00×, about 500 to 1,000×, about 500 to 750×, about 1,000 to 100,00×, about 10,000 to 100,00×, about 20 to 500×, about 20 to 250×, about 20 to 200×, about 20 to 100×, about 20 to 50×, about 50 to 10,000×, about 50 to 1,000×, about 50 to 500×, about 50 to 200×, or about 50 to 100×, improved relative to the reference gNA of SEQ ID NO: 4 or SEQ ID NO: 5. In other cases, the one or more of the improved characteristics of the gNA variant is about 1.1×, 1.2×, 1.3×, 1.4×, 1.5×, 1.6×, 1.7×, 1.8×, 1.9×, 2×, 3×, 4×, 5×, 6×, 7×, 8×, 9×, 10×, 11×, 12×, 13×, 14×, 15×, 16×, 17×, 18×, 19×, 20×, 25×, 30×, 40×, 45×, 50×, 55×, 60×, 70×, 80×, 90×, 100×, 110×, 120×, 130×, 140×, 150×, 160×, 170×, 180×, 190×, 200×, 210×, 220×, 230×, 240×, 250×, 260×, 270×, 280×, 290×, 300×, 310×, 320×, 330×, 340×, 350×, 360×, 370×, 380×, 390×, 400×, 425×, 450×, 475×, or 500× improved relative to the reference gNA of SEQ ID NO: 4 or SEQ ID NO: 5.

    [0280] In some embodiments, a gNA variant can be created by subjecting a reference gRNA to a one or more mutagenesis methods, such as the mutagenesis methods described herein, below, which may include Deep Mutational Evolution (DME), deep mutational scanning (DMS), error prone PCR, cassette mutagenesis, random mutagenesis, staggered extension PCR, gene shuffling, or domain swapping, in order to generate the gNA variants of the disclosure. The activity of reference gRNAs may be used as a benchmark against which the activity of gNA variants are compared, thereby measuring improvements in function of gNA variants. In other embodiments, a reference gRNA may be subjected to one or more deliberate, targeted mutations, substitutions, or domain swaps in order to produce a gNA variant, for example a rationally designed variant. Exemplary gRNA variants produced by such methods are described in the Examples and representative sequences of gNA scaffolds are presented in Table 3.

    [0281] In some embodiments, the gNA variant comprises one or more modifications compared to a reference guide nucleic acid scaffold sequence, wherein the one or more modification is selected from: at least one nucleotide substitution in a region of the gNA variant; at least one nucleotide deletion in a region of the gNA variant; at least one nucleotide insertion in a region of the gNA variant; a substitution of all or a portion of a region of the gNA variant; a deletion of all or a portion of a region of the gNA variant; or any combination of the foregoing. In some cases, the modification is a substitution of 1 to 15 consecutive or non-consecutive nucleotides in the gNA variant in one or more regions. In other cases, the modification is a deletion of 1 to 10 consecutive or non-consecutive nucleotides in the gNA variant in one or more regions. In other cases, the modification is an insertion of 1 to 10 consecutive or non-consecutive nucleotides in the gNA variant in one or more regions. In other cases, the modification is a substitution of the scaffold stem loop or the extended stem loop with an RNA stem loop sequence from a heterologous RNA source with proximal 5′ and 3′ ends. In some embodiments, the gNA variant comprises an extended stem loop region comprising at least 10, at least 100, at least 500, at least 1000, or at least 10,000 nucleotides. In some embodiments, the heterologous stem loop increases the stability of the gNA. In some embodiments, the heterologous RNA stem loop is capable of binding a protein, an RNA structure, a DNA sequence, or a small molecule. In some embodiments, an exogenous stem loop region comprises an RNA stem loop or hairpin, for example a thermostable RNA such as MS2 (ACAUGAGGAUUACCCAUGU; SEQ ID NO: 354), Qβ (UGCAUGUCUAAGACAGCA; SEQ ID NO: 355), U1 hairpin II (AAUCCAUUGCACUCCGGAUU; SEQ ID NO: 356), Uvsx (CCUCUUCGGAGG; SEQ ID NO: 357), PP7 (AGGAGUUUCUAUGGAAACCCU; SEQ ID NO: 358), Phage replication loop (AGGUGGGACGACCUCUCGGUCGUCCUAUCU; SEQ ID NO: 359), Kissing loop_a (UGCUCGCUCCGUUCGAGCA; SEQ ID NO: 360), Kissing loop_b1 (UGCUCGACGCGUCCUCGAGCA; SEQ ID NO: 361), Kissing loop_b2 (UGCUCGUUUGCGGCUACGAGCA; SEQ ID NO: 362), G quadriplex M3q (AGGGAGGGAGGGAGAGG; SEQ ID NO: 363), G quadriplex telomere basket (GGUUAGGGUUAGGGUUAGG; SEQ ID NO: 364), Sarcin-ricin loop (CUGCUCAGUACGAGAGGAACCGCAG; SEQ ID NO: 365) or Pseudoknots (UACACUGGGAUCGCUGAAUUAGAGAUCGGCGUCCUUUCAUUCUAUAUACUUUGG AGUUUUAAAAUGUCUCUAAGUACA; SEQ ID NO: 366). In some embodiments, an exogenous stem loop comprises a long non-coding RNA (lncRNA). As used herein, a lncRNA refers to a non-coding RNA that is longer than approximately 200 bp in length. In some embodiments, the 5′ and 3′ ends of the exogenous stem loop are base paired, i.e., interact to form a region of duplex RNA. In some embodiments, the 5′ and 3′ ends of the exogenous stem loop are base paired, and one or more regions between the 5′ and 3′ ends of the exogenous stem loop are not base paired.

    [0282] In some cases, a gNA variant of the disclosure comprises two or more modifications in one region. In other cases, a gNA variant of the disclosure comprises modifications in two or more regions. In other cases, a gNA variant comprises any combination of the foregoing modifications described in this paragraph. In some embodiments, exemplary modifications of gNA of the disclosure include the modifications of Table 3.

    [0283] In some embodiments, a 5′ G is added to a gNA variant sequence for expression in vivo, as transcription from a U6 promoter is more efficient and more consistent with regard to the start site when the +1 nucleotide is a G. In other embodiments, two 5′ Gs are added to a gNA variant sequence for in vitro transcription to increase production efficiency, as T7 polymerase strongly prefers a G in the +1 position and a purine in the +2 position. In some cases, the 5′ G bases are added to the reference scaffolds of Table 2. In other cases, the 5′ G bases are added to the variant scaffolds of Table 3.

    [0284] Table 3 provides exemplary gNA variant scaffold sequences of the disclosure created by the methods of the disclosure. In Table 3, (−) indicates a deletion at the specified position(s) relative to the reference sequence of SEQ ID NO: 5, (+) indicates an insertion of the specified base(s) at the position indicated relative to SEQ ID NO: 5, (:) indicates the range of bases at the specified start:stop coordinates of a deletion or substitution relative to SEQ ID NO: 5, and multiple insertions, deletions or substitutions are separated by commas; e.g., A14C, T17G. In some embodiments, the gNA variant scaffold comprises any one of the sequences listed in Table 3, or SEQ ID NOS: 2101-2280, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity thereto. In some embodiments, the gNA variant comprises one or more additional changes to a sequence of any one of SEQ ID NOs: 2201-2280. In some embodiments, the gNA variant comprises the sequence of any one of SEQ ID NOS: 2236, 2237, 2238, 2241, 2244, 2248, 2249, or 2259-2280, or having at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity thereto. In some embodiments, the gNA variant comprises one or more additional changes to a sequence of any one of SEQ ID NOs: 2201-2280. In some embodiments of the gNA variants of the disclosure, the gNA variant comprises at least one modification, wherein the at least one modification compared to the reference guide scaffold of SEQ ID NO: 5 is selected from one or more of: (a) a C18G substitution in the triplex loop; (b) a G55 insertion in the stem bubble; (c) a U1 deletion; (d) a modification of the extended stem loop wherein (i) a 6 nt loop and 13 loop-proximal base pairs are replaced by a Uvsx hairpin; and (ii) a deletion of A99 and a substitution of G65U that results in a loop-distal base that is fully base-paired. In some embodiments, the gNA variant comprises the sequence of any one of SEQ ID NOS: 2236, 2237, 2238, 2241, 2244, 2248, 2249, or 2259-2280. It will be understood that in those embodiments wherein a vector comprises a DNA encoding sequence for a gNA, or where a gNA is a gDNA or a chimera of RNA and DNA, that thymine (T) bases can be substituted for the uracil (U) bases of any of the gNA sequence embodiments described herein.

    TABLE-US-00012 TABLE 3 Exemplary gNA Variant Scaffold Sequences SEQ ID NAME or NO: Modification NUCLEOTIDE SEQUENCE 2101 phage UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA replication UGUCGUAUGGGUAAAGCGCAGGUGGGACGACCUCUCGGUCGUCCUAU stable CUGAAGCAUCAAAG 2102 Kissing UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA loop_b1 UGUCGUAUGGGUAAAGCGCUGCUCGACGCGUCCUCGAGCAGAAGCAU CAAAG 2103 Kissing UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA loop_a UGUCGUAUGGGUAAAGCGCUGCUCGCUCCGUUCGAGCAGAAGCAUCA AAG 2104 32, uvsX GUACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACU hairpin AUGUCGUAUGGGUAAAGCGCCCUCUUCGGAGGGAAGCAUCAAAG 2105 PP7 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCAGGAGUUUCUAUGGAAACCCUGAAGCAU CAAAG 2106 64, trip mut, GUACUGGCGCCUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACU extended stem AUGUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAU truncation CAAAG 2107 hyperstable UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA tetraloop UGUCGUAUGGGUAAAGCGCUGCGCUUGCGCAGAAGCAUCAAAG 2108 C18G UACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU AAGAAGCAUCAAAG 2109 T17G UACUGGCGCUUUUAUCGCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU AAGAAGCAUCAAAG 2110 CUUCGG UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA loop UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGACUUCGGUCCGAUAA AUAAGAAGCAUCAAAG 2111 MS2 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCACAUGAGGAUUACCCAUGUGAAGCAUCA AAG 2112 -1, A2G, -78, GCUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAU G77T GUCGUAUGGGUAAAGCGCUUAUUUAUCGUGAGAAAUCCGAUAAAUAA GAAGCAUCAAAG 2113 QB UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUGCAUGUCUAAGACAGCAGAAGCAUCAA AG 2114 45, 44 hairpin UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCAGGGCUUCGGCCGAAGCAUCAAAG 2115 U1A UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCAAUCCAUUGCACUCCGGAUUGAAGCAUC AAAG 2116 A14C, T17G UACUGGCGCUUUUCUCGCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU AAGAAGCAUCAAAG 2117 CUUCGG UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA loop modified UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGACUUCGGUCCGAUAAAU AAGAAGCAUCAAAG 2118 Kissing UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA loop_b2 UGUCGUAUGGGUAAAGCGCUGCUCGUUUGCGGCUACGAGCAGAAGCA UCAAAG 2119 -76:78, -83:87 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUUAUCGAGAGAUAAAUAAGAAGCA UCAAAG 2120 -4 UACGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAU GUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAUA AGAAGCAUCAAAG 2121 extended stem UACUGGCGCCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACU truncation AUGUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAU CAAAG 2122 C55 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUCGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU AAGAAGCAUCAAAG 2123 trip mut UACUGGCGCCUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGACUUCGGUCCGAUAAAU AAGAAGCAUCAAAG 2124 -76:78 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUUAUCGAGAAAUCCGAUAAAUAAG AAGCAUCAAAG 2125 -1:5 GCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCG UAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAUAAGAA GCAUCAAAG 2126 -83:87 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAGAUAAAUAAGAA GCAUCAAAG 2127 =+G28, A82T, UACUGGCGCUUUUAUCUCAUUACUUUGGAGAGCCAUCACCAGCGACU -84, AUGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGUAUCCGAUAAAU AAGAAGCAUCAAAG 2128 =+51T UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAA UAAGAAGCAUCAAAG 2129 -1:4, +G5A, AGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUC +G86, GUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUGCCGAUAAAUAAG AAGCAUCAAAG 2130 =+A94 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAA UAAGAAGCAUCAAAG 2131 =+G72 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUGUAUCGGAGAGAAAUCCGAUAAA UAAGAAGCAUCAAAG 2132 shorten front, GCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCG CUUCGG UAUGGGUAAAGCGCUUAUUUAUCGGACUUCGGUCCGAUAAAUAAGCG loop modified. CAUCAAAG extend extended 2133 A14C UACUGGCGCUUUUCUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU AAGAAGCAUCAAAG 2134 -1:3, +G3 GUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUG UCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAUAA GAAGCAUCAAAG 2135 =+C45, +T46 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACCU UAUGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAA AUAAGAAGCAUCAAAG 2136 CUUCGG GAUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAU loop modified, GUCGUAUGGGUAAAGCGCUUAUUUAUCGGACUUCGGUCCGAUAAAUA fun start AGAAGCAUCAAAG 2137 -93:94 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAA GAAGCAUCAAAG 2138 =+T45 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGAUCU AUGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAA UAAGAAGCAUCAAAG 2139 -69, -94 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGGCUUAUUUAUCGGAGAGAAAUCCGAUAAAAA GAAGCAUCAAAG 2140 -94 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAA AGAAGCAUCAAAG 2141 modified UACUGGCGCUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAU CUUCGG, GUCGUAUGGGUAAAGCGCUUAUUUAUCGGACUUCGGUCCGAUAAAUA minus T in 1st AGAAGCAUCAAAG triplex 2142 -1:4, +C4, CGGCGCUUUUCUCGCAUUACUUUGAGAGCCAUCACCAGCGACUAUGU A14C, T17G, CGUAUGGGUAAAGCGCUUAUUGUAUCGAGAGAUAAAUAAGAAGCAUC +G72, -76:78, AAAG -83:87 2143 T1C, -73 CACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUUUCGGAGAGAAAUCCGAUAAAUA AGAAGCAUCAAAG 2144 Scaffold UACUGGCGCUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUUC uuCG, stem GGUCGUAUGGGUAAAGCGCUUAUGUAUCGGCUUCGGCCGAUACAUAA uuCG. Stem GAAGCAUCAAAG swap, t shorten 2145 Scaffold UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUU uuCG, stem CGGUCGUAUGGGUAAAGCGCUUAUGUAUCGGCUUCGGCCGAUACAUA uuCG. Stem AGAAGCAUCAAAG swap 2146 =+G60 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUGAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAA UAAGAAGCAUCAAAG 2147 no stem UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUU Scaffold CGGUCGUAUGGGUAAAG uuCG 2148 no stem GAUGGGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUUCG Scaffold GUCGUAUGGGUAAAG uuCG, fun start 2149 Scaffold GAUGGGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUUCG uuCG, stem GUCGUAUGGGUAAAGCGCUUAUUUAUCGGCUUCGGCCGAUAAAUAAG uuCG, fun AAGCAUCAAAG start 2150 Pseudoknots UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUACACUGGGAUCGCUGAAUUAGAGAUCG GCGUCCUUUCAUUCUAUAUACUUUGGAGUUUUAAAAUGUCUCUAAGU ACAGAAGCAUCAAAG 2151 Scaffold GGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUUCGGU uuCG, stem CGUAUGGGUAAAGCGCUUAUUUAUCGGCUUCGGCCGAUAAAUAAGAA uuCG GCAUCAAAG 2152 Scaffold GCUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUUC uuCG, stem GGUCGUAUGGGUAAAGCGCUUAUUUAUCGGCUUCGGCCGAUAAAUAA uuCG, no start GAAGCAUCAAAG 2153 Scaffold UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUU uuCG CGGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAA UAAGAAGCAUCAAAG 2154 =+GCTC36 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUGCUCCACCAGCG ACUAUGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAU AAAUAAGAAGCAUCAAAG 2155 G quadriplex UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA telomere UGUCGUAUGGGUAAAGCGGGGUUAGGGUUAGGGUUAGGGAAGCAUCA basket+ ends AAG 2156 G quadriplex UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA M3q UGUCGUAUGGGUAAAGCGGAGGGAGGGAGGGAGAGGGAAAGCAUCAA AG 2157 G quadriplex UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA telomere UGUCGUAUGGGUAAAGCGUUGGGUUAGGGUUAGGGUUAGGGAAAAGC basket no ends AUCAAAG 2158 45, 44 hairpin UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA (old version) UGUCGUAUGGGUAAAGCGC--------AGGGCUUCGGCCG------- --GAAGCAUCAAAG 2159 Sarcin-ricin UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA loop UGUCGUAUGGGUAAAGCGCCUGCUCAGUACGAGAGGAACCGCAGGAA GCAUCAAAG 2160 uvsX, C18G UACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCCCUCUUCGGAGGGAAGCAUCAAAG 2161 truncated stem UACUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUA loop, C18G, UGUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUC trip mut AAAG (T10C) 2162 short phage UACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUA rep, C18G UGUCGUAUGGGUAAAGCGCGGACGACCUCUCGGUCGUCCGAAGCAUC AAAG 2163 phage rep UACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUA loop, C18G UGUCGUAUGGGUAAAGCGCAGGUGGGACGACCUCUCGGUCGUCCUAU CUGAAGCAUCAAAG 2164 =+G18, UACUGGCGCCUUUAUCUGCAUUACUUUGAGAGCCAUCACCAGCGACU stacked onto AUGUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAU 64 CAAAG 2165 truncated stem GCUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU loop, C18G, -1 GUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUCA A2G AAG 2166 phage rep UACUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUA lpop, C18G, UGUCGUAUGGGUAAAGCGCAGGUGGGACGACCUCUCGGUCGUCCUAU trip mut CUGAAGCAUCAAAG (T10C) 2167 short phage UACUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUA rep, C18G, UGUCGUAUGGGUAAAGCGCGGACGACCUCUCGGUCGUCCGAAGCAUC trip mut AAAG (T10C) 2168 uvsX, trip mut UACUGGCGCCUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA (T10C) UGUCGUAUGGGUAAAGCGCCCUCUUCGGAGGGAAGCAUCAAAG 2169 truncated stem UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA loop UGUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUC AAAG 2170 =+A17, UACUGGCGCCUUUAUCAUCAUUACUUUGAGAGCCAUCACCAGCGACU stacked onto AUGUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAU 64 CAAAG 2171 3′ HDV UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA genomic UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU ribozyme AAGAAGCAUCAAAGGGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCC GGCUGGGCAACAUUCCGAGGGGACCGUCCCCUCGGUAAUGGCGAAUG GGACCC 2172 phage rep UACUGGCGCCUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA loop, trip mut UGUCGUAUGGGUAAAGCGCAGGUGGGACGACCUCUCGGUCGUCCUAU (T10C) CUGAAGCAUCAAAG 2173 -79:80 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAAAUCCGAUAAAUAA GAAGCAUCAAAG 2174 short phage UACUGGCGCCUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA rep, trip mut UGUCGUAUGGGUAAAGCGCGGACGACCUCUCGGUCGUCCGAAGCAUC (T10C) AAAG 2175 extra UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA truncated stem UGUCGUAUGGGUAAAGCGCCGGACUUCGGUCCGGAAGCAUCAAAG loop 2176 T17G, C18G UACUGGCGCUUUUAUCGGAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU AAGAAGCAUCAAAG 2177 short phage UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA rep UGUCGUAUGGGUAAAGCGCGGACGACCUCUCGGUCGUCCGAAGCAUC AAAG 2178 uvsX, C18G, -1 GCUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU A2G GUCGUAUGGGUAAAGCGCCCUCUUCGGAGGGAAGCAUCAAAG 2179 uvsX, C18G, GCUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU trip mut GUCGUAUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG (T10C), -1 A2G, HDV  -99 G65U 2180 3′ HDV UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA antigenomic UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU ribozyme AAGAAGCAUCAAAGGGGUCGGCAUGGCAUCUCCACCUCCUCGCGGUC CGACCUGGGCAUCCGAAGGAGGACGCACGUCCACUCGGAUGGCUAAG GGAGAGCCA 2181 uvsX, C18G, GCUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU trip mut GUCGUAUGGGUAAAGCGCCCUCUUCGGAGGGCGCAUCAAAG (T10C), -1 A2G, HDV AA(98:99)C 2182 3′ HDV UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA ribozyme UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU (Lior Nissim, AAGAAGCAUCAAAGUUUUGGCCGGCAUGGUCCCAGCCUCCUCGCUGG Timothy Lu) CGCCGGCUGGGCAACAUGCUUCGGCAUGGCGAAUGGGACCCCGGG 2183 TAC(1:3)GA, GAUGGCGCCUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAU stacked onto GUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUCA 64 AAG 2184 uvsX, -1 A2G GCUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAU GUCGUAUGGGUAAAGCGCCCUCUUCGGAGGGAAGCAUCAAAG 2185 truncated stem GCUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU loop, C18G, GUCGUAUGGGUAAAGCUCUUACGGACUUCGGUCCGUAAGAGCAUCAA trip mut AG (T10C), -1 A2G, HDV -99 G65U 2186 short phage GCUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU rep, C18G, GUCGUAUGGGUAAAGCUCGGACGACCUCUCGGUCGUCCGAGCAUCAA trip mut AG (T10C), -1 A2G, HDV -99 G65U 2187 3′ sTRSV WT UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA viral UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU Hammerhead AAGAAGCAUCAAAGCCUGUCACCGGAUGUGCUUUCCGGUCUGAUGAG ribozyme UCCGUGAGGACGAAACAGG 2188 short phage GCUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU rep, C18G, -1 GUCGUAUGGGUAAAGCGCGGACGACCUCUCGGUCGUCCGAAGCAUCA A2G AAG 2189 short phage GCUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU rep, C18G, GUCGUAUGGGUAAAGCGCGGACGACCUCUCGGUCGUCCGAAGCAUCA trip mut AAG (T10C), -1 A2G, 3′ genomic HDV 2190 phage rep GCUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU loop, C18G, GUCGUAUGGGUAAAGCUCAGGUGGGACGACCUCUCGGUCGUCCUAUC trip mut UGAGCAUCAAAG (T10C), -1 A2G, HDV -99 G65U 2191 3′ HDV UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA ribozyme UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU (Owen Ryan, AAGAAGCAUCAAAGGAUGGCCGGCAUGGUCCCAGCCUCCUCGCUGGC Jamie Cate) GCCGGCUGGGCAACACCUUCGGGUGGCGAAUGGGAC 2192 phage rep GCUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU loop, C18G, -1 GUCGUAUGGGUAAAGCGCAGGUGGGACGACCUCUCGGUCGUCCUAUC A2G UGAAGCAUCAAAG 2193 0.14 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUACUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAA UAAGAAGCAUCAAAG 2194 -78, G77T UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUUAUCGUGAGAAAUCCGAUAAAUA AGAAGCAUCAAAG 2195 GUACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACU AUGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAA UAAGAAGCAUCAAAG 2196 short phage GCUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAU rep, -1 A2G GUCGUAUGGGUAAAGCGCGGACGACCUCUCGGUCGUCCGAAGCAUCA AAG 2197 truncated stem GCUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU loop, C18G, GUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUCA trip mut AAG (T10C), -1 A2G 2198 -1, A2G GCUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAU GUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAUA AGAAGCAUCAAAG 2199 truncated stem GCUGGCGCCUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAU loop, trip mut GUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUCA (T10C), -1 AAG A2G 2200 uvsX, C18G, GCUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU trip mut GUCGUAUGGGUAAAGCGCCCUCUUCGGAGGGAAGCAUCAAAG (T10C), -1 A2G 2201 phage rep GCUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAU loop, -1 A2G GUCGUAUGGGUAAAGCGCAGGUGGGACGACCUCUCGGUCGUCCUAUC UGAAGCAUCAAAG 2202 phage rep GCUGGCGCCUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAU loop, trip mut GUCGUAUGGGUAAAGCGCAGGUGGGACGACCUCUCGGUCGUCCUAUC (T10C), -1 UGAAGCAUCAAAG A2G 2203 phage rep GCUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU loop, C18G, GUCGUAUGGGUAAAGCGCAGGUGGGACGACCUCUCGGUCGUCCUAUC trip mut UGAAGCAUCAAAG (T10C), -1 A2G 2204 truncated stem UACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUA loop, C18G UGUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUC AAAG 2205 uvsX, trip mut GCUGGCGCCUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAU (T10C), -1 GUCGUAUGGGUAAAGCGCCCUCUUCGGAGGGAAGCAUCAAAG A2G 2206 truncated stem GCUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAU loop, -1 A2G GUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUCA AAG 2207 short phage GCUGGCGCCUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAU rep, trip mut GUCGUAUGGGUAAAGCGCGGACGACCUCUCGGUCGUCCGAAGCAUCA (T10C), -1 AAG A2G 2208 5′HDV GAUGGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAAC ribozyme ACCUUCGGGUGGCGAAUGGGACUACUGGCGCUUUUAUCUCAUUACUU (Owen Ryan, UGAGAGCCAUCACCAGCGACUAUGUCGUAUGGGUAAAGCGCUUAUUU Jamie Cate) AUCGGAGAGAAAUCCGAUAAAUAAGAAGCAUCAAAG 2209 5′HDV GGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAACAUU genomic CCGAGGGGACCGUCCCCUCGGUAAUGGCGAAUGGGACCCUACUGGCG ribozyme CUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCGUAU GGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAUAAGAAGCA UCAAAG 2210 truncated stem GCUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU loop, C18G, GUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGCGCAUCAA trip mut AG (T10C), -1 A2G, HDV AA(98:99)C 2211 5′env25 pistol CGUGGUUAGGGCCACGUUAAAUAGUUGCUUAAGCCCUAAGCGUUGAU ribozyme CUUCGGAUCAGGUGCAAUACUGGCGCUUUUAUCUCAUUACUUUGAGA (with an added GCCAUCACCAGCGACUAUGUCGUAUGGGUAAAGCGCUUAUUUAUCGG CUUCGG AGAGAAAUCCGAUAAAUAAGAAGCAUCAAAG loop) 2212 5′HDV GGGUCGGCAUGGCAUCUCCACCUCCUCGCGGUCCGACCUGGGCAUCC antigenomic GAAGGAGGACGCACGUCCACUCGGAUGGCUAAGGGAGAGCCAUACUG ribozyme GCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCG UAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAUAAGAA GCAUCAAAG 2213 3′ UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA Hammerhead UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU ribozyme AAGAAGCAUCAAAGCCAGUACUGAUGAGUCCGUGAGGACGAAACGAG (Lior Nissim, UAAGCUCGUCUACUGGCGCUUUUAUCUCAU Timothy Lu) guide scaffold scar 2214 =+A27, UACUGGCGCCUUUAUCUCAUUACUUUAGAGAGCCAUCACCAGCGACU stacked onto AUGUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAU 64 CAAAG 2215 5′Hammerhead CGACUACUGAUGAGUCCGUGAGGACGAAACGAGUAAGCUCGUCUAGU ribozyme CGUACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGAC (Lior Nissim, UAUGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAA Timothy Lu) AUAAGAAGCAUCAAAG smaller scar 2216 phage rep GCUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU loop, C18G, GUCGUAUGGGUAAAGCGCAGGUGGGACGACCUCUCGGUCGUCCUAUC trip mut UGCGCAUCAAAG (T10C), -1 A2G, HDV AA(98:99)C 2217 -27, stacked UACUGGCGCCUUUAUCUCAUUACUUUAGAGCCAUCACCAGCGACUAU onto 64 GUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUCA AAG 2218 3′ Hatchet UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU AAGAAGCAUCAAAGCAUUCCUCAGAAAAUGACAAACCUGUGGGGCGU AAGUAGAUCUUCGGAUCUAUGAUCGUGCAGACGUUAAAAUCAGGU 2219 3 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA Hammerhead UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU ribozyme AAGAAGCAUCAAAGCGACUACUGAUGAGUCCGUGAGGACGAAACGAG (Lior Nissim, UAAGCUCGUCUAGUCGCGUGUAGCGAAGCA Timothy Lu) 2220 5′Hatchet CAUUCCUCAGAAAAUGACAAACCUGUGGGGCGUAAGUAGAUCUUCGG AUCUAUGAUCGUGCAGACGUUAAAAUCAGGUUACUGGCGCUUUUAUC UCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCGUAUGGGUAAAG CGCUUAUUUAUCGGAGAGAAAUCCGAUAAAUAAGAAGCAUCAAAG 2221 5′HDV UUUUGGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAA ribozyme CAUGCUUCGGCAUGGCGAAUGGGACCCCGGGUACUGGCGCUUUUAUC (Lior Nissim, UCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCGUAUGGGUAAAG Timothy Lu) CGCUUAUUUAUCGGAGAGAAAUCCGAUAAAUAAGAAGCAUCAAAG 2222 5′Hammerhead CGACUACUGAUGAGUCCGUGAGGACGAAACGAGUAAGCUCGUCUAGU ribozyme CGCGUGUAGCGAAGCAUACUGGCGCUUUUAUCUCAUUACUUUGAGAG (Lior Nissim, CCAUCACCAGCGACUAUGUCGUAUGGGUAAAGCGCUUAUUUAUCGGA Timothy Lu) GAGAAAUCCGAUAAAUAAGAAGCAUCAAAG 2223 3′ HH15 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA Minimal UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU Hammerhead AAGAAGCAUCAAAGGGGAGCCCCGCUGAUGAGGUCGGGGAGACCGAA ribozyme AGGGACUUCGGUCCCUACGGGGCUCCC 2224 5′ RBMX CCACCCCCACCACCACCCCCACCCCCACCACCACCCUACUGGCGCUU recruiting UUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCGUAUGGG motif UAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAUAAGAAGCAUCA AAG 2225 3′ UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA Hammerhead UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU ribozyme AAGAAGCAUCAAAGCGACUACUGAUGAGUCCGUGAGGACGAAACGAG (Lior Nissim, UAAGCUCGUCUAGUCG Timothy Lu) smaller scar 2226 3′ env25 pistol UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA ribozyme UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU (with an added AAGAAGCAUCAAAGCGUGGUUAGGGCCACGUUAAAUAGUUGCUUAAG CUUCGG CCCUAAGCGUUGAUCUUCGGAUCAGGUGCAA loop) 2227 3′ Env-9 UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA Twister UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU AAGAAGCAUCAAAGGGCAAUAAAGCGGUUACAAGCCCGCAAAAAUAG CAGAGUAAUGUCGCGAUAGCGCGGCAUUAAUGCAGCUUUAUUG 2228 =+ATTATCT UACUGGCGCUUUUAUCUCAUUACUAUUAUCUCAUUACUUUGAGAGCC CATTACT25 AUCACCAGCGACUAUGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGA GAAAUCCGAUAAAUAAGAAGCAUCAAAG 2229 5′Env-9 GGCAAUAAAGCGGUUACAAGCCCGCAAAAAUAGCAGAGUAAUGUCGC Twister GAUAGCGCGGCAUUAAUGCAGCUUUAUUGUACUGGCGCUUUUAUCUC AUUACUUUGAGAGCCAUCACCAGCGACUAUGUCGUAUGGGUAAAGCG CUUAUUUAUCGGAGAGAAAUCCGAUAAAUAAGAAGCAUCAAAG 2230 3′ Twisted UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA Sister 1 UGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAU AAGAAGCAUCAAAGACCCGCAAGGCCGACGGCAUCCGCCGCCGCUGG UGCAAGUCCAGCCGCCCCUUCGGGGGCGGGCGCUCAUGGGUAAC 2231 no stem UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUA UGUCGUAUGGGUAAAG 2232 5′HH15 GGGAGCCCCGCUGAUGAGGUCGGGGAGACCGAAAGGGACUUCGGUCC Minimal CUACGGGGCUCCCUACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCA Hammerhead UCACCAGCGACUAUGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAG ribozyme AAAUCCGAUAAAUAAGAAGCAUCAAAG 2233 5′Hammerhead CCAGUACUGAUGAGUCCGUGAGGACGAAACGAGUAAGCUCGUCUACU ribozyme GGCGCUUUUAUCUCAUUACUGGCGCUUUUAUCUCAUUACUUUGAGAG (Lior Nissim, CCAUCACCAGCGACUAUGUCGUAUGGGUAAAGCGCUUAUUUAUCGGA Timothy Lu) GAGAAAUCCGAUAAAUAAGAAGCAUCAAAG guide scaffold scar 2234 5′Twisted ACCCGCAAGGCCGACGGCAUCCGCCGCCGCUGGUGCAAGUCCAGCCG Sister 1 CCCCUUCGGGGGCGGGCGCUCAUGGGUAACUACUGGCGCUUUUAUCU CAUUACUUUGAGAGCCAUCACCAGCGACUAUGUCGUAUGGGUAAAGC GCUUAUUUAUCGGAGAGAAAUCCGAUAAAUAAGAAGCAUCAAAG 2235 5′sTRSV WT CCUGUCACCGGAUGUGCUUUCCGGUCUGAUGAGUCCGUGAGGACGAA viral ACAGGUACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGC Hammerhead GACUAUGUCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGA ribozyme UAAAUAAGAAGCAUCAAAG 2236 148, =+G55, GUACUGGCGCCUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACU stacked onto AUGUCGUAGUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCA 64 UCAAAG 2237 158, GUACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACU 103 + 148 (+G55) AUGUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG -99, G65U 2238 174, Uvsx ACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU Extended stem GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG with [A99] G65U), C18G, {circumflex over ( )}G55, [GT-1] 2239 175, extended ACUGGCGCCUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAU stem GUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUCA truncation, AAG T10C, [GT-1] 2240 176, 174 with GCUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU A1G GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG substitution for T7 transcription 2241 177, 174 with ACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU bubble (+G55) GUCGUAUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG removed 2242 181, stem 42 ACUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU (truncated GUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUCA stem loop); AAG T10C, C18G, [GT-1] (95+[GT-1]) 2243 182, stem 42 ACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU (truncated GUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUCA stem loop); AAG C18G, [GT-1] 2244 183, stem 42 ACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU (truncated GUCGUAGUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUC stem loop); AAAG C18G, {circumflex over ( )}G55, [GT-1] 2245 184, stem 48 ACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU (uvsx, -99 GUCGUAUUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG g65t); C18G, {circumflex over ( )}T55, [GT-1] 2246 185, stem 42 ACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU (truncated GUCGUAUUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUC stem loop); AAAG C18G, {circumflex over ( )}T55, [GT-1] 2247 186, stem 42 ACUGGCGCCUUUAUCAUCAUUACUUUGAGAGCCAUCACCAGCGACUA (truncated UGUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUC stem loop); AAAG T10C, {circumflex over ( )}A17, [GT-1] 2248 187, stem 46 ACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU (uvsx); GUCGUAGUGGGUAAAGCGCCCUCUUCGGAGGGAAGCAUCAAAG C18G, {circumflex over ( )}G55, [GT-1] 2249 188, stem 50 ACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU (ms2 U15C, GUCGUAGUGGGUAAAGCUCACAUGAGGAUCACCCAUGUGAGCAUCAA -99, g65t); AG C18G, {circumflex over ( )}G55, [GT-1] 2250 189, 174 + ACUGGCACUUUUACCUGAUUACUUUGAGAGCCAACACCAGCGACUAU G8A; T15C; GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG T35A 2251 190, 174 + ACUGGCACUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU G8A GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG 2252 191, 174 + ACUGGCCCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU G8C GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG 2253 192, 174 + ACUGGCGCUUUUACCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU T15C GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG 2254 193, 174 + ACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAACACCAGCGACUAU 135A GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG 2255 195, 175 + ACUGGCACCUUUACCUGAUUACUUUGAGAGCCAACACCAGCGACUAU C18G + GUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUCA G8A; T15C; AAG T35A 2256 196, 175+ ACUGGCACCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU C18G + G8A GUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUCA AAG 2257 197, 175 + ACUGGCCCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU C18G + G8C GUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUCA AAG 2258 198, 175 + ACUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAACACCAGCGACUAU C18G +T35A GUCGUAUGGGUAAAGCGCUUACGGACUUCGGUCCGUAAGAAGCAUCA AAG 2259 199, 174 + GCUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU A2G (test G GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG transcription at start; ccGCT...) 2260 200, 174 + GACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUA {circumflex over ( )}G1 UGUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG (ccGACT...) 2261 201, 174 + ACUGGCGCCUUUAUCUGAUUACUUUGGAGAGCCAUCACCAGCGACUA T10C; {circumflex over ( )}G28 UGUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG 2262 202, 174 + ACUGGCGCAUUUAUCUGAUUACUUUGUGAGCCAUCACCAGCGACUAU T10A; {circumflex over ( )}28T GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG 2263 203, 174 + ACUGGCGCCUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU T10C GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG 2264 204,174+ ACUGGCGCUUUUAUCUGAUUACUUUGGAGAGCCAUCACCAGCGACUA {circumflex over ( )}G28 UGUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG 2265 205, 174 + ACUGGCGCAUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU T10A GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG 2266 206, 174 + ACUGGCGCUUUUAUCUGAUUACUUUGUGAGCCAUCACCAGCGACUAU A28T GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG 2267 207, 174+ ACUGGCGCUUUUAUUCUGAUUACUUUGAGAGCCAUCACCAGCGACUA {circumflex over ( )}T15 UGUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG 2268 208, 174 + ACGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAUG [T4] UCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG 2269 209,174+ ACUGGCGCUUUUAUAUGAUUACUUUGAGAGCCAUCACCAGCGACUAU C16A GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG 2270 210, 174 + ACUGGCGCUUUUAUCUUGAUUACUUUGAGAGCCAUCACCAGCGACUA {circumflex over ( )}T17 UGUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG 2271 211, 174 + ACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAGCACCAGCGACUAU T35G GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG (compare with 174 + T35A above) 2272 212, 174 + ACUGGCGCUGUUAUCUGAUUACUUCGAGAGCCAUCACCAGCGACUAU U11G, GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCGAAG A105G (A86G), U26C 2273 213, 174 + ACUGGCGCUCUUAUCUGAUUACUUCGAGAGCCAUCACCAGCGACUAU U11C, GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCGAAG A105G (A86G), U26C 2274 214, ACUGGCGCUUGUAUCUGAUUACUCUGAGAGCCAUCACCAGCGACUAU 174 + U12G; GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAGAG A106G (A87G), U25C 2275 215, 174 + U12C; ACUGGCGCUUCUAUCUGAUUACUCUGAGAGCCAUCACCAGCGACUAU A106G GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAGAG (A87G), U25C 2276 216, ACUGGCGCUUUGAUCUGAUUACCUUGAGAGCCAUCACCAGCGACUAU 174_tx_11.G, GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAGG 87.G, 22.C 2277 217, ACUGGCGCUUUCAUCUGAUUACCUUGAGAGCCAUCACCAGCGACUAU 174_tx_11.C, GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAGG 87.G, 22.C 2278 218, 174 + ACUGGCGCUGUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU I11G GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG 2279 219, 174 + ACUGGCGCUUUUAUCUGAUUACUUUGAGAGCCAUCACCAGCGACUAU A105G GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCGAAG (A86G) 2280 220, 174 + ACUGGCGCUUUUAUCUGAUUACUUCGAGAGCCAUCACCAGCGACUAU U26C GUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAAAG

    [0285] VI. Methods of Constructing the Library

    [0286] The libraries described herein may be constructed in a variety of ways. Libraries may be constructed using, for example PCR-based mutagenesis, plasmid recombineering, or other methods known to one of skill in the art to generate protein and RNA variants. In some embodiments, a combination of methods are used to construct one or more variant libraries.

    [0287] In some embodiments, PCR-based mutagenesis is used to construct variant RNA libraries, such as sgRNA variant libraries. For example, in some embodiments, a PCR mutagenesis method using degenerate oligonucleotides is used to produce single nucleotide substitution variants. These degenerate oligonucleotides may be synthesized such that each locus of the primer that is complementary to the sgRNA locus has a 97% chance of being the wild type base, and a 1% chance of being each of the other three naturally occurring nucleotides. During PCR, the degenerate oligos may anneal to, and just beyond, the sgRNA scaffold within a small plasmid, amplifying the entire plasmid. The PCR product can then be purified, ligated, and transformed into a cell, such as E. coli, for screening. In other embodiments, a different PCR method is used to construct sgRNA scaffolds with single nucleotide insertions and deletions. For example, a unique PCR reaction is set up for each base pair intended for mutation. These PCR primers can be designed and paired such that PCR products will either be missing a base pair, or contain an additional inserted base pair. For inserted base pairs, PCR primers will insert a degenerate base such that all four possible naturally occurring nucleotides are represented in the final library.

    [0288] In some embodiments of the DME methods provided herein, mutations are incorporated into double stranded DNA encoding the biomolecule. This DNA can be maintained and replicated in a standard cloning vector, for example a bacterial plasmid, referred to herein as the target plasmid. In some embodiments, an exemplary target plasmid contains a DNA sequence encoding the reference biomolecule that will be subjected to DME, a bacterial origin of replication, and a suitable antibiotic resistance expression cassette. In some embodiments, the antibiotic resistance cassette confers resistance to Kanamycin, Ampicillin, Spectinomycin, Bleomycin, Streptomycin, Erythromycin, Tetracycline, or Chloramphenicol. In some embodiments, the antibiotic resistance cassette confers resistance to Kanamycin.

    [0289] Thus, in some embodiments, provided herein is a method of constructing a library of polynucleotide variants of a reference biomolecule, comprising: [0290] (a) constructing a polynucleotide that encodes for a variant of the reference biomolecule, wherein the reference biomolecule is a protein or RNA or DNA; [0291] wherein the polynucleotide encodes an alteration of one or more monomer locations of the reference biomolecule, wherein the monomer is an amino acid of the protein or ribonucleotide of the RNA or deoxyribonucleotide of DNA, and [0292] wherein each alteration of a monomer location is independently selected from the group consisting of substitution of the monomer, deletion of one or more consecutive monomers beginning at the location, and insertion of one or more consecutive monomers adjacent to the location; and [0293] (b) repeating the polynucleotide construction of (a) a sufficient number of times such that the library of polynucleotide represents variants comprising a single alteration of a single location for at least 1% of the monomer locations of the biomolecule.

    [0294] Said methods of polynucleotide library construction may be used to produce a polynucleotide library representing any of the variant libraries described herein. For example, such methods may be used to construct a library of polynucleotides representing variants comprising a single alteration of a single location for at least 5%, at least 10%, at least 30%, at least 70%, at least 90%, or any other % described herein of the total monomer locations of the reference biomolecule; or variants comprising substitution of the monomer, variants comprising deletion of one or more monomers beginning at the location, and variants comprising insertion of one or more new monomers adjacent to the location for at least 1%, at least 5%, at least 10%, at least 30%, at least 50%, at least 70%, at least 90%, or other % of monomer locations; and wherein insertion comprises insertion of one to four monomers; or deletion comprises deletion of one to four monomers; or substitution comprises substitution with each of the other naturally occurring monomers; or variants each independently comprising alteration of one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more locations, wherein the library as a whole represents alteration of at least 5%, at least 10%, at least 30%, at least 70%, or at least 90% of the total locations of the reference biomolecule; or any combinations thereof, or any other variant libraries described herein. In some embodiments, each variant biomolecule independently comprises alteration of between one to twenty, between one to ten, between one to five, between five to ten, between five to fifteen, between five to twenty, between ten to fifteen, between ten to twenty, between fifteen to twenty, or between three to seven, or between three to ten monomer locations.

    [0295] A library comprising said variants can be constructed in a variety of ways. In certain embodiments, plasmid recombineering is used to construct a library. Such methods can use DNA oligonucleotides encoding one or more mutations to incorporate said mutations into a plasmid encoding the reference biomolecule. For biomolecule variants with a plurality of mutations, in some embodiments more than one oligonucleotide is used. In some embodiments, the DNA oligonucleotides encoding one or more mutations wherein the mutation region is flanked by between 10 and 100 nucleotides of homology to the target plasmid, both 5′ and 3′ to the mutation. Such oligonucleotides can in some embodiments be commercially synthesized and used in PCR amplification. An exemplary template for an oligonucleotide encoding a mutation is provided below [0296] 5′-(N).sub.10-100−Mutation−(N′).sub.10-100−3′
    wherein the region encoding the mutation is flanked on the 5′ and 3′ ends by between 10 to 100 (independently) nucleotides that are homologous to the target plasmid (e.g., “homology arms”). The region encoding the desired mutation or mutations will comprise three nucleotides encoding an amino acid (for substitutions or single insertions), or zero nucleotides (for deletions). In some embodiments the oligonucleotide encodes insertion of greater than one amino acid. For example, wherein the oligonucleotide encodes the insertion of X amino acids, the region encoding the desired mutation comprises 3*X nucleotides encoding the X amino acids. In some embodiments, the mutation region encodes more than one mutation, for example mutations to two or more monomers of a biomolecule that are in close proximity (e.g., next to each other, or within 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, or more monomers of each other).

    [0297] Such exemplary oligonucleotides may, for example, encode protein variants or RNA variants. For example, wherein the reference biomolecule is a protein, 40 different amino acid mutations to a single monomer in a protein can be encoded using 40 different oligonucleotides comprising the same set of homology arms (e.g., substitution with each of the 19 other naturally occurring amino acids, single insertion of each of the 20 naturally occurring amino acids, and single deletion of the original amino acid). In some embodiments, wherein the reference biomolecule is RNA, 8 possible oligonucleotides, using one set of homology arms, can be used to encode the 8 different nucleotide mutations to a single monomer (e.g., substitution with each of the other three naturally occurring nucleotides, single insertion of each of the 4 naturally occurring nucleotides, and single deletion of the original nucleotide). In some embodiments, wherein one or more non-natural monomers is used, additional oligonucleotides are constructed. In some embodiments, different pairs of homology arms (e.g., pairs of homology arms of different lengths) can be used to encode variants of the same target monomer or monomers.

    [0298] Nucleotide sequences code for particular amino acid monomers in a substitution or insertion mutation in an oligo as described herein will be known to the person of ordinary skill in the art. For example, TTT or TTC triplets can be used to encode phenylalanine; TTA, TTG, CTT, CTC, CTA or CTG can be used to encode leucine; ATT, ATC or ATA can be used to encode isoleucine; ATG can be used to encode methionine; GTT, GTC, GTA or GTG c can be used to encode valine; TCT, TCC, TCA, TCG, AGT or AGC can be used to encode serine; CCT, CCC, CCA or CCG can be used to encode proline; ACT, ACC, ACA or ACG can be used to encode threonine; GCT, GCC, GCA or GCG can be used to encode alanine; TAT or TAC can be used to encode tyrosine; CAT or CAC can be used to encode histidine; CAA or CAG can be used to encode glutamine, AAT or AAC can be used to encode asparagine; AAA or AAG can be used to encode lysine; GAT or GAC can be used to encode aspartic acid; GAA or GAG can be used to encode glutamic acid; TGT or TGC c can be used to encode cysteine; TGG can be used to encode tryptophan; CGT, CGC, CGA, CGG, AGA or AGG can be used to encode arginine; and GGT, GGC, GGA or GGG can be used to encode glycine. In addition, ATG is used for initiation of the peptide synthesis as well as for methionine and TAA, TAG and TGA can be used to encode for the termination of the peptide synthesis.

    [0299] In some exemplary embodiments where the reference biomolecule undergoing DME is an RNA, 8 different oligonucleotides, using the same set of homology arms, encode the above enumerated 8 different single nucleotide mutations for each nucleotide in the RNA that is targeted for DME. When the mutation is of a single ribonucleotide, the region of the oligo encoding the mutations can consist of the following nucleotide sequences: one nucleotide specifying a nucleotide (for substitutions or insertions), or zero nucleotides (for deletions). In some embodiments, the oligonucleotides are synthesized as single stranded DNA oligonucleotides. In some embodiments, all oligonucleotides targeting a particular amino acid or nucleotide of a biomolecule subjected to DME are pooled. In some embodiments, all oligonucleotides targeting a biomolecule subjected to DME are pooled. There is no limit to the type or number of mutations that can be created simultaneously in a library.

    [0300] Therefore, in some aspects, provided herein is a library of variant oligonucleotides, wherein: [0301] each variant oligonucleotide independently encodes an alteration of one or more sequential monomer locations of a reference biomolecule, wherein: [0302] the reference biomolecule is a protein, RNA, or DNA, [0303] the one or more monomers are one or more amino acids of the protein or ribonucleotides of the RNA or deoxyribonucleotide of the DNA, and [0304] wherein each alteration of a monomer location is independently selected from the group consisting of substitution of the monomer, deletion of one or more consecutive monomers beginning at the location, and insertion of one or more consecutive monomers adjacent to the location; [0305] each variant oligonucleotide comprises a pair of homology arms flanking the encoded alteration, wherein the homology arms are homologous to the reference biomolecule sequences flanking the corresponding monomer location alteration, and wherein each homology arm independently comprises between 10 to 100 nucleotides; and [0306] the library of variant oligonucleotides represents alteration of a single monomer for at least 1% of monomer locations.

    [0307] In some embodiments, the library of variant oligonucleotides represents alteration of a single monomer for at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% of monomer locations. In certain embodiments, the library of variant oligonucleotides represents alteration of a single monomer for between 10% to 100%, between 20% to 100%, between 30% to 100%, between 40% to 100%, between 50% to 100%, between 60% to 100%, between 70% to 100%, between 80% to 100, or between 90% to 100% of monomer locations. In some embodiments, the library of variant oligonucleotides represents a library of variant biomolecules, wherein each variant biomolecule independently comprises alteration of one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty or more locations, wherein the library as a whole represents alteration of at least 5%, at least 10%, at least 30%, at least 70%, or at least 90% of the total locations of the reference biomolecule. In some embodiments, the library of variant oligonucleotides represents a library of variant biomolecules, wherein each variant biomolecule independently comprises alteration of between one to twenty, between one to ten, between one to five, between five to ten, between five to fifteen, between five to twenty, between ten to fifteen, between ten to twenty, between fifteen to twenty, or between three to seven, or between three to ten monomer locations.

    [0308] Plasmid recombineering can then be used to recombine these synthetic mutations into a target gene of interest. In some embodiments of plasmid recombineering methods, a target plasmid encoding the reference protein, a standard bacterial origin of replication, and an antibiotic resistance cassette (e.g., an antibiotic resistance cassette conferring resistance to Kanamycin, Ampicillin, Spectinomycin, Bleomycin, Streptomycin, Erythromycin, Tetracycline, or Chloramphenicol) is constructed. A library of oligonucleotides encoding the desired mutation may be constructed, for example, through commercial synthesis. A plurality of plasmids and the library of oligonucleotides are combined and introduced into an expression cell, for example introduced into E. coli (such as EcNR2 cells) using electroporation. The electroporated cells are then grown in the presence of the antibiotic, selecting for cells that have been transformed with the plasmid. Plasmids from these transformed cells are isolated using standard methods known to one of skill in the art, resulting in a plurality of plasmids, into at least some of which an oligonucleotide encoding for the desired mutation has been incorporated. Thus, at least a portion of the plasmids encode for protein variants. The isolated plasmids may also include plasmids that encode the reference protein, without incorporating any mutations. For example, in some embodiments, a single round of plasmid recombineering may produce a plurality of plasmids in which 10-30% independently encode for protein variants. Performing another round of plasmid recombineering using the plurality of isolated plasmids with another library of oligonucleotides (either the same library or a new library) may, in some embodiments, increase the total percentage of plasmids that encode for a protein variant. In certain embodiments, performing additional rounds of plasmid recombineering using plasmids from the previous round also results in stacking of mutations, for example producing plasmids that encode for variants comprising two, three, four, five, or more monomer alterations.

    [0309] Therefore, in some aspects, provided herein is a vector library comprising a plurality of vectors, wherein each vector independently comprises one variant oligonucleotide of an oligonucleotide library as described herein. In certain embodiments, the vectors are constructed using plasmid recombineering. Exemplary vectors may include, but are not limited to, lentiviral vectors, adenoviral vectors, adeno-associated viral (AAV) vectors, and bacterial plasmids. In some embodiments, the vector is a bacterial plasmid further comprising a bacterial origin of replication and an antibiotic resistance expression cassette (e.g., conferring resistance to Kanamycin, Ampicillin, Spectinomycin, Bleomycin, Streptomycin, Erythromycin, Tetracycline or Chloramphenicol).

    [0310] Further provided are methods of selecting a biomolecule variant, comprising producing a library of reference biomolecule variants from a polynucleotide variant library as described herein, or a vector library as described herein; screening the library of biomolecule variants for one or more functional characteristics; and selecting a biomolecule variant from the library.

    [0311] In some embodiments, for certain libraries, methods of plasmid recombineering must be altered. For example, for some libraries, additional rounds plasmid recombineering are needed to construct enough vectors of sufficient diversity to adequately sample the desired alteration space of the reference molecule (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or more rounds). In certain embodiments, a higher concentration of oligos encoding the alterations must be combined with the plasmid vectors to construct enough vectors of sufficient diversity to adequately sample the desired alteration space of the reference molecule. In some variations, the number of additional rounds and/or increased concentration of oligos does not have a linear relationship with the increased sampling space needed. Certain parameters may therefore be affected by reference biomolecule size and/or level of desired diversity in the library, but cannot be derived directly in a linear relationship in some embodiments.

    [0312] In other embodiments, methods other than plasmid recombineering are used to construct one or more DME libraries, or a combination of plasmid recombineering and other methods are used to construct one or more DME libraries. For example, DME libraries may, in some embodiments, be constructed using one of the other mutational methods described herein. Such libraries may then be taken through the library screening as described herein, and further iterations be carried out if desired.

    [0313] Collectively, the methods of the disclosure result in variants of CasX proteins and guides that can form ribonucleoprotein complexes (RNP), or gene editing pairs, that, in some embodiments, have one or more improved characteristics compared to a gene editing pair of a reference CasX and reference guide RNA. Exemplary improved characteristics, as described herein, may in some embodiments, and include improved CasX:gNA RNP complex stability, improved binding affinity between the CasX and gNA, improved kinetics of RNP complex formation, higher percentage of cleavage-competent RNP, improved RNP binding affinity to the target DNA, improved unwinding of the target DNA, increased editing activity, improved editing efficiency, improved editing specificity, increased activity of the nuclease, increased target strand loading for double strand cleavage, decreased target strand loading for single strand nicking, decreased off-target cleavage, improved binding of the non-target strand of DNA, or improved resistance to nuclease activity. In the foregoing embodiments, the improvement is at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 50-fold, at least about 100-fold, at least about 500-fold, at least about 1000-fold, at least about 5000-fold, at least about 10,000-fold, or at least about 100,000-fold compared to the characteristic of a reference CasX protein and reference gNA pair. In other cases, the one or more of the improved characteristics may be improved about 1.1 to 100,00×, about 1.1 to 10,00×, about 1.1 to 1,000×, about 1.1 to 500×, about 1.1 to 100×, about 1.1 to 50×, about 1.1 to 20×, about 10 to 100,00×, about 10 to 10,00×, about 10 to 1,000×, about 10 to 500×, about 10 to 100×, about 10 to 50×, about 10 to 20×, about 2 to 70×, about 2 to 50×, about 2 to 30×, about 2 to 20×, about 2 to 10×, about 5 to 50×, about 5 to 30×, about 5 to 10×, about 100 to 100,00×, about 100 to 10,00×, about 100 to 1,000×, about 100 to 500×, about 500 to 100,00×, about 500 to 10,00×, about 500 to 1,000×, about 500 to 750×, about 1,000 to 100,00×, about 10,000 to 100,00×, about 20 to 500×, about 20 to 250×, about 20 to 200×, about 20 to 100×, about 20 to 50×, about 50 to 10,000×, about 50 to 1,000×, about 50 to 500×, about 50 to 200×, or about 50 to 100×, improved relative to a reference gene editing pair. In other cases, the one or more of the improved characteristics may be improved about 1.1×, 1.2×, 1.3×, 1.4×, 1.5×, 1.6×, 1.7×, 1.8×, 1.9×, 2×, 3×, 4×, 5×, 6×, 7×, 8×, 9×, 10×, 11×, 12×, 13×, 14×, 15×, 16×, 17×, 18×, 19×, 20×, 25×, 30×, 40×, 45×, 50×, 55×, 60×, 70×, 80×, 90×, 100×, 110×, 120×, 130×, 140×, 150×, 160×, 170×, 180×, 190×, 200×, 210×, 220×, 230×, 240×, 250×, 260×, 270×, 280×, 290×, 300×, 310×, 320×, 330×, 340×, 350×, 360×, 370×, 380×, 390×, 400×, 425×, 450×, 475×, or 500× improved relative to a reference gene editing pair. In some embodiments, the variant gene editing pair comprises a gNA variant comprising a sequence of any one of SEQ ID NOs: 2101-2280 and a CasX variant of Table 1. In some embodiments, the gene editing pair comprises a CasX selected from any one of CasX 119, CasX 438, CasX 457, CasX 488, or CasX 491 and a gNA selected from any one of SEQ ID NOS: 2104, 2106, or 2238.

    [0314] The description herein sets forth numerous exemplary configurations, methods, parameters, and the like. It should be recognized, however, that such description is not intended as a limitation on the scope of the present disclosure, but is instead provided as a description of exemplary embodiments.

    [0315] VII. Kits and Articles of Manufacture

    [0316] In some aspects, provided herein are kits comprising a biomolecule protein variant as described herein and a suitable container (for example a tube, vial or plate).

    [0317] In some embodiments, the biomolecule variant is a Cas protein variant (such as a CasX variant protein). In some embodiments, the biomolecule variant is a CasX variant protein, and the kit further comprises a CasX guide RNA variant as described herein, or the reference guide RNA of SEQ ID NO: 4 or SEQ ID NO: 5.

    [0318] In other embodiments, the biomolecule variant is a gRNA variant (such as a gRNA variant that binds to CasX). In some embodiments, the biomolecule variant is a CasX gRNA variant and the kit further comprises a CasX variant protein as described herein, or the reference CasX protein of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

    [0319] In certain embodiments, provided herein are kits comprising a CasX protein and gRNA pair comprising a CasX variant protein and a CasX gRNA variant as described herein.

    [0320] In some embodiments, the kit further comprises a buffer, a nuclease inhibitor, a protease inhibitor, a liposome, a therapeutic agent, a label, a label visualization reagent, or any combination of the foregoing. In some embodiments, the kit further comprises a pharmaceutically acceptable carrier, diluent or excipient.

    [0321] In some embodiments, the kit comprises appropriate control compositions for gene editing applications, and instructions for use.

    [0322] In some embodiments, the kit comprises a vector comprising a sequence encoding a CasX variant protein of the disclosure, a CasX gRNA variant of the disclosure, or a combination thereof.

    EXAMPLES

    [0323] The following Examples are merely illustrative and are not meant to limit any aspects of the present disclosure in any way.

    Example 1: Assays Used to Measure sgRNA and CasX Protein Activity

    [0324] Several assays were used to carry out initial screens of CasX protein and sgRNA DME libraries and engineered mutants, and to measure the activity of select protein and sgRNA variants relative to CasX reference sgRNAs and proteins.

    [0325] E. coli CRISPRi screen: Briefly, biological triplicates of dead CasX DME Libraries on a chloramphenicol (CM) resistant plasmid with a GFP guide RNA on a carbenicillin (Carb) resistant plasmid were transformed (at >5× library size) into MG1655 with genetically integrated and constitutively expressed GFP and RFP (see FIG. 13A-13B). Cells were grown overnight in EZ-RDM+Carb, CM and Anhydrotetracycline (aTc) inducer. E. coli were FACS sorted based on gates for the top 1% of GFP but not RFP repression, collected, and resorted immediately to further enrich for highly functional CasX molecules. Double sorted libraries were then grown out and DNA was collected for deep sequencing on a highseq. This DNA was also re-transformed onto plates and individual clones were picked for further analysis.

    [0326] E. coli Toxin selection: Briefly, carbenicillin resistant plasmid containing an arabinose inducible toxin were transformed into E. coli cells and made electrocompetent. Biological triplicates of CasX DME Libraries with a toxin targeted guide RNA on a chloramphenicol resistant plasmid were transformed (at >5× library size) into said cells and grown in LB+CM and arabinose inducer. E. coli that cleaved the toxin plasmid survived in the induction media and were grown to mid log and plasmids with functional CasX cleavers were recovered. This selection was repeated as needed. Selected libraries were then grown out and DNA was collected for deep sequencing on a highseq. This DNA was also re-transformed onto plates and individual clones were picked for further analysis and testing.

    [0327] Lentiviral based screen: Lentiviral particles were produced in HEK293 cells at a confluency of 70%-90% at time of transfection. Cells were transfected using polyethylenimine based transfection of plasmids containing a CasX DME library. Lentiviral vectors were co-transfected with the lentiviral packaging plasmid and the VSV-G envelope plasmids for particle production. Media was changed 12 hours post-transfection, and virus harvested at 36-48 hours post-transfection. Viral supernatants were filtered using 0.45 mm membrane filters, diluted in cell culture media if appropriate, and added to target cells HEK cells with an Integrated GFP reporter. Polybrene was supplemented to enhance transduction efficiency, if necessary. Transduced cells were selected for 24-48 hr post-transduction using puromycin and grown for 7-10 days. Cells were then sorted for GFP disruption & collected for highly functional CasX sgRNA or protein variants. Libraries were then Amplified via PCR directly from the genome and collected for deep sequencing on a highseq. This DNA could also be re-cloned and re-transformed onto plates and individual clones were picked for further analysis.

    [0328] Assaying editing efficiency of an EGFP reporter: To assay the editing efficiency of CasX reference sgRNAs and proteins and variants thereof, EGFP HEK293T reporter cells were seeded into 96-well plates and transfected according to the manufacturer's protocol with lipofectamine 3000 (Life Technologies) and 100-200 ng plasmid DNA encoding a reference or variant CasX protein, P2A—puromycin fusion and the reference or variant sgRNA. The next day cells were selected with 1.5 μg/ml puromycin for 2 days and analyzed by fluorescence-activated cell sorting (FACS) 7 days after selection to allow for clearance of EGFP protein from the cells. EGFP disruption via editing was traced using an Attune NxT Flow Cytometer and high-throughput autosampler.

    Example 2: Cleavage Efficiency of CasX Reference sgRNA

    [0329] The reference CasX sgRNA of SEQ ID NO: 4 (below) is described in WO 2018/064371, the contents of which are incorporated herein by reference.

    TABLE-US-00013 (SEQ ID NO: 4) ACAUCUGGCGCGUUUAUUCCAUUACUUUGGAGCCAGUCCCAGCGACUAU GUCGUAUGGACGAAGCGCUUAUUUAUCGGAGAGAAACCGAUAAGUAAAA CGCAUCAAAG.

    [0330] It was found that alterations to the sgRNA reference sequence of SEQ ID NO: 4, producing SEQ ID NO: 5 (below) were able to improve CasX cleavage efficiency.

    TABLE-US-00014 (SEQ ID NO: 5) UACUGGCGCUUUUAUCUCAUUACUUUGAGAGCCAUCACCAGCGACUAUG UCGUAUGGGUAAAGCGCUUAUUUAUCGGAGAGAAAUCCGAUAAAUAAGA AGCAUCAAAG.

    [0331] To assay the editing efficiency of CasX reference sgRNAs and variants thereof, EGFP HEK293T reporter cells were seeded into 96-well plates and transfected according to the manufacturer's protocol with lipofectamine 3000 (Life Technologies) and 100-200 ng plasmid DNA encoding a reference CasX protein, P2A—puromycin fusion and the sgRNA. The next day cells were selected with 1.5 μg/ml puromycin for 2 days and analyzed by fluorescence-activated cell sorting (FACS) 7 days after selection to allow for clearance of EGFP protein from the cells. EGFP disruption via editing was traced using an Attune NxT Flow Cytometer and high-throughput autosampler.

    [0332] When testing cleavage of an EGFP reporter by CasX reference and sgRNA variants, the following spacer target sequences were used:

    TABLE-US-00015 E6 (TGTGGTCGGGGTAGCGGCTG; SEQ ID NO: 29) and E7 (TCAAGTCCGCCATGCCCGAA; SEQ ID NO: 30).

    [0333] An example of the increased cleavage efficiency of the sgRNA of SEQ ID NO: 5 compared to the sgRNA of SEQ ID NO: 4 is shown in FIG. 5A. Editing efficiency of SEQ ID NO: 5 was improved 176% compared to SEQ ID NO: 4. Accordingly, SEQ ID NO: 5 was chosen as reference sgRNA for DME and additional sgRNA variant design, described below.

    Example 3: Mutagenesis of CasX References gRNA Produces Variants with Improved Target Cleavage

    [0334] DME of the sgRNA was achieved using two distinct PCR methods. The first method, which generates single nucleotide substitutions, makes use of degenerate oligonucleotides. These are synthesized with a custom nucleotide mix, such that each locus of the primer that is complementary to the sgRNA locus has a 97% chance of being the wild type base, and a 1% chance of being each of the other three nucleotides. During PCR, the degenerate oligos anneal to, and just beyond, the sgRNA scaffold within a small plasmid, amplifying the entire plasmid. The PCR product was purified, ligated, and transformed into E. coli. The second method was used to generate sgRNA scaffolds with single or double nucleotide insertions and deletions. A unique PCR reaction was set up for each base pair intended for mutation: In the case of the CasX scaffold of SEQ ID NO: 5, 109 PCRs were used. These PCR primers were designed and paired such that PCR products were either missing a base pair, or contained an additional inserted base pair. For inserted base pairs, PCR primers inserted a degenerate base such that all four possible nucleotides were represented in the final library.

    [0335] Once constructed, both the protein and sgRNA DME libraries were assayed in a screen or selection as described in Example 1 to quantitatively identify mutations conferring enhanced functionality. Any assay, such as cell survival or fluorescence intensity, is sufficient so long as the assay maintains a link between genotype and phenotype. High throughput sequencing of these populations and validating individual variant phenotypes provided information about mutations that affect functionality as assayed by screening or selection. Statistical analysis of deep sequencing data provided detailed insight into the mutation landscape and mechanism of protein function or guide RNA function (see FIGS. 3A-3B, FIG. 4A, 4B, 4C).

    [0336] DME libraries of sgRNA variants were made using a reference gRNA of SEQ ID NO: 5, underwent selection or enrichment, and were sequenced to determine the fold enrichment of the sgRNA variants in the library. The libraries included every possible single mutation of every nucleotide, and double indels (insertion/deletions). The results are shown in FIGS. 3A-3B, FIGS. 4A-4C, and Tables 4-26 below.

    [0337] To create a library of base pair substitutions using DME, two degenerate oligonucleotides that each bind to half of the sgRNA scaffold and together amplify the entire plasmid comprising the starting sgRNA scaffold were designed. These oligos were made from a custom nucleotide mix with a 3% mutation rate. These degenerate oligos were then used to PCR amplify the starting scaffold plasmid using standard manufacturing protocols. This PCR product was gel purified, again following standard protocols. The gel purified PCR product was then blunt end ligated and electroporated into an appropriate E. coli cloning strain. Transformants were grown overnight on standard media, and plasmid DNA was purified via miniprep.

    [0338] To generate a library of small insertions and deletions, PCR primers were designed such that the PCR products resulting from amplification of the plasmid comprising the base sgRNA scaffold would either be missing a base pair, or contain an additional inserted base pair. For inserted base pairs, PCR primers were designed in which a degenerate base has been inserted, such that all four possible nucleotides were represented in the final library of pooled PCR products. The starting sgRNA scaffold was then PCR amplified with each set of oligos as their own reaction. Each PCR reaction contained five possible primers, although all primers annealed to the same sequence. For example, Primer 1 omitted a base, in order to create a deletion. Primers 2, 3, 4, and 5 inserted either an A, T, G, or C. However, these five primers all annealed to the same region and hence could be pooled in a single PCR. However, PCRs for different positions along the sgRNA needed to be kept in separate tubes, and 109 distinct PCR reactions were used to generate the sgRNA DME library.

    [0339] The resulting 109 PCR products were then run on an agarose gel and excised before being combined and purified. The pooled PCR products were blunt ligated and electroporated into E. coli. Transformants were grown overnight on standard media with an appropriate selectable marker, and plasmid DNA was purified via miniprep. Having created a library of all single small indels, the steps of PCR amplifying the starting plasmid with each set of oligos, purifying, blunt end ligating, transforming into E. coli and miniprepping can be repeated to obtain a library containing most double small indels. Combining the single indel library and double indel library at a ratio of 1:1000 resulted in a library that represented both single and double indels.

    [0340] The resulting libraries were then combined and passed through screening and/or selection process to identify variants with enhanced cleavage activity. DME libraries were screened using toxin cleavage and CRISPRi repression in E. coli, as well as EGFP cutting in lentiviral-transfected HEK293 cells, as described in Example 1. The fold enrichment of scaffold variants in DME libraries that have undergoing screening/selection followed by sequencing is shown below in Tables 4-26. The read counts associated with each of the below sequences in Tables 4-26 were determined (‘annotations’, ‘seq’). Only sequences with at least 10 reads across any sample were analyzed to filter from 15 Million to 600 K sequences. The below ‘seq’ gives the sequence of the entire insert between the two 5′ random 5mer and the 3′ random 5mer. ‘seq_short’ gives the anticipated sequence of the scaffold only. The mutations associated with each sequence were determined through alignment (‘muts’). All alterations are indicated by their [position (0-indexed)].[reference base].[alternate base]. Position 0 indicates the first T of the transcribed gRNA. Sequences with multiple mutations are semicolon separated. The column muts_1indexed, gives the same information but 1-indexed instead of 0-indexed. Each of the modifications are annotated (‘annotated_variants’), as being a single substitution/insertion/deletion, double substitution/insertion/deletion, single_del_single_sub (a deletion and an adjacent substitution), a single_sub_single_ins (a substitution and adjacent insertion), ‘outside_ref’ (indicates that the alteration is outside the transcribed gRNA), or ‘other’ (any larger substitution/insertion/deletion or some combination thereof). An insertion at position i indicates an inserted base between position i-1 and i (i.e. before the indicated position). To note about variant annotation: a deletion of any one of a consecutive set of bases can be attributed to any of those bases. Thus, a deletion of the T at position −1 is the same sequence as a deletion of the T at position 0. ‘counts’ indicates the sequencing-depth normalized read count per sequence per sample. Technical replicates were combined by taking the geometric mean. ‘log2enrichment’ gives the median enrichment (using a pseudocount of 10) across each context, or across all samples, after merging for technical replicates. The naive read count was averaged (geometric) between the D2_N and D3_N samples. Finally, the ‘log2enrichment_err’ gives the ‘confidence interval’ on the mean log2 enrichment. It is the standard deviation of the enrichment across samples*2/sqrt of the number of samples. Below, only the sequences with median log2enrichment−log2enrichment_err>0 are shown (2704/614564 sequences examined). Tables 4-26. Encoding sequences of exemplary CasX sg RNA variants and resulting activity. CI indicates confidence interval; MI indicates median enrichment, which indicates enhanced activity.

    TABLE-US-00016 TABLE 4 SEQ index ID NO muts_1indexed MI 95% CI 7240543 367 27.-.C; 76.G.- 3.389759419 2.039653812 7240150 368 27.-.C; 75.-.0 3.111121121 1.861731632 2584994 369 0.T.-; 2.A.C; 27.-.0 2.99728039 1.806144082 2618163 370 0.T.-; 2.A.C; 55.-.G 2.914525039 0.724917266 2655870 371 2.A.C; 0.T.-; 76.GG.-A 2.902927654 0.391463755 2762330 372 2.A.C; 0.T.-; 55.-.T 2.856516028 1.28972451 7247368 373 27.-.C; 86.C.- 2.83486805 1.637226249 2731505 374 2.A.C; 0.T.-; 75.-.G 2.79481581 0.624981577 2729600 375 2.A.C; 0.T.-; 76.-.T 2.791450948 0.628411541 2701142 376 2.A.C; 0.T.-; 87.-.T 2.767966305 0.559343857 2659588 377 2.A.C; 0.T.-; 75.-.0 2.732934068 0.47710005 2582823 378 0.T.-; 2.A.C; 27.-.A 2.729090618 1.668805537 3000598 379 1.TA.--; 76.G.- 2.704136598 0.439453245 10565036 380 15.-.T; 74.-.T 2.681400766 0.808439581 9696472 381 28.-.T; 76.GG.-T 2.681108849 1.714840304 2674674 382 2.A.C; 0.T.-; 86.-.0 2.6499525 0.771736317 7254130 383 27.-.C; 75.CG.-T 2.62887552 1.755487816 2977442 384 1.TA.--; 55.-.G 2.628550631 0.887370086 2661951 385 2.A.C; 0.T.-; 76.G.- 2.626541337 0.431834643 1937646 386 2.A.C; 0.TT.--; 75.-.C 2.626298021 1.328305588 2232796 387 0.T.-; 55.-.G 2.606847968 0.776502589 2714418 388 0.T.-; 2.A.C; 81.GA.-T 2.595247917 0.442508417 2700142 389 2.A.C; 0.T.-; 87.-.G 2.581884688 0.608402275 2667512 390 2.A.C; 0.T.-; 77.GA.-- 2.576796073 0.588238221 7239606 391 27.-.C; 76.-.A 2.565846214 1.440612113 10563356 392 15.-.T; 75.-.G 2.55742746 1.055615566 7181049 393 27.-.A; 75.-.0 2.542663573 1.893477285 2720034 394 2.A.C; 0.T.-; 78.-.0 2.5314705 0.491793711 2265581 395 0.T.-; 86.-.0 2.51980638 0.504274578 2256355 396 0.T.-; 76.GG.-C 2.516497885 0.942311138 7251229 397 27.-.C; 76.-.G 2.516430339 1.79266874 10281529 398 17.-.T; 76.GG.-A 2.515423121 1.103585285 2299702 399 0.T.-; 74.-.T 2.504423509 0.391893392 2670445 400 2.A.C; 0.T.-; 85.T.- 2.498536138 1.225406412 2258816 401 0.T.-; 76.G.- 2.494311051 0.474787855 7241311 402 27.-.C; 77.GA.-- 2.492787478 1.594841999 2658150 403 2.A.C; 0.T.-; 76.GG.-C 2.491526929 0.585113234 2734378 404 2.A.C; 0.T.-; 74.-.T 2.489805276 0.484841997 2723181 405 2.A.C; 0.T.-; 76.-.6 2.488387029 0.421138525 2288202 406 0.T.-; 81.GA.-T 2.487414543 0.591223915 2278172 407 0.T.-; 89.-.0 2.48621302 0.689529044 2997382 408 1.TA.--; 76.GG.-A 2.465426966 1.066239003 255017 409 0.T.-:76.GG.-A 2.463250003 0.421992457 2257399 410 0.T.-; 75.-.0 2.460412385 0.675576028 12183183 411 2.A.-; 81.GA.-T 2.459190685 0.736058302 7252067 412 27.-.C; 76.GG.-T 2.45896207 2.062274813 10525083 413 15.-.T; 75.-.0 2.448013673 1.006223409 7253869 414 27.-.C; 74.-.T 2.439328513 1.638183736 4303777 415 4.T.-; 76.-.T 2.435110112 0.781688536 2741395 416 2.A.C; 0.T.-; 73.A.- 2.434901914 0.633362915 7250940 417 27.-.C; 78.A.- 2.423359724 2.064125021 4302595 418 4.T.-; 76.GG.-T 2.42205606 0.850176631 4275786 419 4.T.-; 87.-.T 2.419947604 1.019110537 2650980 420 2.A.C; 0.T.-; 74.-.0 2.414107731 0.461696916 2458336 421 1.TA.--; 3.C.A; 76.G.- 2.410845711 1.088632737 10284144 422 17.-.T; 76.G.- 2.406246674 1.637908059 2726809 423 2.A.C; 0.T.-; 76.G.-; 2.400026208 0.556489787 78.A.T 2280896 424 0.T.-; 87.-.T 2.398060925 0.559723653 2673790 425 2.A.C; 0.T.-; 88.G.- 2.39801837 1.017283194 3188700 426 0.T.-; 2.A.G; 27.-.0 2.394340831 1.73237167 9632434 427 16.------------. 2.393572747 1.140837334 CTCATTACTTTG; 75.-.G 3029757 428 1.TA.--; 78.A.- 2.391614326 0.52432112 2728393 429 2.A.C; 0.T.-; 76.GG.-T 2.390176219 0.714223997 2300381 430 0.T.-; 75.CG.-T 2.385232105 0.948093789 2279969 431 0.T.-; 86.C.- 2.382152098 0.403913543 2260011 432 0.T.-; 77.-.0 2.379187705 0.60793876 2248579 433 0.T.-; 72.-.0 2.377033686 0.742558535 12075394 434 2.A.-; 55.-.G 2.376878541 0.679081085 9602743 435 28.-.C; 76.GG.-C 2.376348735 1.680837509 2736722 436 2.A.C; 0.T.-; 73.AT.-C 2.374354239 1.104279695 12117240 437 2.A.-; 76.GG.-A 2.372161723 0.428593735 10307397 438 17.-.T; 78.-.0 2.365042525 0.867959934 3034775 439 1.TA.--; 75.-.G 2.359826914 0.99152259 12030812 440 2.A.-; 27.-.A 2.355284207 1.651243725 10530683 441 15.-.T; 86.-.A 2.354920575 0.999356279 12202799 442 2.A.-; 75.-.G 2.352119205 0.508202346 9687168 443 28.-.T; 76.GG.-A 2.350792044 1.612399102 4309853 444 4.T.-; 75.CG.-T 2.344380848 0.844586894 4234320 445 4.T.-; 75.-.0 2.343966564 0.820229568 2698521 446 2.A.C; 0.T.-; 88.-.T 2.33926209 0.684535077 2253698 447 0.T.-; 75.-.A 2.33353651 0.918413016 2468003 448 1.TA.--; 3.C.A; 75.-.G 2.329652898 0.934127399 12290253 449 2.A.-; 28.-.0 2.326187914 1.587751482 2999382 450 1.TA.--; 75.-.0 2.315411787 0.591810721 3227871 451 2.A.G; 0.T.-; 55.-.G 2.313991155 0.774330181 10521017 452 15.-.T; 74.-.0 2.313768991 0.910046563 10089663 453 19.-.T; 75.-.G 2.308273929 1.077849871 4274894 454 4.T.-; 87.-.G 2.308046437 0.511567574 2466567 455 1.TA.--; 3.C.A; 78.A.- 2.307828141 1.291273333 2696261 456 2.A.C; 0.T.-; 89.-.0 2.292578418 0.680820688 2675948 457 2.A.C; 0.T.-; 89.-.A 2.289131671 1.259062601 10521784 458 15.-.T; 74.-.G 2.282950048 0.904736128 12123787 459 2.A.-; 76.G.- 2.27754961 0.49194122 10310335 460 17.-.T; 76.GG.-T 2.27478155 0.80367504 2295876 461 0.T.-; 77.-.T 2.273004186 0.931439741 2697871 462 0.T.-; 2.A.C; 89.-.T 2.250463711 0.626247893 2735417 463 2.A.C; 0.T.-; 75.CG.-T 2.249451799 0.389761214 2671836 464 0.T.-; 2.A.C; 86.-.A 2.245473306 0.542416673 12033345 465 2.A.-; 27.-.C 2.235034582 1.903166042

    TABLE-US-00017 TABLE 5 SEQ ID index NO muts_1indexed MI 95% CI 2821484 466 0.T.-; 2.A.C; 17.-T. 2.234604485 0.750279684 3033813 467 1.TA.--; 76.-.T 2.229483844 0.547530348 2291551 468 0.T.-; 78.-.0 2.226391312 0.53155696 2716457 469 2.A.C; 0.T.-; 80.A.- 2.212685904 0.548257242 2697599 470 2.A.C; 0.T.-; 89.A.- 2.209480847 1.345862006 12135440 471 2.A.-; 87.-.A 2.208341827 1.052844724 4273350 472 4.T.-; 88.-.T 2.207860033 1.012912804 2298121 473 0.T.-; 75.-.G 2.207579751 0.240933007 2652510 474 0.T.-; 2.A.C; 74.-.G 2.206487468 0.612576212 3006640 475 1.TA.--; 86.-.0 2.206221139 0.584000131 10313388 476 17.-.T; 74.-.T 2.206178293 1.036335839 10081410 477 19.-.T; 87.-.G 2.205894948 0.589463833 3033236 478 1.TA.--; 76.GG.-T 2.198134613 0.669434462 7242523 479 27.-.C86.-.0 2.198004115 1.972713412 7254383 480 27.-.C; 73.AT.-C 2.19783418 1.510443212 2264531 481 0.T.-; 87.-.A 2.197793214 0.777981784 2727301 482 0.T.-; 2.A.C; 77.-.T 2.196877578 1.323161971 3019306 483 1.TA.--; 87.-.G 2.191451738 0.53442114 4295725 484 4.T.-; 78.A.- 2.187137221 0.609047392 10311816 485 17.-.T75.-.G 2.187062055 1.506790657 12167745 486 2.A.-; 87.-.G 2.184448369 0.736092188 12199256 487 2.A.-; 76.GG.-T 2.178714409 0.736646546 6477911 488 16.-.C; 75.-.G 2.177618084 0.983309644 4274124 489 4.T.-; 86.C.- 2.17055291 0.474178023 12206105 490 2.A.-; 74.-.T 2.170189846 0.60843597 12166825 491 2.A.-; 86.C.- 2.167668003 0.773946533 11956698 492 2.AC.--; 43.C; 86.-.0 2.164335553 1.359888436 2280390 493 0.T.-; 87.-.G 2.162228704 0.478769807 2650159 494 2.A.C; 0.T.-; 74.T. 2.160583429 0.51707006 10531253 495 15.-.T; 87.-.A 2.15924529 1.129639708 2665054 496 2.A.C; 0.T.-; 79.G.- 2.157940781 0.562020183 8531520 497 75.-.G; 86.-.0 2.154823863 0.581992186 2296436 498 0.T.-; 76.GG.-T 2.153923256 0.67936875 4249048 499 4.T.-; 86.-.0 2.142285584 0.675472603 10547068 500 15.-.T; 87.-.G 2.139808506 0.856696675 12168820 501 2.A.-; 87.-.T 2.139576287 0.458066181 2466824 502 1.TA.--; 3.C.A; 76.-.6 2.137393958 0.98855471 3036963 503 1.TA.--; 75.CG.-T 2.136816031 0.479393618 10522450 504 15.-.T; 75.-.A 2.134930675 1.003462809 10300736 505 17.-.T87.-.T 2.134132228 1.348111441 3002220 506 1.TA.--; 79.G.- 2.131038893 0.607179239 3030471 507 1.TA.--; 76.-.G 2.129810368 0.371633581 10523429 508 15.-.T; 76.GG.-A 2.129808628 0.787404871 1909254 509 0.TTA.---; 3.C.A; 75.-.G 2.129733196 1.147227186 3004722 510 1.TA.--; 85.T.- 2.123755125 1.091994071 2672731 511 2.A.C; 0.T.-; 87.-.A 2.121163195 0.897965834 12129733 512 2.A.-; 77.GA.-- 2.11956301 0.499892769 4250089 513 4.T.-; 89.-.A 2.116592595 0.997715957 2688981 514 2.A.C; 0.T.-; 99.-.G 2.112345173 0.980184341 2995452 515 1.TA.--; 74.-.G 2.112014409 0.610553646 12114782 516 2.A.-; 75.-.A 2.110203616 0.499880843 2993173 517 1.TA.--; 73.-.A 2.10375793 0.696850789 1978344 518 0.T.C; 87.-.G 2.100156515 0.870067465 4294004 519 4.T.-; 78.-.0 2.098823408 0.595418093 10568306 520 15.-.T; 73.A.- 2.096194341 0.741080975 10561545 521 15.-.T; 76.GG.-T 2.095379508 0.553757689 2713433 522 2.A.C; 0.T.-; 82.AA.-T 2.094347694 0.559870514 1863579 523 0.TT.--; 75.-.G 2.086195215 0.787239435 3006303 524 1.TA.--; 88.G.- 2.086194701 0.536507797 4236935 525 4.T.-; 76.G.- 2.081251549 0.919447585 12138801 526 2.A.-; 89.-.A 2.079884636 1.115488685 12164760 527 2.A.-; 89.-.T 2.079725529 0.315885203 10288787 528 17.-.T; 86.-.0 2.079540543 0.927030301 2664128 529 0.T.-2.A.C; 77.-.C 2.079234701 0.378694546 2663861 530 0.T.-; 2.A.C; 76.G.-; 2.077930225 0.700390601 78.A.C 2726063 531 0.T.-; 2.A.C; 78.A.T 2.077653454 0.972036971 4232837 532 4.T.-; 76.GG.-C 2.068589675 0.579547915 3001194 533 1.TA.--; 77.-.A 2.062571166 0.628957326 2048069 534 0.TT.--; 2.A.G; 76.G.- 2.05862732 1.413051852 2653681 535 2.A.C; 0.T.-; 75.-.A 2.051977832 0.427290312 2265126 536 0.T.-; 88.G.- 2.050226061 0.556563218 2739399 537 0.T.-; 2.A.C; 73.A.G 2.049449237 1.003306718 7250543 538 27.-.C; 78.-.C 2.047334217 1.480241124 2747651 539 0.T.-; 2.A.C66.0 2.046981233 0.899726699 12437734 540 1.TAC.---; 78.A.- 2.043018072 0.614544855 2826230 541 0.T.-; 2.A.C; 15.-.T 2.041901776 0.537816622 2709008 542 2.A.C; 0.T.-; 82.A.-; 2.036707329 1.246046649 84.A.T 3005336 543 1.TA.--; 86.-.A 2.034175728 0.483054171 4301274 544 4.T.-; 76.G.-; 78.A.T 2.028068229 0.873353997 3018865 545 1.TA.--; 86.C.- 2.024668973 0.616204139 2699310 546 2.A.C; 0.T.-; 86.0.- 2.023086951 0.563791987 2279026 547 0.T.-; 89.A.- 2.022323648 1.568173921 7248209 548 27.-.C; 82.A.- 2.022242177 1.626724535 10562113 549 15.-.T; 76.-.T 2.019995187 0.857776668 7181373 550 27.-.A; 76.G.- 2.014441438 1.907810918 10559019 551 15.-.T; 76.-.G 2.014069707 0.752817112 3018452 552 1.TA.--; 88.-.T 2.012932283 0.626313379

    TABLE-US-00018 TABLE 6 SEQ ID index NO muts_1indexed MI 95% CI 12118457 553 2.A.-; 76.-.A 2.011043775 1.170428809 2805043 554 2.A.C; 0.T.-; 28.-.0 2.009926076 1.5236908 4242379 555 4.T.-; 77.GA.-- 2.007947564 0.98469627 2259846 556 0.T.-; 76.6.-; 78.A.0 2.004816439 0.640251884 6462092 557 16.-.C; 87.-.A 2.001230775 0.982714839 4312495 558 4.T.-; 73.AT.-G 1.997381596 0.707994266 2668714 559 0.T.-; 2.A.C; 81.GA.-C 1.996012534 0.678455572 2294477 560 0.T.-; 78.AG.-T 1.993651117 0.703085174 12198135 561 2.A.-; 77.-.T 1.993577573 1.432706828 4238150 562 4.T.-; 77.-.A 1.992607238 0.761786326 3019738 563 1.TA.--; 87.-.T 1.992446303 0.532459966 2352050 564 0.T.-; 17.-.T 1.991048683 0.852386811 2705912 565 2.A.C; 0.T.-; 83.-.0 1.99036719 0.585299092 6478822 566 16.-.C; 74.-.T 1.988911775 0.477065619 2665913 567 2.A.C; 0.T.-; 79.GA.-C 1.9871574 1.186495063 3331447 568 2.A.G; 0.T.-; 76.GG.-T 1.984971034 0.958178637 3186538 569 2.A.G; 0.T.-; 27.-.A 1.983054551 1.530372349 2738784 570 2.A.C; 0.T.-; 73.AT.-G 1.977333796 0.62344263 7832272 571 55.-.G 1.976646956 0.881875422 4297458 572 4.T.-; 76.-.G 1.976295522 0.996798704 3334291 573 2.A.G; 0.T.-; 75.-.G 1.975325989 0.653653125 2212416 574 0.T.-; 27.-.0 1.973859043 1.457984475 8752897 575 55.-.T; 76.G.- 1.971785265 0.46834501 2293333 576 0.T.-36.-.G 1.970005749 0.514281315 7180386 577 27.-.A; 76.GG.-A 1.969392489 1.667131306 2996180 578 1.TA.--; 75.-.A 1.966703028 0.475623563 7238423 579 27.-.C; 74.T.- 1.962642235 1.563372071 2261752 580 0.T.-; 77.GA.-- 1.961634278 0.503084863 10282247 581 17.-.T; 76.GG.-C 1.960039354 0.718769466 4230973 582 4.T.-; 76.GG.-A 1.958471711 0.723493647 4276520 583 4.T.-; 86.-.G 1.958025163 0.900653677 2675193 584 0.T.-; 2.A.C; 88.GA.-C 1.956983044 0.878446278 13101476 585 -1.GT.--; 75.-.G 1.952447041 0.438583434 7203209 586 27.G.-76.GG.-C 1.952129576 1.708559549 2724398 587 0.T.-; 2.A.C; 78.A.G 1.947253829 0.801326607 10309365 588 17.-.T; 78.-.T 1.946957778 1.542210263 10520418 589 15.-.T; 74.T.- 1.944704908 0.727975608 10300394 590 17.-.T; 87.-.0 1.943744986 1.037237205 4248302 591 4.T.-; 88.G.- 1.936753816 0.857321817 7240856 592 27.-.C; 76.G.-; 78.A.0 1.936751382 1.187952295 4313003 593 4.T.-; 73.A.G 1.935442861 0.687757679 2467599 594 1.TA.--; 3.C.A; 76.GG.-T 1.92287425 1.104512209 2279202 595 0.T.-; 89.-.T 1.921076549 0.70944656 2259410 596 0.T.-; 77.-.A 1.920454929 0.417160464 4305674 597 4.T.-; 75.-.G 1.915266489 1.088551012 6459602 598 16.-.C; 76.G.- 1.914798378 0.642358195 2701869 599 0.T.-; 2.A.C; 86.-.G 1.914049421 0.477347775 2252978 600 0.T.-; 74.-.G 1.911378422 0.602397906 6470049 601 16.-.C; 87.-.G 1.910419486 0.714796483 12134362 602 2.A.-; 86.-.A 1.906851105 0.661062722 12209524 603 2.A.-; 73.A.0 1.901209161 1.154288772 2260529 604 0.T.-; 79.G.- 1.899530324 0.82876912 2690549 605 0.T.-; 2.A.C; 98.-.T 1.898891625 0.95407757 10073100 606 19.-.T; 88.G.- 1.89794244 0.781693777 4239969 607 4.T.-; 79.G.- 1.897769811 0.794035202 3026047 608 1.TA.--; 81.GA.-T 1.896236907 0.554505707 3003294 609 1.TA.--; 77.GA.-- 1.895773589 0.506363603 12121216 610 2.A.-; 75.-.0 1.895093657 0.610069511 2696635 611 0.T.-; 2.A.C; 89.AT.-G 1.893880561 0.881556619 12130978 612 2.A.-; 81.GA.-C 1.891473979 0.935650632 6475473 613 16.-.C; 78.A.- 1.888788297 0.580982578 1853356 614 0.TT.--; 76.G.- 1.884632638 0.80171104 8544082 615 75.-.G; 87.-.G 1.884341912 0.535653292 2884429 616 1.-.C; 76.6.- 1.883538595 0.673377662 6368955 617 17.-.A; 76.-.G 1.882010313 0.843102729 2746170 618 2.A.C; 0.T.-; 66.CT.-G 1.87989538 0.516685509 4226314 619 4.T.-; 74.-.0 1.873701307 0.901044909 6304607 620 16.-.A; 76.G.- 1.873365067 0.522811196 2583788 621 0.T.-; 2.A.C; 27.G.- 1.873101254 1.38825951 2255694 622 0.T.-; 76.-.A 1.869207789 0.836610884 7249882 623 27.-.C; 80.A.- 1.867026014 1.645069173 10069481 624 19.-.T; 75.-.0 1.864128274 0.644689284 2643173 625 0.T.-; 2.A.C; 70.T.- 1.863776691 1.688937677 12749699 626 0.-.T; 75.-.G 1.863460232 0.756791498 7208859 627 27.G.-; 87.-.G 1.861951751 1.68656168 4271233 628 4.T.-; 89.-.0 1.854344144 0.839274714 6455215 629 16.-.C; 73.-.A 1.850284678 0.825458676 2816525 630 0.T.-; 2.A.C; 19.-.T 1.847987652 0.368770724 2292594 631 0.T.-; 78.A.- 1.846146605 0.312862911 2287708 632 0.T.-; 82.AA.-T 1.845505779 0.408363625 2721779 633 2.A.C; 0.T.-; 78.A.- 1.842043235 0.676554896 1945942 634 0.TT.--; 2.A.C; 75.-.G 1.841650114 1.270815664 12111705 635 2.A.-; 74.-.0 1.840532416 0.668977898

    TABLE-US-00019 TABLE 7 SEQ index ID NO muts_1indexed MI 95% CI 2567750 636 0.T.-; 2.A.C; 16.-.0 1.8403251 0.426712425 2463364 637 1.TA.--; 3.C.A; 87.-.G 1.839213942 0.821355081 3031594 638 1.TA.--; 78.AG.-T 1.838954225 0.619562955 10199376 639 18.-.G; 75.-.G 1.837121283 1.238162985 4272444 640 4.T.-; 89.A.- 1.836884745 0.9982317 9610551 641 28.-.C; 78.A.- 1.835988851 1.801689999 2737747 642 0.T.-; 2.A.C; 73.A.0 1.832606597 1.293143415 12113430 643 2.A.-; 74.-.G 1.828115917 0.752764013 10530413 644 15.-.T; 85.TC.-G 1.825064554 1.155205145 12176759 645 2.A.-; 83.-.T 1.824304802 1.045532305 12127185 646 2.A.-79.0.- 1.824126309 0.605894284 4288099 647 4.T.-; 81.GA.-T 1.823734764 0.75329209 12196850 648 2.A.-; 78.A.T 1.82118191 1.085783969 6457366 649 16.-.C; 75.-.A 1.820899999 0.638027421 12105140 650 2.A.-; 72.-.0 1.818449485 0.69990752 1944577 651 0.TT.--; 2.A.C; 78.A.- 1.816800398 1.169943299 4293546 652 4.T.-; 78.AG.-C 1.815616502 1.015355487 9996838 653 19.-.G; 74.-.T 1.814174099 0.799877397 10301024 654 17.-.T; 86.-.G 1.813594662 0.966656071 2308228 655 0.T.-; 66.C.- 1.811408251 0.755819624 7835938 656 55.-.G; 75.-.G 1.811344956 1.11212595 3005841 657 1.TA.--; 87.-.A 1.810592015 0.805934793 12169698 658 2.A.-; 86.-.G 1.807867405 0.857412996 3028597 659 1.TA.--; 78.AG.-C 1.802701874 0.743214495 7191855 660 27.-.A; 75.CG.-T 1.802109849 1.429792639 9972503 661 19.-.G; 74.T.- 1.801952299 0.749871626 4026979 662 3.-.C; 75.-.G 1.801908368 1.374192028 7180118 663 27.-.A; 75.-.A 1.801182739 1.524863174 10081203 664 19.-.T; 86.C.- 1.799229513 0.502156779 10532156 665 15.-.T; 86.-.0 1.796941605 1.070232668 2749667 666 2.A.C; 0.T.-; 65.GC.-T 1.795230574 0.641741966 12139228 667 2.A.-; 90.-.0 1.793917598 1.201242724 10288547 668 17.-.T; 88.G.- 1.793873519 1.192733019 4331367 669 4.T.-; 55.-.T 1.792669241 0.481210459 2725463 670 2.A.C; 0.T.-; 78.-.T 1.79217915 0.507302457 2718857 671 0.T.-; 2.A.C; 79.GA.-T 1.791913163 0.899839665 2247247 672 0.T.-; 72.-.A 1.791822909 0.887353696 12125011 673 2.A.-; 77.-.A 1.786430219 0.527171387 4225246 674 4.T.-; 74.T.- 1.786417427 0.629044775 12165722 675 2.A.-; 88.-.T 1.786308399 1.272797742 2733129 676 0.T.-; 2.A.C; 75.C.- 1.785722582 0.560847969 2469676 677 1.TA.--; 3.C.A; 73.A.- 1.785269687 1.17402736 3018172 678 1.TA.--; 89.-.T 1.784650459 0.75738752 12196049 679 2.A.-; 78.-.T 1.782353237 0.753905536 9612063 680 28.-.C; 74.-.T 1.782091765 1.617793957 10547909 681 15.-.T86.-.G 1.781475153 0.81786269 12194342 682 2.A.-; 78.A.-; 80.A.- 1.77971829 1.288558347 4228855 683 4.T.-; 75.-.A 1.775913052 0.896674597 10546613 684 15.-.T; 86.C.- 1.775790253 0.858668751 10547538 685 15.-.T; 87.-.T 1.771955914 1.080256702 10519772 686 15.-.T; 73.-.A 1.770892898 0.624353321 8510297 687 77.G.T 1.76973633 1.238813589 12119606 688 2.A.-; 76.GG.-C 1.768206821 1.109938596 2669299 689 0.T.-; 2.A.C; 85.TC.-A 1.766862971 0.841676179 6469807 690 16.-.C; 86.C.- 1.764660394 0.758824717 10197299 691 18.-.G; 76.-.G 1.763760462 0.832130059 3344225 692 2.A.G; 0.T.-; 73.A.- 1.76219764 1.216224489 2456917 693 1.TA.--; 3.C.A; 75.-.A 1.760739771 1.203417145 10307233 694 17.-.T; 78.AG.-C 1.760381908 1.100594294 12314352 695 2.A.-; 15.-.T 1.758187872 0.435582357 12177388 696 2.A.-; 82.AA.-- 1.750995276 0.61463172 2694455 697 0.T.-; 2.A.C; 91.A.-; 1.750810727 1.014669774 93.A.G 3040066 698 1.TA.--; 73.A.- 1.750348973 0.689636186 10081633 699 19.-.T87.-.T 1.749883408 0.917269067 4246508 700 4.T.-; 86.-.A 1.748983402 0.938986874 4301580 701 4.T.-; 77.-.T 1.743946631 0.701295877 10181172 702 18.-.G; 75.-.A 1.743101698 1.01566765 12200668 703 2.A.-; 76.-.T 1.740748942 0.87292689 10524336 704 15.-.T; 76.GG.-C 1.738223203 0.390480555 3007212 705 1.TA.--; 89.-.A 1.737858461 1.071814108 10526271 706 15.-.T; 76.G.- 1.737620179 1.09826626 10561166 707 15.-.T; 77.-.T 1.736588831 0.744748617 2663037 708 2.A.C; 0.T.-; 77.-.A 1.731783986 0.417310116 12136525 709 2.A.-; 88.G.- 1.731312294 0.57794653 8758832 710 55.-.T; 78.A.- 1.730884483 0.640655822 1864295 711 0.TT.--; 75.CG.-T 1.7286748 0.424298588 10550736 712 15.-.T; 82.A.-; 84.A.G 1.728100107 0.887580069 2657071 713 2.A.C; 0.T.-; 76.-.A 1.727660257 1.206003654 2059338 714 0.TT.--; 2.A.G; 75.-.G 1.725033887 1.054075378 12182224 715 2.A.-; 82.AA.-T 1.721741871 0.598515022 2671130 716 2.A.C; 0.T.-; 85.TC.-G 1.721255074 0.884259809 4200182 717 4.T.-; 55.-.G 1.721190019 1.232924607 2281298 718 0.T.-; 86.-.G 1.720150085 0.459949896

    TABLE-US-00020 TABLE 8 SEQ index ID NO muts_1indexed MI 95% CI 7182097 719 27.-.A; 77.GA.-- 1.718675301 1.318350535 2251662 720 0.T.-; 74.T.- 1.718536267 0.428185144 1904870 721 0.TTA.---; 3.C.A; 1.715468512 1.34467556 76.G.- 10553996 722 15.-.T; 81.GA.-T 1.71542255 0.963037099 10202590 723 18.-.G; 73.A.- 1.715117267 0.822174045 3028839 724 1.TA.--; 78.-.C 1.712954587 0.450495404 3304552 725 0.T.-; 2.A.G; 1.712919885 0.767193507 89.-.T 4247308 726 4.T.-; 87.-.A 1.711145921 0.765770921 4318521 727 4.T.-; 66.CT.-G 1.710421741 0.956759562 7247759 728 27.-.C; 86.-.G 1.709588646 1.198020951 10198320 729 18.-.G; 76.GG.-T 1.709356476 0.700624761 2457655 730 1.TA.--; 3.C.A; 1.709355062 1.259561047 76.GG.-C 3032520 731 1.TA.--; 76.G.-; 1.709186022 0.754280463 78.A.T 2702792 732 0.T.-; 2.A.C; 1.70908021 0.741854781 86.CC.-T 12171374 733 2.A.-; 84.AT.-- 1.708956084 1.239010302 10192666 734 18.-.G; 87.-.G 1.706139319 0.672236416 2642318 735 2.A.C; 0.T.-; 1.703389866 0.651239291 72.-.A 2718074 736 2.A.C; 0.T.-; 1.699976056 1.191093731 77.GA.--; 82.A.T 12191670 737 2.A.-; 78.A.- 1.696728454 0.819298298 2456219 738 1.TA.--; 3.C.A; 1.696442704 1.260292211 74.T.- 2457365 739 1.TA.--; 3.C.A; 1.694881811 0.951237077 76.GG.-A 8538180 740 75.-.G 1.694861152 0.415924921 3020581 741 1.TA.--; 1.692620071 1.160105308 86.CC.-T 10281916 742 17.-.T; 76.-.A 1.692603642 0.648841391 2707684 743 0.T.-; 2.A.C; 1.691822732 1.346496086 82.A.-; 84.A.G 2676761 744 0.T.-; 2.A.C; 1.68930292 0.99991905 90.-.G 7213979 745 27.G.-; 75.CG.-T 1.688772312 1.195343004 2459101 746 1.TA.--; 3.C.A; 1.686519606 0.966564286 77.GA-- 8123571 747 75.-C; 86.-.C 1.685647367 0.454380756 12207287 748 2.A.-; 75.CG.-T 1.685305192 0.563871209 2740245 749 2.A.C; 0.T.-; 1.684914398 1.012999566 70.-.T 10531744 750 15.-.T; 88.G.- 1.684556387 1.172453501 2669798 751 2.A.C; 0.T.-; 1.683775918 0.485672655 82.-.A 2294771 752 0.T.-; 78.-.T 1.683554242 0.365785232 7213033 753 27.G.-; 76.GG.-T 1.681704475 1.553533309 7829581 754 55.-.G; 76.G.- 1.681581148 1.157922781 2808092 755 0.T.-; 2.A.C; 1.680339253 1.570645735 28.-.T 2960043 756 1.TA.--; 27.-.C 1.675962289 1.352861328 10506564 757 15.-.T; 55.-.G 1.675003018 1.443016487 4315349 758 4.T.-; 73.A.T 1.667757548 0.705372587 2705067 759 2.A.C; 0.T.-; 1.667686194 0.498039786 82.A.- 3330280 760 0.T.-; 2.A.G; 1.666946086 0.947896566 76.G.-; 78.A .T 9630969 761 16.------------ . 1.664680451 1.315435632 CTCATTACTTTG; 75.-.A 12173513 762 2.A.-; 82.A.- 1.663830201 0.733539657 3280346 763 0.T.-; 2.A.G; 1.662631303 1.204381863 87.-.A 7238549 764 27.-.C; 74.-.C 1.661306709 1.214766158 8154695 765 76.G.-; 78.A.C 1.661229303 0.368056731 10516784 766 15.-.T; 72.-.A 1.66016215 0.597302394 10307953 767 17.-.T; 78.A.- 1.65952488 0.82365406 12432835 768 1.TAC.---; 75.-.C 1.654476204 0.813686317 12193344 769 2.A.-; 76.-.G 1.653563552 0.663784021 2297191 770 0.T.-; 76.-.T 1.652000897 0.458064366 2126158 771 0.TTA.---; 1.649649089 1.318355451 3.C.G; 87.-G 2283617 772 0.T.-; 83.-.C 1.648963324 1.421238851 2654520 773 2.A.C; 0.T.-; 1.647087379 0.573966628 75.CG.-A 3332543 774 0.T.-; 2.A.G; 1.644966768 0.844422969 76.-.T 9604425 775 28.-.C88.G.- 1.6439264 1.218234779 12109255 776 2.A.-; 73.-.A 1.643507554 0.929692908 12438229 777 1.TAC.---; 1.641912193 0.689368529 76.GG.-T 8153054 778 77.G.C 1.64142005 1.384906369 10308482 779 17.-.T; 76.-.G 1.641323583 1.127042919 10300026 780 17.-.T; 86.C.- 1.641224613 1.227957862 2715234 781 2.A.C; 0.T.-; 1.640370122 1.47602933 80.AG.-C 10532541 782 15.-.T; 90.T.- 1.640240149 1.020337794 12721860 783 0.-.T; 76.G.- 1.639509598 0.366635004 2460008 784 1.TA.--; 3.C.A; 1.639261031 0.936045278 86.-.C 2264044 785 0.T.-; 86.-.A 1.639121471 0.511832699 12188811 786 2.A.-; 78.AG.-C 1.637960122 0.77568855 12432569 787 1.TAC.---; 1.637292013 0.882764983 76.GG.-A 9602947 788 28.-.C; 75.-.C 1.636117538 1.557596786 2994003 789 1.TA.--; 74. T.- 1.633550393 0.541929003 12213405 790 2.A.-; 73.A.- 1.63354167 0.735980135 2719575 791 0.T.-; 2.A.C; 1.633437814 0.44613275 78.AG.-C 2123173 792 0.TTA.---; 3.C.G; 1.632290442 1.510924178 76.G.- 10086342 793 19.-.T; 78.-.C 1.630575414 0.477336939 12236371 794 2.A.-; 55.-.T 1.629793154 0.850354697 6473588 795 16.-.C; 81.GA.-T 1.6283178 0.397977937 7240999 796 27.-.C; 79.G.- 1.627916832 1.310172414 12189370 797 2.A.-; 78.-.C 1.625186884 0.714620198 3005003 798 1.TA.--; 85.TC.-G 1.624844672 0.819992466 10185851 799 18.-.G; 86.-.C 1.622189588 0.720091613 2725020 800 0.T.-; 2.A.C; 1.621816405 0.69613073 78.AG.-T

    TABLE-US-00021 TABLE 9 SEQ ID index NO muts_1indexed MI 95% CI 12212274 801 2.A.-; 70.-.T 1.620710424 1.038198418 8470264 802 78.-.C 1.617470851 0.271680388 2286841 803 0.T.-; 82.AA.-G 1.617088496 0.606230824 7241506 804 27.-.C; 81.GA.-C 1.616908898 1.111991942 12163987 805 2.A.-; 89.A.G 1.616843955 0.718476436 3364655 806 0.T.-; 2.A.G; 1.615459441 1.131392113 55.-.T 1904677 807 0.TTA.---; 3.C.A; 1.613614518 0.965094427 75.-.C 2712438 808 2.A.C; 0.T.-; 82.-.T 1.61208488 0.769494423 14645004 809 -29.A.C; 0.T.-; 1.610092293 0.432743672 2.A.C; 76.G.- 10322550 810 17.-.T; 55.-.T 1.608294231 0.835345091 10304965 811 17.-.T; 82.AA.-T 1.605684059 1.005872373 10279228 812 17.-.T; 74.-.C 1.603403686 0.964621553 3263089 813 2.A.G; 0.T.-; 1.603002415 0.944419565 74.-.G 2282393 814 0.T.-; 82.A.-; 1.601545542 1.047011173 85.T.G 2463251 815 1.TA .--; 3.C.A; 1.597766756 0.958863507 86.C.- 2459897 816 1.TA .--; 1.595799757 0.724801659 3.C.A; 88.G.- 1852430 817 0.TT.--; 76.GG.-A 1.595672352 0.848408617 10305251 818 17.-.T; 81.GA.-T 1.593404575 1.07855471 9603994 819 28.-.C; 85.TC.-A 1.593398609 1.338922574 4319798 820 4.T.-; 66.CT.-- 1.5927753 0.719209709 3042484 821 1 .TA.--; 66.CT.-G 1.592062494 0.578104998 8544184 822 75.-.G; 87.-.T 1.591574219 0.630898033 2709867 823 2.A.C; 0.T.-; 1.590223625 0.505705027 82.AA.-C 3439310 824 0.T.-; 2.A.G; 1.589266839 0.341479677 15.-.T 2718364 825 0.T.-; 2.A.C; 1.587566696 1.149184797 80.A.T 4223967 826 4.T.-; 73.-.A 1.587282349 0.645700343 4271617 827 4.T.-; 89.AT.-G 1.587137334 1.233444621 10460510 828 16.C.-; 76.GG.-A 1.586590153 0.787644542 4227764 829 4.T.-; 74.-.G 1.585660861 0.680124313 9994855 830 19.-.G; 76.GG.-T 1.58530649 0.779320174 3272821 831 2.A.G; 0.T.-; 1.583120825 0.912440621 76.G.-; 78.A.C 12110798 832 2.A.-; 74.T.- 1.581717864 0.658647546 1975319 833 0.T.C; 76.G.- 1.58114814 0.609951036 10316332 834 17.-.T; 73.A.- 1.580871543 0.902426494 2720616 835 0.T.-; 2.A.C; 1.58077409 0.565168836 78.A.C 8753785 836 55.-.T; 86.-.C 1.580570661 0.907594533 8112378 837 76.-.A 1.579846517 0.965148419 2819005 838 0.T.-; 2.A.C; 1.579281152 0.490774802 18.-.G 8357828 839 87.-.G 1.578903423 0.260894611 6477023 840 16.-.C; 76.GG.-T 1.577281377 0.801993714 12737747 841 0.-.T; 87.-.G 1.576853785 0.587015792 12309294 842 2.A.-; 17.-.T 1.575651742 0.644197096 2252133 843 0.T.-; 74.-.C 1.575512867 0.340117554 10567192 844 15.-.T; 73.AT.-G 1.575291887 0.657147067 3261438 845 2.A.G; 0.T.-; 74.-.C 1.574575619 0.783331617 15169229 846 -29.A.G; 75.-.G 1.574259504 0.382115947 6128804 847 14.-.A; 1.573502126 0.97997063 76.GG.-T 12197720 848 2.A.-; 76.G.-; 1.57327628 0.892867309 78.A.T 3326919 849 2.A.G; 0.T.-; 1.572520314 0.782894375 76.-.G 12164376 850 2.A.-; 89.A.- 1.571939028 1.399860294 2990209 851 1.TA.--; 70.T.- 1.571341225 1.473641775 8538220 852 75.-.G; 132.G.T 1.5708167 0.464722537 10068467 853 19.-.T; 76.GG.-A 1.570115611 0.903671278 9697533 854 28.-.T; 75.CG.-T 1.568984808 1.329590045 2958993 855 1.TA.--; 27.-.A 1.567973804 1.255119149 3001629 856 1 .TA.--; 76.G.-; 1.566060562 0.524342191 78.A.C 4291732 857 4.T.-; 77.GA.--; 1.564592325 1.309941389 82.A.T 4238868 858 4.T.-; 76.G.-; 1.56447294 0.829602825 78.A.C 3306461 859 0.T.-; 2.A.G; 1.563833782 0.717413376 87.-.G 1937976 860 2.A.C; 0.TT.--; 1.560038457 1.462696008 76.G.- 4172716 861 4.T.-; 27.-.C 1.558070079 1.387693861 12185288 862 2.A.-; 80.A.- 1.557024858 0.705941145 14813579 863 -29.A.C; 75.-.G 1.556839809 0.414912384 2468675 864 1.TA.--; 3.C.A; 1.553046656 0.931035197 75.CG.-T 12195510 865 2.A.-; 78.AG.-T 1.55000419 0.886783857 4285997 866 4.T.-; 82.AA.-G 1.549250991 0.782347429 3275841 867 2.A.G; 0.T.-; 1.549221581 0.526146695 77.GA.-- 3018032 868 1.TA.--; 89.A.- 1.549009371 1.113927175 2301817 869 0.T.-; 73.A.C 1.54864254 0.917412432 3305057 870 0.T.-; 2.A.G; 88.-.T 1.547965444 0.420214747 2122618 871 0.TTA.---; 3.C.G; 1.547889984 1.094378143 76.GG.-A 2289325 872 0.T.-; 80.A.- 1.547099084 0.393404706 4291562 873 4.T.-; 80.AG.-T 1.546888356 1.017074272 10557226 874 15.-.T; 78.-.C 1.544857428 0.974814633 12748115 875 0.-.T; 76.GG -T 1.544686324 0.709928076 3026518 876 1.TA.--; 80.AG.-C 1.544042546 1.240581963 10545028 877 15.-.T; 89.-.C 1.542272906 0.579291446 3416823 878 0.T.-; 2.A.G; 28.-.C 1.53913175 1.436213329 9976094 879 19.-.G; 76.G.- 1.538689261 0.748851507 1852751 880 0.TT.--; 76.GG.-C 1.536921551 0.769662735 4314686 881 4.T.-; 73.A.- 1.536187783 1.014477961

    TABLE-US-00022 TABLE 10 SEQ ID index NO muts_1indexed MI 95% CI 6470272 882 16.-.C; 87.-.T 1.535725631 0.59665986 2673006 883 0.T.-; 2.A.C; 1.535462742 0.804157995 87.C.A 12137377 884 2.A.-; 86.-.C 1.535147851 0.546194055 12184036 885 2.A.-; 80.AG.-C 1.531564715 1.351567783 10285242 886 17.-.T; 77.-.C 1.53026457 1.164347551 2263017 887 0.T.-; 82.-.A 1.529811403 0.467986989 12163286 888 2.A.-; 89.AT.-G 1.528822089 1.00107691 2706481 889 2.A.C; 0.T.-; 1.52754828 1.209383598 82.A.-; 84.A.C 4320578 890 4.T.-; 66.C.- 1.527179936 0.994611388 3004121 891 1.TA.--; 85.TC.-A 1.525870388 0.697533949 3269260 892 2.A.G; 0.T.-; 75.-.C 1.521722305 0.738666566 7835518 893 55.-.G; 76.-.G 1.518881805 0.935071683 10195401 894 18.-.G; 81.GA.-T 1.518543539 0.775808631 6477333 895 16.-.C; 76.-.T 1.51587769 0.626814313 4171307 896 4.T.-; 27.-.A 1.513605325 1.233769066 10299590 897 17.-.T; 88.-.T 1.513069933 1.295754832 6478447 898 16.-.C; 75.C.- 1.512491339 0.508038646 4249490 899 4.T.-; 88.GA.-C 1.512130404 0.73669735 12220656 900 2.A.-; 66.C.- 1.512020037 1.05546421 7240739 901 27.-.C; 77.-.A 1.511778431 1.177553371 10315246 902 17.-.T; 73.AT.-G 1.511330905 1.009774993 1944754 903 0TT.--; 2.A.C; 1.511225805 1.155505022 76.-.G 3337255 904 2.A.G; 0.T.-; 74.-.T 1.509602507 0.678006083 6362999 905 17.-.A; 76.G.- 1.508590435 1.042551324 3017407 906 1.TA.--; 89.-.C 1.508577828 0.465448085 9973601 907 19.-.G; 75.-.A 1.502907348 0.893737423 12186826 908 2.A.-; 80.AG.-T 1.500547059 0.812595989 3035711 909 1.TA.--; 75.C.- 1.50008318 0.591995026 8526584 910 76.-.T 1.499331872 0.320393064 2211100 911 0.T.-; 27.-.A 1.498766744 1.299978621 8558515 912 74.-.T 1.498532736 0.244304059 4321895 913 4.T.-; 65.GC.-T 1.498442707 0.661273129 12204638 914 2.A.-; 75.C.- 1.49596065 0.654918883 8118238 915 76.GG.-C 1.495070866 0.554503755 2348592 916 0.T.-; 19.-.T 1.493134598 0.463440478 3282394 917 0.T.-; 2.A.G; 1.490851105 1.143853171 88.GA.-C 9974216 918 19.-.G; 76.GG.-A 1.489833949 0.650334517 3435006 919 0.T.-; 2.A.G; 1.487780343 0.572012417 17.-.T 2291281 920 0.T.-; 78.AG.-C 1.48644962 0.721753764 3013663 921 1.TA.--; 99.-.G 1.484001366 0.730348567 7255023 922 27.-.C; 70.-.T 1.483723737 1.383884246 4307384 923 4.T.-; 75.C.- 1.483251669 0.591919226 2702279 924 0.T.-; 2.A.C; 1.482180584 1.154754969 86.CC.-G 3036396 925 1.TA.--; 74.-.T 1.480425433 0.455235967 10196645 926 18.-.G; 78.-.C 1.478934738 0.7577364 4308690 927 4. T.-74.-.T 1.478644519 0.955354495 4298804 928 4.T.-; 78.A.G 1.476605159 0.725427219 12125860 929 2.A.-; 76.G.-; 1.47599621 0.782159575 78.A.C 2675530 930 0.T.-; 2.A.C; 1.473977708 1.266428954 90.T.- 7242260 931 27.-.C; 88.G.- 1.473373043 1.439338655 4287312 932 4.T.-; 82.AA.-T 1.472766154 0.577453742 3339492 933 2.A.G; 0.T.-; 1.471548367 1.444939954 73.AT.-C 4290113 934 4.T.-; 80.A.- 1.470113687 0.639199692 2293835 935 0.T.-; 78.A.-; 80.A.- 1.469388611 0.86669662 6455860 936 16.-.C; 74.-.C 1.467963371 0.526897826 2706303 937 0.T.-; 2.A.C; 1.467184493 1.023191849 82.AA.--; 85.T.C 7252350 938 27.-.C; 76.-.T 1.467027327 1.179599877 3277392 939 0.T.-; 2.A.G; 1.466923265 1.201147414 85.TC.-A 8538161 940 75.-.G; 132.G.C 1.466591325 0.427589068 8202442 941 87.-.A 1.464924451 0.818791149 2898633 942 1.-.C; 78.-.C 1.464030898 0.456291529 2648767 943 2.A.C; 0.T.-; 73.-.A 1.463173362 0.658913335 6115163 944 14.-.A; 88.G.- 1.46294421 0.52938306 10576534 945 15.-.T; 55.-.T 1.461210677 0.556416566 1904556 946 0.TTA.---; 3.C.A; 1.461144948 1.088815589 76.GG.-C 8073267 947 74.-.C 1.458640802 0.430303917 8755280 948 55.-.T 1.458287413 0.637579805 2341059 949 0.T.-; 28.-.C 1.457350597 1.284432147 3007006 950 1.TA.--; 90.T.- 1.45647646 1.125399861 7833962 951 55.-.G; 87.-.G 1.456238024 0.883248585 4299868 952 4.T.-; 78.-.T 1.455724565 0.940309293 8342692 953 89.A.G 1.454833967 0.974687875 2262741 954 0.T.-; 85.TC.-A 1.451410557 0.583323465 1942088 955 0TT.--; 2.A.C; 1.450492391 1.215838114 86.C.- 10200245 956 18.-.G; 74.-.T 1.448405766 0.937707192 4219211 957 4.T.-; 72.-.A 1.446520177 0.549344991 2457931 958 1.TA.--; 3.C.A; 1.444076731 0.735893179 75.-.C 3038631 959 1.TA.--; 73.AT.-G 1.443584213 0.559939739 12753950 960 0.-.T; 73.A.- 1.4435332 0.573037517 2129014 961 0.TTA.---; 3.C.G; 1.439545748 1.366024853 75.-.G 7833901 962 55.-.G; 86.C.- 1.439456801 0.67108624 10066878 963 19.-.T; 74.-.C 1.43944975 0.662912873

    TABLE-US-00023 TABLE 11 SEQ index ID NO muts_1indexed MI 95% CI 2714726 964 0.T.-; 2.A.C; 1.438502347 0.738791942 77.GA.--; 83.A.T 12106738 965 2.A.-; 72.-.G 1.437789303 1.200787575 2720418 966 0.T.-; 2.A.C; 1.43644621 1.201219979 77.GA.--; 80.A.C 2291924 967 0.T.-; 78.A.C 1.4359349 0.93677707 9991025 968 19.-.G; 81.GA.-T 1.434371779 0.688279351 4243954 969 4.T.-; 85.TC.-A 1.432539899 0.673581956 6362816 970 17.-.A; 75.-.C 1.432516289 0.887237626 8204227 971 87.C.A 1.432133272 1.064542809 1980019 972 0.T.C; 78.A.- 1.431187129 0.702091337 8142815 973 76.G.-; 130.T.G 1.429104435 0.270795433 10554966 974 15.-.T; 80.A.- 1.428888329 1.003322663 2702620 975 0.T.-; 2.A.C; 1.427340154 0.891520531 86.C.T 8142856 976 76.G.-; 132.G.C 1.427043687 0.237774998 12012995 977 2.A.-; 16.-.C 1.424513327 0.515408648 4284095 978 4.T.-; 82.AA.-C 1.424103366 0.718417545 10546168 979 15.-.T; 88.-.T 1.423883538 1.002262718 8128579 980 75.-.C 1.423710515 0.273255106 2703946 981 2.A.C; 0.T.-; 1.423451845 1.275687556 82.A.-; 85.T.G 12433040 982 1.TAC.---; 76.G.- 1.422927656 0.851734633 12162901 983 2.A.-; 89.-.C 1.42171048 0.831363626 2814556 984 0.T.-; 2.A.C; 19.-.G 1.420198732 0.571931257 8142933 985 76.G.-; 132.G.T 1.41986544 0.297329476 2710592 986 2.A.C; 0.T.-; 81.-.G 1.419787754 0.684050276 8537382 987 75.-.G; 121.C.A 1.419392503 0.407819009 12434064 988 1.TAC.---; 86.-.C 1.417035784 0.739250344 12438652 989 1. TAC.---; 75.C.- 1.416797803 0.893829093 8105679 990 76.GG.-A 1.415509749 0.237573505 8089861 991 75.-.A; 86.-.C 1.414086312 0.397272867 10177945 992 18.-.G; 72.-.A 1.413781205 0.836300188 4243445 993 4.T.-; 81.GA.-C 1.413254084 0.887148369 8123491 994 75.-.C; 88.G.- 1.41240947 0.440956817 4313666 995 4.T.-; 70.-.T 1.411481565 0.506158491 7180551 996 27.-.A; 76.-.A 1.409575725 1.180673384 6534510 997 17.-.G; 76.GG.-T 1.407215614 0.941339052 3025550 998 1.TA.--; 82.AA.-T 1.406508777 0.569736842 10275000 999 17.-.T; 71.-.C 1.40607729 0.754323892 8530347 1000 75.-C.GA 1.405553591 0.332518861 12438782 1001 1.TAC.---; 74.-.T 1.404014328 0.86810435 2724111 1002 2.A.C; 0.T.-; 78.A.-; 1.402948435 1.013377956 -80.A. 12682492 1003 0.-.T; 27.-.C 1.402481385 1.265768183 8336449 1004 89.-.C 1.399968085 0.251375019 2994450 1005 1.TA.--; 74.-.C 1.399303097 0.436372549 10070026 1006 19.-.T; 76.G.- 1.398597697 0.599022476 4246898 1007 4.T.-; 86.CC.-A 1.398315453 0.996312871 2056199 1008 0TT.--; 2.A.G; 1.397796768 1.058988953 82.AA.-T 2726405 1009 0.T.-; 2.A.C; 1.397727971 0.988558899 77.G.T 8093322 1010 75.-.A 1.396233471 0.309278367 4239175 1011 4.T.-; 77.-.C 1.395763792 0.978685252 3031832 1012 1.TA.--; 78.-.T 1.394964503 0.529438738 2303944 1013 0.T.-; 73.A.- 1.394767477 0.685653215 2255406 1014 0.T.-; 76.GG.-- 1.39467151 1.055424187 2468522 1015 1.TA.--; 3.C.A; 1.393765331 0.747608286 74.-.T 8543995 1016 75.-.G; 86.C.- 1.39257441 0.371930382 8348831 1017 88.-.T 1.392335932 0.333299943 2899043 1018 1.-.C; 78.A.- 1.392119807 0.692690413 6611143 1019 18.C.-; 75.-.A 1.391822496 0.602240717 8142880 1020 76.G.- 1.39077182 0.256141665 4294538 1021 4.T.-; 78.A.C 1.390406199 0.607275427 447196 1022 -27.C.A; 75.-.G 1.390265949 0.365279208 3338210 1023 2.A.G; 0.T.-; 1.390242773 0.685982978 75.CG.-T 8538250 1024 75.-.G; 131.A.C 1.389343955 0.441726963 10302419 1025 17.-.T; 83.-.C 1.388447653 1.345445476 3169133 1026 0.T.-; 2.A.G; 1.387799855 0.626570598 16.-.C 1855234 1027 0.TT.--; 86.-.C 1.386552663 0.590192706 3027053 1028 1.TA.--; 80.A.- 1.386335615 0.44423395 8142905 1029 76.G.-; 133.A.C 1.386299403 0.311670925 2465375 1030 1.TA.--; 3.C.A; 1.386188008 0.849600498 81.GA.-T 8137397 1031 76.G.-; 98.-.A 1.38509752 0.65791826 3304306 1032 2.A.G; 0.T.-; 1.38362179 1.225993381 89.A.- 8537231 1033 75.-.G; 120.C.A 1.383053376 0.450967918 4299393 1034 4.T.-; 78.AG.-T 1.382187217 1.034357685 3295454 1035 2.A.G; 0.T.-; 1.381863603 1.038871163 99.-.G 8519489 1036 76.GG.-T 1.379556363 0.163945711 3264318 1037 2.A.G; 0.T.-; 1.379358937 0.702823304 75.-.A 3266116 1038 2.A.G; 0.T.-; 1.379046637 0.672325549 76.GG.-A 2997992 1039 1.TA.--; 76.-.A 1.378072319 0.700284634 2672282 1040 2.A.C; 0.T.-; 1.376499067 0.804782737 86.CC.-A 14798941 1041 -29.A.C; 75.-.C 1.375822882 0.254844812 12031760 1042 2.A.-; 27.G.- 1.375192693 1.374595871 2201185 1043 0.T.-; 16.-.C 1.372900924 0.445813321 2400173 1044 1.-.A; 76.G.- 1.372064456 0.596118731 10088256 1045 19.-.T; 76.G.-; 1.369986019 0.714603396 78.A.T 10284913 1046 17 -.T; 77.- A 1.369839502 1.090311599

    TABLE-US-00024 TABLE 12 SEQ index ID NO muts_1indexed MI 95% CI 10545701 1047 15.-.T; 89.A.- 1.369748818 1.003332985 8212851 1048 86.-.C 1.369391509 0.539620134 8132895 1049 75.-.C; 86.C.- 1.368039243 0.296779105 3281950 1050 2.A.G; 0.T.-; 1.367611373 0.907291353 86.-.C 1858655 1051 0.TT.--; 87.-.G 1.367558992 0.620186488 12737396 1052 0.-.T; 86.C.- 1.365343254 0.552234176 6474033 1053 16.-.C; 80.A.- 1.363437029 0.56174258 2646406 1054 0.T.-; 2.A.C; 1.36343607 1.115304879 72.-.G 3020097 1055 1.TA.--; 86.-.G 1.363355265 0.580106368 12160739 1056 2.A.-; 91.A.-; 1.363329423 1.066828539 93.A.G 14919005 1057 -29.A.C; 2.A.-; 1.362482864 0.432898468 76.G.- 10527714 1058 15.-.T; 79.G.- 1.361775897 0.846824969 3023033 1059 1.TA.--; 82.A.-; 1.361357615 1.194817135 84.A.G 2467773 1060 1.TA.--; 3.C.A; 1.36121818 0.679797788 76.-.T 2284824 1061 0.T.-83.-.T 1.360543389 0.848033047 9987305 1062 19.-.G; 87.-.G 1.360442144 0.734418526 2628450 1063 2.A.C; 0.T.-; 1.360069277 0.861447129 65.GC.-A 8531228 1064 75.-.G; 87.-.A 1.359545621 0.690949702 1939243 1065 0.TT.--; 2.A.C; 1.358280955 0.943115167 86.-C 3050495 1066 1.TA.--; 55.-.T 1.358171094 0.87966165 7835450 1067 55.-.G; 78.A.- 1358033334 0.698343089 12702721 1068 0.-.T; 55.-.G 1.357295007 0.530874809 4231994 1069 4.T.-; 76.-.A 1.357045893 0.79932847 10185683 1070 18.-.G; 88.G.- 1.35658647 1.037901 2709497 1071 2.A.C; 0.T.-; 1.355764778 1.203503878 82.A.C 8330844 1072 91.A.G 1.355287946 1.033211677 10287644 1073 17.-.T; 85.TC.-G 1.355153586 1.18231053 9976346 1074 19.-.G; 77.-.A 1.354948471 0.743583366 8759277 1075 55.-.T; 75.-.G 1.352910748 0.800352238 2711676 1076 2.A.C; 0.T.-; 1.351869067 0.771861665 82.AA.-G 10199887 1077 18.-.G; 75.C.- 1.351414349 0.818440979 12131652 1078 2.A.-; 85.TC.-A 1.351255788 1.139173311 8628479 1079 66.CT.-G; 76.G.- 1.350688923 0.362115272 2459762 1080 1.TA.--; 3.C.A; 1.350298722 1.009173521 87.-.A 8647329 1081 66.C.T 1.350057167 1.188259683 6526262 1082 17.-.G; 76.G.- 1.349925914 1.264875753 2279498 1083 0.T.-; 88.-.T 1.349921712 0.487773646 2719218 1084 0.T.-; 2.A.C; 79. 1.349444156 1.087166266 GAGAAA.TTTCTC 1858516 1085 0.TT.--; 86.C.- 1.349395537 1.336682614 14798574 1086 -29.A.C; 76.GG.-C 1.34699507 0.500207927 10178596 1087 18.-.G; 72.-.C 1.346450015 0.765748852 8118222 1088 76.GG.-C; 132.G.C 1.34615675 0.516935159 12181387 1089 2.A.-; 82.-.T 1.344913969 0.639139505 10285141 1090 17.-.T; 76.G.-; 1.344831557 0.980116215 78.A.C 8565359 1091 75.CG.-T 1.344784065 0.28783714 8142963 1092 76.G.-; 131.A.C 1.344489963 0.258971589 6313836 1093 16.-.A; 78.A.- 1.341546233 0.715419964 6455586 1094 16.-.C; 74.T.- 1.340536921 0.588962188 10069022 1095 19.-.T; 76.GG.-C 1.339199983 0.689265401 8538125 1096 75.-.G; 130.T.G 1.339090974 0.405488829 8208034 1097 88.G.- 1.339014146 0.22663535 4210228 1098 4.T.-; 65.G.- 1.337504821 0.725776958 8555144 1099 74.-.T; 86.-.C 1.336356371 0.495439384 2211631 1100 0.T.-; 27.G.- 1.335840597 1.02295738 14799468 1101 -29.A.C; 76.G.- 1.335226973 0.265255991 3023524 1102 1.TA.--; 82.AA.-- 1.334715286 0.777258592 14921453 1103 -29.A.C; 2.A.-; 1.334084702 0.448087214 75.-.G 2465666 1104 1.TA.--; 3.C.A; 1.333777233 1.225453831 80.A.-- 2124272 1105 0.TTA.---; 3.C.G; 1.333161176 1.020991136 86.-.C 4366553 1106 4.T.-; 28.-.C 1.333118117 1.147457336 15160651 1107 -29.A.G; 75.-.C 1.332785693 0.280235081 2248937 1108 0.T.-; 70.T.-; 73.A.C 1.329283638 1.288981376 10307622 1109 17.-.T; 78.A.C 1.328660147 0.893411396 2670634 1110 0.T.-; 2.A.C; 1.327285114 0.860888625 85.TC.-- 10180147 1111 18.-.G; 74.-.C 1.326125292 0.932899353 10288203 1112 17.-.T; 87.-.A 1.325075156 0.741328018 14806896 1113 -29.A.C; 87.-.G 1.324442672 0.255955368 2708627 1114 0.T.-; 2.A.C; 1.32346629 0.575802358 82.AA.- 3260655 1115 2.A.G; 0.T.-; 74.T.- 1.322242725 0.641221404 12719454 1116 0.-.T; 76.GG.-A 1.322124436 0.483164367 12432022 1117 1.TAC.---; 74.-.C 1.320938397 0.64685233 4245923 1118 4.T.-; 85.TC.-G 1.320596842 1.255360283 8363261 1119 87.-.T 1.320550533 0.482292904 2128723 1120 0.TTA.---; 1.318357676 1.198530269 3.C.G; 76.GG.-T 8514493 1121 77.-.T 1.317772824 0.80389443 3330625 1122 0.T.-; 2.A.G; 1.317088275 1.251882713 77.-.T 10279842 1123 17.-.T; 74.-.G 1.316219704 0.99735284 3271300 1124 2.A.G; 0.T.-; 1.315040838 0.602125183 76.G.- 12209957 1125 2.A.-; 73.-.G 1.314239351 1.123034513 2295677 1126 0.T.-; 76.G.-; 1.313626293 0.643771948 78.A.T 7188615 1127 27.-.A; 79. 1.311956522 1.250658747 GAGAAA.TTTCTC

    TABLE-US-00025 TABLE 13 SEQ index ID NO muts_1indexed MI 95% CI 8638657 1128 66.CT.-G; 78.A.- 1.311428923 0.33055537 6470437 1129 16.-.C; 86.-.G 1.309929002 0.430012879 12102732 1130 2.A.-; 72.-.A 1.307434337 0.918377829 8142718 1131 76.G.-; 129.C.A 1.304595264 0.256619569 8156448 1132 77.-.C 1.304175846 0.589870986 1852995 1133 0.TT.--; 75.-.C 1.303475262 0.900561689 2887175 1134 1.-.C; 88.G.- 1.302706726 0.597968881 2263396 1135 0.T.-; 85.T.- 1.302466047 1.134047233 1825818 1136 0.TT.-A; 76.G.- 1.301875777 1.110318533 8344169 1137 89.A.- 1.301561654 1.225981484 2709285 1138 2.A.C; 0.T.-; 1.30091689 0.894342408 82.-.C 3023675 1139 1.TA.--; 82.A.-; 1.299899754 0.818223111 84.A.T 10084841 1140 19.-.T; 81.GA.-T 1.297930762 0.600453513 1976248 1141 0.T.C; 86.-.C 1.297836547 0.825789148 12154344 1142 2.A.-; 99.-.G 1.296306945 1.001477179 13097626 1143 -1.GT.--; 76.G.- 1.295125439 0.441980787 6458438 1144 16.-.C; 76.-.A 1.29467865 0.846781549 8150274 1145 77.-.A 1.294485982 0.228877584 8757116 1146 55.-.T; 87.-.G 1.292770836 0.600605612 2701481 1147 0.T.-; 2.A.C; 1.291935395 0.554674604 87.C.T 6458094 1148 16.-.C; 76.GG.-A 1.289567023 1.072472271 8096141 1149 75.-.A; 87.-.G 1.289021439 0.399874445 1937383 1150 0.TT.--; 2.A.C; 1.288410807 1.057575643 76.GG.-C 10527226 1151 15.-.T; 76.G.-; 1.288081249 0.940790829 78.A.C 2461285 1152 1.TA.--; 3.C.A 1.288043851 1.103673268 9999142 1153 19.-.G; 73.A.- 1.286125046 0.905401071 8190839 1154 85.TC.-- 1.285570034 0.96890997 4021093 1155 3.-.C; 87.-.G 1.285356603 0.94937054 8128562 1156 75.-.C; 132.G.C 1.283817887 0.295940599 4026117 1157 3.-.C; 76.GG.-T 1.282205843 0.870543947 3458694 1158 0.TTAC.----; 1.2817117 1.235570501 75.-.C 2402393 1159 1.-.A; 87.-.A 1.281613783 0.828164871 1852100 1160 0.TT.--; 75.-.A 1.281266877 0.682106006 3325688 1161 2.A.G; 0.T.-; 1.280888677 0.892056905 78.A.- 2742029 1162 0.T.-; 2.A.C; 1.280778188 0.548022631 73.A.T 6577492 1163 18.-.A; 86.-.C 1.279802601 0.717533757 12218636 1164 2.A.-; 66.CT.-G 1.279066994 0.773028062 8219007 1165 89.-.A 1.278500325 1.111071537 6369323 1166 17.-.A; 76.GG.-T 1.278457146 0.804381168 2651674 1167 0.T.-; 2.A.C; 1.278172092 1.277273592 74.TC.-- 12717259 1168 0.-.T; 74.-.C 1.277376795 0.540831784 15160113 1169 -29.A.G; 1.277357928 0.269809108 76.GG.-A 2900998 1170 1.-.C; 76.-.T 1.277094929 0.459925786 1864123 1171 0.TT.--; 74.-.T 1.275311167 0.782684718 1936243 1172 0.TT.--; 2.A.C; 1.26922446 0.978313316 73.-.A 10087310 1173 19.-.T; 76.-.G 1.268648221 1.013020879 8128641 1174 131.A.C; 75.-.C 1.268371306 0.347123635 2466267 1175 1.TA.--; 3.C.A; 1.267812234 0.761193775 78.-.C 14814370 1176 -29.A.C; 74.-.T 1.267572185 0.224895956 8367586 1177 86.-.G 1.267571029 0.166811565 14814654 1178 -29.A.C; 1.267223704 0.299661636 75.CG.-T 7178892 1179 27.-.A; 72.-.C 1.266580365 1.241702285 2713900 1180 0.T.-; 2.A.C; 1.266523416 1.064785518 82.AA.--; 84.A.T 12745658 1181 0.-.T; 78.A.- 1.266094696 0.628742094 12436108 1182 1.TAC.---; 86.C.- 1.265494144 0.683395752 8490474 1183 76.-.G; 131.A.C 1.264843818 0.316333863 6479094 1184 16.-.C; 75.CG.-T 1.264484483 0.657988122 10280354 1185 17.-.T; 75.-.A 1.264238931 1.254859427 10528666 1186 15.-.T; 77.GA.-- 1.264204883 1.069840201 10303386 1187 17.-.T; 82.AA.-- 1.264094608 1.141678594 2355406 1188 0.T.-; 15.-.T 1.26208998 0.699889425 3032160 1189 1.TA.--; 78.A.T 1.261906598 0.661737928 7237755 1190 27.-.C; 72.-.C 1.261808889 1.185044155 2295261 1191 0.T.-; 78.A.T 1.261798645 0.619874643 14798078 1192 -29.A.C; 1.261281447 0.214857356 76.GG.-A 3307911 1193 0.T.-; 2.A.G; 1.259023231 0.786548058 86.-.G 8132962 1194 75.-.C; 87.-.G 1.259001218 0.463752754 10181383 1195 18.-.G; 1.258323933 0.523286921 75.CG.-A 8197001 1196 86.-.A 1.256849633 0.486914942 10309927 1197 17.-.T; 76.G.-; 1.256782087 0.744678415 78.A.T 2301271 1198 0.T.-; 73.AT.-C 1.256424659 0.81100738 13853791 1199 -14.A.C; 75.-.G 1.255450038 0.42561035 8538003 1200 75.-.G; 128.T.G 1.255025364 0.362250327 8531397 1201 75.-.G; 88.G.- 1.254071245 0.476939803 10088571 1202 19.-.T; 76.GG.-T 1.253979064 0.431051128 10090672 1203 19.-.T; 74.-.T 1.253721121 0.83319223 9978638 1204 19.-.G; 87.-.A 1.253713731 0.820915459 10183679 1205 18.-.G; 76.G.-; 1.253476631 0.445201573 78.A.C 2283016 1206 0.T.-; 82.A.- 1.252963004 0.465519392 2695201 1207 0.T.-; 2.A.C; 1.25282914 0.803574579 91.A.G 6475853 1208 16.-.C; 76.-.G 1.250559059 0.663368638 6111106 1209 14.-.A; 1.249881883 0.738247287 76.GG.-A 3082312 1210 1.TA.--; 17.-.T 1.249436868 0.812464001

    TABLE-US-00026 TABLE 14 SEQ index ID NO muts_1indexed MI 95% CI 10566255 1211 15.-.T; 73.AT.-C 1.248872576 0.813225669 10070730 1212 19.-.T; 79.G.- 1.248861015 0.601945811 14812876 1213 -29.A.C; 76.GG.-T 1.248067875 0.150831793 1246999 1214 -15.T.G; 76.G.- 1.247102347 0.224797578 8558498 1215 74.-.T; 132.G.C 1.246022069 0.249030346 10518792 1216 15.-.T; 72.-.G 1.245964164 0.488651001 4277925 1217 4.T.-; 84.AT.-- 1.245854234 0.936943861 8352817 1218 86.C.- 1.244532434 0.150629215 8538048 1219 75.-.G; 129.C.A 1.244280774 0.412263647 14797557 1220 -29.A.C; 75.-.A 1.242782689 0.319674168 8538200 1221 75.-.G; 133.A.C 1.241616447 0.440187544 4283490 1222 4.T.-; 82.-.C 1.24156885 0.687466845 1865218 1223 0.TT.--; 73.A.- 1.240690771 0.7042098 6525015 1224 17.-.G; 75.-.A 1.240613105 0.979161775 10181717 1225 18.-.G; 76.GG.-A 1.23997956 1.137575689 6458686 1226 16.-.C; 76.GG.-C 1.239775702 0.87363525 9978404 1227 19.-.G; 86.-.A 1.239174316 0.801664764 9631659 1228 16.------------. 1.2381472 1.157545889 CTCATTACTTTG 1938525 1229 0.TT.--; 2.A.C; 1.234976889 0.873037971 77.GA.-- 1907202 1230 0.TTA.---; 3.C.A; 1.234558517 0.900076058 87.-.G 2315524 1231 0.T.-; 55.-.T 1.234352592 0.65468754 8531688 1232 75.-.G; 89.-.A 1.234168624 0.685214819 14798356 1233 -29.A.C; 76.-.A 1.233456387 0.88515606 8590491 1234 73.A.G 1.232844488 0.306976558 3335980 1235 2.A.G; 0.T.-; 75.C.- 1.23143562 0.615508551 2695420 1236 0.T.-; 2.A.C; 1.23131981 1.032803346 91.AA.-G 3307298 1237 0.T.-; 2.A.G; 87.-.T 1.231275978 0.519311047 2560220 1238 0.T.-; 2.A.C; 14.-.A 1.231165601 0.62236647 15165185 1239 -29.A.G; 87.-.G 1.231041719 0.270182884 12718005 1240 0.-.T; 74.-.G 1.230670859 0.871174328 10058332 1241 19.-.T; 55.-.G 1.229512018 1.083906642 8532180 1242 75.-.G; 98.-.A 1.229364421 0.748719278 7242912 1243 27.-.C; 90.-.G 1.229092331 0.949305592 8105731 1244 76.GG.-A; 131.A.C 1.228181078 0.230343111 2748293 1245 2.A.C; 0.T.-; 66.C.- 1.227763647 0.98496011 3026215 1246 1.TA.--; 77.GA.--; 1.226977479 0.997524073 83.A.T 1938157 1247 0.TT.--; 2.A.C; 1.225574228 0.831200101 77.-.A 11775381 1248 2.-.C; 76.G.- 1.225102258 0.595949363 15161003 1249 -29.A.G; 76.G.- 1.223889061 0.294582862 14811016 1250 -29.A.C; 78.-.C 1.222938798 0.273221745 7237431 1251 27.-.C; 72.-.A 1.221788719 1.142877721 4220887 1252 4.T.-; 72.-.C 1.219780408 0.66608177 10561000 1253 15.-.T; 76.G.-; 1.218871558 0.647994569 78.A.T 3318946 1254 0.T.-; 2.A.G; 1.217687896 0.704918875 81.GA.-T 10565555 1255 15.-.T; 75.CG.-T 1.217561106 1.206694498 2644619 1256 2.A.C; 0.T.-; 1.217521416 0.643415599 72.-.C 12112275 1257 2.A.-; 74.T.G 1.217072779 0.652972838 1862409 1258 0.TT.--; 76.-.G 1.217021239 0.888749766 7189944 1259 27.-.A; 78.-.T 1.216123094 1.075111755 6126842 1260 14.-.A; 78.-.C 1.215991705 0.768204394 8543659 1261 75.-.G; 88.-.G 1.214712222 0.655007886 2684568 1262 2.A.C; 0.T.- 1.213071327 0.264663522 2697264 1263 2.A.C; 0.T.-; 1.2126732 1.021553423 89.A.G 4285424 1264 4.T.-; 82.A.G 1.211126496 1.094417444 4298510 1265 4T.-; 78.A.-; 1.209030922 0.66844537 80.A.- 3594929 1266 2.-.A; 87.-.T 1.208764231 0.738646374 10310746 1267 17.-.T; 76.-.T 1.208539188 0.919441484 6535421 1268 17.-.G; 74.-.T 1.207908272 0.926692004 2738172 1269 0.T.-; 2.A.C73.-.G 1.207771032 1.035065567 1942201 1270 0.TT.--; 2.A.C; 1.207677897 0.973271683 87.-.G 8518877 1271 76.GG.-T; 1.206646593 0.182266975 121.C.A 15159780 1272 -29.A.G; 75.-.A 1.205938094 0.315739517 2290805 1273 0.T.-; 79. 1.204355839 0.868799816 GAGAAA.TTTCTC 2399086 1274 1.-.A; 76.GG.-A 1.203971897 0.48437301 1974829 1275 0.T.C; 76.GG.-A 1.203879032 0.4210079

    TABLE-US-00027 TABLE 15 SEQ index ID NO muts_1indexed MI 95% CI 1192019 1276 -15.T.G; 0.T.-; 1.20360799 0.302971783 2.A.C 8565342 1277 75.CG.-T; 132.G.C 1.202289742 0.286937554 8357813 1278 87.-.G; 132.G.C 1.201504305 0.284156001 14647197 1279 -29.A.C; 0.T.-; 1.19977199 0.596254455 2.A.C; 75.-.G 10192426 1280 18.-.G; 86.C.- 1.197676147 0.845523053 2239077 1281 0.T.-; 65.GC.-A 1.197039025 0.827792408 12185807 1282 2.A.-; 80.A.-82.A.- 1.195795094 1.14774883 14921338 1283 -29.A.C; 2.A.-; 1.194753512 0.590835399 76.GG.-T 1909484 1284 0.TTA.---; 3.C.A; 1.194601681 0.899923073 74.-.T 10067367 1285 19.-.T; 74.-.G 1.194366583 0.703892606 8406855 1286 82.A.-; 84.A.T 1.19422157 0.570093929 3084704 1287 1.TA.--; 15.-.T 1.194024744 0.639373123 8117630 1288 76.GG.-C; 121.C.A 1.193941022 0.493915898 14813162 1289 -29.A.C; 76.-.T 1.193770617 0.312340253 10086912 1290 19.-.T; 78.A.- 1.193704359 0.526544832 8565389 1291 75.CG.-T; 132.G.T 1.19331243 0.298806463 6627225 1292 18.C.-; 76.GG.-T 1.192355135 0.550645762 8485326 1293 76.-.G; 86.-.C 1.192298677 0.493607798 1853928 1294 0.TT.--; 79.G.- 1.191920618 0.949329516 12437875 1295 1.TAC.---; 76.-.G 1.191773341 0.823417938 10182569 1296 18.-.G; 75.-.C 1.191543511 0.876936342 6584325 1297 18.-.A; 76.-.G 1.190997627 0.955552088 8638758 1298 66.CT.-G; 76.-.G 1.190381196 0.453916978 6460324 1299 16.-.C; 79.G.- 1.190312109 0.493534915 8365015 1300 87.C.T 1.190052456 0.872602313 8490408 1301 76.-.G 1.18960287 0.31994112 6525955 1302 17.-.G; 75.-.C 1.188288682 1.099927803 6460105 1303 16.-.C; 76.G.-; 1.187507242 0.685448258 78.A.C 6112043 1304 14.-.A; 75.-.C 1.18750131 0.773401733 1978266 1305 0.T.C; 86.C.- 1.186318648 0.482781507 8636881 1306 66.CT.-G; 87.-.G 1.186183907 0.213972824 15241255 1307 -29.A.G; 2.A.-; 1.185988694 0.443745556 75.-.G 6362433 1308 17.-.A; 76.GG.-A 1.185910029 0.85106617 2059902 1309 0.TT.--; 2.A.G; 1.185892464 1.168809929 74.-.T 14799744 1310 -29.A.C; 77.-.A 1.185825684 0.192460709 8118273 1311 76.GG.-C; 1.18519234 0.62982038 132.G.T 4278865 1312 4.T.-; 84.-.T 1.184410432 1.107710251 10065094 1313 19.-.T; 72.-.C 1.1828142 0.675106042 8561350 1314 74.-.T; 87.-.G 1.182048719 0.393482481 15160423 1315 -29.A.G; 1.180793171 0.555546714 76.GG.-C 2994738 1316 1.TA.--; 74.T.G 1.18058976 0.979631175 15058565 1317 -29.A.G; 0.T.-; 1.180163675 0.270139027 2.A.C 12222182 1318 2.A.-; 65.GC.-T 1.179771955 0.796494205 2881480 1319 1.-.C; 74.T.- 1.179501503 0.538435597 10193035 1320 18.-.G86.-.G 1.17845471 0.684536204 6459089 1321 16.-.C; 75.-.C 1.17843793 0.58933484 10298749 1322 17.-.T; 89.-.C 1.178374767 0.684239424 8490381 1323 76.-.G; 132.G.C 1.177042107 0.335663686 12306660 1324 2.A.-; 18.-.G 1.177019617 0.435298202 8124036 1325 75.-.C; 98.-.A 1.176947131 0.49926186 2893687 1326 1.-.C; 88.-.T 1.17496713 0.780013503 6305247 1327 16.-.A; 77.GA.-- 1.174157138 0.633742635 7248579 1328 27.-.C; 83.-.T 1.173562933 1.083697051 2883890 1329 1.-.C; 75.-.C 1.173398841 0.613509504 10183041 1330 18.-.G; 76.G.- 1.173134322 0.967093776 2696443 1331 0.T.-; 2.A.C; 1.173067193 0.976987691 89.A.C 15239681 1332 -29.A.G; 2.A.-; 1.173012223 0.486727112 76.G.- 8087771 1333 74.-.G; 87.-.G 1.172944262 0.426278168 10285497 1334 17.-.T; 79.G.- 1.17154961 0.929605625 8118258 1335 76.GG.-C; 1.170986028 0.499395392 133.A.C 8141939 1336 76.G.-; 121.C.A 1.17085979 0.256575176 8066677 1337 74.T.- 1.168909113 0.239501292 8558553 1338 74.-.T; 132.G.T 1.167854164 0.29356652 6469022 1339 16.-.C; 89.-.C 1.167563507 0.467845833 1046356 1340 -17.C.A; 75.-.G 1.166966628 0.334507035 10532753 1341 15.-.T; 89.-.A 1.16628898 0.941587373 2706855 1342 2.A.C; 0.T.-; 1.165750392 0.619157804 83.-.G 12194678 1343 2.A.-; 78.A.G 1.165471135 0.91536488 12126149 1344 2.A.-; 77.-.C 1.164066997 0.392106235 3039439 1345 1.TA.--; 70.-.T 1.162844229 1.00756116 8123371 1346 75.-.C; 87.-.A 1.161856358 0.505141299 15160286 1347 -29.A.G; 76.-.A 1.161712843 0.721602172 8758541 1348 55.-.T; 80.A.- 1.160729144 0.587416563 12433294 1349 1.TAC.---; 1.160546375 0.559999519 79.G.- 14801714 1350 -29.A.C87.-.A 1.15970438 0.841171049 15058156 1351 2.A.C; 0.T.-; 1.158508484 0.396829259 -29.A.G; 76.G.- 2298993 1352 0.T.-; 75.C.- 1.158479025 0.419303739 13100965 1353 -1.GT.--; 78.A.- 1.158052786 0.371262978 8438445 1354 77.GA.--; 83.A.T 1.156188842 0.838502061 8519469 1355 76.GG.-T; 1.155859915 0.148192041 132.G.C

    TABLE-US-00028 TABLE 16 SEQ index ID NO muts_1indexed MI 95% CI 8569101 1356 75.CGG.-TT 1.154557321 0.217307834 4310993 1357 4.T.-;73.AT.-C 1.153274081 0.453854703 9971050 1358 19.-.G;72.-.C 1.152740318 0.725290861 2996647 1359 1.TA.--;75.CG.-A 1.151902848 0.811777159 8561305 1360 74.-.T;86.C.- 1.151372297 0.237653764 8093224 1361 75.-.A;129.C.A 1.151362432 0.273047434 3323632 1362 2.A.G;0.T.-;78.AG.- 1.150994398 0.848919541 C 14663326 1363 - 1.150191366 0.599920591 29.A.C;0.T.-;2.A.G; 75.-.G 1936729 1364 0.TT.- 1.15004696 1.030340427 -;2.A.C;74.-.G 1977130 1365 0.T.C 1.148209421 0.707223693 8141742 1366 120.C.A;76.G.- 1.148153033 0.267222437 1908681 1367 0.TTA.-- 1.14774524 0.964815 -;3.C.A;76.-.G 3017898 1368 1.TA.--;89.A.G 1.147741635 0.737313223 3340495 1369 0.T.-;2.A.G;73.A.C 1.147576225 1.09581674 2254255 1370 0.T.-;75.CG.-A 1.146513584 0.700676298 11953402 1371 2.AC.- 1.145157595 1.093445431 -;4.T.C;76.GG.-C 2684619 1372 0.T.-;2.A.C; 132.G.T 1.144862088 0.260357332 10314306 1373 17.-.T;73.AT.-C 1.144426663 1.028995367 10559572 1374 15.-.T;78.A.G 1.143699755 0.578604678 2630318 1375 2.A.C;0.T.-;66.CT.- 1.143660067 0.5343262 A 1943847 1376 0.TT.- 1.142911019 0.764533182 -;2.A.C;81.GA.-T 4270685 1377 4.T.-;90.-.T 1.142261105 1.061096734 8066737 1378 74.T.-;131.A.C 1.142106376 0.297627826 6101577 1379 14.-.A;55.-.G 1.141633238 0.632413834 4279604 1380 4.T.-;82.A.- 1.141087787 0.86559009 2284176 1381 0.T.-;83.-.G 1.140852012 0.573812016 6480468 1382 16.-.C;70.-.T 1.1398625 0.613893735 2640116 1383 0.T.-;2.A.C;71.-.C 1.13661499 0.936457355 10194587 1384 18.-.G;82.AA.-C 1.136546503 0.867225106 15456465 1385 -30.C.G;75.-.G 1.136361233 0.420956305 3432602 1386 0.T.-;2.A.G;18.-.G 1.136032616 0.358683183 8345813 1387 89.-.T 1.134872739 0.634425715 3023247 1388 1.TA.--;83.-.T 1.134857334 0.960489164 10472698 1389 16.C.-;76.-.G 1.134422965 0.910950327 1855129 1390 0.TT.--;88.G.- 1.133496442 0.758584634 9993029 1391 19.-.G;78.A.- 1.133174297 0.792593276 15168776 1392 -29.A.G;76.GG.-T 1.132498922 0.227015084 2464359 1393 1.TA.- 1.131831655 1.057358093 -;3.C.A;82.A.-;84.A. G 12156161 1394 2.A.-;98.-.T 1.130993969 0.851874656 8544614 1395 75.-.G;82.A.- 1.130902206 0.457628408 2278784 1396 0.T.-;89.A.G 1.129976098 0.932328577 4229697 1397 4.T.-;75.CG.-A 1.129356919 1.031398221 6461360 1398 16.-.C;82.-.A 1.129237794 0.60908879 8128601 1399 133.A.C;75.-.0 1.129022276 0.316118395 6362009 1400 17.-.A;74.-.G 1.127775382 0.792324832 14806733 1401 -29.A.C;86.C.- 1.127749344 0.128149617 1937160 1402 0.TT.- 1.126385937 0.99995983 -;2.A.C;76.GG.-A 4311644 1403 4.T.-;73.A.C 1.126234133 0.593451059 1863149 1404 0.TT.--;76.GG.-T 1.126088195 0.642579265 15169751 1405 -29.A.G;74.-.T 1.12571698 0.264785044 14811726 1406 -29.A.C;76.-.G 1.125696747 0.337727802 6480066 1407 16.-.C;73.AT.-G 1.125267029 0.917637118 3014440 1408 1.TA.--;98.-.T 1.125187087 0.944870769 6473404 1409 16.-.C;82.AA.-T 1.125183194 0.45047498 7179375 1410 27.-.A;73.-.A 1.12275521 1.11852897 12303885 1411 2.A.-;19.-.T 1.122538412 0.456330423 2267762 1412 0.T.-;98.-.A 1.122023688 0.678726891 10318319 1413 17.-.T;66.CT.-G 1.121565522 1.049618975 8093357 1414 75.-.A;132.G.T 1.121299918 0.315044761 3027775 1415 1.TA.--;80.AG.-T 1.120820262 0.672573613 10549691 1416 15.-.T;82.A.- 1.11965366 0.843624461 8558571 1417 74.-.T;131.A.C 1.119006524 0.242404014 12210725 1418 2.A.-;73.AT.-G 1.118721361 0.804765677 6462677 1419 16.-.C;86.-.0 1.118051706 0.993606042 2281811 1420 0.T.-;86.CC.-T 1.117740311 0.882847082 8496336 1421 78.A.-;80.A.- 1.11711092 0.515102154 3038148 1422 1.TA.--;73.A.0 1.116865927 0.861601124 10199335 1423 75.-.G;127.T.G 1.115860528 0.443672147 14801930 1424 -29.A .C;88.G.- 1.115492358 0.261525199 2885740 1425 1.-.C;81.GA.-C 1.115472314 0.689247174 8436871 1426 81.GA.-T 1.115411316 0.273931065 6533591 1427 17.-.G;78.-.C 1.115398223 0.879526979 8508461 1428 78.A.T 1.115273341 0.522766505 2303258 1429 0.T.-;70.-.T 1.114089034 0.865293893 10200479 1430 18.-.G;75.CG.-T 1.11302882 0.732217972 8142460 1431 76.G.-;126.C.A 1.111268298 0.288237659 8490449 1432 76.-.G;132.G.T 1.111184304 0.315337948 1862090 1433 0.TT.--;78.A.- 1.110821771 0.799594856 8105143 1434 76.GG.-A;121.C.A 1.110817347 0.256306387 10204124 1435 18.-.G;65.GC.-T 1.110123297 0.661140904 2696979 1436 0.T.-2.A.C;88.-.G 1.109825686 0.606525063 1246393 1437 -15.T.G;76.GG.-A 1.109540149 0.193534821 4277641 1438 4.T.-;84.-.C 1.109476081 1.084635844 12163684 1439 2.A.-;88.-.G 1.108884791 0.569947232 3643882 1440 3.CT.-A;76.GG.-A 1.108525297 0.784501998 6461122 1441 16.-.C;81.GA.-C 1.108411865 0.6256586 14645694 1442 2.A.C;0.T.-;-29.A.C 1.108180575 0.267740202 2678659 1443 0.T.-;2.A.C;98.-.A 1.108043817 0.375625961 2295085 1444 0.T.-;77.GA.- 1.107908285 0.695122129 -;80.A.T 8127785 1445 75.-.C; 120.C.A 1.107076026 0.298513014 8357871 1446 87.-.G;132.G.T 1.106990466 0.336105007 12090020 1447 2.A.-;66.CT.-A 1.106107395 0.759889566 3079463 1448 1.TA.--;19.-.T 1.105122706 0.424402722 10277558 1449 17.-.T;72.-.G 1.105013965 0.33485503 2694724 1450 0.T.-;2.A.C;92.A.T 1.102493901 0.92875617 3135565 1451 1.T.G;3.C.-;75.C.- 1.102427225 0.672977559 6304328 1452 16.-.A;75.-.0 1.102231603 0.655223933 2708067 1453 2.A.C;0.T.-;83.-.T 1.102074657 0.85908326

    TABLE-US-00029 TABLE 17 SEQ index ID NO muts_1indexed MI 95% CI 6469331 1454 16.-.C;89.A.- 1.101247124 0.790943347 10073526 1455 19.-.T;90.T.- 1.100917015 0.917104807 3017595 1456 1.TA.--;89.AT.-G 1.100705976 0.903502652 3031194 1457 1.TA.--;78.A.G 1.100353042 1.041515667 12123777 1458 2.A.-;76.G.-;132.G.C 1.099950644 0.426062735 15451300 1459 -30.C.G;76.G.- 1.099949995 0.258120629 8105041 1460 76.GG.-A;120.C.A 1.099511776 0.197987545 2894267 1461 1.-.C;87.-.T 1.099423144 0.721770941 2998547 1462 1.TA.--;76.GG.-C 1.099108914 0.77205836 3022051 1463 1.TA.--;83.-.C 1.098959048 0.800244551 8512487 1464 76.G.-;78.A.T 1.098356606 0.434447312 2285757 1465 0.T.-;82.AA.-C 1.09769235 0.581396293 6531470 1466 17.-.G;87.-.G 1.097040084 0.891732461 3461447 1467 0.TTAC.----;78.A.- 1.096939612 1.032099163 6475031 1468 16.-.C;78.-.C 1.096131509 0.622829146 10194914 1469 18.-.G;82.AA.-G 1.095184273 0.925851293 1041972 1470 -17.C.A;76.G.- 1.094390364 0.259851818 8537811 1471 75.-.G;126.C.A 1.093652258 0.416192839 3020817 1472 1.TA.--;84.AT.-- 1.093578537 1.006083902 2887379 1473 1.-.C;86.-.C 1.09339523 0.649567308 1854285 1474 0.TT.--;77.GA.-- 1.093372662 0.836050071 8357326 1475 87.-.G;121.C.A 1.09282229 0.228022974 8128534 1476 75.-.C;130.T.G 1.091710468 0.291584852 1947291 1477 0.TT.--;2.A.C;73.A.- 1.091598518 1.082985081 12432721 1478 1.TAC.---;76.GG.-C 1.091484949 0.424680956 1252779 1479 -15.T.G;75.-.G 1.091018899 0.435778338 3588353 1480 2.-.A;86.-.0 1.090352944 0.473490794 2900664 1481 1 .-.C;76.GG.-T 1.090288414 0.927626492 8076983 1482 74.T.G 1.090265095 0.516206235 2300899 1483 0.T.-;73.-.C 1.088155007 0.922134256 12202788 1484 2.A.-;75.-.G;132.G.C 1.086592764 0.396856807 10070325 1485 19.-.T;77.-.A 1.085159477 0.602291028 14685826 1486 -29.A.C;4.T.-;76.G.- 1.084700709 0.875467461 14351033 1487 -25.A.C;75.-.G 1.084694375 0.401588153 8607376 1488 73.A.T 1.084223593 0.466050446 12439360 1489 1.TAC.---;73.A.- 1.08377761 0.784604612 12718596 1490 0.-.T;75.-.A 1.082686019 0.729622493 2712801 1491 2.A.C;0.T.-;82.A.T 1.082648143 1.029910332 6613293 1492 18.C.-;77.-.C 1.081600577 0.704127135 8480766 1493 78.A.- 1.080656792 0.244162899 2414074 1494 1.-.A;75.CG.-T 1.078260507 0.690226021 8105662 1495 76.GG.-A;132.G.C 1.078192392 0.265594919 2282078 1496 0.T.-;84.AT.-- 1.077981676 1.017841506 8096091 1497 75.-.A;86.C.- 1.077805608 0.284536894 442111 1498 -27.C.A;76.GG.-C 1.077745882 0.495264554 12161656 1499 2.A.-;91.A.G 1.075879018 0.678047969 9997135 1500 19.-.G;75.CG.-T 1.075769653 0.617579849 6480747 1501 16.-.C;73.A.- 1.074075162 0.613495205 8066659 1502 74.T.-;132.G.C 1.073725216 0.262916351 4265165 1503 4.T.-;99.-.G 1.07334647 0.742133576 8212888 1504 86.-.C;132.G.T 1.071784689 0.489573855 10532402 1505 15.-.T;88.GA.-C 1.071101998 0.564708496 2897244 1506 1.-.C;81.GA.-T 1.07106925 0.381005159 2274809 1507 0.T.-;98.-.T 1.071006931 0.70160388 3584484 1508 2.-.A;76.GG.-C 1.070634794 0.859304506 12115802 1509 2.A.-;75.CG.-A 1.070285621 0.735963692 3349186 1510 2.A.G;0.T.-;66.CT.-G 1.06950253 0.942756466 3314448 1511 0.T.-;2.A.G;82.A.-84. 1.069109584 0.669577854 A.T 2882882 1512 1.-.C;76.GG.-A 1.068897247 0.641235084 8112365 1513 132.G.C;76.-.A 1.068484818 0.642427564 8118289 1514 76.GG.-C;131.A.C 1.067607855 0.671530402 2684538 1515 0.T.-2.A.C132.G.C 1.067511236 0.29169754 3305808 1516 2.A.G;0.T.-;86.C.- 1.067367495 0.81480322 12141962 1517 2.A.-;98.-.A 1.06684638 0.768887059 8629287 1518 66.CT.-G;87.-.A 1.066757603 0.520708474 10548927 1519 15.-.T;84.-.G 1.066135811 0.948733575 12437589 1520 1.TAC.---;78.-.C. 1.066060316 1.009600092 8494451 1521 76.-.G;87.-.G 1.065178507 0.356343345 8148054 1522 76.G.-;87.-.G 1.064941808 0.413919716 2684598 1523 0.T.-;2.A.C;133.A.C 1.064210221 0.264316583 1806606 1524 -3.TAGT.----;76.G.- 1.063373097 0.955312128 6112609 1525 14.-.A;76.G.- 1.062684812 0.689632914 8128619 1526 75.-.C;132.G.T 1.062529409 0.341411659 2263869 1527 0.T.-;85.-.G 1.062153729 1.016617311 8519538 1528 76.GG.-T;131.A.C 1.061496162 0.210300359 15167837 1529 -29.A.G;78.A.- 1.061156026 0.246892291 8539891 1530 113.A.C;75.-.G 1.061040443 0.379626895 6110621 1531 14.-.A;75.-.A 1.060284727 0.621027153 4012102 1532 3.-.C;76.GG.-A 1.059255634 1.031842175 14644765 1533 - 1.058597553 0.329942143 29.A.C;0.T.-;2.A.C;76 .GG.-A 6114928 1534 14.-.A;87.-.A 1.058454656 0.885887929 1858781 1535 0.TT.--;87.-.T 1.058406061 0.825333202 10090936 1536 19.-.T;75.CG.-T 1.055554876 0.65945615 2002673 1537 0.TTA.---;86.-.C 1.055214988 0.912819901 1937274 1538 0.TT.--;2.A.C;76.-.A 1.054745159 0.766113106 1946930 1539 2.A.C;0.TT.--;73.AT.- 1.053796386 1.042376689 G 8564806 1540 75.CG.-T;121.C.A 1.053601658 0.274429264 14646874 1541 - 1.053406381 0.59545095 29.A.C;0.T.-;2.A.C78 .A.- 3279449 1542 2.A.G;0.T.-;86.-.A 1.052984275 0.589481391 10183929 1543 18.-.G;79.G.- 1.052474243 0.657984499 4281239 1544 4.T.-;83.-.G 1.052428885 0.86399563 8636987 1545 66.CT.-G;87.-.T 1.051957568 0.462896567 2684414 1546 129.C.A;2.A.C;0.T.- 1.050747476 0.311891892 10567800 1547 15.-.T;70.-.T 1.050309671 0.621437389 12183487 1548 2.A.-;77.GA.--;83.A.T 1.049084957 0.987091579 3429655 1549 0.T.-;2.A.G;19.-.T 1.048854899 0.495285429 15168064 1550 -29.A.G;76.-.G 1.047823892 0.302363264 8579268 1551 73.A.C 1.047594299 0.683277383 12725378 1552 0.-.T;86.-.A 1.047411001 0.365860881 12133179 1553 2.A.-;85.TC.-- 1.046943252 0.820385361 12169171 1554 2.A.-;87.C.T 1.046922375 0.599814315 1974530 1555 0.T.C;74.-.G 1.045406007 0.681746678 3276852 1556 2.A.G;0.T.-;81.GA.-C 1.045355433 0.975208443 2277126 1557 0.T.-;91.A.-;93.A.G 1.044132704 0.955042692 2668148 1558 0.T.-;2.A.C;80.-.A 1.043324984 0.586273368 1946365 1559 0.TT.--;2.A.C;74.-.T 1.042813973 1.040869889 10086224 1560 19.-.T;78.AG.-C 1.042716835 0.735960104 6474902 1561 16.-.C;78.AG.-C 1.042498444 0.502799595 3001790 1562 1.TA.--;77.-.C 1.042102465 0.683500309 6463023 1563 16.-.C;89.-.A 1.041885948 0.829735162 8470293 1564 78.-.C;132.G.T 1.041802211 0.300184554 3134206 1565 1.T.G;3.C.- 1.041152356 0.79291182 10203551 1566 18.-.G;66.CT.-G 1.039956878 0.786827483 8629503 1567 66.CT.-G;86.-.C 1.039159805 0.369657454 13846013 1568 -14.A.C;76.G.- 1.038294775 0.247154929 2263715 1569 0.T.-;85.TC.-G 1.038283386 0.801663086 10560681 1570 15.-.T;78.A.T 1.037822098 0.677021869 1253221 1571 -15.T.G;75.CG.-T 1.037675362 0.212533654 10556907 1572 15.-.T;78.AG.-C 1.037273554 1.01979448 3319204 1573 0.T.-;2.A.G;77.GA.- 1.035671503 0.978042547 -;83.A.T 2277677 1574 0.T.-;91.AA.-G 1.035145434 0.944699856 3044097 1575 1.TA.--;65.GC.-T 1.033908393 0.776681137 2728986 1576 0.T.-;2.A.C76.GG.- 1.033146947 0.961151984 -;78.A.T 15059527 1577 - 1.032618019 0.530633171 29.A.G;0.T.-;2.A.C;75 .-.G 8127925 1578 75.-.C121.C.A 1.031822771 0.245553704 8069875 1579 74.T.-;87.-.G 1.031655887 0.582873666 4210905 1580 4.T.-;66.CT.-A 1.031653511 0.842224225 393375 1581 -27.C.A;0.T.-;2.A.C 1.031022939 0.248514229 6469193 1582 16.-.C;88.-.G 1.030464034 0.735892666 12723788 1583 0.-.T;77.GA.-- 1.02991096 0.435853484 1975104 1584 0.T.C;75.-.C 1.029831571 0.578621416 447486 1585 -27.C.A;74.-.T 1.029567827 0.222259337 2304326 1586 0.T.-;73.A.T 1.028839146 0.531317588 8480805 1587 78.A.-;132.G.T 1.028699655 0.24544604 10289207 1588 17.-.T;89.-.A 1.026291461 0.760292997 10541758 1589 15.-.T;99.-.G 1.025988854 0.736311706 8580639 1590 73.-TC.G-- 1.025947068 0.358873945 2129400 1591 0.TTA.-- 1.025918395 1.011043018 -;3.C.G.74.-.T 8142671 1592 76.G.-;128.T.G 1.025910634 0.290060081 12726231 1593 0.-.T;88.G.- 1.025634121 0.405083637 10288957 1594 17.-.T;88.GA.-C 1.025294913 0.60244436 2982939 1595 1.TA.--;65.GC.-A 1.024519789 0.854258194 8357852 1596 87.-.G;133.A.C 1.024422549 0.266728008 6626305 1597 18.C.-;76.-.G 1.023762958 0.940900038 15167605 1598 -29.A.G;78.-.C 1.023529076 0.227603078 3273923 1599 2.A.G;0.T.-;79.G.- 1.021930112 0.761031763 10553626 1600 15.-.T;82.AA.-T 1.019809642 0.843756794 3029129 1601 1.TA.--;78.A.C 1.018314726 0.493342655 3133667 1602 1.T.G;3.C.-;76.G.- 1.018063645 0.663755989 14921066 1603 -29.A.C;2.A.-;78.A.- 1.01768547 0.653829676 14806598 1604 -29.A.C;88.-.T 1.01731078 0.326928264 8139512 1605 115.T.G;76.G.- 1.017267726 0.260385137 8636794 1606 66.CT.-G;86.C.- 1.016727519 0.223982922 8127584 1607 75.-.C;119.C.A 1.016622667 0.257590784 4311933 1608 4.T.-;73.-.G 1.015685468 0.722112585 6471359 1609 16.-.C;83.-.C 1.01562419 0.689800797 12433542 1610 1.TAC.---;77.GA.-- 1.015490193 0.963013214 8093303 1611 75.-.A;132.G.C 1.014481628 0.287331894 1246761 1612 -15.T.G;75.-.C 1.013809204 0.244509289 1943763 1613 0.TT.--;2.A.C;82.AA.- 1.01333782 0.875914657 T 4158980 1614 4.T.-;16.-.C 1.012370327 0.730848589 8470306 1615 78.-.C;131.A.C 1.011978039 0.268703426 8069089 1616 74.T.-;98.-.T 1.011870417 0.753778629 12438882 1617 1.TAC.---;75.CG.-T 1.011591105 0.646464747 8338521 1618 89.AT.-G 1.01013237 0.921901816 10088951 1619 19.-.T;76.-.T 1.009998244 0.995271538 12163085 1620 2.A.-;89.A.C 1.009951212 1.005859847 8479927 1621 78.A.-;121.C.A 1.007731759 0.198019758 10196772 1622 18.-.G;78.A.C 1.007451686 0.605771645 8552295 1623 75.C.-;87.-.G 1.006469896 0.446050968 4027916 1624 3.-.C;74.-.T 1.006243971 0.88765081 8489338 1625 76.-.G;119.C.A 1.005065199 0.338308183 446968 1626 -27.C.A;76.GG.-T 1.005048486 0.187310862 2049927 1627 0.TT.--;2.A.G;88.G.- 1.004518203 0.953193053 8598621 1628 70.-.T;87.-.G 1.004188688 0.382729413 8600573 1629 73.A.-;86.-.C 1.004072362 0.368500944 8473900 1630 78.A.C 1.003342068 0.272291839 12174360 1631 2.A.-;83.-.C 1.002121947 0.61218072 442458 1632 -27.C.A;76.G.- 1.000814752 0.255096372 15162537 1633 -29.A.G;86.-.C 0.999559775 0.511729714 2991036 1634 1.TA.--;72.-.C 0.998951084 0.524247852 8489557 1635 76.-.G;120.C.A 0.998819409 0.234587818 2704195 1636 0.T.-;2.A.C;84.A.G 0.998758579 0.779291093 12746931 1637 0.-.T;78.AG.-T 0.998623067 0.694500161 8544289 1638 75.-.G;86.-.G 0.998103804 0.329574932 8490052 1639 76.-.G;126.C.A 0.998093656 0.284212266 3003857 1640 1.TA.--;81.GA.-C 0.997215707 0.622492253 2683589 1641 0.T.-;2.A.C;121.C.A 0.996781493 0.258997418 8565256 1642 75.CG.-T;129.C.A 0.995682253 0.263828668 2684649 1643 0.T.-;2.A.C;131.A.C 0.99524259 0.271694246 10192242 1644 18.-.G88.-.T 0.995235176 0.989010874 8128468 1645 75.-.C;129.C.A 0.994697493 0.26199099 3255338 1646 2.A.G;0.T.-;72.-.C 0.994393387 0.842137355 7829410 1647 55.-.G;75.-.C 0.994082042 0.859909204 15162331 1648 -29.A.G;87,-.A 0.993077228 0.690696181 8212834 1649 86.-.C;132.G.C 0.991782036 0.466773251 13222300 1650 2.A.G;-3.TAGT.--- 0.991302063 0.722815444 -;76.G.- 8470255 1651 78.-.C;132.G.C 0.990938343 0.219379454 2661937 1652 132.G.C;2.A.C;0.T.-;7 0.989945596 0.389653762 6.G.- 2670761 1653 0.T.-;2.A.C;85.TCC.-- 0.989731739 0.7195275 - 11776916 1654 2.-.C;87.-.A 0.989233941 0.938218378 12747759 1655 0.-.T;77.-.T 0.989194317 0.937953146 15165085 1656 -29.A.G;86.C.- 0.987044987 0.176311237 8212745 1657 86.-.C;129.C.A 0.987010247 0.50896412 2989789 1658 1.TA.--;72.-.A 0.986062777 0.659043613 6531564 1659 17.-.G;87.-.T 0.985471522 0.962121285 12436169 1660 1.TAC.---;87.-.G 0.984379414 0.678230211 3311127 1661 2.A.G;0.T.-;82.A.- 0.983849984 0.759053343 2264270 1662 0.T.-;86.CC.-A 0.983283085 0.774791896 10091719 1663 19.-.T;73.AT.-G 0.982030918 0.402281056 8143233 1664 76.G.-;123.A.C 0.98195845 0.225973301 1248077 1665 -15.T.G;86.-.C 0.981472735 0.61947878

    TABLE-US-00030 TABLE 18 SEQ index ID NO muts_1indexed MI 95% CI 12716866 1666 0.-.T;74.T.- 0.980705762 0.501255257 3303133 1667 2.A.G;0.T.-;89.-.C 0.980281754 0.929335139 9974910 1668 19.-.G;76.GG.-C 0.980161229 0.702243506 8143415 1669 76.G.-;122.A.C 0.979878321 0.246975709 1981670 1670 0.T.C;74.-.T 0.979604036 0.59020272 2302384 1671 0.T.-;73.AT.-G 0.978319856 0.564838423 1809039 1672 -3.TAGT.----;78.A.- 0.978230395 0.8011754 13139359 1673 -I .G.-;2.A.C 0.97786126 0.274956142 8538659 1674 75.-.G;122.A.C 0.977608955 0.391570629 2651461 1675 0.T.-;2.A.C;74.T.G 0.976860498 0.581709587 3028256 1676 1.TA.--;79.GA.-T 0.976555598 0.767447405 444970 1677 -27.C.A;87.-.G 0.976499126 0.225151793 2271218 1678 132.G.T;0.T.- 0.976357981 0.375657527 13101059 1679 -1.GT.--;76.-.G 0.97610403 0.319731571 15169928 1680 -29.A.G;75.CG.-T 0.976070783 0.275722437 6454149 1681 16.-.C;72.-.C 0.975765291 0.471747331 8519506 1682 76.GG.-T;133.A.C 0.975539914 0.183246169 1936400 1683 0.TT.--;2.A.C;74.T.- 0.974896363 0.971225863 8363289 1684 87.-.T;132.G.T 0.974823104 0.348800323 14646928 1685 - 0.974746731 0.273309529 29.A.C;0.T.-;2.A.C;76 .-.G 8212907 1686 86.-.C;131.A.C 0.974581449 0.469863402 13097486 1687 -1.GT.--;75.-.C 0.974076361 0.347126982 3272148 1688 2.A.G;0.T.-;77.-.A 0.973879721 0.592128628 8557995 1689 74.-.T;121.C.A 0.973241728 0.209831785 8142576 1690 76.G.-;127.T.G 0.972909535 0.375025867 14816291 1691 -29.A.C;73.A.- 0.971570292 0.231631239 10080185 1692 19.-.T89.-.C 0.971142172 0.564636407 1904247 1693 0.TTA.-- 0.970129816 0.748872279 -;3.C.A;75.-.A 6460821 1694 16.-.C;77.GA.-- 0.969553741 0.637403652 12738126 1695 0.-.T;87.-.T 0.968376883 0.57825455 8357730 1696 87.-.G;129.C.A 0.968242916 0.269738584 12187919 1697 2.A.-;79.GA.-T 0.968227596 0.963113501 14644862 1698 - 0.967299952 0.512413817 29.A.C;0.T.-;2.A.C;76 .GG.-C 13101334 1699 -1.GT.--;76.GG.-T 0.96664163 0.377178934 12437308 1700 1.TAC.---;80.A.- 0.966358793 0.932816051 2672055 1701 0.T.-;2.A.C;86.C.A 0.965996878 0.590376536 6304109 1702 16.-.A;76.GG.-C 0.965683364 0.67187653 12214091 1703 2.A.-;73.A.T 0.965610539 0.601810119 8511126 1704 76.6.-;78.AG.TC 0.96509303 0.453545301 10473646 1705 16.C.-;76.GG.-T 0.964836691 0.499237417 8561622 1706 74.-.T;82.A.- 0.964731122 0.36234088 1981516 1707 0.T.C;75.C.- 0.964349838 0.525063892 4300894 1708 4.T.-;77.G.T 0.964207177 0.235903819 8084158 1709 74.-.G 0.964116495 0.401532934 8096194 1710 75.-.A;87.-.T 0.96360779 0.605413084 2281085 1711 0.T.-;87.C.T 0.960523556 0.675358848 8063355 1712 74.T.-;86.-.C 0.959756198 0.506555584 3038327 1713 1.TA.--;73.-.G 0.9591209 0.853900434 9976817 1714 19.-.6;79.G.- 0.958047025 0.737140085 13223005 1715 2.A.G;-3.TAGT.---- 0.95795641 0.837056459 8542589 1716 75.-.6;98.-.T 0.956947885 0.875376914 3345006 1717 0.T.-;2.A.G;73.A.T 0.956723708 0.792775096 4217628 1718 4.T.-71.-.C 0.956428726 0.494530665 10068711 1719 19.-.T;76.-.A 0.955838642 0.689148232 10198139 1720 18.-.G;77.-.T 0.95550711 0.662670415 2463484 1721 1.TA.--;3.C.A;87.-.T 0.955371341 0.695396423 8490228 1722 76.-.6;128.T.G 0.954993055 0.304520889 3322121 1723 0.T.-;2.A.G;80.AG.-T 0.954883244 0.811714067 2458850 1724 1.TA.--;3.C.A;79.G.- 0.954552438 0.857655704 6626017 1725 18.C.-;78.A.- 0.954491633 0.61106783 8519520 1726 76.GG.-T;132.G.T 0.954300925 0.281109543 1974653 1727 0.T.C;75.-.A 0.954106906 0.489641158 2683428 1728 120.C.A;2.A.C;0.T.- 0.953944451 0.252838081 4272200 1729 4.T.-;89.A.G 0.953838275 0.924709618 8193481 1730 85.TC.-G 0.952706766 0.701420781 6557686 1731 18.C.A;75.-.6 0.952635001 0.330369879 1860902 1732 0.TT.--;81.GA.-T 0.952197311 0.514937583 2717874 1733 2.A.C;0.T.-;80.AG.-T 0.951134819 0.611248832 2882024 1734 1.-.C;74.-.G 0.950794893 0.618759103 3273132 1735 0.T.-;2.A.G;77.-.C 0.95078631 0.397420244 441958 1736 -27.C.A;76.GG.-A 0.949448345 0.20486145 14811390 1737 -29.A.C;78.A.- 0.94924455 0.249151979 14802094 1738 -29.A.C;86.-.C 0.948918554 0.461499664 10523926 1739 15.-.T;76.-.A 0.947880548 0.738861592 12742835 1740 0.-.T;81.GA.-T 0.947825709 0.382500139 8093342 1741 75.-.A;133.A.C 0.9477337 0.326505247 8490265 1742 76.-.G;129.C.A 0.947716798 0.322105698 2412848 1743 1.-.A;76.-.T 0.946977536 0.632308747 8183422 1744 85.TC.-A 0.946704814 0.637809088 2463159 1745 1.TA.--;3.C.A;88.-.T 0.945816148 0.551604962 8490433 1746 76.-.G,133.A.C 0.94580569 0.317798446 2681222 1747 0.T.-;2.A.C;115.T.G 0.945774394 0.287825585 8480741 1748 78.A.-;132.G.C 0.945726636 0.201668102 2663534 1749 0.T.-;2.A.C;77.G.C 0.945544637 0.860590156 8118132 1750 76.GG.-C;129.C.A 0.94554045 0.373219502 6447398 1751 16.-.C;55.-.G 0.945124875 0.768017164 2285156 1752 0.T.-;82.AA.-- 0.94485704 0.502663519 8117520 1753 76.GG.-C;120.C.A 0.944641128 0.413143505 8603147 1754 73.A.- 0.944568512 0.225126189 8537609 1755 75.-.G;124.T.G 0.944260148 0.365887334 2245955 1756 0.T.-;71.-.C 0.944003192 0.683639716 8161116 1757 79.G.- 0.942231169 0.264000452 8536998 1758 75.-.G;119.C.A 0.941935837 0.370421962 8537871 1759 75.-.G;127.T.C 0.941385669 0.333998494 8543767 1760 75.-.G;89.A.- 0.94098922 0.627842945 6603080 1761 18.C.-;55.-.G 0.940735855 0.707170754 13850293 1762 -14.A.C;87.-.G 0.939872328 0.218040413 1852615 1763 0.TT.--;76.-.A 0.938499355 0.749884292 8208020 1764 88.G.-;132.G.C 0.937909946 0.241574819 14918769 1765 -29.A.C;2.A.-;76.GG.- 0.937331761 0.352937114 A 8223161 1766 90.-.G 0.936749506 0.664179652 2684123 1767 0.T.-;2.A.C;126.C.A 0.935869575 0.26198456 2883487 1768 1.-.C;76.GG.-C 0.934458485 0.884247882 8089075 1769 75.-C.AA 0.934377668 0.299006427 13746840 1770 -13.G.T;76.G.- 0.934356994 0.266092099 10179608 1771 18.-.G;73.-.A 0.933175531 0.586679061 8357113 1772 87.-.G;119.C.A 0.933166453 0.238401775 2570963 1773 0.T.-;2.A.C;18.C.- 0.93209533 0.403512556 6621548 1774 18.C.-;88.-.T 0.931719159 0.702372684 8543544 1775 75.-.G;89.-.C 0.93026646 0.330984722 8158269 1776 79.G.A 0.928207937 0.859645581 3341556 1777 2.A.G;0.T.-;73.AT.-G 0.928088432 0.857493258 2683151 1778 119.C.A;2.A.C;0.T.- 0.927519705 0.28783831 8543919 1779 75.-.G;88.-.T 0.925629705 0.543254506 2570189 1780 0.T.-;2.A.C;18.-.A 0.925537001 0.64491759 4015474 1781 3.-.C;86.-.C 0.925505786 0.838123078 2731496 1782 0.T.-;2.A.C;75.-.G;132 0.92511208 0.518018242 .G.C 8480834 1783 78.A.-;131.A.C 0.925032194 0.257034431 3011827 1784 1.TA.-- 0.923354091 0.387659338 8592843 1785 70.-.T;86.-.C 0.923182623 0.500818269 8057655 1786 73.-.A 0.923159152 0.547314306 8480787 1787 78.A.-;133.A.C 0.922523853 0.246503981 2249456 1788 0.T.-;72.-.G 0.922153962 0.819512544 8752628 1789 55.-.T;76.GG.-A 0.92194028 0.502766206 2274200 1790 0.T.-;99.-.T 0.92135973 0.847745604 8142972 1791 76.G.-;131.A.C;133.A. 0.921146739 0.257676388 C 1252489 1792 -15.T.G;76.GG.-T 0.920958972 0.235680049 14822468 1793 -29.A.C;55.-.T 0.920816801 0.523726671 8357890 1794 87.-.G;131.A.C 0.920798886 0.274644926 8485265 1795 76.-.G;88.G.- 0.919513147 0.452533222 14796763 1796 -29.A.C;74.-.C 0.919493708 0.375134959 14796493 1797 -29.A.C;74.T.- 0.919211892 0.248759572 8558538 1798 74.-.T;133.A.C 0.918860846 0.281318049 7247803 1799 27.-.C;86.CC.-G 0.917956151 0.914761883 10073442 1800 19.-.T;88.GA.-C 0.917769495 0.551828645 12133660 1801 2.A.-;85.TC.-G 0.917554718 0.915961511 2572420 1802 0.T.-;2.A.C;19.-.A 0.917245463 0.557634742 8555076 1803 74.-.T;88.G.- 0.915485429 0.37741171 10607377 1804 16.C.T;75.-.G 0.915305946 0.788886753 3281290 1805 2.A.G;0.T.-;88.G.- 0.915191522 0.698541574 12713711 1806 0.-.T;72.-.A 0.915132536 0.659473807 15408234 1807 -30.C.G;0.T.-;2.A.C 0.914828105 0.291008919 12722990 1808 0.-.T;79.G.- 0.91469203 0.498534564 8105716 1809 76.GG.-A;132.G.T 0.913542774 0.274934966 2271180 1810 0.T.- 0.913216156 0.38072164 10289412 1811 17.-.T;90.-.G 0.912848775 0.695466523 14807090 1812 -29.A.C;87.-.T 0.912395361 0.448815242 6108421 1813 14.-.A;72.-.C 0.910081852 0.862648242 8141461 1814 76.G.-;119.C.A 0.909297819 0.26332282 14350324 1815 -25.A.C;76.-.C 0.908340852 0.329528677 8538185 1816 130.-- 0.906159692 0.420876967 T.TAG;133.A.G;75.-. G 8538491 1817 75.-.G;123.A.C 0.905622339 0.359184365 14292135 1818 -25.A.C;0.T.-;2.A.C 0.905462839 0.25526538 2399779 1819 1.-.A;75.-.C 0.903712317 0.626250944 8142947 1820 76.G.-;131.AG.CC 0.90278584 0.311578165 8603195 1821 73.A.-;131.A.C 0.90153794 0.229442208 3329015 1822 2.A.G;0.T.-;78.-.T 0.901071633 0.635158992 2457498 1823 1.TA.--;3.C.A;76.-.A 0.90086193 0.877512785 14799938 1824 -29.A.C;76.G.-;78.A.C 0.900781085 0.250085624 10194359 1825 18.-.G;82.AA.-- 0.900734628 0.723199799 2461767 1826 1.TA.--;3.C.A;99.-.G 0.897938893 0.891247375 8128631 1827 75.-.C;131.AG.CC 0.897742 0.298470213 6130904 1828 14.-.A;75.CG.-T 0.897627082 0.808841286 2885480 1829 1.-.C;77.GA.-- 0.896880771 0.563534094

    TABLE-US-00031 TABLE 19 index SEQ ID NO muts_lindexed MI 95% CI 8565409 1830 131.A.C;75.CG.-T 0.896200168 0.289353432 8526599 1831 76.-.T;133.A.C 0.894753435 0.367051671 8542268 1832 75.-.G;99.-.G 0.894634843 0.466299591 3296935 1833 0.T.-;2.A.G;98.-.T 0.894142418 0.818628527 8535676 1834 115.T.G;75.-.G 0.892450762 0.386408997 8530925 1835 75.-.G;82.-.A 0.890548634 0.434402987 8142901 1836 76.G.-;134.G.T 0.890248996 0.290204128 8142383 1837 76.G.-;125.T.G 0.890028915 0.343416459 2054253 1838 0.TT.--;2.A.G;87.-.T 0.889830012 0.871702087 8001281 1839 71.T.C 0.887843685 0.608229078 6366788 1840 17.-.A;86.C.- 0.887689243 0.797295445 12123821 1841 2.A.-;76.G.-;131.A.C 0.886864617 0.302511684 15159066 1842 -29.A.G;74.T.- 0.88641859 0.227937789 10072842 1843 19.-.T;87.-.A 0.886327606 0.611907237 1979426 1844 0.T.C;80.A.- 0.885687199 0.575980831 10193667 1845 18.-.G;82.A.- 0.885623931 0.827650358 1252039 1846 -15.T.G;76.-.G 0.885300041 0.316383221 4247573 1847 4.T.-;87.C.A 0.885192731 0.526496586 6110295 1848 14.-.A;74.-.G 0.883738665 0.833212815 6369429 1849 17.-.A;76.-.T 0.883709542 0.672045707 6476407 1850 16.-.C;78.-.T 0.883206478 0.612248822 2309043 1851 0.T.-;65.GC.-T 0.88279209 0.648679211 10084280 1852 19.-.T;82.AA.-G 0.882507854 0.749546575 2884850 1853 1.-.C;76.G.-;78.A.C 0.881622675 0.491993778 2347258 1854 0.T.-;19.-.G 0.879771208 0.615653289- 12737110 1855 0.-.T;88.-.T 0.879524619 0.357187729 10557558 1856 15.-.T;78.A.C 0.878879263 0.710410533 1851901 1857 0.TT.--;74.-.G 0.878121046 0.824086218 6621723 1858 18.C.-;86.C.- 0.877071062 0.845236443 10567449 1859 15.-.T;73.A.G 0.876199614 0.489297254 1863878 1860 0.TT.--;75.C.- 0.876141036 0.766200413 7832261 1861 55.-.G;132.G.C 0.875938665 0.806722857 15161180 1862 -29.A.G;77.-.A 0.875136509 0.216285884 8545164 1863 75.-.G;82.AA.-G 0.875109059 0.568849243 7830386 1864 55.-.G;86.-.C 0.874746244 0.74436841 6077749 1865 15.TC.-A;76.G.- 0.874549453 0.859375029 8148008 1866 76.G.-;86.C.- 0.87452541 0.186643953 2278635 1867 0.T.-;88.-.G 0.873679439 0.724828094 1041817 1868 -17.C.A;75.-.C 0.873464925 0.245618671 2465231 1869 1.TA.--;3.C.A;82.AA.-T 0.87288341 0.829692031 2266703 1870 0.T.-;90.-.G 0.87219304 0.862449293 6625678 1871 18.C.-;78.-.C 0.871854232 0.579835472 8136927 1872 76.G.-;86.-.C 0.871633528 0.49310448 8093375 1873 75.-.A;131.A.C 0.870605371 0.334695171 2454809 1874 1.TA.--;3.C.A;72.-.A 0.870104785 0.7360795 1980576 1875 0.T.C;76.GG.-T 0.870084283 0.466063377 2271158 1876 0.T.-;132.G.C 0.869968206 0.382593755 442251 1877 -27.C.A;75.-.C 0.869789461 0.272812946 2350399 1878 0.T.-;18.-.G 0.869175589 0.556109447 8498008 1879 78.A.G 0.868791572 0.35574229 8080600 1880 74.-.G;86.-.C 0.868096002 0.559804248 3328595 1881 2.A.G;0.T.-;78.AG.-T 0.86801762 0.823575147 8467079 1882 78.AG.-C 0.867519598 0.422260229 6459918 1883 16.-.C;77.-.A 0.866086899 0.523207502 2265855 1884 0.T.-;88.GA.-C 0.865179979 0.720694826 15161451 1885 -29.A.G;79.G.- 0.864880911 0.291402918 8565376 1886 75.CG.-T;133.A.C 0.8647622 0.308122333 2684676 1887 0.T.-;2.A.C;131.A.G 0.864125602 0.347136817 6461858 1888 16.-.C;86.-.A 0.863837493 0.610729582 3011807 1889 1.TA.--;132.G.C 0.863489882 0.395655463 1905700 1890 0.TTA.---;3.C.A;86.-.C 0.86299387 0.79224794 8440297 1891 81.GAA.-TT 0.862721887 0.410012308 8752800 1892 55.-.T;75.-.C 0.862228765 0.546437409 12721020 1893 0.-.T75.-.C 0.861994689 0.449429098 441780 1894 -27.C.A;75.-.A 0.861287307 0.299642761 10070497 1895 19.-.T;76.G.-;78.A.C 0.861054294 0.561313263 8112403 1896 76.-.A;132.G.T 0.860916867 0.583979668 1002534 1897 -17.C.A;2.A.C;0.T.- 0.860899766 0.227341425 3324612 1898 0.T.-;2.A.G;78.A.C 0.86070632 0.73672108 3030912 1899 1.TA.--;78.A.-80.A.- 0.860647782 0.838049368 10182195 1900 1 8.-.G;76.GG.-C 0.860369871 0.461905865 8519380 1901 76.GG.-T;129.C.A 0.860233343 0.206775628 8493521 1902 76.-.G;98.-.T 0.859090878 0.735056688 8128428 1903 75.-.C;128.T.G 0.857937673 0.24073509 1248006 1904 -15.T.G;88.G.- 0.856727 0.216712076 5585921 1905 10.T.C;76.G.- 0.855093855 0.370550678 6127219 1906 14.-.A;78.A.- 0.854883422 0.492926654 3007558 1907 1.TA.--;90.-.G 0.854495024 0.711184832 10555821 1908 15.-.T;80.AG.-T 0.854328412 0.84308171 12747339 1909 0.-.T;78.A.T 0.853746444 0.745239398 14344892 1910 -25.A.C;75.-.C 0.853497099 0.295843322 10310038 1911 17.-.T;77.-.T 0.853123635 0.646582684 4303315 1912 4.T.-;76.G.T 0.851550244 0.664150686 14786751 1913 -29.A.C;55.-.G 0.851205863 0.737068985 15059318 1914 -29.A.G;0.T.-;2.A.C;76.-.G 0.851092115 0.284707875 15240190 1915 -29.A.G;2.A.- 0.850701999 0.499567732 6468525 1916 16.-.C;91.A.-;93.A.G 0.848737138 0.651993977 2826831 1917 0.T.-;2.A.C;15.-.T;75.-.G 0.848656876 0.523377407 8212871 1918 86.-.C;133.A.C 0.848086579 0.669274383 3318144 1919 2.A.G;0.T.-;82.AA.-T 0.847571377 0.741743097 1246180 1920 -15.T.G;75.-.A 0.847453607 0.337281833 1982591 1921 0.T.C;66.CT.-G 0.84737962 0.441751749 15166880 1922 -29.A.G;81.GA.-T 0.847298283 0.253268693 1904171 1923 0.TTA.---;3.C.A;74.-.G 0.845851242 0.783342801 14635061 1924 -29.A.C;0.T.- 0.845517511 0.38153428 8565091 1925 75.CG.-T;126.C.A 0.845432049 0.207160773 2725821 1926 0.T.-;2.A.C;77.GA.--;80.A.T 0.845151363 0.836702777 4259960 1927 4.T.-;130.T.G 0.844420024 0.799710867 3135495 1928 1.T.G;3.C.-;75.-.G 0.844345159 0.791310505 14345120 1929 -25.A.C;76.G.- 0.844207275 0.259459942 10071193 1930 19.-.T;81.G.- 0.84366427 0.779495237 6476304 1931 16.-.C;78.AG.-T 0.843608449 0.660829712 15175052 1932 -29.A.G;55.-.T 0.843589728 0.628713279 8519203 1933 76.GG.-T;126.C.A 0.843115863 0.232539946 8173991 1934 77.GA.-- 0.842982504 0.382878127 12746208 1935 0.-.T;76.-.G 0.842187941 0.434677576 8133056 1936 75.-.C;87.-.T 0.842005477 0.419078021 8526626 1937 76.-.T;131.A.0 0.841499516 0.222806303 1252968 1938 -15.T.G;75.C.- 0.840541627 0.361088873 14646713 1939 -29.A.C;0.T.-;2.A.C;80.A.- 0.840363457 0.512884706 6304778 1940 16.-.A;77.-.A 0.839744987 0.461935208 8479746 1941 78.A.-;120.C.A 0.838428917 0.292810002 12763666 1942 0.-.T;55.-.T 0.838009445 0.783484132 2684656 1943 0.T.-;2.A.C;131.A.C;133.A.C 0.837560227 0.206667086 14800177 1944 -29.A.C;79.G.- 0.837044741 0.233067105 8128118 1945 75.-.C;124.T.G 0.836600946 0.256117965 13797685 1946 -14.A.C;0.T.-;2.A.C 0.836119439 0.249533999 4259801 1947 4.T.-;128.T.G 0.836000745 0.762544053 6612829 1948 18.C.-;76.G.- 0.833297918 0.707704073 448172 1949 -27.C.A;73.A.- 0.833152564 0.215681899 1246589 1950 -15.T.G;76.GG.-C 0.832838095 0.560142043 14796144 1951 -29.A.C;73.-.A 0.832196458 0.441116469 6611642 1952 18.C.-;76.GG.-A 0.831495777 0.704158939 3040392 1953 I .TA.--;73.A.T 0.83125454 0.517209585 1938331 1954 0.TT.--;2.A.C;79.G.- 0.83094649 0.782892584 10528065 1955 15.-.T;79.GA.-C 0.830823439 0.713061332 3261986 1956 0.T.-;2.A.G;74.T.G 0.82985054 0.735935966 8131593 1957 75.-.C;99.-.G 0.829803923 0.552794831 14255597 1958 -24.G.T;2.A.- 0.829521014 0.569520648 14879001 1959 -29.A.C;15.-.T;75.-.G 0.829471291 0.804622726 14918841 1960 -29.A.C;2.A.-;76.GG.-C 0.829132035 0.731668707 2290589 1961 0.T.-;79.GA.-T 0.828939315 0.726137312 2951795 1962 1.TA.--;16.-.0 0.828708264 0.305967101 9987799 1963 19.-.G;86.-.G 0.827168874 0.730661257 15455726 1964 -30.C.G;78.A.- 0.827064513 0.282392503 14812695 1965 -29.A.C;77.-.T 0.826064557 0.574798815 8202480 1966 87.-.A;131.A.C 0.825480268 0.570499479 8066107 1967 74.T.-;121.C.A 0.824741856 0.204192194 14807234 1968 -29.A.C;86.-.G 0.823713381 0.173705555 10085211 1969 19.-.T;80.A.- 0.823514146 0.633352874 8180233 1970 81.GA.-C 0.823411608 0.427874666 1044371 1971 -17.C.A;87.-.G 0.821282659 0.292542788 10286908 1972 17.-.T;85.TC.-A 0.821041632 0.501681072 10250881 1973 18.C.T;75.-.G 0.820021901 0.593154858 2463586 1974 1.TA.--;3.0 A;86.-.G 0.819988929 0.682384778 6554412 1975 18.C.A;76.G.- 0.819014386 0.317795095 8485725 1976 76.-.G;98.-.A 0.818075053 0.715764322 2271237 1977 0.T.-;131.A.C 0.817142113 0.351930761 2564816 1978 0.T.-;2.A.C;17.-.A 0.81646896 0.601217336 8357229 1979 87.-.G;120.C.A 0.816184189 0.328957228 12747630 1980 0.-.T;76.G.-;78.A.T 0.815905287 0.796115745 9972115 1981 19.-.G;73.-.A 0.815790669 0.80208701 8212329 1982 86.-.C;121.C.A 0.815247299 0.51423849 14654311 1983 -29.A.C;1.TA.--;76.G.- 0.815105862 0.379590045 1864798 1984 0.TT.--;73.AT.-G 0.814459875 0.762293984 8117352 1985 76.GG.-C;119.C.A 0.812998633 0.432977601 8479512 1986 78.A.-;119.C.A 0.812335411 0.223689176 8133372 1987 75.-.C;82.A.- 0.812332278 0.356824998 10468894 1988 16.C.-;87.-.G 0.812035912 0.666965245 8489702 1989 76.-.G;121.C.A 0.811977229 0.335430162 14919783 1990 -29.A.C;2.A.- 0.811812719 0.51274018 8198335 1991 86.C.A 0.811151507 0.799145123 8105698 1992 76.GG.-A;133.A.C 0.810854998 0.269366495 13845556 1993 -14.A.C;76.GG.-C 0.809202243 0.490618124 3011864 1994 1.TA.--;132.G.T 0.80898504 0.35238499

    TABLE-US-00032 TABLE 20 SEQ index ID NO muts_1indexed MI 95% CI 13222066 1995 2.A.G;-3.TAGT.--- 0.808611561 0.596822595 -;76.GG.-A 6471171 1996 16.-.C;82.A.- 0.808494016 0.510086271 8526572 1997 132.G.C;76.-.T 0.807564936 0.259100497 8352868 1998 86.C.-;131.A.C 0.806885397 0.22636509 10198068 1999 18.-.G;76.G.-;78.A.T 0.806835867 0.435582585 8137025 2000 76.G.-;89.-.A 0.803563673 0.538455612 8629413 2001 66.CT.-G;88.G.- 0.803450388 0.32031914 8105428 2002 76.GG.-A;126.C.A 0.803147022 0.24041185 7947397 2003 66.CT.-A;87.-.G 0.802024989 0.362070069 7835793 2004 55.-.G;76.GG.-T 0.801885567 0.735401291 8140338 2005 76.G.-;116.T.G 0.801593594 0.30577562 12722736 2006 0.-.T;77.-.C 0.801221765 0.426859099 8757065 2007 55.-.T;86.C.- 0.800987285 0.558821092 2398681 2008 1.-.A;75.-.A 0.800763412 0.641433179 4011043 2009 3.-.C;74.-.C 0.79937771 0.713346067 14920334 2010 -29.A.C;2.A.-;86.C.- 0.799161613 0.459738042 13845318 2011 -14.A.C;76.GG.-A 0.799099794 0.18794716 3427589 2012 0.T.-;2.A.G;19.-.G 0.79900678 0.415960568 14806422 2013 -29.A.C;89.A.- 0.798118013 0.702122527 15165304 2014 -29.A.G;87.-.T 0.796830943 0.463308646 2125941 2015 0.TTA.-- 0.796565821 0.79076485 -;3.C.G;89.A.- 15168973 2016 -29.A.G;76.-.T 0.796128601 0.380420766 8538239 2017 75.-.G;131.AG.CC 0.795805651 0.429399788 8528721 2018 76.GGA.-TT 0.795594742 0.447243511 7834109 2019 55.-.G;86.-.G 0.794446595 0.595594758 8476335 2020 78.A.-;98.-.A 0.793884665 0.527904732 8352802 2021 132.G.C;86.C.- 0.793673627 0.214217899 10372832 2022 18.CA.-T;74.-.T 0.793649001 0.724009478 8752727 2023 55.-.T;76.GG.-C 0.792864878 0.681485029 6460172 2024 16.-.C;77.-.C 0.792492284 0.473521838 1245743 2025 -15.T.G;74.T.- 0.792248453 0.347003397 6469515 2026 16.-.C88.-.T 0.791786541 0.64480155 15241028 2027 -29.A.G;2.A.-;78.A.- 0.791581969 0.398369648 2711056 2028 0.T.-;2.A.C;82.A.G 0.791084203 0.74717295 1974296 2029 0.T.C;74.T.- 0.790042405 0.532969357 8637058 2030 66.CT.-G;86.-.G 0.789170768 0.254255894 8526611 2031 76.-.T;132.G.T 0.788188081 0.322643284 8144153 2032 76.G.-;119.C.T 0.788021877 0.239807981 10566620 2033 15.-.T;73.A.C 0.787853854 0.613069845 8557775 2034 74.-.T;119.C.A 0.787787618 0.230477012 8462867 2035 79.GA.-T 0.787274361 0.613395387 8549438 2036 75.C.- 0.7872713 0.425057254 8558414 2037 74.-.T;129.C.A 0.787235849 0.254942799 8105581 2038 76.GG.-A;129.C.A 0.787085201 0.25915294 2281703 2039 0.T.-;86.C.T 0.785739149 0.719182131 2400499 2040 1.-.A;76.G.-;78.A.C 0.785147179 0.482179072 14920368 2041 -29.A.C;2.A.-;87.-.G 0.784869833 0.602095885 8543253 2042 75.-.G;91.A.-;93.A.G 0.784852363 0.451551966 8488707 2043 76.-.G;116.T.G 0.784670342 0.282512341 9979217 2044 19.-.G;86.-.C 0.783235694 0.61177765 15162226 2045 -29.A.G;86.-.A 0.782740907 0.521792231 12146137 2046 2.A.-;116.T.G 0.782680959 0.42917569 5454231 2047 8.G.C;76.G.- 0.782380772 0.6463104 2288382 2048 0.T.-;77.GA.--;83.A.T 0.781480078 0.648018195 8549424 2049 75.C.-;132.G.C 0.781281893 0.386040689 6461529 2050 16.-.C;85.T.- 0.781254783 0.720080877 1090544 2051 2.A.- 0.781168584 0.530340013 2282648 2052 0.T.-;84.-.T 0.779234454 0.667414229 12149194 2053 2.A.-;131.A.G 0.778932674 0.43969611 8142223 2054 76.G.-;124.T.G 0.778900279 0.273194276 8199575 2055 86.CC.-A 0.77887351 0.610550764 13854291 2056 -14.A.C;75.CG.-T 0.778830352 0.362088557 8092813 2057 75.-.A;121.C.A 0.778421275 0.281031479 8605540 2058 73.A.-;87.-.G 0.778324817 0.302912081 68946 2059 0.T.-;2.A.C 0.778217999 0.249763093 12199248 2060 2.A.-;76.GG.- 0.778119212 0.423790052 T;132.G.C 8093073 2061 126.C.A75.-.A 0.777970506 0.369671349 12149170 2062 2.A.-;131.A.C 0.776491674 0.526766214 447600 2063 -27.C.A;75.CG.-T 0.776402867 0.266208398 8143156 2064 76.G.-;126.C.T 0.776218375 0.345711065 1982252 2065 0.T.C;73.A.- 0.776212517 0.440987509 4255522 2066 4.T.-;115.T.G 0.776114871 0.763967165 8112417 2067 76.-.A;131.A.C 0.776058906 0.677356656 8083653 2068 74.-.G121.C.A 0.775457064 0.433721449 8539008 2069 75.-.G120.C.T 0.775033077 0.360907809 13750813 2070 -13.G.T;75.-.G 0.773597076 0.496364906 8759144 2071 55.-.T;76.GG.-T 0.77186309 0.578448287 2684637 2072 0.T.-;2.A.C;131.AG.C 0.771368384 0.250615124 C 8032414 2073 72.-.C 0.770653538 0.299141231 15165408 2074 -29.A.G;86.-.G 0.770467267 0.132165451 8352728 2075 86.C.-;129.C.A 0.769563809 0.199735436 12191702 2076 2.A.-;78.A.-;131.A.C 0.768623982 0.496502512 12751144 2077 0.-.T;74.-.T 0.76856622 0.416724498 2894079 2078 1.-.C;87.-.G 0.76797859 0.69721306 8480622 2079 78.A.-;129.C.A 0.767578125 0.331587077 8758901 2080 55.-.T;76.-.G 0.766343494 0.641541627 8202090 2081 87.-.A;121.C.A 0.766102496 0.622079897 2885067 2082 1.-.C;79.G.- 0.765626173 0.51214927 8202431 2083 87.-.A;132.G.C 0.765077306 0.53718099 12191659 2084 2.A.-;78.A.-;132.G.C 0.764704817 0.595721144 12149115 2085 2.A.-;133.A.C 0.764324854 0.438594709 2271200 2086 0.T.-;133.A.C 0.763753757 0.4294745 2252404 2087 0.T.-;74.T.G 0.763452663 0.476144264 8142993 2088 131.A.G;76.G.- 0.761824261 0.24967661 446438 2089 -27.C.A;78.A.- 0.761792637 0.249126858 8480581 2090 78.A.-;128.T.G 0.76178249 0.28018538 3133382 2091 1.T.G;3.C.-;74.-.G 0.760891826 0.629329233 2302762 2092 0.T.-73.A.G 0.760848385 0.618073183 1041081 2093 -17.C.A;74.T.- 0.760237431 0.229813983 1074428 2094 -17.C.A;2.A.- 0.759954307 0.561101375 10571409 2095 15.-.T65.GC.-T 0.759803199 0.638728683 8598575 2096 70.-.T;86.C.- 0.757656592 0.3746533 8363306 2097 87.-.T;131.A.C 0.757331721 0.451839871 8143881 2098 76.G.-;120.C.T 0.757192938 0.313345954 15159530 2099 -29.A.G;74.-.G 0.757082564 0.394186622 4230077 2100 4.T.-;75.C.A 0.755983607 0.733464455 8146649 2281 76.G.-;99.-.G 0.755070921 0.379444158 2684498 2282 0.T.-,2.A.C,130.T.G 0.754689937 0.294762457 8128273 2283 75.-.C126.C.A 0.753949302 0.276623271 8066406 2284 74.T.-;126.C.A 0.751660833 0.236816233 8363243 2285 87.-.T;132.G.C 0.751028711 0.468864036 8142864 2286 76.G.-;132.GA.CC 0.750861564 0.275934907 2512825 2287 1.T.C;76.G.- 0.7504689 0.48593163 8091801 2288 75.-.A;115.T.G 0.749700204 0.260297227 1114939 2289 -16.C.A;76.G.- 0.749305598 0.263900263 8142311 2290 76.G.-;125.T.C 0.74877691 0.290550934 11774438 2291 2.-.C;76.GG.-A 0.748308714 0.657502587 15064284 2292 -29.A.G;1.TA.-- 0.748045422 0.3832171 1187746 2293 -15.T.G;0.T.- 0.748017281 0.384223169 8092581 2294 75.-.A;119.C.A 0.746934248 0.329723696 1246493 2295 -15.T.G;76.-.A 0.746842913 0.493140906 14646216 2296 - 0.74668829 0.368724428 29.A.C;0.T.-;2.A.C;87 .-.G 8142526 2297 76.G.-;127.T.C 0.74638204 0.249355712 8191621 2298 85.TCC.-GA 0.745990957 0.478821582 10308897 2299 17.-.T;78.A.G 0.74547438 0.691042832 14661314 2300 - 0.745107888 0.569801975 29.A.C;0.T.-;2.A.G;75 .-.C 8549337 2301 75.C.-;129.C.A 0.745005935 0.299426299 8753061 2302 55.-.T;79.G.- 0.744926149 0.513566692 10097262 2303 19.-.T;55.-.T 0.744819737 0.582631114 8161158 2304 79.G.-;131.A.C 0.743647218 0.214645028 2661991 2305 0.T.-;2.A.C;76.G.-;131 0.743411308 0.431940993 .A.C 9987131 2306 19.-.G;86.C.- 0.74325326 0.684101481 1046156 2307 -17.C.A;76.GG.-T 0.742891912 0.206153413 3311900 2308 0.T.-;2.A.G;83.-.C 0.742731517 0.541403805 2412608 2309 1.-.A;76.GG.-T 0.7419989 0.454493748 8092717 2310 75.-.A;120.C.A 0.740460814 0.353030203 2684366 2311 0.T.-;2.A.C;128.T.G 0.740365485 0.319772226 8536239 2312 75.-.G;116.T.G 0.739558614 0.409490289 8483990 2313 78.A.-;98.-.T 0.738582774 0.635321715 1290147 2314 -15.T.G;2.A.-;76.G.- 0.736953498 0.358146051 8629656 2315 66.CT.-G;89.-.A 0.736647742 0.643898592 8039677 2316 72.-.G;86.-.C 0.736394521 0.628402188 8528174 2317 76.-.T;87.-.G 0.736315801 0.316059266 8142772 2318 76.G.-;130.T.C 0.735973311 0.349764548 12148593 2319 2.A.-;126.C.A 0.735792991 0.540631906 8089812 2320 75.-.A;88.G.- 0.735648884 0.621749821 8436907 2321 81.GA.-T;131.A.C 0.734237962 0.289458336 6303279 2322 16.-.A;74.-.G 0.732956994 0.70590626 8136856 2323 76.G.-;88.G.- 0.732170571 0.393401019 13099840 2324 -1.GT.--;87.-.G 0.73213014 0.204923163 12147390 2325 2.A.-;119.C.A 0.731356849 0.364446154 8480707 2326 78.A.-;130.T.G 0.730801992 0.306613853 8145151 2327 76.G.-;113.A.C 0.729155512 0.24017937 2682115 2328 116.T.G;2.A.C;0.T.- 0.726372083 0.269099758 2397740 2329 1.-.A;73.-.A 0.725232042 0.569675223 8477975 2330 78.A.-;115.T.G 0.725003641 0.25829691 10190335 2331 18.-.G;99.-.G 0.724967082 0.471801343 15456232 2332 -30.C.G;76.GG.-T 0.724648029 0.153274083 1191613 2333 - 0.723562149 0.39593116 15.T.G;0.T.-;2.A.C;76. G.- 8352265 2334 86.C.-;121.C.A 0.72284596 0.142245465 8212804 2335 86.-.C;130.T.G 0.721964157 0.480722755 8549476 2336 132.G.T;75.C.- 0.721079989 0.389979571 9994620 2337 I9.-.G;77-.T 0.720984013 0.612544282 14350752 2338 -25.A.C;76.GG.-T 0.720650806 0.13185545 13099030 2339 -1.GT.-- 0.72055901 0.376134358

    TABLE-US-00033 TABLE 21 SEQ index ID NO muts_1indexed MI 95% CI 12147928 2340 2.A.-;121.C.A 0.720545241 0.487545739 1253117 2341 -15.T.G;74.-.T 0.720084866 0.252501472 8208073 2342 88.G.-;131.A.C 0.719133155 0.210050353 2684254 2343 0.T.-;2.A.C;127.T.G 0.719036934 0.352679314 8154688 2344 76.G.-;78.A.C;132.G. 0.718994464 0.383020798 C 318717 2345 -28.G.C;76.G.- 0.71885563 0.191720408 8142885 2346 130.-- 0.718716342 0.300945926 T.TAG;133.A.G;76.G. - 14687527 2347 -29.A.C;4.T.-;78.A.- 0.71775509 0.526752246 15162677 2348 -29.A.G;89.-.A 0.717702888 0.668207942 15450951 2349 -30.C.G;76.GG.-C 0.717140275 0.47685517 8405267 2350 82.AA.-- 0.715989547 0.291686385 8066712 2351 74.T.-;132.G.T 0.715629569 0.310262393 8112393 2352 76.-.A;133.A.C 0.71549299 0.479861009 8564706 2353 75.CG.-T,120.C.A 0.714963297 0.236535754 8538090 2354 75.-.G;130.T.C 0.714585785 0.385707956 14081174 2355 -20.A.C;76.G.- 0.714441554 0.176857594 8357562 2356 87.-.G;126.C.A 0.713356322 0.284696561 6476171 2357 16.-.C;78.A.G 0.713329524 0.676881239 12145038 2358 2.A.-;115.T.G 0.712513 0.523524776 8636717 2359 66.CT.-G;88.-.T 0.712296212 0.372467895 8208060 2360 88.G.-;132.G.T 0.712226175 0.261444904 2746161 2361 0.T.-;2.A.C;66.CT.- 0.711241204 0.361583276 G;132.G.0 8064859 2362 74.T.-;115.T.G 0.710992569 0.209965515 1981797 2363 0.T.C;75.CG.-T 0.710765302 0.646448886 15719823 2364 -32.G.T;0.T.-;2.A.C 0.710088606 0.271097621 3024059 2365 1.TA.--;82.AA.-C 0.709917185 0.373332434 14806152 2366 -29.A.C;89.-.C 0.708940534 0.181536327 14634677 2367 -29.A.C;0.T.-;76.G.- 0.708441715 0.420617475 672656 2368 -23.C.A;75.-.G 0.708188696 0.429780424 8628797 2369 66.CT.-G;77.GA.-- 0.707896801 0.333142814 10529623 2370 15.-.T;85.TC.-A 0.70783661 0.506178761 10196969 2371 18.-.G;78.A.- 0.707389309 0.69751051 8057272 2372 73.-.A;121.C.A 0.707360184 0.369603218 13845728 2373 -14.A.C;75.-.C 0.706574477 0.296568536 1045822 2374 -17.C.A;76.-.G 0.706174615 0.323551014 10460865 2375 16.C.-;76.GG.-C 0.705744149 0.522507616 4222138 2376 4.T.-;72.-.G 0.704993477 0.401332431 1152457 2377 -15.T.C;0.T.-;2.A.C 0.704466347 0.351046476 8069945 2378 74.T.-;87.-.T 0.70432033 0.402131002 6303440 2379 16.-.A;75.-.A 0.704295633 0.656523061 5593794 2380 10.T.C;75.CG.-T 0.704113278 0.280887784 14654654 2381 -29.A.C;1.TA.-- 0.703489272 0.363240543 7829345 2382 55.-.G;76.GG.-C 0.703371081 0.651218332 7490581 2383 36.C.A;76.GG.-C 0.702828956 0.438837246 15452184 2384 -30.C.G;86.-.C 0.702460521 0.465360303 8089736 2385 75.-.A;87.-.A 0.702242786 0.403569437 3161365 2386 0.T.-;2.A.G;14.-.A 0.702180409 0.699897723 8215458 2387 88.GA.-C 0.702027917 0.285995925 2455947 2388 1.TA.--;3.C.A;73.-.A 0.70199884 0.692587003 827787 2389 -21.C.A;76.G.- 0.701801158 0.246155238 3574182 2390 2.-.A;55.-.G 0.70077073 0.681126044 8504697 2391 78.-.T 0.700694002 0.457301016 8147538 2392 76.G.-;91.A.-;93.A.G 0.700512042 0.391148044 8436856 2393 81.GA.-T;132.G.C 0.700344125 0.19857296 8110287 2394 76.-.A;86.-.C 0.700322656 0.448259352 8598693 2395 70.-.T;87.-.T 0.699981587 0.315205095 4260194 2396 4.T.-;129.C.T 0.699010018 0.509569637 8059622 2397 73.-.A;87.-.G 0.698999314 0.388603932 8586230 2398 73.AT.-G 0.698732941 0.264987891 8126524 2399 75.-.C;115.T.G 0.698610242 0.336087672 10084621 2400 19.-.T;82.AA.-T 0.698526311 0.642093957 10607021 2401 16.C.T;78.A.- 0.698487586 0.567347419 8212230 2402 86.-.C;120.C.A 0.698013662 0.50513075 2664493 2403 0.T.-;2.A.C;79.G.A 0.698011945 0.639630835 2203429 2404 0.T.-;18.C.- 0.697561122 0.407203853 8605503 2405 73.A.,-;86.C.- 0.697298567 0.200410632 13852662 2406 -14.A.C;78.A.- 0.697272825 0.309315646 8546163 2407 75.C.-;86.-.C 0.697016055 0.445359301 446575 2408 -27.C.A;76.-.G 0.695980214 0.351410771 8065997 2409 74.T.-;120.C.A 0.695979977 0.233779111 11888602 2410 2.A.C;75.-.G 0.69559201 0.514633776 8536608 2411 75.-.G;118.T.C 0.693904103 0.323497498 14797194 2412 -29.A.C;74.-.G 0.693690739 0.384361164 15166776 2413 -29.A.G;82.AA.-T 0.693594042 0.237378116 14800643 2414 -29.A.C;77.GA.-- 0.693435682 0.378778787 8030604 2415 72.-.C;86.-.C 0.692063669 0.344818271 2464748 2416 1.TA.--;3.C.A;82.AA.- 0.691743005 0.573710339 C 8493269 2417 76.-.G;99.-.G 0.691472756 0.355929538 8549456 2418 75.C.-;133.A.C 0.69071559 0.458090894 2307776 2419 0.T.-;66.CT.-- 0.690358826 0.673270196 6306305 2420 16.-.A;86.-.C 0.690314014 0.602110134 8126956 2421 75.-.C;116.T.G 0.690175397 0.277812588 14809754 2422 -29.A.C;81.GA.-T 0.688454834 0.29609246 8212714 2423 86.-.C;128.T.G 0.687830213 0.369390789 1251890 2424 -15.T.G;78.A.- 0.68686342 0.318568855 8518607 2425 76.GG.-T;119.C.A 0.68650775 0.191235812 8057702 2426 73.-.A;131.A.C 0.686176201 0.431944832 3024866 2427 1.TA.--;82.AA.-G 0.686104906 0.454012439 8367599 2428 86.-.G;133.A.C 0.68587266 0.156982412 8431922 2429 82.AA.-T 0.685861849 0.217270657 8144351 2430 76.G.-;117.G.T 0.685412598 0.238848867 8538257 2431 75.-.G;131.A.C;133.A. 0.685222941 0.418849067 C 8543064 2432 75.-.G;91.A.- 0.684684899 0.640360013 15455856 2433 -30.C.G;76.-.G 0.684667278 0.299094636 12149015 2434 2.A.-;130.T.G 0.684628303 0.459482563 2685087 2435 0.T.-;2.A.C;122.A.C 0.68431304 0.234414414 8084140 2436 74.-.G;132.G.C 0.683463073 0.395894389 8142757 2437 76.G.-;130.T.C;132.G. 0.683368549 0.271903521 C 8538197 2438 75.-.G;134.G.T 0.683303537 0.367656483 15058053 2439 - 0.683089038 0.335849266 29.A.G;0.T.-;2.A.C;76 .GG.-C 8066567 2440 74.T.-;129.C.A 0.680987394 0.26636043 441402 2441 -27.C.A;74.T.- 0.680666111 0.300414617 1042785 2442 -17.C.A;86.-.0 0.678600413 0.334671562 8490149 2443 76.-.G;127.T.G 0.678408907 0.29278641 1905560 2444 0.TTA.-- 0.678221748 0.634547551 -;3.C.A;87.-.A 8352170 2445 86.C.-;120.C.A 0.678142556 0.182223647 1252598 2446 -15.T.G;76.-.T 0.677678067 0.234976145 2400384 2447 1.-.A;77.-.A 0.677524672 0.355978788 8087722 2448 74.-.G;86.C.- 0.676149479 0.432474934 8101522 2449 75.-C.AG 0.67614354 0.285448934 8087834 2450 74.-.G;87.-.T 0.676028279 0.449497639 8431908 2451 82.AA.-T;132.G.C 0.675935187 0.224923092 14645411 2452 - 0.675701823 0.635118105 29.A.C;0.T.-;2.A.C;86 .-.C 2835829 2453 0.T.-;2.A.C;6.G.T 0.674847549 0.297866453 8438736 2454 81.GAA.-TC 0.674319631 0.36029861 8065838 2455 74.T.-;119.C.A 0.673352621 0.209456007 15171004 2456 -29.A,G;73.A.- 0.67309218 0.259465148 8084203 2457 74.-.G;131.A.C 0.672638793 0.327011811 15161712 2458 -29.A.G;77.GA.-- 0.672345803 0.38770658 6613064 2459 18.C.-;77.-.A 0.672260517 0.550699573 12315000 2460 2.A.-;15.-.T;75.-.G 0.672180697 0.634716358 14246167 2461 -24.G.T;75.-.G 0.671730114 0.307720749 15051656 2462 -29.A.G;0.T.- 0.67119501 0.366366001 8469914 2463 78.-.C;121.C.A 0.670982816 0.231982774 8352836 2464 86.C.-;133.A.C 0.670437953 0.207264383 8554990 2465 74.-.T;87.-.A 0.670240877 0.490358551 830076 2466 -21.C.A;75.-.G 0.670218516 0.422319746 8538376 2467 75.-.G;126.C.G 0.670202704 0.370287506 15451096 2468 -30.C.G;75.-.C 0.670027612 0.235695956 1290476 2469 -15.T.G;2.A.- 0.668606404 0.65790079 14644913 2470 - 0.667729957 0.334589988 29.A.C;0.T.-;2.A.C;75 .-.C 8481064 2471 78.A.-;123.A.C 0.666590429 0.232012003 12726534 2472 0.-.T;86.-.C 0.665708352 0.531149931 14814019 2473 -29.A.C;75.C.- 0.665656435 0.396720553 15450607 2474 -30.C.G;75.-.A 0.665082103 0.225224942 8512477 2475 76.G.-;78.A.T;132.G. 0.665001481 0.478100918 C 1247921 2476 -15.T.G;87.-.A 0.664815358 0.476053218 6461965 2477 16.-.C;86.CC.-A 0.663795788 0.62018675 14815751 2478 -29.A.C;73.A.G 0.663422519 0.362091839 8557906 2479 74.-.T;120.C.A 0.663111331 0.196201718 8174025 2480 77.GA --;132.G.T 0.662605083 0.264797557 1979872 2481 0.T.C;78.-.C 0.662557174 0.404196186 8148116 2482 76.G.-;87.-.T 0.662403165 0.583645084 8055441 2483 73.-.A;86.-.C 0.662135274 0.470696085 15162449 2484 -29.A.G;88.G.- 0.66196323 0.205534263 8522485 2485 76.GGA.-TC 0.66191775 0.401082807 3081068 2486 1.TA.--;18.-.G 0.661511132 0.556336464 8117952 2487 76.GG.-C;126.C.A 0.661310322 0.38129357 6469397 2488 16.-.C;89.-.T 0.661127615 0.591422391 8181855 2489 85.TCC.-AA 0.661004434 0.567631116 1044315 2490 -17.C.A;86.C.- 0.660954164 0.167201347 14920528 2491 -29.A.C;2.A.-;82.A.- 0.659413017 0.536093731 8518772 2492 76.GG.-T;120.C.A 0.65901063 0.283077251 15058093 2493 - 0.658082073 0.434010427 29.A.G;0.T.-;2.A.C;75 .-.C 8057683 2494 132.G.T;73.-.A 0.656683021 0.433937068 2459622 2495 1.TA.--;3.C.A;86.-.A 0.656221452 0.656035224 8069836 2496 74.T.-;86.C.- 0.655888245 0.292848962 3320802 2497 2.A.G;0.T.-;80.A.- 0.655685526 0.611479278 14919186 2498 -29.A.C;2.A.-;77.GA.- 0.655286056 0.360298823 8207846 2499 88.G.-;126.C.A 0.655096377 0.243604744 447068 2500 -27.C.A;76.-.T 0.65455178 0.227422314 8603132 2501 73.A.-;132.G.C 0.653928447 0.247296366 8755264 2502 55.-.T;132.G.C 0.653511089 0.548281641 443309 2503 -27.C.A;86.-.C 0.653207249 0.447236787

    TABLE-US-00034 TABLE 22 SEQ index ID NO muts_lindexed MI 95% CI 8548846 2504 75.C.-;121.C.A 0.652717251 0.454635257 8150297 2505 77.-.A;132.G.T 0.652483401 0.274067745 8603165 2506 73.A.-;133.A.C 0.651995199 0.297596 12312790 2507 16.C.-;2.A.- 0.651829339 0.523664364 10248608 2508 18.C.T;76.G.- 0.65143407 0.536447137 1046713 2509 -17.C.A;75.CG.-T 0.651373242 0.2628061 8638044 2510 66.CT.-G;82.AA.-T 0.651267731 0.286853587 3315325 2511 0.T.-;2.A.G;82.AA.-C 0.649742268 0.60527814 12314014 2512 2.A.-;15.-.T;76.G.- 0.649432547 0.573783459 8494400 2513 76.-.G;86.C.- 0.649382925 0.187112086 14920881 2514 -29.A.C;2.A.-;80.A.- 0.648202591 0.517031462 14243707 2515 -24.G.T;76.G.- 0.647505918 0.184867776 12148911 2516 2.A.-;129.C.A 0.646912178 0.60106697 12149062 2517 2.A.-132.G.C 0.646447274 0.501642261 8600526 2518 73.A.-;88.G.- 0.645193272 0.440415837 8538871 2519 75.-.G;121.C.T 0.645184704 0.40216231 8603181 2520 73.A.-;132.G.T 0.645084394 0.288944622 15450764 2521 -30.C.G;76.GG.-A 0.644258092 0.211001918 12149230 2522 2.A.-;129.C.G 0.643329654 0.340406439 8558338 2523 74.-.T;127.T.G 0.643068363 0.272440562 8367575 2524 86.-.G;132.G.C 0.641668887 0.1457948 14647726 2525 -29.A.C;0.T.-;2.A.C;66.CT.-G 0.641412285 0.377955569 8490463 2526 76.-.G;131.AG.CC 0.640049069 0.222285584 12123507 2527 2.A.-;76.G.-;121.C.A 0.639903685 0.451876032 8352850 2528 86.C.-;132.G.T 0.639565433 0.244789313 12191691 2529 2.A.-;78.A.-;132.G.T 0.639118578 0.498911309 8638264 2530 66.CT.-G;80.A.- 0.638943302 0.281775101 1195928 2531 -15.T.G;1.TA.-- 0.638864668 0.361194556 1979286 2532 0.T.C;81.GA.-T 0.63859349 0.548201787 8207662 2533 88.G.-;121.C.A 0.638318686 0.120347159 6460643 2534 16.-.C;81.G.- 0.638310296 0.572206436 2686745 2535 0.T.-;2.A.C;113.A.C 0.638107876 0.276224167 1045705 2536 -17.C.A;78.A.- 0.637718862 0.261909741 8600457 2537 73.A.-;87.-.A 0.636224444 0.454199961 7948057 2538 66.CT.-A;76.-.G 0.636173306 0.379844371 10091271 2539 19.-.T;73.AT.-C 0.636047852 0.54205078 442030 2540 -27.C.A;76.-.A 0.636046349 0.591730246 844891 2541 2.A.-;-21.C.A 0.632935206 0.622195627 10516019 2542 15.-.T;71.-.C 0.632798013 0.533791186 12016332 2543 2.A.-;18.C.- 0.631955982 0.463438076 8073253 2544 74.-.C;132.G.C 0.631661253 0.355974737 8357699 2545 87.-.G;128.T.G 0.630236239 0.334726151 2684905 2546 0.T.-;2.A.C;123.A.C 0.63013769 0.30068044 2684593 2547 0.T.-;2.A.C;134.G.T 0.629727119 0.25806889 12149142 2548 2.A.-;132.G.T 0.629713317 0.481100174 2881692 2549 1.-.C;74.-.C 0.627981095 0.530566104 5590003 2550 87.-.G;10.T.C 0.627660496 0.470739888 12123808 2551 132.G.T;2.A.-;76.G.- 0.627589046 0.327420951 8212595 2552 86.-.C;126.C.A 0.627387867 0.514472305 8173470 2553 77.GA.--;121.C.A 0.626575942 0.292013291 8034488 2554 72.-.C;82.A.- 0.626551427 0.141402238 2411142 2555 1.-.A78.-.C 0.626392306 0.400317799 8096384 2556 75.-.A;82.A.- 0.626331195 0.4184413 2723173 2557 0.T.-;2.A.C;76.-.G;132.G.C 0.626278728 0.31951463 8118097 2558 76.GG.-C;128.T.G 0.625076866 0.405168323 8543409 2559 75.-.G;91.AA.-G 0.624970143 0.399800368 14812614 2560 -29.A.C;76.G.-;78.A.T 0.624719682 0.41001969 6476723 2561 16.-.C;76.G.-;78.A.T 0.624048653 0.568485562 8519286 2562 76.GG.-T;127.T.G 0.623896278 0.239307789 8501650 2563 78.AG.-T 0.623450189 0.439968264 8208050 2564 88.G.-;133.A.C 0.623252172 0.206345206 8549499 2565 75.C.-;131.A.C 0.622971653 0.381498008 12009703 2566 2.A.-;17.-.A 0.62272951 0.617146589 8128850 2567 75.-.C;123.A.C 0.622500225 0.271537384 1862825 2568 0.TT.--;78.-.T 0.622420716 0.588046598 6368672 2569 17.-.A;78.-.C 0.622294539 0.60729061 8519348 2570 76.GG.-T;128.T.G 0.622179066 0.277414915 1041692 2571 -17.C.A;76.GG.-C 0.621568558 0.482033714 8018631 2572 72.-.A 0.620704206 0.469244558 8066533 2573 74.T.-;128.T.G 0.619394119 0.261300111 8436892 2574 81.GA.-T;132.G.T 0.6187912 0.153725765 8636610 2575 66.CT.-G;89.A.- 0.617976625 0.523674002 2884910 2576 1.-.C;77.-.C 0.617324835 0.494013201 8143053 2577 76.G.-;129.C.T 0.617246947 0.285046334 8356385 2578 87.-.G;115.T.G 0.616275923 0.347649465 8561418 2579 74.-.T;87.-.T 0.616099222 0.531230795 6467416 2580 16.-.C;99.-.G 0.614592516 0.506581659 2723199 2581 0.T.-;2.A.C;76.-.G132.G.T 0.614591974 0.388667098 13746674 2582 -13.G.T;75.-.C 0.614408274 0.31688527 15736191 2583 -32.G.T;76.G.- 0.613525442 0.181348798 2950619 2584 1.TA.--;17.T.C 0.612573777 0.330320805 1250048 2585 -15.T.G;87.-.G 0.612309332 0.301352125 8519441 2586 76.GG.-T;130.T.G 0.611111182 0.22661563 8174044 2587 77.GA.--;131.A.C 0.610717722 0.367883539 8083913 2588 74.-.G;126.C.A 0.610464009 0.361277358 6554290 2589 18.C.A;75.-.C 0.610353714 0.248319065 8481228 2590 78.A.-;122.A.C 0.610254061 0.293301542 14004700 2591 -19.G.T;0.T.-;2.A.C 0.609843143 0.268233428 481605 2592 -27.C.A;2.A.- 0.609754574 0.487237879 2262447 2593 0.T.-;81.GA.-C 0.608367109 0.518060275 2683891 2594 0.T.-;2.A.C;124.T.G 0.608299233 0.300466966 2685505 2595 0.T.-;2.A.C;120.C.T 0.608011273 0.287147596 827692 2596 -21.C.A;75.-.C 0.607793108 0.315024918 13101663 2597 -1.GT.--;74.-.T 0.607364457 0.271699421 2271017 2598 0.T.-;128.T.G 0.606729725 0.344765189 8066699 2599 74.T.-;133.A.C 0.606568555 0.229285806 8118193 2600 76.GG.-C;130.T.G 0.606502407 0.534475385 8073290 2601 74.-.C;132.G.T 0.606200531 0.307476047 1117646 2602 -16.C.A;75.-.G 0.60596891 0.417438742 444910 2603 -27.C.A;86.C.- 0.604808061 0.1069721 8563682 2604 75.CG.-T;115.T.G 0.604638581 0.20973375 14645196 2605 -29.A.C;0.T.-;2.A.C;77.GA.-- 0.604366944 0.450675558 14663089 2606 -29.A.C;0.T.-;2.A.G;76.-.G 0.604210237 0.579091661 8480843 2607 78.A.-;131.A.C;133.A.C 0.602956995 0.220786526 15241063 2608 -29.A.G;2.A.-;76.-.G 0.602866438 0.535046196 8128359 2609 75.-.C;127.T.G 0.60265641 0.24558453 12202830 2610 2.A.-;75.-.G;131.A.C 0.6021552 0.300307984 2516661 2611 1.T.C;76.-.G 0.601658638 0.569136768 8600854 2612 73.A.-;98.-.A 0.601410904 0.554678943 15158807 2613 -29.A.G;73.-.A 0.600152864 0.594433328 12147720 2614 2.A.-;120.C.A 0.600140012 0.523644495 14344554 2615 -25.A.C;76.GG.-A 0.599996463 0.212388649 3133295 2616 1.T.G;3.C.-;74.T.- 0.599817227 0.540582624 3601058 2617 2.-.A;76.GG.-T 0.599399219 0.520337615 8562045 2618 74.-.T;82.AA.-T 0.59910687 0.25652345 8080686 2619 74.-.G;89.-.A 0.599083728 0.541504936 8116266 2620 76.GG.-C;115.T.G 0.599077745 0.438717053 8528148 2621 76.-.T;86.C.- 0.597986897 0.267868788 14809572 2622 -29.A.C;82.AA.-T 0.597370752 0.168815452 1041548 2623 -17.C.A;76.GG.-A 0.597127645 0.347987184 13847372 2624 -14.A.C;86.-.C 0.597092285 0.439947956 2654872 2625 0.T.-;2.A.C;75.C.A 0.596011018 0.360937483 8543705 2626 75.-.G;89.A.G 0.595783213 0.480599849 8150315 2627 77.-.A;131.A.C 0.59518379 0.216809566 13854171 2628 -14.A.C;74.-.T 0.59491988 0.255047542 8084187 2629 74.-.G;132.G.T 0.594518766 0.378253331 1249988 2630 -15.T.G;86.C.- 0.594456707 0.263547148 10308807 2631 17.-.T;78.A.-;80.A.- 0.593350924 0.537958354 8093276 2632 75.-.A;130.T.G 0.593146278 0.294496621 15069677 2633 -29.A.G;0.T.-;2.A.G;75.-.G 0.5926846 0.429138172 2884699 2634 1.-.C;77.-.A 0.592681567 0.444413531 14921605 2635 -29.A.C;2.A.-;74.-.T 0.591983792 0.536395035 8448153 2636 80.A.-;132.G.C 0.591660429 0.174714397 8140966 2637 76.G.-;118.T.C 0.591028328 0.208755316 8161100 2638 79.6.-;132.G.C 0.590790681 0.220833117 15165008 2639 -29.A.G;88.-.T 0.58999307 0.294162942 15058006 2640 -29.A.G;0.T.-;2.A.C;76.GG.-A 0.589688255 0.449116705 14647360 2641 -29.A.C;0.T.-;2.A.C;75.CG.-T 0.588777864 0.365024825 8207961 2642 88.G.-;129.C.A 0.588244428 0.254294724 2684707 2643 0.T.-;2.A.C;129.C.G 0.58718304 0.249024882 12177699 2644 2.A.-;82.A.-;84.A.T 0.58696641 0.577956828 8495115 2645 76.-.G;80.A.G 0.586627596 0.276894747 8173741 2646 77.GA.--;126.C.A 0.585562165 0.261884393 8044380 2647 72.-.G;87.-.G 0.585537507 0.496438628 2270366 2648 0.T.-;120.C.A 0.585051153 0.348301546 15456767 2649 -30.C.G;74.-.T 0.584964692 0.259355294 12752882 2650 0.-.T;73.AT.-G 0.583581773 0.561012988 4217308 2651 4.T.-;71.T.C 0.583528708 0.515253098 14810890 2652 -29.A.C;78.AG.-C 0.583180403 0.367641912 13853442 2653 -14.A.C;76.GG.-T 0.582589545 0.211217084 8448176 2654 80.A.- 0.582531333 0.209077508 8103057 2655 76.GG.-A;98.-.A 0.582277673 0.55389364 8141130 2656 76.G.-;118.T.G 0.581284111 0.26198905 8133120 2657 75.-.C;86.-.G 0.581268194 0.268509352 14921140 2658 -29.A.C;2.A.-;76.-.G 0.581166066 0.463527496 1046627 2659 -17.C.A;74.-.T 0.580843268 0.237913321 8490817 2660 76.-.G;122.A.C 0.580816128 0.338035457 2749021 2661 0.T.-;2.A.C;65.G.T 0.580627515 0.520199907 1251730 2662 -15.T.G;78.-.0 0.580454498 0.277680214 8565400 2663 75.CG.-T;131.AG.CC 0.580378421 0.162900123 8034315 2664 72.-.C;87.-.G 0.579900852 0.400196584 1095467 2665 -16.C.A;0.T.-;2.A.C 0.578139753 0.253542538 1982142 2666 0.T.C;70.-.T 0.578040747 0.514803955

    TABLE-US-00035 TABLE 23 SEQ index ID NO muts_lindexed MI 95% CI 2661968 2667 0.T.-;2.A.C;76.G.-;133.A.C 0.57749224 0.441653169 14529775 2668 -28.G.T;75.-.G 0.577078051 0.357956174 2464540 2669 0.T.-;3.C.-;82.AA.-- 0.576438266 0.496783332 3011533 2670 1.TA.--;126.C.A 0.576212191 0.385876942 8160673 2671 79.G.-;121.C.A 0.576161715 0.276769402 445036 2672 -27.C.A;87.-.T 0.576139586 0.385762845 8480668 2673 78.A.-;130.T.C 0.576024382 0.239310768 446329 2674 -27.C.A;78.-.C 0.575818594 0.275614681 8524684 2675 76.-.T;86.-.C 0.575418001 0.427849393 14350148 2676 -25.A.C;78.A.- 0.574994909 0.251987218 15456629 2677 -30.C.G;75.C.- 0.574735978 0.433262652 8084175 2678 74.-.G;133.A.C 0.573978066 0.497590865 8470281 2679 78.-.C;133.A.C 0.573588021 0.327243841 1976159 2680 0.T.C;88.G.- 0.573415984 0.487091048 2553815 2681 0.T.-;2.A.C;11.T.C 0.572813487 0.380949243 8565313 2682 75.CG.-T;130.T.G 0.572720854 0.28519884 8142626 2683 76.G.-;128.T.C 0.572573376 0.270734577 15059444 2684 -29.A.G;0.T.-;2.A.C;76.GG.-T 0.571014973 0.539165235 14349990 2685 -25.A.C;78.-.C 0.570479705 0.339570631 7944404 2686 66.CT.-A;86.-.C 0.570401891 0.517202925 8143508 2687 76.G.-;122.A.G 0.570368433 0.295091218 8483736 2688 78.A.-;99.-.G 0.569940382 0.383399129 8457128 2689 80.AG.-T 0.569875532 0.407717978 14685680 2690 -29.A.C;4.T.-;76.GG.-C 0.569769951 0.468156843 8639135 2691 66.CT.-G;75.-.G 0.569640144 0.439103296 8093196 2692 75.-.A;128.T.G 0.569631485 0.286483725 2574670 2693 0.T.-2.A.C;21.T.A 0.568848291 0.277790817 2270511 2694 0.T.-;121.C.A 0.568823446 0.346919825 2411434 2695 1.-.A;78.A.- 0.568308397 0.492015937 8128649 2696 75.-.C;131.A.C;133.A.C 0.56797398 0.310988199 2837903 2697 2.A.C;0.T.-;5.G.T 0.567182668 0.301762792 15456872 2698 -30.C.G;75.CG.-T 0.566922487 0.275000232 2684575 2699 130.--T.TAG;133.A.G;2.A.C;0.T.- 0.566786287 0.297282581 15486653 2700 -30.C.G;2.A.- 0.566597124 0.457183039 12202811 2701 2.A.-;75.-.G;133.A.C 0.565986807 0.395655607 8480879 2702 78.A.-;129.C.G 0.565951849 0.323772129 3011188 2703 1.TA.--;121.C.A 0.563547027 0.371989823 8297879 2704 99.-.G 0.563426918 0.267608562 8352639 2705 86.C.-;127.T.G 0.563082098 0.202268903 14801514 2706 -29.A.C;86.-.A 0.562277455 0.47388314 1975537 2707 0.T.C;79.G.- 0.562276863 0.48611243 8480783 2708 78.A.-;134.G.T 0.560674716 0.40924491 14351204 2709 -25.A.C;75.C.- 0.56061618 0.404146443 1042672 2710 -17.C.A;87.-.A 0.560291693 0.386629447 8480385 2711 78.A.-;126.C.A 0.56011981 0.238382308 8105496 2712 76.GG.-A;127.T.G 0.559463981 0.268526426 15059173 2713 -29.A.G;0.T.-;2.A.C;80.A.- 0.558328951 0.364430265 8132470 2714 75.-.C;91.AA.-G 0.55794057 0.467738717 14663399 2715 -29.A.C;0.T.-;2.A.G;75.C.- 0.555989953 0.452975089 8132353 2716 75.-.C;91.A.-;93.A.G 0.555655149 0.391589733 6557204 2717 18.C.A;78.A.- 0.55490577 0.33009122 13845080 2718 -14.A.C;75.-.A 0.553964545 0.280917125 2894429 2719 1.-.C;86.-.G 0.553556726 0.355589983 8605594 2720 73.A.-;87.-.T 0.553338911 0.323431172 14918668 2721 -29.A.C;2.A.-;75.-.A 0.553238993 0.285233158 13852859 2722 -14.A.C;76.-.G 0.552869618 0.304031476 8558273 2723 74.-.T;126.C.A 0.552629697 0.203156607 14344734 2724 -25.A.C;76.GG.-C 0.552119262 0.424653466 8063226 2725 74.T.-;87.-.A 0.552096685 0.354902882 8564564 2726 75.CG.-T;119.C.A 0.551864161 0.230129505 13687669 2727 -12.G.T75.-.G 0.551148172 0.378236607 14812439 2728 -29.A.C;78.A.T 0.550882224 0.501507682 7944045 2729 66.CT.-A;76.G.- 0.550594074 0.425751575 2685752 2730 0.T.-;2.A.C;119.C.T 0.549480674 0.2058528 8118242 2731 130.--T.TAG;133.A.G;76.GG.-C 0.548710279 0.423160468 1245577 2732 -15.T.G;73.-.A 0.548630123 0.53908022 15454032 2733 -30.C.G;86.C.- 0.548408194 0.146894103 15738375 2734 -32.G.T;75.-.G 0.548196327 0.30032935 6302341 2735 16.-.A;72.-.C 0.54793736 0.363280011 2287278 2736 0.T.-;82.-.T 0.547862516 0.435436106 3599083 2737 2.-.A;78.-.C 0.547517977 0.397685932 8538303 2738 75.-.G;129.C.G 0.547177668 0.446183912 3025181 2739 1.TA.--;82.-.T 0.546005635 0.497627964 999582 2740 -17.C.A;0.T.- 0.545876413 0.406976245 9986114 2741 19.-.G;89.-.C 0.545714579 0.49212709 13096860 2742 -1.GT.--;74.T.- 0.54540182 0.126101418 14686894 2743 -29.A.C;4.T.-;86.C.- 0.545239171 0.409735305 8515608 2744 76.G.-;78.AG.TT 0.545069364 0.313301484 10071761 2745 19.-.T;85.TC.-A 0.54479944 0.527860057 8540169 2746 75.-.G;113.A.G 0.543102637 0.381475433 15170520 2747 -29.A.G;73.AT.-G 0.542963315 0.302212358 8133499 2748 75.-.C;83.-.G 0.542495998 0.398113706 15161304 2749 -29.A.G;76.G.-;78.A.C 0.542401586 0.360524231 14815543 2750 -29.A.C;73.AT.-G 0.542111484 0.268698449 14812304 2751 -29.A.C;78.-.T 0.541883351 0.456256042 8351219 2752 86.C.-;115.T.G 0.541795444 0.167333867 8363173 2753 87.-.T;129.C.A 0.541710882 0.45548051 8128504 2754 75.-.C;130.T.C 0.541636404 0.301115914 8538167 2755 75.-.G;132.GA.CC 0.541089363 0.415736007 8063302 2756 74.T.-;88.G.- 0.540731374 0.306571561 10087552 2757 19.-.T;78.A.-;80.A.- 0.540592506 0.495589309 7490687 2758 36.C.A;76.G.- 0.540151999 0.152783677 8202465 2759 87.-.A;132.G.T 0.54005277 0.527499683 8519530 2760 76.GG.-T;131.AG.CC 0.539568972 0.199248804 4321391 2761 4.T.-;65.G.T 0.538942702 0.513208936 15239627 2762 -29.A.G;2.A.-;75.-.C 0.538937683 0.394383352 14808642 2763 -29.A.C;82.A.-;84.A.T 0.538835503 0.494127547 12123800 2764 2.A.-;76.G.-;133.A.C 0.53867639 0.36512328 15169507 2765 -29.A.G;75.C.- 0.538649298 0.410436551 2731526 2766 0.T.-;2.A.C;75.-.G;132.G.T 0.538312596 0.51810426 8118032 2767 76.GG.-C;127.T.G 0.53700376 0.351634793 15168665 2768 -29.A.G;77.-.T 0.536694116 0.500951198 8546114 2769 75.C.-;88.G.- 0.536531987 0.433499049 6480287 2770 16.-.C;73.A.G 0.535878646 0.477206798 8367284 2771 86.-.G;121.C.A 0.535296368 0.178941915 14245829 2772 -24.G.T;78.A.- 0.534877866 0.289282764 8526256 2773 76.-.T;121.C.A 0.534562327 0.258036007 320895 2774 -28.G.C;75.-.G 0.533966141 0.338633053 14801003 2775 -29.A.C;85.TC.-A 0.533852209 0.42681567 2900348 2776 1.-.C;76.G.-;78.A.T 0.533722522 0.476159074 8173897 2777 77.GA.--;129.C.A 0.533268703 0.286973833 10315449 2778 17.-.T;73.A.G 0.532731562 0.462080339 8118283 2779 76.GG.-C;131.AG.CC 0.532401677 0.506645788 8638120 2780 66.CT.-G;81.GA.-T 0.529612827 0.189572957 8115215 2781 76.GG.-C;98.-.A 0.529601406 0.407199505 8098639 2782 75.CG.-A 0.528065372 0.398201351 8363276 2783 87.-.T;133.A.C 0.527654337 0.444969797 8490333 2784 76.-.G;130.T.G 0.527134113 0.344258636 670332 2785 -23.C.A;76.G.- 0.526515155 0.335457235 14499641 2786 -28.G.T;0.T.-;2.A.C 0.52630839 0.192014079 8357643 2787 87.-.G;127.T.G 0.526215994 0.313357684 4269759 2788 4.T.-;91.A.-;93.A.G 0.526142398 0.366589265 8145628 2789 76.G.-;113.A.G 0.525564142 0.316731543 1250181 2790 -15.T.G;86.-.G 0.525481067 0.170826111 2684458 2791 0.T.-;2.A.C;130.T.C 0.524709128 0.229934214 8211364 2792 86.-.C;115.T.G 0.524286326 0.484460897 12327615 2793 2.A.-;6.G.T 0.523903903 0.498314675 13750639 2794 -13.G.T;76.GG.-T 0.52360612 0.199695415 8545256 2795 75.-.G;82.AA.-T 0.523533206 0.310507673 15051403 2796 -29.A.G;0.T.-;76.G.- 0.523477863 0.359359453 8128996 2797 75.-.C;122.A.C 0.52294617 0.295511794 15157689 2798 -29.A.G;72.-.A 0.522828828 0.3905261 3011885 2799 1.TA.--;131.A.C 0.522211145 0.412727331 6586124 2800 18.-.A;73.AT.-C 0.521721358 0.392610894 8538269 2801 75.-.G;131.A.G 0.521700337 0.380171958 2661660 2802 0.T.-;2.A.C;76.G.-;121.C.A 0.52050173 0.428916241 8490491 2803 76.-.G;131.A.G 0.520366526 0.267501834 8638542 2804 66.CT.-G;78.-.C 0.519761904 0.367445975 14230312 2805 -24.G.T;0.T.-;2.A.C 0.519671019 0.345673439 6554102 2806 18.C.A;76.GG.-A 0.519352035 0.207450089 8480490 2807 78.A.-;127.T.G 0.519219321 0.21628878 12148735 2808 2.A.-;127.T.G 0.518903576 0.454392832 6554952 2809 18.C.A;86.-.C 0.518790459 0.411420745 8548546 2810 75.C.-;119.C.A 0.517924262 0.375435555 8537738 2811 75.-.G;125.T.G 0.517546384 0.421774082 14524986 2812 -28.G.T;76.G.- 0.517443138 0.210817034 8112028 2813 76.-.A;121.C.A 0.517164085 0.479428413 8558469 2814 74.-.T;130.T.G 0.517109614 0.240257462 8536730 2815 75.-.G;118.T.G 0.516654079 0.347346716 1975405 2816 0.T.C;77.-.A 0.516223556 0.381140846 8490677 2817 76.-.6;123.A.C 0.515655644 0.354670318 14351455 2818 -25.A.C;75.CG.-T 0.515062617 0.304205957 8519708 2819 76.GG.-T;123.A.C 0.514732027 0.221694148 13850181 2820 -14.A.C;86.C.- 0.514653567 0.175135516 829963 2821 -21.C.A;76.GG.-T 0.512665825 0.195077868 396157 2822 -27.C.A;1.TA.-- 0.512397621 0.411313736 8128583 2823 130.--T.TAG;133.A.G;75.-.C 0.511360625 0.326791328 3011846 2824 1.TA.--;133.A.C 0.510597585 0.351631622 14918900 2825 -29.A.C;2.A.-;75.-.C 0.510304993 0.475271006 15159253 2826 -29.A.G;74.-.C 0.509144831 0.438279977 8480820 2827 78.A.-;131.AG.CC 0.508771663 0.277308284 2824789 2828 0.T.-;2.A.C;16.C.- 0.508408045 0.431164458 8030574 2829 72.-.C;88.G.- 0.506884465 0.293464717

    TABLE-US-00036 TABLE 24 SEQ index ID NO muts_lindexed MI 95% CI 8103971 2830 76.GG.-A;115.T.G 0.506714342 0.334208414 8480769 2831 130.--T.TAG;133.A.G;78.A.- 0.506662335 0.275750543 12146846 2832 2.A.-;118.T.C 0.506662335 0.448261871 8105632 2833 76.GG.-A;130.T.G 0.506661965 0.31757799 14655186 2834 -29.A.C;1.TA.--;78.A.- 0.505038768 0.349546779 13887801 2835 -14.A.C;2.A.- 0.50476973 0.416608677 8558448 2836 74.-.T;130.T.C 0.504326742 0.274992635 8588552 2837 73.AT.-G;87.-.G 0.503452084 0.382877256 4277297 2838 4.T.-;86.C.T 0.50273009 0.316942926 8490414 2839 130.--T.TAG;133.A.G;76.-.G 0.502294014 0.265692536 8557082 2840 74.-.T;115.T.G 0.501788618 0.240258884 3010886 2841 1.TA.--;119.C.A 0.501621564 0.332438342 8123134 2842 75.-.C;82.-.A 0.500644531 0.401625156 8558564 2843 74.-.T;131.AG.CC 0.500523453 0.241207919 10570905 2844 15.-.T;66.C.- 0.500493846 0.475165652 8448232 2845 80.A.-;131.A.C 0.499354119 0.207066339 1041390 2846 -17.C.A;75.-.A 0.499154073 0.323859893 646656 2847 -23.C.A;0.T.-;2.A.C 0.499025819 0.25793286 15167125 2848 -29.A.G;80.A.- 0.498690448 0.246341392 8105551 2849 76.GG.-A;128.T.G 0.497708543 0.268069258 8084057 2850 74.-.G;129.C.A 0.495342021 0.351272002 8493858 2851 76.-.G;91.A.- 0.495092834 0.442273746 10544166 2852 15.-.T;91.A.-;93.A.G 0.494903344 0.36111403 8565224 2853 75.CG.-T;128.T.G 0.493977822 0.257917935 8586274 2854 73.AT.-G;131.A.C 0.493739387 0.325651011 8362865 2855 87.-.T;121.C.A 0.493526779 0.439303415 443254 2856 -27.C.A;88.G.- 0.492968287 0.160647841 13171639 2857 -1.G.T;75.-.G 0.492601142 0.491746074 8478628 2858 78.A.-;116.T.G 0.491876176 0.261017897 6557301 2859 18.C.A;76.-.G 0.49164967 0.407268607 8752532 2860 55.-.T;75.-.A 0.491390512 0.44462484 8560929 2861 74.-.T;91.A.-;93.A.G 0.491205156 0.384453162 4295718 2862 4.T.-;78.A.-;132.G.C 0.491177117 0.428226189 10561864 2863 15.-.T;76.G.T 0.491146433 0.343126473 8537677 2864 75.-.G;125.T.C 0.489714365 0.274407052 8143025 2865 76.G.-;129.C.G 0.489227868 0.327699958 8089936 2866 75.-.A;89.-.A 0.488779674 0.372660333 8599794 2867 70.-.T;76.-.G 0.488667386 0.391145449 8105873 2868 76.GG.-A;123.A.C 0.487861644 0.22247771 8517616 2869 76.GG.-T;115.T.G 0.486978242 0.198126193 12149710 2870 2.A.-;122.A.C 0.485932471 0.444772033 8489904 2871 76.-.G;124.T.G 0.485539102 0.229906368 1164547 2872 -15.T.C;76.G.- 0.485109654 0.30382645 8653886 2873 65.GC.-T;87.-.6 0.485040713 0.238958896 8074762 2874 74.-.C;86.C.- 0.484897947 0.341794685 8480183 2875 78.A.-;124.T.G 0.484866253 0.155741545 14921899 2876 -29.A.C;2.A.-;73.A.- 0.484654008 0.412332886 806417 2877 -21.C.A;0.T.-;2.A.C 0.484651885 0.213811885 8367608 2878 86.-.G;132.G.T 0.484324949 0.200140872 3000591 2879 1.TA.--;76.G.-;132.G.C 0.4836883 0.410892791 8602683 2880 73.A.-;121.C.A 0.48312272 0.181092975 1250113 2881 -15.T.G;87.-.T 0.482791984 0.353024933 1246020 2882 -15.T.G;74.-.G 0.482594805 0.468388077 8095244 2883 75.-.A;99.-.G 0.482411376 0.440951749 7516650 2884 38.C.A;75.-.G 0.482411376 0.23182513 8101468 2885 75.C.A;78.A.- 0.482082335 0.243384018 6420798 2886 17.T.C;76.G.- 0.481444121 0.122802281 8080536 2887 74.-.G;88.G.- 0.481189232 0.304120518 8583631 2888 73.AT.-G;86.-.C 0.481173989 0.328294793 2685339 2889 0.T.-;2.A.C;121.C.T 0.480161236 0.259384948 15241190 2890 -29.A.G;2.A.-;76.3G.-T 0.480084038 0.448042386 4235216 2891 4.T.-;77.G.A 0.479539261 0.358264062 333335 2892 2.A.-;-28.G.C 0.479358813 0.436521088 15454091 2893 -30.C.G;87.-.G 0.479044667 0.245281612 8104903 2894 76.GG.-A;119.C.A 0.478218223 0.290640621 14795119 2895 -29.A.C72.-.C 0.478167361 0.366311838 8549156 2896 126.C.A;75.C.- 0.477655337 0.401183875 2270186 2897 0.T.-;119.C.A 0.476357464 0.28961569 442714 2898 -27.C.A;79.G.- 0.475921463 0.33589485 2684191 2899 0.T.-;2.A.C;127.T.C 0.475552623 0.230755681 2661980 2900 0.T.-;2.A.C;76.G.-;132.G.T 0.475543203 0.461390486 8759441 2901 55.-.T;75.CG.-T 0.475274664 0.3110126 8548730 2902 75.C.-;120.C.A 0.474785619 0.390058461 2517486 2903 1.T.C;75.CG.-T 0.474646379 0.383115501 13098412 2904 -1.GT.--;86.-.C 0.473674402 0.202438358 6556251 2905 18.C.A;87.-.G 0.471145708 0.219704096 8539383 2906 75.-.G;117.G.T 0.470019299 0.350569819 2728409 2907 0.T.-;2.A.C;76.GG.-T;132.G.T 0.469423673 0.457772037 8147743 2908 76.G.-;89.-.C 0.468585571 0.171258383 8538151 2909 75.-.G;132.G.A 0.467133266 0.349055208 8519808 2910 76.GG.-T;122.A.C 0.466576243 0.178702651 8538739 2911 75.-.G;122.A.G 0.466576243 0.334549602 8055399 2912 73.-.A;88.G.- 0.466033327 0.320041272 8602922 2913 73.A.-;126.C.A 0.465865335 0.283031316 8558390 2914 74.-.T;128.T.G 0.46527251 0.205871798 8202371 2915 87.-.A;129.C.A 0.465267382 0.464757478 8495023 2916 78.A.-;82.A.G 0.463214654 0.211642756 8093252 2917 75.-.A;130.T.C 0.463013832 0.334659591 2566367 2918 0.T.-2.A.C;17.T.C 0.461392589 0.268420878 443194 2919 -27.C.A;87.-.A 0.460771587 0.399261729 8586216 2920 73.AT.-G;132.G.C 0.460668725 0.250991995 8492129 2921 76.-.G;113.A.G 0.459948539 0.273948034 8602593 2922 73.A.-;120.C.A 0.459546198 0.167376352 12438314 2923 1.TAC.---;76.-.T 0.458955662 0.409257705 8018666 2924 72.-A;111.A.C 0.458702522 0.405962971 2658141 2925 0.T.-;2.A.C;76.GG.-C;132.G.C 0.458544612 0.41841279 2270855 2926 0.T.-;126.C.A 0.458127918 0.339841458 3011711 2927 1.TA.--;129.C.A 0.457672819 0.369464206 8357785 2928 87.-.G;130.T.G 0.457390155 0.321441502 12148855 2929 2.A.-;128.T.G 0.456649691 0.424208993 8538425 2930 75.-.G;126.C.T 0.456066648 0.391670844 14812176 2931 -29.A.C;78.AG.-T 0.455217768 0.421822764 959345 2932 -18.T.G;0.T.-;2.A.C 0.454745656 0.262947402 8352569 2933 86.C.-;126.C.A 0.451977309 0.231744784 8562579 2934 75.CG.-T;86.-.C 0.451863845 0.284864192 12185280 2935 2.A.-;80.A.-;132.G.C 0.451858405 0.397487978 8118567 2936 76.GG.-C;122.A.C 0.449218148 0.341479227 8129443 2937 75.-.C;119.C.T 0.448058984 0.241337157 8488242 2938 76.-.G;115.T.G 0.447807737 0.303351067 2685947 2939 0.T.-;2.A.C;117.G.T 0.447350974 0.223995386 2684042 2940 0.T.-;2.A.C;125.T.G 0.446446953 0.225442366 2628011 2941 0.T.-;2.A.C;65.G.A 0.445909737 0.431014642 1093922 2942 -16.C.A;0.T.- 0.445744275 0.384769858 14021392 2943 -19.G.T;76.G.- 0.445446692 0.210980489 14023783 2944 -19.G.T;75.-.G 0.445006163 0.320561961 8479108 2945 118.T.C;78.A.- 0.444437185 0.180007604 4295742 2946 4.T.-;78.A.-;132.G.T 0.443700313 0.342467455 8348822 2947 88.-.T;132.G.C 0.443636958 0.306921941 8448031 2948 80.A.-;128.T.G 0.442657435 0.216018231 8480854 2949 78.A.-;131.A.G 0.442172304 0.339275348 8073282 2950 74.-.C;133.A.C 0.441868617 0.352017188 2271058 2951 129.C.A;0.T.- 0.441858081 0.316640496 12151722 2952 2.A.-;113.A.C 0.44078825 0.348903885 13168765 2953 -1.G.T;76.G.- 0.440234903 0.237503321 8760885 2954 56.G.T;76.G.- 0.438783025 0.163508619 8518019 2955 76.GG.-T;116.T.G 0.438369692 0.235604662 1117245 2956 -16.C.A;78.A.- 0.438279124 0.16834881 8592769 2957 70.-.T;88.G.- 0.438220877 0.244749237 8628663 2958 66.CT.-G;79.G.- 0.438072351 0.182645901 8480752 2959 78.A.-;132.GA.CC 0.437930513 0.248881928 8059585 2960 73.-.A;86.C.- 0.437225419 0.435957495 13750261 2961 -13.G.T;78.A.- 0.437054685 0.253065367 8539599 2962 75.-.G;114.G.T 0.436888965 0.374443118 8352028 2963 86.C.-;119.C.A 0.436035802 0.188996533 8129947 2964 75.-.C;113.A.C 0.43594687 0.304848987 8538081 2965 75.-.G;130.T.C;132.G.C 0.434698024 0.332020273 8561460 2966 74.-.T;86.-.G 0.432879878 0.233198854 8363222 2967 87.-.T;130.T.G 0.432369032 0.345082874 15749286 2968 -32.G.T;2.A.- 0.43081932 0.390213068 8129269 2969 75.-.C;120.C.T 0.430595045 0.273748314 445858 2970 -27.C.A;82.AA.-T 0.430559526 0.234423079 8133915 2971 75.-.C;80.A.G 0.430504694 0.343719431 1045161 2972 -17.C.A;82.AA.-T 0.430467643 0.182104489 2569551 2973 0.T.-;2.A.C;18.C.A 0.430355335 0.27785676 8034268 2974 72.-.C;86.C.- 0.427635605 0.226345972 481315 2975 -27.C.A;2.A.-;76.G.- 0.427566605 0.366076873 447361 2976 -27.C.A;75.C.- 0.427271989 0.372051561 393117 2977 -27.C.A;0.T.-;2.A.C;76.G.- 0.427167737 0.380439384 672550 2978 -23.C.A;76.GG.-T 0.426979754 0.135361911 13171223 2979 -1.G.T;78.A.- 0.426700654 0.170495659 2269114 2980 0.T.-;115.T.G 0.424407199 0.334312683 15164751 2981 -29.A.G;89.-.C 0.424272539 0.193097014 8150288 2982 77.-.A;133.A.C 0.423804972 0.252292931 13716962 2983 -13.G.T;0.T.-;2.A.C 0.42315833 0.20734707 14810153 2984 -29.A.C;80.A.- 0.422936471 0.207060587 8149925 2985 77.-.A;121.C.A 0.42217724 0.192407441 8118444 2986 76.GG.-C;123.A.C 0.421898172 0.264213012 15450237 2987 -30.C.G;74.T.- 0.421545908 0.305538885 13847292 2988 -14.A.C;88.G.- 0.421223502 0.122864931 8599283 2989 70.-.T;82.AA.-G 0.42040004 0.308617971 2258810 2990 0.T.-;76.G.-;132.G.C 0.420140578 0.380686219 8352862 2991 86.C.-;131.AG.CC 0.42006813 0.340106853 8431466 2992 82.AA.-T;121.C.A 0.418074771 0.20942073 10604385 2993 16.C.T;76.GG.-C 0.418006899 0.309663803

    TABLE-US-00037 TABLE 25 SEQ index ID NO muts_lindexed MI 95% CI 15410869 2994 -30.C.G;1.TA.-- 0.417875135 0.3568233 14644576 2995 -29.A.C;0.T.-;2.A.C;74 0.417019277 0.397760744 8174011 2996 77.GA.--;133.A.C 0.416289819 0.329786398 13750370 2997 -13.G.T;76.-.G 0.415803975 0.250075934 8083409 2998 74.-.G;119.C.A 0.415582401 0.37566693 8093325 2999 130.--T.TAG;133.A.G75.-.A 0.41506487 0.287158065 7740425 3000 51.C.A;75.-.G 0.413952218 0.309260684 2271544 3001 0.T.-;122.A.C 0.412907976 0.313660504 8154715 3002 76.G.-;78.A.C;132.G.T 0.412514098 0.330364487 2684548 3003 0.T.-;2.A.C;132.GA.CC 0.412508844 0.221325092 1042081 3004 -17.C.A;77.-.A 0.412076905 0.146558067 14808586 3005 -29.A.C;82.AA.-- 0.411847708 0.267953299 8106752 3006 76.GG.-A;113.A.C 0.411607169 0.272676178 8447956 3007 80.A.-;127.T.G 0.410631483 0.234388742 8128664 3008 75.-.C;131.A.G 0.409653057 0.338241648 1291175 3009 -15.T.G;2.A.-;75.-.G 0.409209938 0.3796168 1253907 3010 -15.T.G;73.A.- 0.408538157 0.239463307 8128396 3011 128.T.C;75.-.C 0.407284315 0.25239378 14084593 3012 -20.A.C;75.-.G 0.406446952 0.340365597 2661890 3013 0.T.-;2.A.C;76.G.-;129.C.A 0.406369959 0.358795066 8598917 3014 70.-.T;82.A.- 0.40571344 0.363210997 8519493 3015 130.--T.TAG;133.A.G;76.GG.-T 0.404790669 0.16478942 2655861 3016 0.T.-;2.A.C;76.GG.-A;132.G.C 0.404290669 0.211492433 8554353 3017 74.-C.TA 0.403856841 0.278654898 6557545 3018 18.C.A;76.GG.-T 0.403794566 0.248846831 1247115 3019 -15.T.G;77.-.A 0.402928751 0.162190367 15450484 3020 -30.C.G;74.-.G 0.401571837 0.368581694 8105724 3021 76.GG.-A;131.AG.CC 0.400845215 0.31233423 14644689 3022 -29.A.C;0.T.-;2.A.C;75.-.A 0.400778989 0.380620086 8558610 3023 74.-.T;129.C.G 0.400473999 0.215598514 8357449 3024 87.-.G;124.T.G 0.4003889 0.279813501 15738093 3025 -32.G.T;78.A.- 0.39957936 0.178694312 8161146 3026 79.G.-;132.G.T 0.39905064 0.197100501 827638 3027 -21.C.A;76.GG.-C 0.399045423 0.381135643 14647317 3028 -29.A.C;0.T.-;2.A.C;74.AT.-G 0.398936731 0.337066703 8431948 3029 82.AA.-T;132.G.T 0.3962767 0.282558622 14344384 3030 -25.A.C;75.-.A 0.395805888 0.31302797 8508448 3031 78.A.T;132.G.C 0.394920905 0.354687022 8150265 3032 77.-.A;132.G.C 0.394788052 0.232297315 8654330 3033 65.GC.-T;78.A.- 0.394710446 0.293953197 8093514 3034 75.-.A;123.A.C 0.393696908 0.309225612 8352775 3035 86.C.-;130.T.G 0.39207924 0.217323726 8066628 3036 74.T.-;130.T.G 0.391719849 0.262493357 15168618 3037 -29.A.G;76.G.-;78.A.T 0.389830815 0.33561224 672344 3038 -23.C.A;78.A.- 0.389587037 0.321933192 8586257 3039 73.AT.-G;132.G.T 0.388395464 0.296363207 8105301 3040 76.GG.-A;124.T.G 0.388226799 0.287549837 8212901 3041 86.-.C;131.AG.CC 0.386148792 0.352659282 13588657 3042 -10.A.C;76.G.- 0.384737506 0.348068257 728974 3043 -22.T.A;75.-.G 0.384109233 0.325342595 8448212 3044 80.A.-;132.G.T 0.382825545 0.197802389 8128219 3045 75.-.C;125.T.G 0.382212437 0.342348339 8084164 3046 130.--T.TAG;133.A.G;74.-.G 0.380674413 0.324462071 13800992 3047 -14.A.C;1.TA.-- 0.380502059 0.379567092 8084111 3048 74.-.G;130.T.G 0.379838914 0.284915658 14348272 3049 -25.A.C;87.-.G 0.375787656 0.227005333 8032112 3050 72.-.C;121.C.A 0.374984841 0.316858242 8599500 3051 70.-.T;80.A.- 0.374957082 0.306856796 14647476 3052 -29.A.C;0.T.-;2.A.C;73.AT.-G 0.374849427 0.287178991 8637349 3053 66.CT.-G;82.A.- 0.374748495 0.369535198 14059318 3054 2.A.C;0.T.-;-20.A.C 0.374318246 0.261266848 5590089 3055 10.T.C;87.-.T 0.372525513 0.344891 8105685 3056 76.GG.-A;130.--T.TAG;133.A.G 0.372066359 0.23292177 2687214 3057 0.T.-;2.A.C;113.A.G 0.370636094 0.260077315 8605752 3058 73.A.-;82.A.- 0.369387324 0.344859167 8066727 3059 74.T.-;131.AG.CC 0.366894432 0.284573613 872410 3060 -21.C.-;76.G.- 0.366441507 0.282320025 13168637 3061 -1.G.T;75.-.C 0.36622796 0.325690795 442575 3062 -27.C.A;77.-.A 0.365239949 0.148841169 670080 3063 -23.C.A;76.GG.-A 0.365193115 0.229198474 2536818 3064 1.T.C;3.C.- 0.365058878 0.278411465 15239473 3065 -29.A.G;2.A.-;75.-.A 0.364330715 0.307941812 8599361 3066 70.-.T;82.AA.-T 0.364075981 0.203190312 8447558 3067 80.A.-121.C.A 0.363793637 0.189981353 8032400 3068 72.-.C;132.G.C 0.362895096 0.277357076 2591751 3069 0.T.-;2.A.C;33.C.A 0.362710162 0.289879239 8151955 3070 76.G.-;82.A.G 0.361619023 0.2931134 829720 3071 -21.C.A;78.A.- 0.361572174 0.340207762 8633205 3072 66.CT.-G.133.A.C 0.361235295 0.177612583 8367621 3073 86.-.G;131.A.C 0.360882293 0.14994125 8652746 3074 65.GC.-T 0.359676845 0.34117811 8641968 3075 66.CT.-- 0.359510719 0.335128609 8489994 3076 76.-.G;125.T.G 0.359266847 0.243082633 2271196 3077 0.T.-;134.G.T 0.357221231 0.333356566 2684526 3078 0.T.-;2.A.C;132.G.A 0.357103171 0.210774129 6557839 3079 18.C.A;74.-.T 0.356398057 0.194388522 15057882 3080 -29.A.G;0.T.-;2.A.C;74.T.- 0.355573213 0.347677573 14812029 3081 -29.A.C;78.A.G 0.354936599 0.331966329 8565161 3082 75.CG.-T;127.T.G 0.354149416 0.290483884 1042365 3083 -17.C.A;77.GA.-- 0.352230794 0.264271374 1114842 3084 -16.C.A;75.-.C 0.351420163 0.323308043 3011677 3085 1.TA.--;128.T.G 0.349353976 0.272131853 8367521 3086 86.-.G;129.C.A 0.349102113 0.128912924 8545111 3087 75.-.G;82.A.G 0.348846687 0.279265182 13670603 3088 -12.G.T;0.T.-;2.A.C 0.346705159 0.220809539 8152309 3089 76.G.-;80.A.G 0.344879701 0.240148808 14635704 3090 -29.A.C;0.T.-;78.A.- 0.343977628 0.269327054 8101708 3091 75.CGG.-AT 0.343807137 0.263179626 15738145 3092 -32.G.T;76.-.G 0.343373872 0.282940777 14351983 3093 -25.A.C;73.A.- 0.342166961 0.317506007 8066472 3094 74.T.-;127.T.G 0.341452423 0.218881305 8134358 3095 75.-G.CT 0.340668573 0.260397851 8603055 3096 73.A.-;129.C.A 0.339516932 0.284512591 1251152 3097 -15.T.G;82.AA.-T 0.337292843 0.221583879 1005071 3098 -17.C.A;1.TA.-- 0.335312695 0.306486266 8137618 3099 76.G.-;104.C.A 0.335162523 0.190958854 15158102 3100 -29.A.G;72.-.C 0.334668341 0.245386507 8129152 3101 75.-.C;121.C.T 0.334449323 0.186487396 8208002 3102 88.G.-;130.T.G 0.333618091 0.136446113 3581291 3103 2.-.A;72.-.C 0.331079889 0.299960469 1251375 3104 -15.T.G;80.A.- 0.330673201 0.237553781 8128320 3105 75.-.C;127.T.C 0.329450929 0.31539949 8356949 3106 87.-.G;118.T.G 0.328766524 0.276642735 8552259 3107 75.C.-;86.C.- 0.328683252 0.274572035 830221 3108 -21.C.A;74.-.T 0.328073756 0.279164881 2820364 3109 0.T.-;2.A.C;18.C.T 0.328071337 0.303059134 15456319 3110 -30.C.G;76.-.T 0.327788273 0.239917243 8470089 3111 78.-.C;126.C.A 0.327502065 0.285083789 8161135 3112 79.G.-;133.A.C 0.327120166 0.249238373 8481813 3113 78.A.-;119.C.T 0.326577601 0.263148897 2684845 3114 0.T.-;2.A.C;126.C.T 0.326497023 0.268527975 8128793 3115 75.-.C;126.C.T 0.325657328 0.244960408 15405296 3116 -30.C.G;0.T.- 0.324922115 0.303112615 8595845 3117 70.-.T;129.C.A 0.323993445 0.292377507 8105737 3118 76.GG.-A;131.A.C;133.A.C 0.323238212 0.214800697 8470189 3119 78.-.C;129.C.A 0.323151711 0.297959942 14245594 3120 -24.G.T;80.A.- 0.323015835 0.259376759 1251224 3121 -15.T.G;81.GA.-T 0.322672044 0.236717429 7939926 3122 65.G.-;76.G.- 0.321874555 0.229114823 8648998 3123 65.G.T;76.G.- 0.32161445 0.165407591 14098317 3124 -20.A.C;2.A.- 0.321338341 0.261130203 8032447 3125 72.-.C;131.A.C 0.320310642 0.25131762 8061102 3126 74.T.-;76.G.C 0.320134619 0.17974794 8481588 3127 78.A.-;120.C.T 0.31991061 0.266621576 8565286 3128 75.CG.-T;130.T.C 0.319658388 0.299836722 14245896 3129 -24.G.T;76.-.G 0.318978655 0.198135025 8066445 3130 74.T.-;127.T.C 0.318741324 0.229575007 8150200 3131 77.-.A;129.C.A 0.318392177 0.222652224 8479230 3132 78.A.-;118.T.G 0.315585221 0.212655987 8482576 3133 78.A.-;113.A.C 0.313923006 0.235801574 2271423 3134 0.T.-;123.A.C 0.313151728 0.262740752 13907909 3135 -14.A.G;0.T.-;2.A.C 0.312602248 0.24235172 8066743 3136 74.T.-;131.A.C;133.A.C 0.311512836 0.213517827 8352697 3137 86.C.-;128.T.G 0.31093017 0.185786592 301021 3138 -28.G.C;0.T.-;2.A.C 0.308009842 0.177963593 8480313 3139 78.A.-;125.T.G 0.307352894 0.265386782 8136771 3140 76.G.-;87.C.A 0.305748033 0.204149437 8019966 3141 72.-.A;82.A.- 0.305426544 0.276125022 8632613 3142 66.CT.-G;121.C.A 0.305245351 0.18051425 8583599 3143 73.AT.-G;88.G.- 0.305036767 0.281668863 8475891 3144 78.A.-;88.G.- 0.304225711 0.24315761 8567785 3145 75.C.T;77.-.A 0.303944466 0.161149893 8448066 3146 80.A.-;129.C.A 0.303325704 0.215444753 8136691 3147 76.G.-;86.C.A 0.302433752 0.195854751 15059855 3148 -29.A.G;0.T.-;2.A.C;66.CT.-G 0.301250125 0.258032296 13171297 3149 -1.G.T;76.-.G 0.300469679 0.249568302 8470230 3150 78.-.C;130.T.G 0.299543757 0.27947901 8142877 3151 76.G.-;134.G.C 0.29949224 0.197954128 555214 3152 -26.T.C;76.G.- 0.29846809 0.182034813 446048 3153 -27.C.A;80.A.- 0.298324534 0.210212488

    TABLE-US-00038 TABLE 26 index SEQ ID NO muts_1indexed MI 95% CI 8436528 3154 81.GA.-T;121.C.A 0.297090048 0.283427352 8353141 3155 86.C.-;122.A.C 0.296049987 0.245918877 8565426 3156 75.CG.-T;131.A.G 0.295840924 0.235610502 8132576 3157 75.-.C;89.-.C 0.295816698 0.21575762 8092121 3158 75.-.A;116.T.G 0.295438612 0.276704748 8633166 3159 66.CT.-G;132.G.C 0.295238555 0.137541162 8142165 3160 76.G.-;124.T.C 0.294668253 0.252511967 2686290 3161 0.T.-;2.A.C;114.G.T 0.294611939 0.235882425 8161038 3162 79.G.-;129.C.A 0.293458957 0.265995213 13853578 3163 -14.A.C;76.-.T 0.292814241 0.239208093 807836 3164 -21.C.A;1.TA.-- 0.291985874 0.265062731 8469754 3165 78.-.C;119.C.A 0.290688734 0.158231713 8137474 3166 76.G.-;101.C.A 0.290545033 0.225586567 8160587 3167 79.G.-;120.C.A 0.290485378 0.16140082 8142955 3168 76.G.-;131.AGA.CCC 0.289861064 0.156100467 8762708 3169 56.G.T;75.-.G 0.288589286 0.245071065 14635887 3170 0.T.-;-29.A.C;75.-.G 0.287655949 0.220550516 15455571 3171 -30.C.G;78.-.C 0.286554251 0.151262545 8066265 3172 74.T.-;124.T.G 0.284557684 0.18450021 8436842 3173 81.GA.-T;130.T.G 0.283443437 0.227668014 13846354 3174 -14.A.C;79.G.- 0.282193081 0.194513828 8490993 3175 76.-.G;121.C.T 0.281487779 0.237968585 14646258 3176 -29.A.C;0.T.-;2.A.C;87.-.T 0.281390861 0.280842128 8431378 3177 82.AA.-T;120.C.A 0.279359971 0.217352128 8431703 3178 82.AA.-T;126.C.A 0.278958399 0.248775754 447910 3179 -27.C.A;73.AT.-G 0.27887466 0.214623934 8066683 3180 74.T.-;130.--T.TAG;133.A.G 0.278590377 0.236479801 2760011 3181 0.T.-;2.A.C;58.G.T 0.27816451 0.250084418 3012063 3182 1.TA.--;123.A.C 0.277695499 0.270902767 13855018 3183 -14.A.C;73.A.- 0.277345113 0.240410092 8447252 3184 80.A.-;119.C.A 0.276750412 0.261342977 8489127 3185 76.-.G;118.T.G 0.275614164 0.268649953 8526408 3186 76.-.T;126.C.A 0.275422119 0.186856595 8446211 3187 80.A.-;115.T.G 0.273001999 0.176712389 8431937 3188 82.AA.-T;133.A.C 0.272461593 0.215640473 6558231 3189 18.C.A;73.A.- 0.270722227 0.209417884 8159873 3190 79.G.-;115.T.G 0.270544898 0.219973209 8602463 3191 73.A.-;119.C.A 0.267631124 0.229610693 2684642 3192 0.T.-;2.A.C;131.AGA.CCC 0.267606676 0.193922958 8143095 3193 76.G.-;126.C.G 0.26607975 0.205850153 1042210 3194 -17.C.A;79.G.- 0.263898352 0.153341127 15452123 3195 -30.C.G;88.G- 0.262802964 0.246339122 13852053 3196 -14.A.C;80.A.- 0.262449421 0.238482785 8435985 3197 81.GA.-T;115.T.G 0.261537752 0.210117266 223220 3198 -30.C.A;76.G.- 0.260927881 0.212705604 12148242 3199 2.A.-;124.T.C 0.259970416 0.231655778 8602984 3200 73.A.-;127.T.G 0.259333216 0.17429791 318643 3201 -28.G.C;75.-.C 0.258711926 0.253858239 15451555 3202 -30.C.G;79.G.- 0.258610617 0.228040833 8436802 3203 81.GA.-T;129.C.A 0.258102815 0.221392597 8512529 3204 76.G.-;78.A.T;131.A.C 0.256573774 0.192299447 8519060 3205 76.GG.-T;124.T.G 0.254764495 0.17776839 1045581 3206 -17.C.A;78.-.C 0.254111585 0.16098974 13844608 3207 -14.A.C;74.T.- 0.251536336 0.230596398 13171509 3208 -1.G.T;76.GG.-T 0.251215355 0.178972378 8336250 3209 89.-.C;121.C.A 0.247903737 0.177200161 15455277 3210 -30.C.G;80.A.- 0.24643105 0.215568133 8353027 3211 86.C.-;123.A.C 0.245734783 0.146234159 8161013 3212 79.G.-;128.T.G 0.245117825 0.184156133 8105760 3213 76.GG.-A;129.C.G 0.243519956 0.200992141 8558713 3214 74.-.T;123.A.C 0.243362245 0.217508129 2681904 3215 0.T.-;2.A.C;116.T.C 0.243150168 0.227835889 8558310 3216 74.-.T;127.T.C 0.238872167 0.164543464 2684449 3217 0.T-;2.A.C;130.T.C;132.G.C 0.234640315 0.191407277 15052207 3218 -29.A.G;0.T.-;75.-.G 0.232527238 0.228978007 8524468 3219 76.G.T;78.A.- 0.231822737 0.184427214 7490514 3220 36.C.A;76.GG.-A 0.230612085 0.201072386 8633217 3221 66.CT.-G;132.G.T 0.225041391 0.188349309 8069615 3222 74.T.-;89.-.C 0.224219112 0.182205253 15451403 3223 -30.C.G;77.-.A 0.22377016 0.141786542 8520167 3224 76.GG.-T;119.C.T 0.222213862 0.181552856 10994911 3225 8.G.T;76.G.- 0.221857972 0.186488557 2272784 3226 0.T.-;113.A.G 0.217602613 0.188068889 8100983 3227 75.C.A;87.-.G 0.20946824 0.207400395 13851721 3228 -14.A.C;82.AA.-T 0.208699774 0.190610953 8084086 3229 74.-.G;130.T.C 0.207083817 0.200301272 8564034 3230 75.CG.-T;116.T.G 0.206201826 0.195294871 1117838 3231 -16.C.A;75.CG.-T 0.205361121 0.20010844 14023671 3232 -19.G.T;76.GG.-T 0.205124123 0.18913669 8519544 3233 76.GG.-T;131.A.C;133.A.C 0.201318374 0.159186928 8633185 3234 66.CT.-G 0.199632516 0.137407357 14817545 3235 -29.A.C;66.CT.-G 0.199449017 0.147317397 1482006 3236 -9.T.C;76.G.- 0.199005805 0.183058025 14524849 3237 -28.G.T;75.-.C 0.198371675 0.181096792 8470132 3238 78.-.C;127.T.G 0.197187102 0.191993677 7738954 3239 51.C.A;76.G.- 0.188853628 0.174711687 1247296 3240 -15.T.G;79.G.- 0.188770966 0.162582829 8519864 3241 76.GG.-T;122.A.G 0.187827314 0.124500437 1117512 3242 -16.C.A;76.GG.-T 0.185440387 0.166113954 15171788 3243 -29.A.G;66.CT.-G 0.184297092 0.119128778 8601732 3244 73.A.-;115.T.G 0.182910648 0.17442519 6556220 3245 18.C.A;86.C.- 0.182226427 0.124165253 8633071 3246 66.CT.-G;129.C.A 0.174547902 0.164343167 8499488 3247 78.A.-;80.A.G 0.170717115 0.165935562 8519321 3248 76.GG.-T;128.T.C 0.169470546 0.133277047 14348190 3249 -25.A.C;86.C.- 0.164802634 0.107431366 321013 3250 -28.G.C;74.-.T 0.163668333 0.162660862

    [0341] Approximately 140 modified gRNAs were generated, some by DME and some by targeted engineering, and assayed for their ability to disrupt expression of a target GFP reporter construct by creation of indels. Sequences for these gRNA variants are shown in Table 3. These modified gRNAs exclude modifications to the spacer region, and instead comprise different modified scaffolds (the portion of the sgRNA that interacts with the CRISPR protein, protein binding segment). gRNA scaffolds generated by DME include one or more deletions, substitutions, and insertions, which can consist of a single or several bases. The remaining gRNA variants were rationally engineered based on knowledge of thermostable RNA structures, and are either terminal fusions of ribozymes or insertions of highly stable stem loop sequences. Additional gRNAs were generated by combining gRNA variants. The results for select gRNA variants are shown in Table 27 below.

    TABLE-US-00039 TABLE 27 Ability of select gRNA variants to disrupt GFP expression. Normalized Editing SEQ ID Activity (ave, NO: NAME (Description) 2 spacers n = 6) Std. dev. 5 X2 reference — — 2101 phage replication stable 1.42 0.22 2102 Kissing loop_b1 1.17 0.11 2103 Kissing loop_a 1.18 0.03 2104 32, uysX hairpin 1.89 0.11 2105 PP7 1.08 0.04 2106 64, trip mut, extended stem truncation 1.69 0.18 2107 hyperstable tetraloop 1.36 0.11 2108 C18G 1.22 0.42 2109 T17G 1.27 0.04 2110 CUUCGG loop 1.24 0.22 2111 MS2 1.12 0.25 2112 −1, A2G, −78, G77T 1.00 0.18 2113 QB 1.44 0.25 2114 45, 44 hairpin 0.24 0.41 2115 U1A 1.02 0.05 2116 A14C, T17G 0.86 0.01 2117 CUUCGG loop modified 0.75 0.04 2118 Kissing loop_b2 0.99 0.06 2119 −76:78, −83:87 0.97 0.01 2120 −4 0.93 0.03 2121 extended stem truncation 0.73 0.02 2124 −98:100 0.66 0.05 2125 −1:5 0.45 0.05 2126 −2163 0.57 0.02 2127 =+G28, A82T, −84, 0.56 0.04 2128 =+51T 0.52 0.03 2129 −1:4, +G5A, +G86, 0.09 0.21 2130 2174 0.34 0.09 2131 +g72 0.34 0.24 2132 shorten front, CUUCGG loop 0.65 0.02 modified. extend extended 2133 A14C 0.37 0.03 2134 −1:3, +G3 0.45 0.16 2135 =+C45, +T46 0.42 0.04 2136 CUUCGG loop modified, fun start 0.38 0.03 2137 −74:75 0.18 0.04 2138 {circumflex over ( )}T45 0.21 0.05 2139 −69, −94 0.24 0.09 2140 −94 0.01 0.01 2141 modified CUUCGG, minus T in 1st triplex 0.04 0.03 2142 −1:4, +C4, A14C, T17G, +G72, −76:78, −83:87 0.16 0.03 2143 T1C, −73 0.06 0.06 2144 Scaffold uuCG, stem uuCG. Stem swap, t shorten 0.01 0.09 2145 Scaffold uuCG, stem uuCG. Stem swap 0.04 0.03 2146 0.0090408 0.06 0.04 2147 no stem Scaffold uuCG −0.11 0.02 2148 no stem Scaffold uuCG, fun start −0.06 0.02 2149 Scaffold uuCG, stem uuCG, fun start −0.02 0.02 2150 Pseudoknots −0.01 0.01 2151 Scaffold uuCG, stem uuCG −0.05 0.01 2152 Scaffold uuCG, stem uuCG, no start −0.04 0.02 2153 Scaffold uuCG −0.12 0.07 2154 +GCTC36 −0.20 0.05 2155 G quadriplex telomere basket + ends −0.21 0.02 2156 G quadriplex M3q −0.25 0.04 2157 G quadriplex telomere basket no ends −0.17 0.04 2159 Sarcin-ricin loop 0.40 0.03 2160 uvsX, C18G 1.94 0.06 2161 truncated stem loop, C18G, trip mut (T10C) 1.97 0.16 2162 short phage rep, C18G 1.91 0.17 2163 phage rep loop, C18G 1.72 0.13 2164 +G18, stacked onto 64 1.44 0.08 2165 truncated stem loop, C18G, −1 A2G 1.63 0.40 2166 phage rep loop, C18G, trip mut (T10C) 1.76 0.12 2167 short phage rep, C18G, trip mut (T10C) 1.20 0.09 2168 uvsX, trip mut (T10C) 1.54 0.12 2169 truncated stem loop 1.50 0.10 2170 +A17, stacked onto 64 1.54 0.13 2171 3′ HDV genomic ribozyme 1.13 0.13 2172 phage rep loop, trip mut (T10C) 1.39 0.10 2173 −79:80 1.33 0.05 2174 short phage rep, trip mut (T10C) 1.19 0.10 2175 extra truncated stem loop 1.08 0.05 2176 T17G, C18G 0.94 0.09 2177 short phage rep 1.11 0.05 2178 uvsX, C18G, −1 A2G 0.62 0.08 2179 uvsX, C18G, trip mut (T10C), −1 A2G, 1.06 0.08 HDV −99 G65U 2180 3′ HDV antigenomic ribozyme 1.20 0.07 2181 uvsX, C18G, trip mut (T10C), −1 A2G, 0.95 0.03 HDV AA(98:99)C 2182 3′ HDV ribozyme (Lior Nissim, Timothy Lu) 1.08 0.01 2183 TAC(1:3)GA, stacked onto 64 0.92 0.04 2184 uvsX, −1 A2G 1.46 0.13 2185 truncated stem loop, C18G, trip mut (T10C), 0.80 0.02 −1 A2G, HDV −99 G65U 2186 short phage rep, C18G, trip mut (T10C), 0.80 0.05 −1 A2G, HDV −99 G65U 2187 3′ sTRSV WT viral Hammerhead ribozyme 0.98 0.03 2188 short phage rep, C18G, −1 A2G 1.78 0.18 2189 short phage rep, C18G, trip mut (T10C), 0.81 0.08 −1 A2G, 3′ genomic HDV 2190 phage rep loop, C18G, trip mut (T10C), 0.86 0.07 −1 A2G, HDV −99 G65U 2191 3′ HDV ribozyme (Owen Ryan, Jamie Cate) 0.78 0.04 2192 phage rep loop, C18G, −1 A2G 0.70 0.08 2193 {circumflex over ( )}C55 0.78 0.03 2194 −78, G77T 0.73 0.07 2195 {circumflex over ( )}G1 0.73 0.10 2196 short phage rep, −1 A2G 0.66 0.11 2197 truncated stem loop, C18G, trip mut (T10C), 0.68 0.09 −1 A2G 2198 −1, A2G 0.54 0.07 2199 truncated stem loop, trip mut (T10C), −1 A2G 0.40 0.03 2200 uvsX, C18G, trip mut (T10C), −1 A2G 0.35 0.11 2201 phage rep loop, −1 A2G 0.96 0.05 2202 phage rep loop, trip mut (T10C), −1 A2G 0.49 0.06 2203 phage rep loop, C18G, trip mut (T10C), −1 A2G 0.73 0.13 2204 truncated stem loop, C18G 0.59 0.02 2205 uvsX, trip mut (T10C), −1 A2G 0.56 0.08 2206 truncated stem loop, −1 A2G 0.89 0.07 2207 short phage rep, trip mut (T10C), −1 A2G 0.37 0.12 2208 5′HDV ribozyme (Owen Ryan, Jamie Cate) 0.39 0.03 2209 5′HDV genomic ribozyme 0.35 0.06 2210 truncated stem loop, C18G, trip mut (T10C), 0.24 0.04 −1 A2G, HDV AA(98:99)C 2211 5′env25 pistol ribozyme (with an added 0.33 0.07 CUUCGG loop) 2212 5′HDV antigenomic ribozyme 0.17 0.01 2213 3′ Hammerhead ribozyme (Lior Nissim, 0.09 0.02 Timothy Lu) guide scaffold scar 2214 +A27, stacked onto 64 0.03 0.03 2215 5′Hammerhead ribozyme (Lior Nissim, 0.18 0.03 Timothy Lu) smaller scar 2216 phage rep loop, C18G, trip mut (T10), 0.13 0.04 −1 A2G, HDV AA(98:99)C 2217 −27, stacked onto 64 0.00 0.03 2218 3′ Hatchet 0.09 0.01 2219 3′ Hammerhead ribozyme (Lior Nissim, 0.05 0.03 Timothy Lu) 2220 5′Hatchet 0.04 0.03 2221 5′HDV ribozyme (Lior Nissim, Timothy Lu) 0.08 0.01 2222 5′Hammerhead ribozyme (Lior Nissim, 0.22 0.01 Timothy Lu) 2223 3′ HH15 Minimal Hammerhead ribozyme 0.01 0.01 2224 5′ RBMX recruiting motif −0.08 0.03 2225 3′ Hammerhead ribozyme (Lior Nissim, −0.04 0.02 Timothy Lu) smaller scar 2226 3′ env25 pistol ribozyme (with an added −0.01 0.01 CUUCGG loop) 2227 3′ Env-9 Twister −0.17 0.02 2228 +ATTATCTCATTACT25 −0.18 0.27 2229 5′Env-9 Twister −0.02 0.01 2230 3′ Twisted Sister 1 −0.27 0.02 2231 no stem −0.15 0.03 2232 5′HH15 Minimal Hammerhead ribozyme −0.18 0.04 2233 5′Hammerhead ribozyme (Lior Nissim, −0.14 0.01 Timothy Lu) guide scaffold scar 2234 5′Twisted Sister 1 −0.14 0.04 2235 5′sTRSV WT viral Hammerhead ribozyme −0.15 0.02 2236 148, =+G55, stacked onto 64 3.40 0.18 2239 175, trip mut, extended stem truncation, 1.18 0.09 with [T] deletion at 5′ end

    [0342] Although guide stability can be measured thermodynamically (for example, by analyzing melting temperatures) or kinetically (for example, using optical tweezers to measure folding strength), without wishing to be bound by any theory it is believed that a more stable sgRNA bolsters CRISPR editing efficiency. Thus, editing efficiency was used as the primary assay for improved guide function.

    [0343] The activity of the gRNA scaffold variants was assayed using E6 and E7 spacers targeting GFP. The starting sgRNA scaffold in this case was a reference Planctomyces CasX tracr RNA fused to a Planctomyces Crispr RNA (crRNA) using a “GAAA” stem loop (SEQ ID NO: 5). The activity of variant gRNAs shown in Table 27 was normalized to the activity of this starting, or base, sgRNA scaffold.

    [0344] The sgRNA scaffold was cloned into a small (less than 3 kilobase pair) plasmid with a 3′ type II restriction enzyme site for dropping in different spacers. The spacer region of the sgRNA is the part of the sgRNA interacts with the target DNA, and does not interact directly with the CasX protein. Thus, scaffold changes should be spacer independent. One way to achieve this is by executing sgRNA DME and testing sgRNA variants using several distinct spacers, such as the E6 and E7 spacers targeting GFP. This reduces the possibility of creating an sgRNA scaffold variant that works well with one spacer sequence targeting one genetic target, but not other spacer sequences directed to other targets. For the data shown in Table 27, the E6 and E7 spacer sequences targeting GFP were used. Repression of GFP expression by sgRNA variants was normalized to GFP repression by the sgRNA starting scaffold of SEQ ID NO: 5 assayed with the same spacer sequence(s).

    [0345] Activity of select sgRNA variants is shown in FIGS. 5A and 5B, mean change in activity is shown in Table 27, and sgRNA variant sequences are provided in Table 3. sgRNA variants with increased activity were tested in HEK293 cells as described in Example 1.

    Example 4: Mutagenesis of CasX Protein Produces Improved Variants

    [0346] A selectable, mammalian-expression plasmid was constructed that included a reference, also referred to herein as starting or base, CasX protein sequence, an sgRNA scaffold, and a destination sequence that can be replaced by spacer sequences. In this case, the starting CasX protein was SEQ ID NO: 2, the wild type Planctomycetes CasX sequence and the scaffold was the wild type sgRNA scaffold of SEQ ID NO: 5. This destination plasmid was digested using the appropriate restriction enzyme following manufacturer's protocol. Following digestion, the digested DNA was purified using column purification according to manufacturer's protocol. The E6 and E7 spacer oligos targeting GFP were annealed in 10 uL of annealing buffer. The annealed oligos were ligated to the purified digested backbone using a Golden Gate ligation reaction. The Golden Gate ligation product was transformed into chemically competent bacterial cells and plated onto LB agar plates with the appropriate antibiotic. Individual colonies were picked, and the GFP spacer insertion was verified via Sanger sequencing.

    [0347] The following methods were used to construct a DME library of CasX variant proteins. The functional Plm CasX system, which is a 978 residue multi-domain protein (SEQ ID NO: 2) can function in a complex with a 108 bp sgRNA scaffold (SEQ ID NO: 5), with an additional 3′ 20 bp variable spacer sequence, which confers DNA binding specificity. Construction of the comprehensive mutation library thus required two methods: one for the protein, and one for the sgRNA. Plasmid recombineering was used to construct a DME protein library of CasX variant proteins. PCR-based mutagenesis was used to construct an RNA library of the sgRNA. Importantly, the DME approach can make use of a variety of molecular biology techniques. The techniques used for genetic library construction can be variable, while the design and scope of mutations encompasses the DME method.

    [0348] In designing DME mutations for the reference CasX protein, synthetic oligonucleotides were constructed as follows: for each codon, three types of oligonucleotides were synthesized. First, the substitution oligonucleotide replaced the three nucleotides of the codon with one of 19 possible alternative codons which code for the 19 possible amino acid mutations. 30 base pair flanking regions of perfect homology to the target gene allow programmable targeting of these mutations. Second, a similar set of 20 synthetic oligonucleotides encoded the insertion of single amino acids. Here, rather than replace the codon, a new region consisting of three base pairs was inserted between the codon and the flanking homology region. Twenty different sets of three nucleotides were inserted, corresponding to new codons for each of the twenty amino acids. Larger insertions can be built identically but will contain an additional three, six, or nine base pairs, encoding all possible combinations of two, three, or four amino acids. Third, an oligonucleotide was designed to remove the three base pairs comprising the codon, thus deleting the amino acid. As above, oligonucleotides can be designed to delete one, two, three, or four amino acids. Plasmid recombineering was then used to recombine these synthetic mutations into a target gene of interest, however other molecular biology methods can be used in its place to accomplish the same goal.

    [0349] Table 28 shows fold enrichment of CasX variant protein DME libraries created from the reference protein of SEQ ID NO: 2, which were then subjected to DME selection/screening processes.

    [0350] In Table 28 below, the read counts associated with each of the listed variants was determined. Each variant was defined by its position (0-indexed), reference base, and alternate base. Only sequences with at least 10 reads (summed) across samples were analyzed, to filter from 457K variants to 60K variants. An insertion at position i indicates an inserted base between position i-1 and i (i.e., before the indicated position). ‘counts’ indicates the sequencing-depth normalized read count per sequence per sample. Technical replicates were combined by taking the geometric mean. ‘log2enrichment’ gives the median enrichment (using a pseudocount of 10) across each context, or across all samples, after merging for technical replicates. Each context was normalized by its own naive sample. Finally, the ‘log2enrichment_err’ gives the ‘confidence interval’ on the mean log2 enrichment. It is the std. deviation of the enrichment across samples *2/sqrt of the number of samples. Below, only the sequences with median log2enrichment−log2enrichment_err>0 are shown (60274 sequences examined).

    [0351] The computational protocol used to generate Table 28 was as follows: each sample library was sequenced on an Illumina HiSeq for 150 cycles paired end (300 cycles total). Reads were trimmed to remove adapter sequences, and aligned to a reference sequence. Reads were filtered if they did not align to the reference, or if the expected number of errors per read was high, given the phred base quality scores. Reads that aligned to the reference sequence, but did not match exactly, were assessed for the protein mutation that gave rise to the mismatch, by aligning the encoded protein sequence of the read to the protein sequence of the reference at the aligned location. Any consecutive variants were grouped into one variant that extended multiple residues. The number of reads that support any given variant was determined for each sample. This raw variant read count per sample was normalized by the total number of reads per sample (after filtering for low expected number of errors per read, given the phred quality scores) to account for different sequencing depths. Technical replicates were combined by finding the geometric mean of variant normalized read count (shown below, ‘counts’). Enrichment was calculated for each sample by diving by the naive read count (with the same context—i.e. D2, D3, DDD). To down weight the enrichment associated with low read count, a pseudocount of 10 was added to the numerator and denominator during the enrichment calculation. The enrichment for each context is the median across the individual gates, and the enrichment overall is the median enrichment across the gates and contexts. Enrichment error is the standard deviation of the log2 enrichment values, divided by the sqrt of the number of values per variant, multiplied by 2 to make a 95% confidence interval on the mean.

    [0352] Heat maps of DME variant enrichment for each position of the CasX reference protein are shown in FIGS. 7A-7I and FIGS. 8A-8C. Fold enrichment of DME variants with single substitutions, insertions and deletions of each amino acid of the reference CasX protein of SEQ ID NO: 2 are shown. FIGS. 7A-7I and Table 28 summarize the results when the DME experiment was run at 37° C. FIGS. 8A-8C summarize the results when the same experiment was run at 45° C. A comparison of the data in FIGS. 7A-7I and FIGS. 8A-8C shows that running the same assay at two temperatures enriches for different variants. A comparison of the two temperatures thus indicates which amino acid residues and changes are important for thermostability and folding, and can be targeted to produce CasX variant proteins with improved thermostability and folding. FIG. 9 shows a survey of the comprehensive mutational landscape of all single mutations of the reference CasX protein of SEQ ID NO: 2.

    TABLE-US-00040 TABLE 28 Fold enrichment of CasX DME variants. Pos. Ref. Alt. Med. Enrich. 95% CI Pos. Ref. Alt. Med. Enrich. 95% CI 11 R N 3.123689614 1.666090155 877 V D 1.738762289 0.688664606 13 -- AS 2.772897791 0.812692873 459 K W 1.696823829 0.67904004 13 -- AG 2.740825108 1.138556052 891 E K 1.6928634 0.819015932 12 - V 2.739405927 1.743064315 9 - T 1.667698181 0.626564384 13 -- TS 2.69239793 1.005397595 19 - R 1.664532235 0.885325268 12 - Y 2.676525308 1.621386271 11 R P 1.655382042 1.234907956 754 FE LA 2.638126094 0.709679147 793 - L 1.585086754 0.91714318 13 - L 2.63160466 1.131924801 931 S L 1.583295371 0.643295534 14 V S 2.616515776 1.515637887 12 -- AG 1.580094246 1.037517499 877 V G 2.558943878 1.132565008 770 M P 1.577648056 1.061356917 21 - D 2.295527175 0.893253582 791 L E 1.551380949 0.823309399 12 -- PG 2.222956581 1.243693989 21 - A 1.542633652 0.760237264 824 V M 2.181465681 1.137291381 814 F H 1.510927821 0.672796928 12 - Q 2.102167857 1.396704669 12 - C 1.506305374 0.730799624 13 L E 2.049540302 0.886997965 791 L S 1.505731571 0.598349327 12 R A 2.046419725 1.229773759 792 -- AS 1.474378912 0.833339427 889 S K 2.030682939 0.721857305 12 - L 1.46896091 0.783746198 791 - Q 1.996189679 0.799796529 795 T - 1.465811841 0.744738295 21 - S 1.907167641 0.736834562 792 - Q 1.462809015 0.586506727 14 - A 1.89090961 1.25865759 11 R S 1.459875087 0.740946571 11 R M 1.88125645 0.779897343 11 R T 1.450818176 0.908088492 856 Y R 1.83253552 0.74976479 738 A V 1.397545277 0.638310372 707 A Q 1.830052571 0.555234229 791 - Y 1.382702158 0.877495368 16 - D 1.826796594 1.168291076 384 E P 1.36783963 0.775382596 17 S G 1.799890039 0.536675637 793 -- ST 1.351743597 0.608183464 931 S M 1.798321904 1.171026479 738 A T 1.349932545 0.581386051 13 L V 1.782912682 0.513630591 781 W Q 1.342276465 0.719454459 11 -- AS 1.782444935 0.75642805 17 - G 1.340746587 0.878053267 856 Y K 1.748619552 0.651026121 12 -- AS 1.333635165 1.19716917 796 -- AS 1.742437726 0.859039085 771 A Y 1.292995852 0.871463205 792 - E 1.290525566 1.195462062 979 L-E[stop] VSSK (SEQ 1.125229136 0.372301096 ID NO: 3797) 921 A M 1.28763891 0.560591034 936 R Q 1.117866436 0.745233062 979 LE[stop]GS- VSSKDL 1.282505495 0.371661154 979 LE[stop]GS- VSSKDLQAS 1.111969193 0.311410682 (SEQ ID NO: PGIK (SEQ ID N (SEQ ID 3804) NO: 3279) NO: 3813) 770 M Q 1.279910431 1.186538897 396 Y Q 1.105278825 0.646150998 16 -- AG 1.271874994 0.55951096 979 LE[stop]GSP VSSKDL 1.104849849 0.260693612 (SEQ ID NO: 3804) 384 E N 1.247124467 0.607911368 353 L F 1.103922948 0.510520582 979 L- VS 1.239823793 0.315337927 979 LE[stop]GS- VSSKDLQA 1.100880851 0.345695892 PG (SEQ ID (SEQ ID NO: NO: 3251) 3810) 979 LE[stop] VSS 1.233215135 0.36262523 697 Y H 1.097977697 0.419010874 658 --D APG 1.220851584 0.979760686 796 -- PG 1.095168865 0.816765224 979 L-E VSS 1.21568584 0.37106558 4 -- TS 1.088089915 0.693109756 385 E S 1.210243487 0.826999735 10 R K 1.085472062 0.382234839 979 LE[stop]GS- VSSKDLQAS 1.208612972 0.286427519 790 G M 1.066566819 0.686227232 PGIK (SEQ ID NK (SEQ ID NO: NO: 3814) 3279)[stop] 793 -- SA 1.192367811 0.72089465 921 A K 1.056315246 0.70226115 739 R A 1.188987234 0.611670208 696 - R 1.049001055 0.880941583 795 -- AS 1.183930928 0.90542554 9 I L 1.039309233 0.528320595 979 LE[stop]GS-P VSSKDLQ 1.180100725 0.35995062 979 LE[stop]GSPG VSSKDLQAS 1.037884742 0.299531766 (SEQ ID NO: IK (SEQ ID NK (SEQ ID 3809) NO: NO: 3814) 3279)[stop]N 977 V K 1.17977084 0.720108501 13 - S 1.031062599 0.727357338 658 --D AAS 1.173300666 0.50353561 384 E R 1.028117481 0.683537724 14 -- TS 1.173232132 0.700156049 21 K D 1.019445543 0.748518701 10 - V 1.164019233 1.085055677 978 [stop] G 1.016498062 0.514955543 375 E K 1.163948709 0.891802018 979 L-E[stop]G VSSKD (SEQ 1.016126075 0.353515679 ID NO: 3800) 795 -- AG 1.14629929 0.481029275 10 R N 1.010184099 0.846798556 979 LE[stop]GSPG VSSKDLQ 1.143633475 0.340695621 794 -- PG 1.00924007 0.987312969 (SEQ ID NO: (SEQ ID NO: 3251) 3809) 979 LE VS 1.142516835 0.386398408 741 L W 0.851844349 0.594072278 877 V Q 1.141917178 0.655790093 24 - W 0.835220929 0.745009807 791 L Q 1.004388299 0.361910793 755 E [stop] 0.833955657 0.31600491 792 P G 1.002325281 0.805296973 928 I T 0.832425124 0.307759846 877 V C 0.995089773 0.566724231 979 LE[stop]GS- VSSKDLQAS 0.822335062 0.317179456 PGI (SEQ ID (SEQ ID NO: NO: 3278) 3812) 476 C Y 0.984546648 0.686487573 781 W K 0.810589018 0.686153856 19 -- PG 0.984071689 0.738694244 791 L R 0.806201856 0.611654466 979 LE[stop]GSPG VSSKDLQA 0.972011014 0.292930615 979 LE[stop]GSPG VSSKDLQAS 0.80600706 0.220866187 I (SEQ ID NO: (SEQ ID NO: IK (SEQ ID N (SEQ ID 3278) 3810) NO: NO: 3813) 3279)[stop] 752 L P 0.971338521 0.459371253 711 E Q 0.793874739 0.38732268 12 R C 0.969988229 0.745286116 703 T N 0.791134752 0.735228799 12 R Y 0.962112567 0.714384629 793 S - 0.7821232 0.523699668 979 LE[stop]GSPG VSSKDLQAS 0.960035296 0.298173201 385 E K 0.781091846 0.579724424 IK (SEQ ID (SEQ ID NO: NO: 3279) 3812) 18 -- PG 0.952532997 0.782330584 955 R M 0.780963169 0.340474646 778 M I 0.945963409 0.345538178 469 - N 0.775656135 0.541879732 798 S P 0.942103893 0.470224487 788 Y T 0.770125047 0.581859138 16 D G 0.941159649 0.341870864 705 Q R 0.76633283 0.261069709 22 A Q 0.937573643 0.676316271 9 -- TS 0.763723778 0.674640849 754 FE IA 0.935796963 0.660936674 979 LE[stop]GS VSSKD (SEQ 0.761764547 0.205465156 ID NO: 3800) 1 Q K 0.935474248 0.373656765 715 A K 0.761122086 0.540516283 14 V F 0.932689058 0.742246472 384 E K 0.760859162 0.22641046 8 K I 0.928472117 0.521050669 591 QG R- 0.757963418 0.374903235 384 E G 0.920571639 0.452302777 316 R M 0.757086682 0.310302995 732 D T 0.912254061 0.759438627 770 M T 0.753193128 0.319236781 658 D Y 0.894131769 0.312165116 384 E Q 0.752976137 0.602376709 211 L P 0.887315174 0.318877781 17 S E 0.752400908 0.414988963 14 V A 0.885138345 0.699864156 755 E D 0.74863141 0.212934852 979 LE[stop]G V--S 0.884897395 0.252782429 12 R - 0.743504623 0.648509511 13 - F 0.883212774 0.713984249 938 Q E 0.741570425 0.469451701 979 LE[stop]G VSSK (SEQ 0.881127427 0.417135617 657 I V 0.73806027 0.256874713 ID NO: 3797) 386 D K 0.879045429 0.728272074 656 G C 0.659813316 0.293973226 5 R I 0.871114116 0.317513506 4 K N 0.656251908 0.302190904 660 -- AS 0.862493953 0.798632847 774 Q E 0.654737733 0.134116674 877 V M 0.855677916 0.267740831 -1 S C 0.652333059 0.118222939 -1 S T 0.735179004 0.144429929 21 -- AS 0.651563705 0.48650799 2 E [stop] 0.734071396 0.323713248 185 L P 0.649897837 0.225081568 384 E A 0.733775595 0.660142332 38 P T 0.648698083 0.350485275 891 E Y 0.733458673 0.465192765 936 R H 0.648045448 0.423309347 643 V F 0.732765961 0.577614171 813 G C 0.644003475 0.310838653 796 - C 0.732364738 0.485790322 786 L M 0.643153738 0.314936636 280 L M 0.731787266 0.258239226 942 K N 0.639528926 0.249553292 695 - K 0.730902961 0.509205112 293 Y H 0.636816244 0.207205991 343 W L 0.725824372 0.292120452 542 F L 0.635949082 0.181128276 3 ------ IKRINK (SEQ 0.721338414 0.470264314 303 W L 0.635588216 0.261903568 ID NO: 3475) 732 D N 0.71945188 0.416870981 979 LE V[stop] 0.635165807 0.329009453 687 --- PTH 0.716433371 0.159856315 578 P H 0.634392073 0.324298942 176 A D 0.71514177 0.206626688 687 -- PT 0.633217575 0.355316701 485 W L 0.713411462 0.238105577 886 K N 0.632562679 0.231080349 22 A D 0.710738042 0.32510753 20 K R 0.632186797 0.237509121 193 L P 0.709349304 0.242633498 248 L P 0.631068881 0.180279623 899 R M 0.707875506 0.298429738 18 N S 0.630660766 0.266585824 886 KG R- 0.706803824 0.286241441 836 M V 0.630065132 0.266534124 796 -- TS 0.697218521 0.492426198 116 K N 0.629540403 0.234219411 329 P H 0.696817542 0.314817482 847 EG GA 0.628295048 0.299740787 273 L P 0.696199602 0.349703999 912 L P 0.627137425 0.187179246 31 L M 0.696080627 0.331245769 92 P H 0.626243107 0.350245614 645 - E 0.692307595 0.590013131 299 Q K 0.623386276 0.302029469 9 I Y 0.689813642 0.667593375 707 A T 0.622086487 0.275515174 9 1 N 0.688953393 0.257809633 669 L M 0.620453868 0.351072046 919 H R 0.688781806 0.363439859 789 E D 0.617920878 0.216264385 687 P H 0.684782236 0.310607479 916 F S 0.617302977 0.309372822 332 P H 0.672484781 0.326219913 55 P li 0.616365993 0.329695842 796 - N 0.672333697 0.64437503 936 R G 0.615282844 0.189389227 421 W L 0.667702097 0.291970479 595 F L 0.615176885 0.154670433 875 E [stop] 0.66617872 0.287006304 0 M 1 0.612039515 0.303853593 378 L K 0.664474618 0.393361359 925 A P 0.581907283 0.186614282 891 E Q 0.663650921 0.312291932 659 R L 0.580864225 0.319384189 926 L M 0.661737644 0.525550321 306 L P 0.578183307 0.210431982 381 L R 0.609889042 0.420808291 676 P Q 0.577757554 0.308473522 945 T A 0.609683347 0.258353939 877 V E 0.57724394 0.294796776 389 K N 0.609647876 0.274048697 19 T A 0.576889973 0.198407278 755 E G 0.607714844 0.078377344 14 V D 0.574902804 0.437270334 559 I M 0.606040482 0.27336203 887 G Q 0.574717855 0.519529758 825 L P 0.604240507 0.192490062 935 L V 0.573813105 0.185021716 733 M T 0.603960776 0.340233556 961 W L 0.573698555 0.253700288 664 P T 0.60370266 0.234348448 23 -- GP 0.572198674 0.570313308 10 R T 0.602483957 0.372156893 541 R L 0.571508027 0.254421711 964 F L 0.60175279 0.17004436 288 E D 0.571482463 0.24542675 911 C S 0.601303891 0.279730674 742 L V 0.570384839 0.3027928 788 Y G 0.600935917 0.580949772 931 S T 0.570369019 0.120673525 447 Q K 0.600543047 0.297568309 623 ------- RRTRQDE 0.569913903 0.141118873 (SEQ ID NO: 3684) 13 L P 0.599989903 0.236688663 27 P H 0.569605452 0.285015385 193 L M 0.599332216 0.309308194 28 M T 0.56885021 0.216863369 114 P H 0.599262194 0.344450733 907 E [stop] 0.567613159 0.345163987 660 G R 0.599221963 0.319640645 577 D Y 0.567493308 0.253952459 894 S T 0.599084973 0.166490359 672 P H 0.566921749 0.31335168 904 P H 0.59783828 0.349499416 669 L P 0.564276636 0.224594167 782 L T 0.595786463 0.513346845 52 E D 0.564250133 0.246311739 944 Q K 0.595243666 0.351818545 46 N T 0.563094073 0.208662987 207 P H 0.595218482 0.277632613 5 R G 0.560139309 0.15069426 151 H N 0.595188624 0.277503327 912 L V 0.559515875 0.111973397 495 A K 0.594637604 0.315764586 40 L M 0.558605774 0.239058063 -1 S P 0.594582952 0.377333364 923 Q [stop] 0.558515774 0.34688202 480 L E 0.594055289 0.432259346 979 L- E[stop]G VSSKE (SEQ 0.557263947 0.22994802 ID NO: 3826) 469 E A 0.594025118 0.30338267 41 R T 0.555902565 0.199937528 11 R G 0.59320688 0.163279008 179 E [stop] 0.555817911 0.245362937 85 W L 0.591691074 0.2708118 344 W L 0.555474112 0.286390208 15 K E 0.587925122 0.149546484 703 T R 0.53396819 0.160757401 755 E K 0.586636571 0.217538569 962 Q E 0.533896042 0.302336405 337 Q R 0.585098232 0.172195554 764 Q H 0.53385913 0.24340782 877 V A 0.584567684 0.258968272 793 S T 0.533306619 0.17379091 793 -- TS 0.583269098 0.45091329 6 I M 0.533192185 0.188523563 670 I R 0.582033902 0.112618756 467 L P 0.533022246 0.179464215 63 R M 0.554978749 0.336590825 244 Q [stop] 0.532045714 0.262393061 1 Q R 0.554755158 0.207724233 8 K N 0.531704561 0.294399975 9 I V 0.554053334 0.219348804 508 F V 0.529042378 0.192146822 914 C [stop] 0.552658801 0.347714953 665 A P 0.529013767 0.174049723 836 M I 0.551813626 0.180327214 46 NL T[stop] 0.529006897 0.272198259 856 Y H 0.549262192 0.369311354 3 I V 0.528916598 0.14506718 620 L M 0.548957556 0.322210662 518 W S 0.528332889 0.199792834 926 L P 0.547714601 0.450095044 792 P A 0.528028079 0.112407207 377 L P 0.546553821 0.20366425 13 L A 0.526728857 0.318983292 920 A S 0.545992524 0.484867291 56 Q K 0.526387006 0.188452852 961 W [stop] 0.544371204 0.244581668 878 N S 0.526073971 0.27887921 746 V G 0.543151726 0.512718498 213 Q E 0.525578421 0.16885346 554 --- RFY 0.542549772 0.20487223 748 Q H 0.525406412 0.200108279 664 P H 0.542466431 0.281534858 15 K N 0.525094369 0.273038164 5 R [stop] 0.541304946 0.166704906 954 K N 0.524763966 0.208680978 803 Q K 0.540975244 0.291121648 835 W L 0.524725836 0.26540236 652 M I 0.540953074 0.217563311 847 E D 0.524019387 0.23897504 326 KG R- 0.540593574 0.402287668 608 L M 0.523890883 0.248052068 789 E [stop] 0.540122225 0.236046287 932 W R 0.523129128 0.299781077 889 S L 0.539927241 0.375365013 21 K N 0.522953217 0.250998038 10 R I 0.539433301 0.326816988 790 G [stop] 0.5229473 0.262740975 725 K N 0.539088606 0.178127049 707 A D 0.522560362 0.214610237 603 L P 0.538897648 0.229282796 954 K V 0.522546614 0.349200627 15 K R 0.538786311 0.154390287 952 T A 0.521534511 0.149679645 541 R G 0.537572295 0.133876643 892 A D 0.521298872 0.228218092 632 L M 0.537440995 0.246129141 847 ------- EGQITYY 0.521149636 0.115331328 (SEQ ID NO: 3388) 665 A S 0.536996011 0.286216687 7 N I 0.521103862 0.202836314 650 K E 0.536939626 0.139863469 917 E K 0.509268127 0.386629094 932 W L 0.536075206 0.314946873 12 R I 0.509210198 0.267908359 684 L M 0.535519584 0.338883641 326 K N 0.508325806 0.277854988 918 T R 0.535067274 0.304580877 802 A W 0.507146644 0.398619961 10 R G 0.534873359 0.3557865 627 Q H 0.506946344 0.17779761 575 F L 0.534865272 0.139851134 705 Q K 0.506601342 0.205329495 737 T G 0.534759369 0.303617666 935 L P 0.505173269 0.279127846 907 E G 0.534688762 0.240107856 636 L P 0.504912592 0.279575261 702 R M 0.520743818 0.247227864 378 L V 0.504856105 0.146721248 901 S G 0.520379757 0.143482219 770 M I 0.502407214 0.148647414 560 N H 0.519240936 0.286066696 302 I T 0.502263164 0.328365742 350 V M 0.518159753 0.277778553 584 P H 0.501836401 0.188263444 535 F L 0.518099748 0.153008763 962 Q H 0.501557133 0.21210836 512 Y H 0.517168474 0.223506594 909 F L 0.501216251 0.397907118 278 1 M 0.516794992 0.238648894 522 G C 0.50035512 0.232143601 746 V A 0.51672383 0.202625874 233 M I 0.500272986 0.246898577 664 P R 0.516702968 0.252959416 284 P R 0.499965267 0.18413971 -1 S A 0.516689693 0.142459137 639 E D 0.499845638 0.16815712 298 A D 0.51645727 0.257163483 351 K E 0.49917291 0.274793088 361 G C 0.515521808 0.242033529 12 R S 0.498984129 0.193129295 424 1 V 0.515355817 0.185117148 920 A V 0.498509984 0.394258252 907 E D 0.514835248 0.277377403 709 E [stop] 0.498173203 0.222297538 923 Q E 0.514826301 0.324456465 443 S H 0.498010803 0.445232627 413 W L 0.514728329 0.241932097 27 P L 0.497724007 0.373177387 748 Q R 0.514571576 0.240563892 849 Q K 0.497661989 0.259123161 591 Q H 0.514415886 0.331792035 793 - Q 0.497102388 0.47673495 1 Q E 0.514404075 0.263908964 750 A G 0.496799617 0.243940432 171 P T 0.513803013 0.237477165 26 G C 0.496365725 0.228107532 544 K R 0.512919851 0.163480182 706 A D 0.494947511 0.225683587 677 ------- LSRFKD 0.511837147 0.194279796 431 L P 0.494543065 0.192514906 (SEQ ID NO: 3577) 377 L M 0.511718619 0.274965484 13 LV AS 0.494489513 0.367074627 1 Q H 0.511496323 0.29357307 0 M V 0.49405414 0.206071479 202 R M 0.511365875 0.303187834 614 R I 0.494053835 0.209299062 422 E [stop] 0.511043687 0.224103239 248 L M 0.49299868 0.24880607 922 E [stop] 0.510570886 0.450135707 81 L M 0.492127571 0.369172442 407 ------- KKHGED 0.510425363 0.211479415 (SEQ ID NO: 3500) 8 K A 0.510125467 0.417426274 921 D Y 0.479522102 0.330930172 300 I M 0.510084254 0.178542003 17 S R 0.479410291 0.242870401 668 A P 0.509985424 0.202934866 23 G C 0.47738757 0.286426817 418 - D 0.49144742 0.21486801 892 A G 0.477302415 0.253000116 914 C R 0.490784001 0.353820866 832 A T 0.47606534 0.23451824 3 I S 0.490305334 0.219289736 421 W [stop] 0.475666945 0.216973062 781 W L 0.490256264 0.225567162 316 R S 0.47464939 0.264534919 234 G [stop] 0.489800943 0.231905474 681 K N 0.474468269 0.192816933 369 A V 0.489746571 0.142680124 22 A V 0.474221933 0.206217506 685 G C 0.48966455 0.174412352 691 L M 0.473867575 0.189071763 498 A S 0.489397172 0.173872708 95 L V 0.473859579 0.188485586 746 V D 0.488692506 0.484120982 827 K N 0.47365473 0.198868181 666 -- AG 0.488446913 0.383322789 858 R M 0.473407136 0.257236194 309 W L 0.487964134 0.209151088 519 Q P 0.472315609 0.224391717 979 ---- VSSK (SEQ 0.486810051 0.287650542 95 L P 0.471361064 0.162277972 ID NO: 3797) 27 P R 0.486771244 0.185539954 976 A T 0.470889659 0.109031 583 L M 0.486474099 0.232216764 782 L I 0.470558203 0.125178365 760 G R 0.485722591 0.195838563 723 A S 0.469929973 0.218713854 596 I T 0.485474246 0.130718203 24 K R 0.469399175 0.236250784 189 G [stop] 0.484957086 0.271997616 748 Q E 0.46890075 0.291020418 884 W L 0.48469466 0.210361106 686 --- NPT 0.468711675 0.157459195 162 E [stop] 0.484515492 0.270313618 1 Q L 0.468380179 0.341181409 405 L P 0.484058533 0.143471721 466 G V 0.467982153 0.207162352 815 T A 0.483688268 0.140346764 346 --- MVC 0.467747954 0.140593808 875 E D 0.483680843 0.230122106 746 V L 0.467699466 0.162488099 703 T K 0.483561705 0.243688021 101 Q K 0.467562845 0.263058522 35 V A 0.48268809 0.163074127 99 V L 0.467355555 0.098627209 320 K E 0.482629615 0.202594011 354 I M 0.46704321 0.243813968 203 E D 0.482289135 0.173584261 826 E [stop] 0.466802563 0.164892155 202 R S 0.482184999 0.1640178 150 P L 0.466773068 0.200507693 613 G C 0.482001189 0.220237462 476 C R 0.466682009 0.123054893 220 A P 0.481251117 0.159715468 38 P H 0.466309116 0.291701454 920 A G 0.481026982 0.321704418 120 E [stop] 0.465867266 0.21730484 874 E Q 0.480905869 0.250463545 370 G R 0.465477814 0.252126933 192 A G 0.480770514 0.112319124 7 N K 0.465102103 0.221573061 578 P T 0.48002354 0.203348553 920 A P 0.45449471 0.288443793 515 A P 0.480000762 0.142980394 701 Q H 0.453812486 0.146230302 55 P T 0.465075846 0.236340763 891 E [stop] 0.453785945 0.233457013 681 K E 0.464515385 0.142005053 133 C W 0.453639333 0.137405208 781 W C 0.464433122 0.295451154 370 G V 0.453597184 0.202403506 946 N D 0.463522655 0.373105851 548 E D 0.453077345 0.109679349 368 L M 0.463023353 0.266615533 689 H D 0.453055551 0.09160837 0 M T 0.462868938 0.232012879 931 S R 0.45302365 0.382294772 737 T A 0.462760296 0.301960654 133 C [stop] 0.452586533 0.10138833 847 ---- EGQI (SEQ 0.462759431 0.219565444 868 E [stop] 0.452282618 0.301898798 ID NO: 3385) 0 M K 0.462242932 0.245616902 33 V L 0.451975838 0.159872004 711 E [stop] 0.461879161 0.191719959 266 D Y 0.451699485 0.165335876 357 K N 0.461332764 0.184353442 497 E D 0.451539434 0.154482619 434 H D 0.461154018 0.191223379 661 E [stop] 0.45138977 0.234896635 910 V E 0.460870605 0.281013173 897 K N 0.451376493 0.172130787 922 E D 0.460080408 0.286351122 894 S G 0.451201568 0.216541569 480 L D 0.459795711 0.404684507 46 N K 0.450854268 0.293319843 772 E G 0.459510918 0.312503946 42 E [stop] 0.450047213 0.226279727 369 A P 0.459368992 0.154954523 20 K N 0.449773662 0.196721642 148 G C 0.459321913 0.21989387 285 H N 0.44861581 0.243329874 565 E [stop] 0.459284191 0.257970072 47 L V 0.448453393 0.267732388 472 K N 0.458126194 0.217353923 953 D E 0.448187279 0.183598076 19 T K 0.458002489 0.250652905 8 K E 0.447865624 0.173510738 550 F L 0.457885561 0.135416611 255 K N 0.447654062 0.257753112 642 E D 0.457477443 0.18048994 965 Y [stop] 0.447638184 0.206848878 761 F L 0.457399802 0.126293846 381 L V 0.447548148 0.24623578 104 P H 0.457206235 0.205670388 938 Q K 0.44750144 0.297903846 588 G C 0.457151433 0.254991865 719 S C 0.4472033 0.232249869 516 F L 0.456927783 0.127509134 89 Q K 0.447094951 0.222907496 147 K N 0.456444496 0.280029247 735 R L 0.447058488 0.220193339 651 P H 0.456356549 0.186081926 673 E G 0.446968171 0.213951556 2 E D 0.456056175 0.35763481 126 G C 0.446802066 0.204738022 643 V G 0.455368156 0.295796806 919 H D 0.446668628 0.327432207 524 K N 0.45482233 0.143701874 23 G V 0.446595867 0.2102612 18 N K 0.454706199 0.199478283 733 M 1 0.446594817 0.174646778 5 R T 0.45449471 0.277079709 490 R G 0.435740618 0.182925074 310 Q E 0.446297431 0.123674296 789 E G 0.435579914 0.162786893 729 L V 0.445993097 0.433135394 603 -- LE 0.43556049 0.202470667 455 W L 0.445597501 0.281894997 442 R S 0.435504028 0.210966357 215 G V 0.445352945 0.205217458 714 R I 0.435462316 0.200883442 135 P T 0.44528202 0.217449002 8 K R 0.435212211 0.195908908 936 R T 0.445259832 0.32221387 854 N D 0.43513717 0.067943636 519 Q K 0.444720886 0.28933765 335 E [stop] 0.434927464 0.21407853 656 G R 0.444552088 0.279063867 915 G R 0.434895859 0.195491247 613 G R 0.444378039 0.117584873 762 G C 0.434868342 0.215911162 16 D Y 0.44433236 0.241975919 3 I T 0.434607673 0.107252687 5 R K 0.443724261 0.262708705 406 E [stop] 0.434574625 0.271888642 3 I M 0.443191661 0.128675121 710 V A 0.434488312 0.161462791 523 V L 0.443126307 0.088900743 594 E Q 0.434478655 0.199232108 760 G C 0.442544743 0.174174731 601 L M 0.433295669 0.21298138 27 P T 0.442229152 0.271402709 194 --- DFY 0.433205 0.315807396 694 G D 0.441607057 0.430247861 79 A S 0.433187114 0.14702693 695 E D 0.440698297 0.174763691 913 NC FS 0.432811714 0.214195068 96 M I 0.440309501 0.212758418 955 R S 0.432632415 0.15138175 234 G V 0.44028737 0.19450919 793 ------ SKTYL (SEQ 0.432421193 0.207758327 ID NO: 3715) 385 E D 0.440128169 0.19408182 171 P H 0.432364213 0.194710101 744 Y H 0.439198298 0.25211241 560 N S 0.432346515 0.239882019 519 Q H 0.438343378 0.164581049 370 --- GYK 0.432297106 0.219290605 385 E [stop] 0.438258279 0.212771705 321 P Q 0.432271564 0.211438092 793 S R 0.438010456 0.160112082 979 LE[stop]GS- VSSKDLRA 0.432126183 0.250028634 PG (SEQ ID (SEQ ID NO: NO: 3251) 3820) 726 A S 0.437983799 0.129329735 21 K E 0.431813708 0.20570077 953 D Y 0.437888499 0.29124605 348 C W 0.431395847 0.285738532 203 E [stop] 0.437866757 0.193004717 712 Q E 0.430794328 0.137430622 887 G V 0.437831028 0.150855683 867 V A 0.430546539 0.112438125 189 G R 0.437816984 0.195105194 902 H N 0.430482041 0.210989962 672 P L 0.437768207 0.1420574 232 C R 0.430431738 0.130635142 906 Q R 0.437668081 0.257388395 164 E [stop] 0.43010378 0.307258004 887 G R 0.436446894 0.261046568 926 L V 0.42049552 0.169568285 6 I T 0.436255483 0.311769796 873 S R 0.420222785 0.189220359 751 M R 0.436212653 0.194544034 823 R G 0.420141589 0.140425724 115 V A 0.436134597 0.191229151 703 T A 0.419927183 0.299947391 348 C R 0.429790014 0.254295816 265 K N 0.419762272 0.205398427 13 L R 0.429496589 0.209797858 904 P L 0.419717349 0.24717221 11 R W 0.429311947 0.298268587 315 G A 0.419275038 0.167267502 944 Q E 0.429084418 0.194128082 346 M I 0.418933456 0.153077303 974 K E 0.428778767 0.120819051 301 V A 0.418922077 0.253824177 935 L M 0.428357966 0.408223034 545 I M 0.418607437 0.264461321 131 Q E 0.427961752 0.108783149 676 P T 0.41817469 0.167866208 961 W R 0.427770336 0.153009954 516 F S 0.418152987 0.18301751 508 F L 0.427277307 0.150834085 790 G V 0.417872524 0.17800118 732 D Y 0.427260152 0.232782252 890 G V 0.417424955 0.242331279 876 S G 0.427219565 0.1654476 684 L P 0.41697175 0.237298169 36 M I 0.426965901 0.18021585 369 A T 0.416965887 0.158164268 699 E [stop] 0.426936027 0.247620152 890 G R 0.416918523 0.30183511 624 R G 0.426915666 0.161800086 515 A T 0.416763488 0.158965629 687 ----- PTHTL (SEQ 0.426399688 0.235010897 ID NO: 3626) 176 A G 0.425859136 0.154112817 903 R G 0.416689964 0.149830948 256 K N 0.425760398 0.195398586 898 K [stop] 0.416641263 0.154852179 904 P A 0.425684716 0.273763449 632 L V 0.416523782 0.131108293 859 Q K 0.425619083 0.166409301 126 G D 0.41639346 0.171080754 222 G [stop] 0.425285813 0.299517445 151 H R 0.41621118 0.192083944 20 K E 0.425128158 0.147645138 480 L P 0.4153828 0.153349872 327 G C 0.425002655 0.239317573 569 M T 0.415261579 0.12705723 530 L P 0.423859206 0.240275284 819 A S 0.414776737 0.173259385 175 E Q 0.423850119 0.242087732 212 E [stop] 0.414560972 0.214325617 797 L P 0.423394833 0.254739368 104 P T 0.414121539 0.241680787 351 K M 0.423313443 0.177944606 765 G A 0.413859942 0.202334164 912 L M 0.423204978 0.27824291 862 -- VK 0.413059952 0.195129021 188 F L 0.422539663 0.187750751 210 P A 0.412638448 0.228860931 850 I M 0.422459968 0.218452121 824 V A 0.412207035 0.173953175 391 K N 0.422162984 0.158915852 736 N K 0.411883437 0.18403448 894 - S 0.42194087 0.23660887 13 L H 0.411795935 0.405614507 758 S R 0.420859106 0.119214586 844 L V 0.411372197 0.244473235 941 K N 0.420814047 0.266042931 973 W L 0.403521777 0.16358494 381 L P 0.42076192 0.122089029 976 A S 0.403444209 0.261893297 564 G C 0.411344604 0.228204596 180 L P 0.403389637 0.163854455 694 G R 0.41123482 0.211796515 220 A S 0.402957864 0.279961071 977 V L 0.411157664 0.380351062 894 ------ SLLKK (SEQ 0.402797711 0.216370575 ID NO: 3720) 142 E K 0.410509302 0.15102557 739 R I 0.402772732 0.234602886 4 K E 0.410380978 0.274892917 548 E [stop] 0.402765683 0.262561545 890 G D 0.410337543 0.240602631 764 Q K 0.402617217 0.220740512 409 H D 0.410132391 0.22531365 723 A D 0.402461227 0.236080429 563 S C 0.409998896 0.206123321 934 F L 0.402458138 0.384373835 793 S N 0.409457982 0.067541166 42 E D 0.401939693 0.171540664 705 Q H 0.409365382 0.15278139 956 A G 0.401859954 0.23877341 515 A D 0.409252018 0.206051204 771 A D 0.401428057 0.231350403 382 S R 0.408669778 0.157144259 15 K M 0.401237871 0.256454456 97 S N 0.408564877 0.109922347 298 A V 0.401000777 0.140487597 624 R I 0.40845718 0.228955853 128 A P 0.400992369 0.173078759 568 P T 0.408066084 0.284742394 511 Q H 0.400978135 0.171613013 702 R S 0.408063786 0.129537489 26 G V 0.400800405 0.212307845 796 Y N 0.40788333 0.311628718 591 ------ QGREFI (SEQ 0.400574847 0.190655853 ID NO: 3636) 897 K R 0.407876662 0.136002906 156 G S 0.400389686 0.306653761 292 A V 0.407642755 0.163883385 728 N S 0.400298817 0.177178828 741 L Q 0.407532982 0.11928093 917 ------ ETHADE 0.400170477 0.15562198 (SEQ ID NO: 3401) 315 G C 0.407147181 0.218556644 640 R G 0.399931978 0.200741 -1 S Y 0.407080752 0.324937034 254 I M 0.39981124 0.209846066 945 T I 0.407011152 0.285905433 644 L P 0.399481964 0.165702888 695 E [stop] 0.406081569 0.227028835 549 A S 0.399416255 0.189530269 956 A S 0.405686952 0.185566124 528 L V 0.399354304 0.147818268 752 L M 0.405575007 0.172103348 502 I V 0.399285899 0.256373682 45 E [stop] 0.405531899 0.162357698 79 A D 0.399080303 0.154917165 487 G C 0.405450681 0.290615306 753 I M 0.399024046 0.268887392 310 Q R 0.405123752 0.12048192 588 G D 0.398941525 0.112261489 791 L P 0.404916001 0.108993438 873 S G 0.392619693 0.143564629 767 R I 0.404746394 0.223610078 414 G D 0.392615344 0.149137614 538 G C 0.404409405 0.233295785 237 A G 0.392578525 0.167793454 584 P A 0.403953066 0.108926305 479 E [stop] 0.392365621 0.272905538 552 A D 0.403929388 0.192995621 752 L V 0.392234134 0.171880044 648 N D 0.403814843 0.290734901 692 R I 0.391963575 0.221910688 722 Y H 0.398538883 0.164012123 683 s Y 0.39187962 0.197184801 550 - G 0.398527591 0.353355602 568 P s 0.391506615 0.094807068 133 C R 0.398285042 0.283233819 114 P T 0.391456539 0.163794482 591 -- QG 0.398079043 0.133460692 341 V A 0.391246425 0.087691935 877 V L 0.398057665 0.212468549 50 K R 0.39108021 0.159163965 958 V A 0.398007545 0.130004197 698 K R 0.390885992 0.181654156 903 R I 0.39789959 0.321002606 979 L- V[stop] 0.3907803 0.18994351 118 G D 0.397657151 0.192339782 932 W G 0.390757599 0.185057669 745 A S 0.397594938 0.285476509 519 Q R 0.390675235 0.117792262 914 C F 0.397278541 0.29475166 140 K E 0.390615529 0.123713502 461 --- SFV 0.39704755 0.20205322 40 L P 0.390579865 0.194510846 637 --- TFE 0.396824735 0.209304074 978 - [stop] 0.390537744 0.255501032 855 R M 0.396780958 0.191874811 509 S T 0.390466368 0.117704569 142 E [stop] 0.396624103 0.229993954 465 E [stop] 0.390424913 0.211758729 108 D N 0.396298431 0.15939576 88 F S 0.390363974 0.156430305 730 ------- ADDMVRN 0.395727458 0.207712648 429 E [stop] 0.390336598 0.135919503 (SEQ ID NO: 3305) 241 T I 0.395690613 0.131948289 783 --- TAK 0.390178711 0.143499076 641 R I 0.395315387 0.202249461 442 R M 0.390097432 0.262199628 364 F L 0.395209211 0.112951976 453 T A 0.389911631 0.312187594 739 R G 0.395162717 0.191317885 923 Q H 0.389855175 0.353446475 446 A S 0.39510798 0.254001902 666 V A 0.389840585 0.169825945 593 R [stop] 0.395071199 0.196636879 499 E D 0.38958943 0.172940321 168 L P 0.39502304 0.27101743 930 R G 0.389517964 0.2357312 890 G C 0.394653545 0.224530018 847 ------ EGQITY 0.389324278 0.122951036 (SEQ ID NO: 3387) 677 -- LS 0.394551417 0.187547463 846 V L 0.389120343 0.259313474 47 L R 0.394492318 0.238759289 908 K N 0.38907418 0.225076472 339 N S 0.394482682 0.152047471 975 P T 0.388901662 0.256059318 316 R G 0.394439897 0.159274636 783 T R 0.381262501 0.118770396 206 H N 0.394299838 0.156799046 916 F V 0.380756944 0.281228145 651 P A 0.394024946 0.151434436 450 A T 0.38074186 0.136570467 441 R G 0.393551449 0.150649913 906 Q E 0.380700478 0.285392821 325 L P 0.393343386 0.140601419 29 K [stop] 0.380574061 0.171976662 589 K N 0.3926379 0.261890195 936 R I 0.38042421 0.204558309 149 K N 0.38882454 0.171027465 754 F I 0.380277272 0.145574058 691 L P 0.388805401 0.14397393 315 G S 0.380117687 0.143338421 207 P A 0.387921412 0.102883658 89 Q [stop] 0.379768129 0.102222221 11 - S 0.387747808 0.379461072 289 G C 0.379664161 0.235845043 638 F L 0.387272475 0.168477543 750 A T 0.379378398 0.182932261 558 V L 0.386662896 0.254612529 216 G C 0.379274317 0.176888646 816 I V 0.386659025 0.185203822 303 W C 0.379215164 0.182222922 680 F L 0.386638685 0.211225716 295 N K 0.379144284 0.378487654 329 P T 0.386489681 0.220048383 919 H Y 0.379137691 0.321018649 576 D G 0.386151413 0.113653327 726 A D 0.379067543 0.145080733 225 G V 0.386137184 0.239109613 133 C S 0.378841599 0.162936296 22 A G 0.385839168 0.336984972 497 E [stop] 0.378292682 0.202801468 146 D E 0.385277721 0.095712474 444 E K 0.378042967 0.318660643 507 G R 0.385233777 0.212044464 693 I M 0.378036899 0.225823359 523 V I 0.385109283 0.152511446 587 F L 0.377947216 0.117981043 501 S G 0.385073546 0.140125388 291 E D 0.377733323 0.142365006 763 R L 0.38502172 0.191531655 85 W S 0.377648166 0.097279693 705 Q E 0.384851421 0.17568818 165 R M 0.377647305 0.161201002 82 H D 0.383907018 0.103874584 569 M I 0.377387614 0.195898876 794 K N 0.383803253 0.195192527 247 I T 0.37729282 0.165305688 979 LE[stop]GSPG VSSKDLR 0.38375861 0.240184851 513 - N 0.377106209 0.14731404 (SEQ ID NO: (SEQ ID NO: 3251) 3819) 894 S R 0.383344078 0.273603195 754 F L 0.376911731 0.164266559 639 E [stop] 0.383174826 0.193125393 21 K [stop] 0.376868031 0.199468055 655 I M 0.383102617 0.208514699 268 A T 0.376839819 0.129211081 261 L V 0.382856978 0.19611714 672 P T 0.376830532 0.204970386 480 L R 0.382841683 0.252187108 735 R [stop] 0.376814295 0.09621637 489 L V 0.38262991 0.16124555 147 K E 0.376789616 0.140417542 134 Q E 0.382580711 0.180510987 904 P R 0.37666328 0.185106225 650 -- PA 0.382487274 0.372015728 712 Q H 0.376030218 0.227827888 630 P H 0.381699363 0.211396524 92 P T 0.368981275 0.236532466 21 K R 0.381603442 0.1634713 292 A T 0.36879806 0.193425471 677 --- LSR 0.381372384 0.163400905 465 E D 0.368752489 0.224455423 284 P T 0.381276843 0.171865261 189 -------- GQRALDFY 0.368745456 0.227136846 (SEQ ID NO: 3448) 2 E V 0.375325693 0.197955097 805 T A 0.368671629 0.11272788 184 S I 0.375300851 0.252137747 947 K E 0.368551642 0.227968732 163 H D 0.3751698 0.208290707 148 G D 0.36788165 0.139635081 677 L P 0.375131489 0.090158552 129 C W 0.367758112 0.199915902 44 L P 0.374906966 0.249472829 129 C [stop] 0.367708546 0.192643557 606 G V 0.374739683 0.285964981 98 R T 0.367673403 0.174398036 937 S G 0.374669762 0.248499289 478 C W 0.367598979 0.111931907 727 K N 0.374273348 0.164838535 228 L M 0.367328433 0.24869867 734 V A 0.374244799 0.121134147 547 P H 0.367324308 0.220855574 902 H Q 0.374087073 0.175219897 105 K N 0.367245695 0.155463083 398 F L 0.373909011 0.239653674 597 W R 0.367058721 0.142955463 845 K N 0.373742099 0.158752661 328 F L 0.366955458 0.100787228 822 D N 0.373424135 0.138952336 469 E [stop] 0.366917206 0.180496612 136 L M 0.372880562 0.202180857 130 S T 0.366622403 0.127263853 543 K E 0.372880222 0.146877967 283 Q E 0.366530641 0.247989672 244 Q H 0.372873077 0.184616643 958 V L 0.366470474 0.270699212 403 L R 0.372697479 0.330913239 673 E Q 0.366346139 0.219545941 679 R I 0.372176403 0.370324076 118 G C 0.366255984 0.265748809 738 A D 0.372074442 0.291834989 848 G V 0.366195099 0.200861406 155 F L 0.371845015 0.114679195 923 Q L 0.366184575 0.233234243 174 P R 0.371603352 0.137168151 357 K R 0.366148171 0.185792239 919 H N 0.371556993 0.327290993 623 ------ RRTRQD 0.365486053 0.26101804 (SEQ ID NO: 3683) 944 Q H 0.37144256 0.338788753 85 W C 0.365346783 0.146084706 164 E G 0.370935537 0.216755032 376 ----- ALLPY (SEQ 0.365321474 0.191317647 ID NO: 3319) 197 S G 0.370856052 0.178568608 356 E D 0.365050343 0.136074432 840 N K 0.370814634 0.142530771 262 A S 0.365012551 0.204615446 13 L M 0.370495333 0.29466367 774 Q K 0.359747336 0.182131652 488 D N 0.370055302 0.226946737 439 E D 0.359587685 0.134619305 929 A P 0.370027168 0.168555798 198 I T 0.359370526 0.173615874 580 L V 0.36995513 0.139984948 156 G C 0.359055571 0.173590319 135 P A 0.369933138 0.10604161 399 G C 0.358922413 0.255017848 342 D Y 0.369924443 0.189241086 59 S T 0.358703019 0.109042363 959 ET AV 0.369879201 0.114167508 93 V M 0.358615623 0.161948363 557 T A 0.369640872 0.087836911 674 G [stop] 0.358503233 0.220631194 6 I V 0.369460173 0.192497769 539 K N 0.358074633 0.087009621 765 G S 0.3649426 0.100657536 709 E D 0.357944736 0.136689683 717 ---- GYSR (SEQ 0.364903794 0.186125273 120 E G 0.357933511 0.168382586 ID NO: 3457) 199 H Y 0.364586783 0.168211628 494 F L 0.357874746 0.139367085 796 Y H 0.364521403 0.145575579 272 G V 0.357428523 0.207170798 237 A P 0.364453395 0.150681341 527 N I 0.357320226 0.086164887 768 T A 0.36435574 0.18512185 236 V A 0.357249373 0.125737046 513 N D 0.364305814 0.16260499 974 K N 0.357242055 0.190403244 823 RV LS 0.364237044 0.11377221 10 RR PG 0.356712463 0.324298272 656 G A 0.364010939 0.135958583 39 D Y 0.356585187 0.235756832 276 P T 0.363878534 0.201304545 579 N S 0.3558347 0.181516226 214 I V 0.363876419 0.142178855 214 I M 0.355779849 0.142887254 300 I V 0.363823907 0.234997169 843 E [stop] 0.355689249 0.225441771 769 F S 0.363687361 0.079831237 526 ---- LNLY (SEQ 0.355597159 0.179351732 ID NO: 3563) 182 T R 0.363686071 0.201742372 667 I M 0.355548811 0.239632986 677 L V 0.363578004 0.138045802 559 I V 0.355478406 0.171281999 796 Y C 0.363566923 0.281557418 706 A S 0.355431605 0.116949175 5 R S 0.363258223 0.211185531 11 RR TS 0.35536352 0.272262643 298 A S 0.36320777 0.211187305 865 L Q 0.355287262 0.164676142 594 E [stop] 0.36278807 0.205352129 946 N K 0.355277474 0.180093688 105 K R 0.362205009 0.140104618 689 HI PV 0.355052108 0.144577201 907 E Q 0.362024887 0.226228418 898 K N 0.354894826 0.200062158 509 S G 0.361807445 0.13953396 950 -- GN 0.354845909 0.167057981 110 R I 0.361752083 0.138681372 332 P T 0.354796362 0.20270742 406 E Q 0.361750488 0.303638253 323 Q E 0.354759964 0.249399571 470 A V 0.361349462 0.10686226 42 E A 0.354721226 0.213005644 4 K [stop] 0.36129388 0.179352157 644 L V 0.351676716 0.163471035 362 K E 0.361196668 0.232368389 78 K E 0.35167205 0.128519193 713 R G 0.3607467 0.181817788 272 G C 0.351365895 0.208785029 857 K N 0.360715256 0.172046815 157 -------- RCNVSEHE 0.351115058 0.126463217 (SEQ ID NO: 3661) 120 E D 0.36030686 0.214810208 883 S R 0.351093302 0.143213807 277 K E 0.36002957 0.210892547 917 E V 0.350763439 0.206641731 477 RCELK (SEQ SFSSH (SEQ 0.360015336 0.177473578 843 E D 0.350569244 0.142523946 ID NO: 3285) ID NO: 3696) 532 I T 0.359759307 0.145072322 870 D Y 0.350431061 0.194706521 22 A T 0.354629728 0.083320918 393 F V 0.35027948 0.168738586 948 T S 0.354488334 0.198422577 162 E K 0.350236681 0.12523983 16 D E 0.354450775 0.187189495 119 N D 0.350147467 0.235898677 170 S Y 0.354344814 0.160709939 306 L M 0.349889759 0.165537841 862 VKDLS (SEQ 0.354059938 0.179170942 110 R T 0.349523294 0.289863999 ID NO: 3781) 249 E [stop] 0.354016591 0.294486267 976 A D 0.34941868 0.241042383 531 I M 0.353941253 0.095481374 914 C W 0.349231308 0.169568161 266 D H 0.35392753 0.237329699 115 V M 0.349160578 0.17839763 859 Q E 0.353923377 0.126451964 863 K N 0.348978081 0.175915912 113 I V 0.353631334 0.187941798 830 K R 0.348789882 0.11782242 136 L P 0.353572714 0.240617705 564 G S 0.348654331 0.240781896 503 L M 0.353400839 0.174768283 647 S I 0.348570495 0.163208612 51 P R 0.353321532 0.126698252 617 E D 0.348384104 0.103608149 179 E D 0.353270131 0.108592116 262 A T 0.348231917 0.222328473 31 L V 0.353260601 0.168619621 713 R I 0.348163293 0.202182526 502 I F 0.353258477 0.139633145 893 L P 0.348133135 0.24849422 378 L M 0.353221613 0.189998728 202 R G 0.347997162 0.177282082 890 G A 0.353138339 0.149947604 806 S Y 0.347673828 0.200543155 913 N K 0.353092797 0.294888192 391 K R 0.347608788 0.122435715 956 A D 0.352997131 0.204713576 683 S C 0.34755615 0.102168244 158 C W 0.352758393 0.130405614 446 A T 0.347296208 0.236243043 157 ---- RCNV (SEQ 0.352566351 0.116984328 282 P A 0.347073665 0.253113968 ID NO: 3658) 771 A G 0.352390901 0.141133059 580 L P 0.347062657 0.078573865 227 A G 0.352335693 0.141777326 895 L P 0.347059979 0.152424473 202 RE G- 0.352321171 0.210660545 929 A T 0.34702013 0.306789031 99 V F 0.352314021 0.162936095 555 F L 0.343270194 0.098281937 643 V E 0.352268894 0.209333581 294 N D 0.343264324 0.126839815 41 R I 0.352205261 0.321737078 553 N D 0.342736197 0.153294035 387 R P 0.352184692 0.159814147 893 L M 0.342736077 0.179172833 539 K E 0.351957196 0.146275596 951 N K 0.342592943 0.278844401 478 C F 0.351788403 0.313141443 51 P T 0.342576973 0.1929364 942 K E 0.351775756 0.256493816 649 I T 0.342534817 0.270208479 36 M I 0.351715805 0.097577134 175 E D 0.342455704 0.202360388 108 D Y 0.347014656 0.291577591 823 R S 0.341965728 0.273152096 258 E [stop] 0.34694757 0.281979872 219 C R 0.341954249 0.136482174 673 E A 0.346691172 0.265253287 283 Q R 0.341949927 0.224313066 950 G D 0.346646349 0.128298199 444 E [stop] 0.341881438 0.217688103 792 P T 0.346487957 0.236073016 649 I V 0.341655494 0.148589673 673 E [stop] 0.346388527 0.198074161 854 N K 0.341614877 0.157948422 150 P R 0.34632855 0.278480507 514 C S 0.34160113 0.231141571 456 L P 0.345951509 0.161500864 623 ---- RRTR (SEQ 0.341527608 0.187073234 ID NO: 3681) 790 G R 0.345911786 0.179210019 585 L M 0.341496703 0.21431877 647 S T 0.345819661 0.158521168 211 -- LE 0.341207432 0.169230112 542 F S 0.345619595 0.191970857 544 K E 0.341142267 0.208342511 841 G D 0.345447865 0.129392183 478 C R 0.341091687 0.148433288 57 P A 0.345371652 0.147875225 858 R G 0.340977066 0.206052559 578 P R 0.345346371 0.12075926 172 H D 0.340873936 0.298188428 793 S I 0.345235059 0.262377638 16 D A 0.340771918 0.308121625 453 T S 0.345118763 0.097101409 525 K N 0.340626838 0.147516442 651 P R 0.345088622 0.208316961 532 I V 0.340576058 0.099088927 556 Y [stop] 0.345070339 0.114662396 520 K [stop] 0.34056167 0.228510512 86 E [stop] 0.344943839 0.21976554 743 Y [stop] 0.340397436 0.102396798 646 S G 0.344888595 0.154435246 344 W C 0.340364668 0.176812201 592 G C 0.34478874 0.240350052 220 A G 0.340276978 0.133945921 49 K N 0.344659946 0.130706516 186 G V 0.340265085 0.116877863 586 A D 0.344294219 0.15117877 694 G C 0.340225482 0.309935909 166 L V 0.34415435 0.139737754 411 E Q 0.340144727 0.282548314 726 A P 0.344144415 0.164178243 406 E G 0.340120492 0.140875629 666 V L 0.344130904 0.155760915 573 F L 0.340030507 0.166015227 749 D H 0.344052929 0.242192495 52 E [stop] 0.336207682 0.211986135 486 Y C 0.34395063 0.130965705 299 Q E 0.336024324 0.156699489 134 Q K 0.343594633 0.210709609 183 YS WM 0.335855997 0.179538112 91 D H 0.34352508 0.153686099 194 D Y 0.335755348 0.131644969 40 LR PV 0.343506493 0.155292328 213 Q R 0.335726769 0.209853061 12 R T 0.343490891 0.187270573 802 A D 0.33571172 0.168573673 653 N D 0.343487264 0.148663517 163 H N 0.33571123 0.197315666 52 E Q 0.343438912 0.247941408 943 Y C 0.335604909 0.172843558 8 K Q 0.343298615 0.279455517 118 G S 0.335544316 0.125891126 458 A G 0.339794018 0.171435317 758 S G 0.335513561 0.149050456 675 C [stop] 0.339687357 0.208292109 941 K [stop] 0.335374859 0.192348189 576 D Y 0.339621402 0.21774439 279 ------- TLPPQPH 0.335305655 0.144688363 (SEQ ID NO: 3755) 787 A S 0.339526186 0.318305548 632 LF PV 0.335263893 0.113883053 537 G C 0.339454064 0.174110887 894 ------ SLLKKR 0.335263893 0.141289409 (SEQ ID NO: 3721) 185 -- LG 0.339451721 0.186103153 943 Y [stop] 0.335115123 0.291608446 844 L P 0.339318044 0.191881119 38 P R 0.33481965 0.113021039 712 Q K 0.339288003 0.193891353 616 I F 0.334790976 0.107803908 591 Q R 0.339223049 0.160616368 134 Q H 0.334549336 0.158461695 169 L P 0.339210958 0.127439702 186 G C 0.334321874 0.156717674 923 ----- QAALN (SEQ 0.339143383 0.169170821 184 S G 0.334296555 0.223929833 ID NO: 3631) 623 R S 0.339131953 0.245088648 765 G C 0.33423513 0.213904011 589 K Q 0.33901987 0.177422866 687 P T 0.334191461 0.22545553 522 G V 0.338985606 0.226282565 803 --- QYT 0.33418367 0.096860089 204 S T 0.338673547 0.170845305 374 Q R 0.334175524 0.104826318 698 K E 0.338580473 0.129708045 455 W C 0.334165051 0.186741008 497 E V 0.338306724 0.13489235 552 ----- ANRFY (SEQ 0.333923423 0.258649392 ID NO: 3327) 23 G S 0.338162596 0.15304761 407 K R 0.333913165 0.142719617 29 K R 0.337989172 0.147861886 175 E K 0.333834455 0.196225639 716 G V 0.337974681 0.202399788 610 ----- LANGR (SEQ 0.333428825 0.102899397 ID NO: 3536) 703 T S 0.337889214 0.141977828 127 F I 0.329561201 0.268089932 979 LE[stop]GSPG VSSKDLE 0.337814175 0.168342402 837 T S 0.329510402 0.099725089 (SEQ ID NO: (SEQ ID NO: 3251) 3805) 240 L M 0.3377179 0.151631422 704 I T 0.329114566 0.113551049 950 G C 0.337265205 0.234973706 387 R L 0.328928103 0.199189713 7 N S 0.337036852 0.185037778 171 P R 0.328685191 0.279786527 64 A P 0.336967696 0.255179815 767 R T 0.328611454 0.173820273 795 T S 0.336837648 0.117371137 597 W L 0.328585458 0.282536549 480 L Q 0.336803159 0.213915334 955 R G 0.328533511 0.252801289 600 L V 0.336801383 0.230766925 629 E [stop] 0.328472442 0.226070443 175 E [stop] 0.336712437 0.187755487 699 E G 0.328340286 0.161755276 63 R S 0.336640982 0.183725757 564 G A 0.328244232 0.11512512 394 A P 0.336388779 0.125201204 129 C F 0.327975914 0.184885596 230 ---- DACM (SEQ 0.333428825 0.108521075 26 G S 0.327861024 0.174859434 ID NO: 3341) 848 G S 0.333406808 0.165245749 199 H N 0.327823226 0.25447122 630 P R 0.333389309 0.182782946 701 Q R 0.327746296 0.151982714 442 R G 0.333281333 0.186150848 186 G D 0.327613843 0.101552272 836 M T 0.33320739 0.215623837 422 E D 0.327579534 0.227939955 222 G V 0.333139545 0.173506426 924 A T 0.327501843 0.29494568 21 K T 0.333022379 0.190202016 176 A P 0.32741005 0.239900376 696 S I 0.332955668 0.138037632 499 E K 0.327284744 0.159757942 635 A T 0.332902532 0.130552446 546 K R 0.327156617 0.166513946 551 E G 0.332833114 0.158314375 556 Y H 0.327151432 0.118520339 780 D Y 0.332787267 0.203141483 548 --- EAF 0.326965289 0.171181066 47 L M 0.332771785 0.228474741 901 S I 0.326880206 0.320148616 347 V L 0.332766547 0.164853137 14 V I 0.326870011 0.276842054 841 G C 0.332584425 0.2483922 814 F L 0.32685269 0.084563864 593 R I 0.332546881 0.22140312 157 ------ RCNVSE 0.326801479 0.200654893 (SEQ ID NO: 3660) 749 D Y 0.332359902 0.199451757 250 H R 0.326584294 0.078102923 27 P S 0.332358372 0.306966339 730 A V 0.326443401 0.110931779 276 P H 0.332221583 0.26420075 497 E Q 0.326193187 0.212891542 293 Y [stop] 0.332046234 0.133526657 536 K R 0.326129704 0.20597101 3 I N 0.332004357 0.072687293 906 Q P 0.326073598 0.193779388 642 ---- EVLD (SEQ 0.331972419 0.22538863 243 Y D 0.326001836 0.130392708 ID NO: 3404) 620 L P 0.331807594 0.15763111 786 L Q 0.32241581 0.22201146 456 L V 0.331754102 0.143226803 4 K M 0.32231147 0.124043743 130 S G 0.331571239 0.167684126 781 W R 0.322196176 0.263818038 629 E K 0.33154282 0.153428302 182 T I 0.322044203 0.109310181 950 G V 0.331464709 0.229681218 888 R G 0.322001059 0.172130189 328 F Y 0.331454046 0.090600532 388 K N 0.321769292 0.13958088 303 W S 0.331070804 0.245928403 504 D Y 0.321517406 0.182186572 421 W C 0.330779828 0.216037825 260 R I 0.321461619 0.146534668 351 K R 0.330630005 0.142537112 695 E Q 0.321451268 0.199405121 498 A T 0.33049042 0.166213318 960 T A 0.321351275 0.243570837 937 S T 0.330380882 0.231058955 496 I F 0.321275456 0.162860461 592 OR DN 0.329593548 0.300041765 454 D H 0.321034191 0.123925099 798 S F 0.325769587 0.320454472 859 Q H 0.321009248 0.15665955 882 S G 0.325732755 0.141569252 432 S I 0.32093586 0.219919612 759 R G 0.325319087 0.080028833 120 E Q 0.320905282 0.134126668 576 D V 0.325192282 0.239519469 359 E [stop] 0.320840565 0.172779106 309 W [stop] 0.325098891 0.096106342 474 E [stop] 0.320753733 0.198938474 554 R I 0.325075441 0.185726803 609 K R 0.320654761 0.097190768 483 Q H 0.324598695 0.153049426 654 L P 0.320340402 0.21351518 979 E VSSKDQ 0.324398559 0.118712651 344 W G 0.32013599 0.133467654 (SEQ ID NO: 3823) 834 G C 0.324348652 0.175539945 629 E D 0.319764058 0.097801219 719 S Y 0.324298439 0.22105488 631 A D 0.319695703 0.120854121 842 K R 0.324267597 0.102772814 124 S Y 0.319588026 0.148095027 97 S T 0.324252325 0.240123255 244 Q R 0.319581236 0.174412151 172 H N 0.324047776 0.168532939 338 A D 0.319500211 0.171228389 692 R G 0.324024313 0.134914995 634 V L 0.3194918 0.113193905 39 D V 0.324012084 0.186802864 91 D N 0.319468455 0.231799127 776 T I 0.323918216 0.153171775 740 D E 0.319448668 0.093677265 652 M T 0.323898442 0.13705991 942 K R 0.319440348 0.184998826 611 A V 0.323836429 0.18975125 146 D Y 0.319268754 0.209601725 658 D G 0.323834837 0.116577804 513 N K 0.319264079 0.180017602 158 C [stop] 0.323773158 0.093674966 366 Q H 0.318971922 0.184226775 887 G A 0.32369757 0.19151617 477 R G 0.318963003 0.179227033 337 Q H 0.323607141 0.165283008 947 K R 0.318930494 0.25585521 319 A D 0.323458799 0.152084781 478 C S 0.318576968 0.151506435 215 GGNSCA 0.323334457 0.165215546 94 G A 0.315344942 0.125574217 (SEQ ID NO: 3431) 351 K N 0.323273003 0.138737748 509 S R 0.315237336 0.198196247 878 - I 0.323133111 0.265099492 715 A S 0.314795788 0.184022977 597 W C 0.323039345 0.210227048 639 E G 0.314490675 0.131536259 85 W G 0.3230112 0.140970302 485 W R 0.314444162 0.077460473 830 K E 0.322976082 0.171606667 529 Y [stop] 0.314338149 0.096977512 193 -- LD 0.322600674 0.167338288 773 R M 0.314128132 0.191934874 350 V A 0.32248331 0.252994511 227 A D 0.313893012 0.086820124 443 S G 0.318453544 0.181417518 865 L V 0.313870986 0.093939035 766 K E 0.318255467 0.119279294 25 T S 0.313828907 0.165926738 557 T S 0.318254881 0.136960287 206 H R 0.313540953 0.153060153 39 D E 0.318241109 0.177504749 33 V I 0.313378588 0.092743144 586 A S 0.318046156 0.197164692 736 N S 0.313292021 0.139875641 270 A P 0.317952258 0.133471459 613 G A 0.313219371 0.139952239 707 A S 0.317797903 0.176472631 472 K R 0.313201874 0.163543589 173 K N 0.317699885 0.158843579 149 --- KPH 0.313073613 0.111009375 676 P R 0.317616441 0.273323665 966 R I 0.313069041 0.220268045 409 H N 0.31739526 0.238962249 847 E [stop] 0.312986862 0.248850102 878 N D 0.317341485 0.123856244 892 A V 0.312917635 0.236911004 967 K E 0.317328223 0.198885809 322 L P 0.312907638 0.167614176 405 L M 0.317316848 0.232382071 947 K N 0.312809501 0.23804854 759 R T 0.317284234 0.210047842 820 D Y 0.312669916 0.196444965 505 I M 0.317274558 0.129635964 627 Q E 0.312477809 0.180929549 612 N D 0.317252502 0.181380961 20 K T 0.312450252 0.306509245 862 V A 0.317158438 0.090072044 914 C G 0.312434698 0.246328459 295 -N LS 0.317076665 0.155046903 793 S G 0.312385644 0.182436917 165 R G 0.317047785 0.17842685 411 E D 0.312132984 0.213313342 760 G D 0.316786277 0.162885521 901 S R 0.311953255 0.163461395 244 Q K 0.316600083 0.246636704 393 F L 0.311946018 0.192991506 238 S Y 0.316596499 0.171458712 757 L P 0.311927617 0.117197609 475 F L 0.316549309 0.192939087 702 R G 0.311688104 0.266620819 829 K N 0.316494901 0.154808851 589 K R 0.311588343 0.136320933 28 M I 0.31630177 0.188404934 717 G R 0.311565735 0.080863714 186 G A 0.316262682 0.1767869 286 T S 0.311321567 0.240949263 679 R G 0.316180477 0.112760057 150 P T 0.311291496 0.13427262 925 A G 0.315901657 0.192750307 107 I L 0.307707331 0.205313283 892 A P 0.315901657 0.129374073 776 T A 0.307705621 0.113209696 642 E A 0.315758891 0.205380131 306 L V 0.307515106 0.116397313 629 E G 0.315702888 0.119743865 651 P T 0.307457933 0.189846398 642 E G 0.315673565 0.11044042 155 F Y 0.307385155 0.165676404 104 P R 0.315607101 0.202791238 229 S T 0.307373154 0.086318269 807 K E 0.315573228 0.117464708 517 I V 0.307363772 0.108604289 599 D E 0.315416693 0.115740153 334 V A 0.306982037 0.139604112 578 P A 0.311263999 0.106013626 614 R K 0.306921623 0.187827913 41 R G 0.311016733 0.286865829 824 V L 0.306719384 0.210851946 781 W S 0.310870839 0.281958829 723 A V 0.306692766 0.140247988 382 S I 0.310857774 0.22558917 711 E G 0.306675894 0.224133351 723 A T 0.310856537 0.118165477 499 E Q 0.306671973 0.224590082 451 A G 0.310527551 0.159640493 104 P S 0.306640385 0.162249455 568 P L 0.310447286 0.186724922 3 I L 0.306608196 0.194776786 216 G S 0.310362762 0.143843218 702 R K 0.306541295 0.149431609 216 G R 0.310272111 0.119909677 954 K E 0.306525004 0.187285491 89 Q R 0.310167676 0.139047602 842 --- KEL 0.306410776 0.206532128 433 K R 0.310161393 0.097615554 466 G C 0.30635382 0.179163452 21 KA NC 0.310061242 0.098851828 979 ----- VSSKD (SEQ 0.306277048 0.179502088 ID NO: 3799) [stop] 141 L P 0.309573602 0.118441502 830 K 0.306086752 0.154175951 425 D Y 0.309531408 0.253195982 243 Y F 0.306073033 0.15669665 579 N D 0.309484128 0.137585893 88 F L 0.305867737 0.156711191 825 L V 0.309431153 0.160157183 149 K E 0.305762803 0.092392237 464 I M 0.309049855 0.208541437 102 P H 0.305663323 0.198476248 710 V L 0.309047105 0.126001585 554 ---- RFYT (SEQ 0.305511625 0.122801047 ID NO: 3665) 671 D H 0.309035221 0.209514286 720 - R 0.305347434 0.161540535 735 R P 0.309028904 0.132025621 128 A G 0.305254739 0.159245241 819 A G 0.308778739 0.188847749 122 L P 0.305222365 0.154910099 2 E G 0.308512084 0.159248809 792 P S 0.305214901 0.160903917 109 Q H 0.308384304 0.180580793 312 L P 0.305192803 0.183880511 66 L V 0.308337109 0.160085063 299 Q [stop] 0.305119863 0.096364942 93 V L 0.308334538 0.186355769 668 A T 0.305069729 0.135204642 621 Y [stop] 0.308307714 0.182192979 962 Q R 0.302114892 0.192863031 0 M L 0.308276685 0.236934633 656 G S 0.301941181 0.160658808 857 K E 0.308118374 0.128063493 526 L P 0.301907253 0.200130867 264 L I 0.308089176 0.231951197 181 V L 0.301627326 0.141701986 646 S T 0.307934288 0.163215891 602 S G 0.301374384 0.168690577 461 S T 0.307923977 0.13026743 2 E K 0.301361669 0.293245611 937 S N 0.307902696 0.280386833 46 N S 0.301357514 0.121526311 774 Q L 0.30782826 0.179585187 71 T S 0.301285774 0.182156883 427 K N 0.307771318 0.212433986 887 G D 0.301271887 0.117733719 422 E G 0.307743696 0.21393123 121 R S 0.301231571 0.167844846 639 E Q 0.304680843 0.266883075 108 D V 0.301094262 0.261979025 812 C [stop] 0.304671385 0.223383408 979 LE[stop]GS- VSSKDLQA 0.301043 0.222937332 PGI (SEQ ID (SEQ ID NO: NO: 3278) 3810)[stop] 856 -- YK 0.304562199 0.117931145 73 Y [stop] 0.300976299 0.109164204 959 ------- ETWQSFY 0.304562199 0.204359044 645 D H 0.300832783 0.189820783 (SEQ ID NO: 3403) 640 R [stop] 0.304365031 0.131009317 972 --- VWK 0.300386808 0.146545616 968 KL S[stop] 0.304328899 0.221090558 127 F S 0.300342022 0.146847301 24 K N 0.304215048 0.239991354 571 V A 0.300337937 0.156010497 858 R T 0.304052714 0.1448623 386 D N 0.300273532 0.259491112 530 L M 0.303970715 0.250168829 381 L M 0.300116697 0.157006178 269 S R 0.303928294 0.209763505 493 P A 0.299995588 0.227049942 251 Q E 0.303459913 0.190095434 199 H R 0.299830107 0.074234175 340 E Q 0.30343193 0.10804688 642 E [stop] 0.299768631 0.20842894 623 - R 0.303430789 0.233394445 352 K [stop] 0.299555207 0.106916877 880 D Y 0.30324465 0.244720194 314 I V 0.299339024 0.237860572 223 P A 0.303031527 0.177373299 696 S T 0.299269551 0.19370537 899 R T 0.302967154 0.112177355 554 R G 0.299260223 0.263070996 60 N D 0.30295183 0.177064719 413 W S 0.298889603 0.120871006 966 R S 0.302926375 0.099801177 973 W [stop] 0.298886432 0.173734887 687 P A 0.302859855 0.188291569 1 Q [stop] 0.298848883 0.253324527 821 Y C 0.302780706 0.154234626 59 S G 0.298416382 0.178538741 628 D Y 0.302709978 0.176578494 717 G [stop] 0.298317755 0.217662606 952 -------- TDKRAFVE 0.302629733 0.089246659 348 C S 0.298274049 0.13599769 (SEQ ID NO: 3741) 540 L V 0.302623885 0.094608809 707 A G 0.298173789 0.189062395 855 R T 0.302608606 0.19469877 345 D Y 0.295298688 0.153403354 59 S I 0.302606901 0.165051866 469 E G 0.295269456 0.193145904 272 G D 0.302541592 0.185286895 495 A T 0.295248074 0.179130836 284 P H 0.302498547 0.213421981 929 A G 0.295233981 0.250007265 342 -- TS 0.302413033 0.240972915 435 I T 0.2952095 0.10707736 43 R W 0.302283296 0.149981215 586 A T 0.295123473 0.125804414 760 G A 0.302207311 0.130376601 627 Q R 0.295089748 0.147312376 766 K N 0.302181165 0.136382512 17 S I 0.295022842 0.203345294 478 CE AQ 0.298056287 0.28697996 96 M V 0.29492941 0.118289949 915 G A 0.298020743 0.21282862 83 V M 0.294841632 0.151911965 969 L M 0.297993119 0.288243926 721 K [stop] 0.294783263 0.121804362 953 D V 0.297929214 0.145206254 550 F S 0.294772324 0.160417343 485 W G 0.297911414 0.242181721 538 G A 0.29474804 0.174345187 676 P A 0.297863971 0.089640148 462 F L 0.294742725 0.14185505 4 K T 0.297828559 0.161108285 822 D H 0.294658575 0.162957386 631 A G 0.297777083 0.103836414 213 QI PV 0.294575907 0.193654425 250 H P 0.29766948 0.081415922 658 D N 0.294502464 0.107952026 11 - R 0.29755173 0.242218951 309 W S 0.294338009 0.284836107 274 A T 0.297540582 0.172279995 835 W C 0.294317109 0.120763755 918 T K 0.297381988 0.249593921 607 S Y 0.294194742 0.192145848 43 R L 0.297375059 0.247052829 853 Y [stop] 0.294188525 0.116100881 51 P A 0.29736536 0.241677851 895 L M 0.294152124 0.189733578 64 A T 0.297190007 0.136022098 298 AQ DR 0.294067945 0.080730567 617 E Q 0.297156994 0.256789508 221 S T 0.293988985 0.161830985 468 K 0.297121715 0.218726347 854 ----- NRYKRQ 0.29389502 0.164228467 (SEQ ID NO: 3597) 705 Q [stop] 0.297097391 0.129530594 184 --- SLG 0.29389502 0.133943716 538 G D 0.297030166 0.143641253 24 K E 0.293893146 0.087429384 697 Y [stop] 0.29694611 0.165401562 903 R T 0.293855808 0.156130706 30 T N 0.296922856 0.20113666 649 I M 0.293844709 0.213121389 374 Q E 0.296916876 0.294201034 646 S N 0.293718938 0.053702828 429 E G 0.296692622 0.12956891 751 M T 0.293692865 0.188828745 617 E G 0.296673186 0.100617287 138 V A 0.293692865 0.172441917 174 P L 0.296325925 0.125090192 421 W R 0.293643119 0.202965718 476 C W 0.296243077 0.108583652 891 E D 0.290888227 0.199229012 536 K [stop] 0.296174047 0.204485045 663 I T 0.290884576 0.159824412 340 E [stop] 0.296106359 0.228363644 86 E G 0.290735509 0.164271816 263 N S 0.295761788 0.153417105 950 ------- GNTDKRA 0.290646329 0.08439848 (SEQ ID NO: 3447) 292 A D 0.295588873 0.132003236 910 V A 0.290614659 0.192165123 524 K E 0.295588726 0.123024834 130 S R 0.290579337 0.126556505 252 K E 0.295509892 0.130412924 286 T A 0.290569747 0.161258253 360 D H 0.295426779 0.169820671 412 D Y 0.290563856 0.192946257 771 A T 0.295409018 0.21146028 390 G C 0.290531408 0.226107283 960 T S 0.295303172 0.200733126 96 M T 0.290483084 0.117441458 885 T A 0.293639992 0.136222429 796 Y F 0.290480726 0.145066767 372 K N 0.293601801 0.159631501 617 E [stop] 0.290459043 0.254049857 899 R W 0.293409271 0.197663789 520 K Q 0.290432231 0.149193863 323 Q R 0.293396269 0.187618952 238 S C 0.29036146 0.125809391 787 A V 0.293181255 0.111256021 510 K N 0.290307315 0.121616244 97 S G 0.29311892 0.120983434 751 M I 0.290086322 0.117481113 523 V A 0.293107836 0.144403198 764 Q E 0.290043861 0.213865459 606 GS -A 0.293095145 0.176419666 239 F L 0.290032145 0.120563078 647 S G 0.293070849 0.180316262 750 A S 0.290021488 0.169783417 401 L M 0.293059235 0.238931791 509 S N 0.290010303 0.173158694 706 A T 0.293004089 0.157196701 791 L V 0.28993006 0.240441646 167 I M 0.292976512 0.174804994 976 A P 0.289917569 0.129909297 239 F Y 0.292846447 0.244049066 970 K E 0.289792346 0.088055606 532 I M 0.292790974 0.132047771 370 G S 0.289754414 0.116500268 362 K N 0.292779584 0.196868197 229 S I 0.289718863 0.192569781 531 I F 0.292690193 0.245999103 126 G S 0.289695476 0.136718855 551 E D 0.292676692 0.177028816 39 D H 0.28966543 0.205820796 366 Q R 0.292637285 0.233099785 541 R W 0.289647451 0.149474595 45 E K 0.292602703 0.135241306 963 S R 0.289642486 0.119359764 170 S P 0.292487757 0.117055288 614 R G 0.289631701 0.096593744 522 -------- GVKKLNLY 0.292477218 0.205588046 903 R K 0.289598509 0.276955136 (SEQ ID NO: 3455) 184 S T 0.292461578 0.171099938 700 K E 0.289582689 0.146563937 256 K R 0.292459664 0.134546625 176 A T 0.289565984 0.071489526 898 K R 0.292371281 0.233917307 862 V L 0.28755723 0.122530143 687 ------ PTHILR (SEQ 0.292237604 0.252992689 376 A D 0.287488687 0.149852687 ID NO: 3627) 499 E [stop] 0.292180944 0.205912614 717 G A 0.287475979 0.138371481 439 E [stop] 0.291789527 0.178224776 871 R G 0.287423469 0.12544588 286 T I 0.291597253 0.134630039 779 E [stop] 0.287388451 0.214465092 326 K R 0.291167908 0.130858044 659 R Q 0.287382153 0.188389105 309 W C 0.291117426 0.126634127 688 T S 0.2872606 0.18090055 141 L V 0.291053469 0.125358393 450 A G 0.287222025 0.226851871 599 D H 0.290990101 0.194898673 608 L P 0.287206606 0.153956956 714 R G 0.289551118 0.131217053 74 T A 0.28708898 0.151009591 849 Q E 0.289450204 0.14256548 101 Q H 0.287075864 0.127870371 861 V L 0.289424991 0.184715842 168 L M 0.287051161 0.164606192 227 A S 0.289407395 0.147147965 522 G A 0.286889556 0.191392288 337 Q E 0.289400311 0.154536453 158 -- CN 0.286856801 0.104191954 282 P Q 0.289371748 0.241776764 822 D Y 0.286792384 0.216414998 147 ----- KGKPH (SEQ 0.289327222 0.167067239 31 LL PV 0.286704233 0.167404084 ID NO: 3494) 215 -------- GGNSCASG 0.28926976 0.113347286 753 ------ IFENLS (SEQ 0.286664247 0.204891377 (SEQ ID NO: ID NO: 3474) 3432) 615 - Q 0.288918789 0.138819471 894 ---- SLLK (SEQ 0.286588033 0.088926565 ID NO: 3719) 148 ------- GKPHTNY 0.288918789 0.145077971 443 S R 0.286575868 0.16053834 (SEQ ID NO: 3438) 70 L V 0.288897546 0.141249384 813 G S 0.286517663 0.166687094 131 Q H 0.28889109 0.089984222 545 I T 0.28643634 0.175437623 417 Y [stop] 0.288830461 0.139069155 43 R G 0.286322337 0.211707784 917 E Q 0.288684907 0.209421131 671 D G 0.28629192 0.163952723 681 K R 0.288657171 0.188212382 501 S T 0.286282753 0.120251174 824 --- VLE 0.288568311 0.142383803 729 L M 0.286200559 0.141100837 757 L M 0.288547614 0.138199941 264 L F 0.28603772 0.148836446 683 S P 0.288449161 0.100064584 613 G S 0.285821749 0.213295055 879 N D 0.288359669 0.112916417 806 S P 0.285754508 0.139734573 87 EF AV 0.28833835 0.157423397 251 Q R 0.285704309 0.129794167 623 R M 0.288312668 0.180378091 503 L P 0.285623626 0.150765257 360 D G 0.288240177 0.1450193 544 K N 0.285528499 0.105740594 469 E D 0.288213424 0.169330277 685 G S 0.285482686 0.116956671 488 D H 0.288056714 0.224399768 66 L P 0.285241304 0.178235911 832 A D 0.28797086 0.133987122 713 R [stop] 0.281751627 0.150509506 331 F L 0.287898632 0.125465761 759 R I 0.281715415 0.207490665 880 D N 0.287796432 0.265861692 103 A D 0.281654023 0.156258821 813 G V 0.28764847 0.18793522 352 K R 0.281644749 0.090972271 125 S R 0.287612867 0.078156909 23 G D 0.281613067 0.110087313 315 G V 0.287582891 0.216366011 490 R I 0.28158749 0.189684 348 C [stop] 0.285167016 0.232120541 534 Y C 0.281578683 0.19797794 615 V L 0.285139566 0.138644746 728 N K 0.281567938 0.122533743 34 R K 0.285068253 0.155629412 218 S G 0.28156304 0.0827746 606 G D 0.284708065 0.131937418 131 Q K 0.28143462 0.261996702 564 G R 0.284584869 0.153328649 117 D Y 0.281261616 0.150312544 767 R G 0.284520477 0.167110905 809 C S 0.281246687 0.119977311 459 K N 0.284319069 0.144116629 899 R S 0.281103794 0.115069396 100 A G 0.284064196 0.232698011 192 A P 0.281083951 0.125030936 182 T S 0.284017418 0.165066704 913 N S 0.280977138 0.259159821 552 A P 0.28399207 0.192922882 232 C S 0.28083211 0.170644437 874 E [stop] 0.283924403 0.212096559 928 I L 0.280808974 0.249623753 656 G V 0.283837412 0.096364514 495 A G 0.280579997 0.166279564 527 N D 0.283828964 0.095606466 917 ----- ETHAA (SEQ 0.280544768 0.259917773 ID NO: 3399) 560 N D 0.283827293 0.131100485 85 W- LS 0.280472053 0.101385815 518 W [stop] 0.283768829 0.144873432 344 W [stop] 0.280246002 0.139860723 900 F Y 0.283754684 0.18210141 493 P H 0.280219202 0.225933372 485 W C 0.283722783 0.101623525 189 G A 0.28010846 0.181165246 528 L M 0.283582823 0.241404553 565 E G 0.28010846 0.126376781 463 V L 0.283409253 0.174572622 944 Q R 0.279992746 0.221800854 938 Q R 0.283399277 0.159588016 674 G A 0.27982066 0.112736684 809 C R 0.2832933 0.140866937 45 E V 0.279758496 0.126165976 765 G V 0.283226034 0.181883423 281 P A 0.27973122 0.169207983 253 V E 0.283192966 0.158310209 828 L P 0.279653349 0.165044194 745 A D 0.283094632 0.139036808 460 A D 0.27950426 0.185233285 739 R S 0.283000418 0.086394522 539 K R 0.279423784 0.231876099 262 A D 0.282981572 0.21883829 62 S G 0.279325036 0.105769252 75 E D 0.282861668 0.096240394 883 S T 0.278909433 0.17133128 122 L V 0.28282995 0.142431105 166 --- LIL 0.27890183 0.114735325 427 K R 0.282689541 0.126741896 553 N K 0.276534729 0.129122139 472 K E 0.282354225 0.243592384 500 N K 0.276479484 0.075342066 69 L V 0.282311609 0.233097353 796 Y [stop] 0.276459628 0.151040972 128 A D 0.282136746 0.144684711 313 K E 0.276424062 0.141250225 240 L P 0.282112821 0.187484636 184 S R 0.276360484 0.093462218 840 N D 0.28205862 0.169019904 770 M V 0.276349013 0.177344184 496 I L 0.281766947 0.156440465 30 T S 0.27626759 0.074607362 445 D N 0.27879438 0.120139275 887 G C 0.276203171 0.205245818 121 R G 0.278752599 0.152495589 885 T S 0.276162821 0.125136939 66 LN PV 0.278503247 0.058556198 372 K E 0.2761455 0.186164615 603 ------- LETGSLK 0.278503247 0.20379117 161 S F 0.276099268 0.101256778 (SEQ ID NO: 3545) 225 G [stop] 0.278489806 0.182580993 280 LP PV 0.2760948 0.15312325 175 --- EAN 0.278488851 0.117512649 118 G A 0.276069076 0.158472607 274 A S 0.278435433 0.213434648 945 T S 0.275967844 0.217091948 870 D G 0.278347965 0.136371883 597 W S 0.275959763 0.205648781 683 S T 0.278234202 0.119170388 700 K [stop] 0.275943939 0.231744011 792 P H 0.277909356 0.196357382 654 L M 0.275895098 0.222206287 18 N R 0.277904726 0.144376969 34 R I 0.275728667 0.262529033 484 K R 0.277812806 0.156918996 650 K N 0.275727906 0.092682765 51 P H 0.27780081 0.207949147 347 V D 0.275634849 0.162043607 549 A D 0.277618034 0.184792104 701 Q E 0.275445666 0.129639485 285 H Q 0.277595201 0.164383067 221 S P 0.275424064 0.253543179 772 E [stop] 0.277569205 0.252009775 902 H Y 0.275413846 0.238626124 233 M T 0.277522281 0.101460422 408 K N 0.275278915 0.187758493 677 ------- LSRFKDS 0.277439144 0.176461932 410 G R 0.275207307 0.148329245 (SEQ ID NO: 3578) 444 E D 0.277438575 0.185715982 202 R T 0.27519939 0.225294793 287 K R 0.277424076 0.122002352 190 Q H 0.275101911 0.155497318 86 E Q 0.277422525 0.267475322 296 V A 0.274868513 0.216028266 650 K R 0.277338051 0.1661601 176 A V 0.274754076 0.101747221 119 N K 0.2772012 0.097660237 16 D V 0.274707044 0.080710216 419 E D 0.27717758 0.091079949 338 A G 0.274649181 0.21549192 849 Q H 0.277146577 0.10057266 908 K [stop] 0.274631009 0.235774306 745 A P 0.277094424 0.180486538 745 A T 0.274596368 0.139876086 895 L V 0.277059576 0.147621158 582 I T 0.274539152 0.136455089 200 V R 0.276947529 0.109871945 73 Y H 0.274522926 0.183155681 491 G A 0.276923451 0,236639042 525 ------ KLNLYL 0.272179534 0.127115618 (SEQ ID NO: 3512) 437 L P 0.276817656 0.127643327 178 D H 0.27217863 0.114858223 794 K E 0.276808052 0.108760175 186 G S 0.272004663 0.206440397 609 K E 0.274518342 0.096584602 797 LS PV 0.271846299 0.116235959 148 ----- GKPHT (SEQ 0.274483854 0.138944547 434 H L 0.271775834 0.108387354 ID NO: 3436) 269 S I 0.274483065 0.167999753 124 S C 0.271634239 0.201362524 600 L P 0.274446407 0.156944314 687 ---- PTHI (SEQ ID 0.271046382 0.217907583 NO: 3625) 609 K N 0.274296988 0.098675974 626 R I 0.271037385 0.191496316 548 E G 0.274291628 0.174184065 717 G V 0.271024109 0.162847575 282 P R 0.274223113 0.269615449 534 Y [stop] 0.270681224 0.104188898 743 Y N 0.274041951 0.169744437 150 P H 0.270599643 0.192362809 273 LA PV 0.273953381 0.083004597 552 A S 0.270597368 0.181876059 241 ----- TKYQD (SEQ 0.273953381 0.041697608 150 P S 0.270581156 0.14794261 ID NO: 3752) 752 LI PV 0.273953381 0.179521275 270 A S 0.270550408 0.145246028 500 ----- NSILD (SEQ 0.273953381 0.096079618 563 S Y 0.270533409 0.17681632 ID NO: 3598) 88 FQ DR 0.273953381 0.132934109 664 --- PAV 0.270462826 0.090794222 548 E K 0.273785339 0.140999456 97 S I 0.270410385 0.155670382 758 S T 0.273170088 0.17814745 64 A D 0.270367942 0.13574281 884 W S 0.27315778 0.127540825 143 Q E 0.27021122 0.220203083 258 E D 0.273147573 0.172394328 686 N I 0.270089028 0.228432562 720 R M 0.272984313 0.209562405 544 K [stop] 0.270051777 0.124983342 217 N H 0.272871217 0.212149421 537 G A 0.270050779 0.18424231 0 M R 0.272866831 0.105028991 902 H L 0.269853978 0.238618549 376 A G 0.27284261 0.107816996 361 G A 0.269774718 0.191146018 221 S C 0.272816553 0.204562414 963 S C 0.269617744 0.20243244 691 LR PV 0.272779276 0.168092844 965 Y H 0.26944455 0.246260675 796 YL DR 0.272779276 0.144849416 66 --- LNK 0.269318761 0.181427468 439 ---- EERR (SEQ 0.272779276 0.117493254 959 ----- ETWQS (SEQ 0.269318761 0.133778085 ID NO: 3381) ID NO: 3402) 383 S N 0.272651878 0.203030872 509 ----- SKQYN (SEQ 0.269239232 0.199612231 ID NO: 3712) 603 L M 0.272615876 0.2046327 32 L I 0.269033673 0.109933858 183 Y H 0.27230417 0.167987777 913 N I 0.265873279 0.228181021 858 R K 0.272264159 0.162833579 775 Y S 0.265844485 0.132207982 209 K N 0.269020729 0.109971766 678 S R 0.265770435 0.147977027 48 R [stop] 0.268939151 0.082435645 602 S R 0.265750704 0.118408744 466 - T 0.268825688 0.095723888 121 R T 0.265718915 0.126781949 45 E Q 0.268733142 0.139266278 818 S R 0.265623217 0.145609734 843 E Q 0.268599201 0.195661988 798 S C 0.265584497 0.073889024 643 V L 0.268577714 0.156052892 864 ------ DLSVEL 0.265506357 0.19885122 (SEQ ID NO: 3365) 285 H R 0.268299231 0.21489701 373 R G 0.265364174 0.162678423 317 D G 0.268047511 0.116283826 803 Q E 0.265269725 0.202509841 195 F L 0.268045884 0.108480308 628 D E 0.265261641 0.142156395 590 R K 0.267781681 0.208536761 194 D N 0.265249363 0.155857424 180 L V 0.267694655 0.240305187 336 R I 0.2651284 0.181377392 21 KA TV 0.267470584 0.147038119 602 S I 0.265065039 0.204267576 210 P H 0.267434518 0.190772597 34 R S 0.265026085 0.223416007 612 N S 0.267419306 0.129882451 775 Y N 0.264899495 0.150356822 440 E G 0.267419306 0.166870392 647 ---- SNIK (SEQ ID 0.264896362 0.152108713 NO: 3725) 651 P L 0.267350724 0.179171164 369 A G 0.264866639 0.127314344 686 ------- NPTHILR 0.267281547 0.145940038 407 KKHGEDWG RSTARTGA 0.26465494 0.11425501 (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: 3595) 3269) 3688) 56 Q E 0.267209421 0.156465006 117 D H 0.264598341 0.092643909 656 G D 0.267197717 0.143131022 149 K R 0.26429667 0.254633892 591 Q E 0.267046259 0.172628923 624 R S 0.264277774 0.09593797 771 A P 0.266971248 0.20146384 526 L M 0.26419728 0.176624184 667 I N 0.266893998 0.140849994 671 D N 0.264084519 0.212711081 333 L P 0.26683779 0.202160591 572 N K 0.264075863 0.218490453 168 L V 0.266833554 0.09646076 949 T S 0.263657544 0.110498861 43 R P 0.266528412 0.166392391 20 KKA T-V 0.263583848 0.126615658 76 M T 0.26642278 0.06437874 56 Q R 0.263561421 0.151855491 85 WE CC 0.266335966 0.095081027 492 K N 0.263524564 0.121563708 784 A D 0.266225364 0.186318048 315 G D 0.26350398 0.250984577 179 E G 0.266200643 0.159572948 440 E [stop] 0.260572941 0.226197983 282 P T 0.266142294 0.234821238 245 D Y 0.260411841 0.171518027 505 I V 0.266033676 0.153318009 838 T A 0.260310871 0.127668195 884 W C 0.265892315 0.146379991 510 K E 0.260303511 0.170827119 705 Q L 0.265873279 0.218762249 885 T I 0.260229119 0.18213929 625 T S 0.263431268 0.11997699 606 G C 0.260187776 0.249968408 657 I S 0.26332391 0.140695845 298 A P 0.260175418 0.137767012 688 T R 0.26332192 0.129910161 31 L R 0.260094537 0.205569477 835 W R 0.263224631 0.136063076 19 T I 0.259989986 0.207028692 903 R S 0.263145681 0.157044964 886 K R 0.259901164 0.087667222 876 S T 0.262876961 0.112192073 817 T S 0.259831477 0.054519088 468 K R 0.262863102 0.120169191 901 S T 0.259815097 0.082797155 590 --- RQG 0.26279648 0.125412364 343 W S 0.259761267 0.144643456 912 L R 0.262679132 0.194562045 25 T R 0.259617038 0.188030957 222 G R 0.262575495 0.121179798 238 S P 0.259597922 0.12796144 379 P A 0.262556362 0.200217288 343 W R 0.259570669 0.092335686 7 N Y 0.262545332 0.249153444 317 D Y 0.259540606 0.174340169 514 C R 0.262528328 0.153764358 347 ------ VCNVICK 0.259425173 0.186479916 (SEQ ID NO: 3770) 964 -- FY 0.262491519 0.18918584 606 G S 0.259379927 0.201078104 951 N I 0.262433241 0.181173796 879 N S 0.259300679 0.19356618 738 A S 0.262344275 0.213159289 784 A S 0.259182688 0.192685039 109 Q K 0.262161279 0.235829587 48 R I 0.259088713 0.132594855 371 Y C 0.262089785 0.121531872 112 L M 0.25908476 0.122948809 62 S I 0.262062515 0.217469036 181 V A 0.259030426 0.153412207 967 K N 0.261999761 0.11991933 567 V M 0.258972858 0.206147057 395 R T 0.261975414 0.202071604 787 A P 0.258909575 0.199316536 546 K E 0.261933935 0.196957538 741 --- LLY 0.258835623 0.170116186 473 D H 0.26183541 0.210514432 280 -- LP 0.258711013 0.142341042 422 ERIDKKV 0.261766763 0.175889641 639 ------- ERREVLD 0.258711013 0.096645952 (SEQ ID NO: (SEQ ID NO: 3393) 3395) 661 E D 0.261685468 0.21738252 11 RR AS 0.258711013 0.198257452 807 K N 0.261631077 0.137745855 660 G V 0.258707306 0.163939116 495 A P 0.261336035 0.145111761 519 ----- QKDGVK 0.255711118 0.090066635 (SEQ ID NO: 3641) 474 E V 0.261129255 0.1424745 977 V E 0.255573788 0.223531947 100 A V 0.261042682 0.097040591 448 S P 0.255534334 0.216106849 660 G A 0.260992911 0.257791059 872 ---- LSEE (SEQ 0.255312236 0.130213196 ID NO: 3572) 613 G V 0.260991628 0.142830183 534 -Y DS 0.255312236 0.080703663 356 --- EKK 0.260606313 0.08939761 765 -- GK 0.255312236 0.10865158 419 E R 0.260606313 0.127113021 28 MK C- 0.255312236 0.091611028 62 S N 0.258582734 0.206139171 826 EK DR 0.255312236 0.103881802 716 G C 0.258579754 0.205579693 302 I S 0.2552956 0.169641843 185 L M 0.258521471 0.171738368 866 S I 0.255156321 0.209048192 407 K N 0.258498581 0.130697064 472 K M 0.255025429 0.186702335 973 W C 0.258383156 0.162271324 165 R S 0.25497678 0.100932181 419 E [stop] 0.258326013 0.179526252 242 K R 0.254948866 0.230748057 457 R K 0.258323684 0.189885325 311 --- KLK 0.25494628 0.09906032 876 S R 0.258284608 0.118534232 200 V E 0.254874846 0.123567532 19 T S 0.258270715 0.163493921 129 C R 0.25474894 0.168215252 680 F S 0.258237866 0.129529513 284 P A 0.254723328 0.141080203 2 E A 0.257800465 0.161538463 232 --- CMG 0.254645266 0.200305653 20 K D 0.257606921 0.080857215 946 N S 0.2545847 0.199844301 481 K E 0.257527339 0.131433394 80 I V 0.254434146 0.224490053 227 A P 0.257425537 0.162403215 327 G V 0.25442364 0.168129037 319 A G 0.25734846 0.183688663 107 I V 0.254364427 0.144921072 773 R T 0.257312824 0.076585471 777 R I 0.254281708 0.219559132 59 S R 0.257311236 0.098683009 801 L P 0.254280774 0.139428109 522 G D 0.257141461 0.205906219 417 Y H 0.254230823 0.102936144 164 E D 0.257089377 0.152824439 251 Q L 0.254085129 0.154282551 705 QA R- 0.257083631 0.186668119 856 Y [stop] 0.254033585 0.087466157 82 H Y 0.256846745 0.145259346 753 I F 0.25397349 0.160875608 606 G R 0.256772211 0.222683526 303 W G 0.253842324 0.162875151 281 P L 0.256724807 0.103452649 852 Y H 0.253666441 0.130229811 471 D Y 0.256649107 0.251689277 223 P S 0.253640033 0.10193396 231 A S 0.256583564 0.187236499 472 K [stop] 0.253606489 0.18360472 433 K N 0.256518065 0.138408672 471 D N 0.250823008 0.230246417 883 S G 0.256375244 0.115658726 714 R [stop] 0.250772621 0.098784657 672 P A 0.256302042 0.169194225 192 A S 0.25063862 0.18266448 681 KD R- 0.256180855 0.206050883 668 A D 0.250605134 0.186660163 762 G A 0.256159485 0.149790153 147 -- KG 0.250457437 0.166419391 774 Q R 0.256113556 0.176872341 464 IE DR 0.250457437 0.129773988 630 P T 0.255980317 0.147464802 325 -- LK 0.250457437 0.197198993 151 H Q 0.255948941 0.118092357 812 C R 0.250440238 0.175896886 38 PDL LT[stop] 0.255810824 0.132108929 215 G C 0.250425413 0.161826099 240 LT PV 0.255810824 0.138991378 564 G D 0.250350924 0.110254953 851 T S 0.25343316 0.097399235 787 A D 0.250325364 0.160958271 725 K E 0.253359857 0.175271591 674 G V 0.25029228 0.086627759 115 V L 0.253354021 0.093695173 182 T A 0.250160953 0.131790182 918 T I 0.253156435 0.23080792 383 S R 0.250148943 0.108851149 630 P L 0.252953716 0.223745102 497 E G 0.250036476 0.073841396 75 E Q 0.252809731 0.120415311 154 Y C 0.250036476 0.229055007 480 L M 0.252718021 0.192126204 827 K R 0.250016633 0.209047833 197 S T 0.252713621 0.125864993 722 Y [stop] 0.249927847 0.149439604 779 E Q 0.25259488 0.11277405 380 Y H 0.249902562 0.080398395 340 EV DC 0.252472535 0.047624791 68 K [stop] 0.249695921 0.134323821 12 R K 0.252469729 0.189301078 178 D Y 0.24960373 0.233005696 515 A S 0.252433747 0.168422609 880 D V 0.249521617 0.133706258 615 ---- VIEK (SEQ 0.252369421 0.112001396 543 K R 0.249512007 0.164262829 ID NO: 3778) 513 N S 0.252353713 0.094778563 101 Q E 0.249509933 0.220597507 274 A P 0.252335379 0.222801897 261 L P 0.249467079 0.135680009 474 E Q 0.252314637 0.161495393 410 G A 0.249451996 0.157770206 898 K E 0.252289386 0.197783073 916 --------- FETHAAEQA 0.249445316 0.231377364 (SEQ ID NO: 3410) 397 Q K 0.252164481 0.217428232 467 L M 0.249366626 0.154018589 455 W S 0.25204917 0.248519347 745 A V 0.249363082 0.18169323 135 P S 0.252041319 0.143618662 773 R K 0.249259705 0.143796066 500 N D 0.252036438 0.129905572 221 S Y 0.249177365 0.225580403 204 S I 0.252028425 0.131493678 953 DK CL 0.248980289 0.153230139 235 A T 0.251989659 0.158776047 29 KT NC 0.247444507 0.126896702 839 I M 0.251899392 0.164461403 777 R G 0.247073817 0.140696212 473 D N 0.251700557 0.215226558 720 R T 0.246870637 0.139065914 715 A D 0.251688144 0.14707302 529 --- YLI 0.246804685 0.066320143 352 K E 0.251658395 0.165058904 977 V M 0.24675063 0.232768749 413 R I 0.251517421 0.230382833 414 G C 0.246666689 0.173156358 272 G R 0.251488679 0.185835986 487 G D 0.246317089 0.205561043 647 S R 0.251423405 0.100129809 696 S G 0.246296346 0.111834798 333 L M 0.251344003 0.196286065 515 A G 0.246293045 0.17108612 964 F Y 0.25104576 0.166483614 438 -- EE 0.246243471 0.172505379 474 E K 0.250927827 0.172968831 730 A S 0.246013083 0.141113967 751 M V 0.250846737 0.147715329 574 N D 0.245981475 0.227302881 213 ------ QIGGNS 0.248980289 0.134226006 747 T S 0.245965899 0.17316365 (SEQ ID NO: 3639) 57 P H 0.248900571 0.215896368 740 D Y 0.245945789 0.167910919 301 V L 0.24886944 0.106508651 640 R I 0.245900817 0.188813199 586 A P 0.248863678 0.211216154 3 I F 0.245678 0.179390362 909 F Y 0.248749713 0.182356511 355 N D 0.245670687 0.09594124 626 R T 0.248743703 0.208846467 371 Y [stop] 0.245500092 0.105713424 186 G R 0.24871786 0.199871451 51 P S 0.24544462 0.203086773 645 D N 0.248657263 0.126033155 28 M L 0.245403036 0.189135882 173 K R 0.24855018 0.153000538 458 A D 0.245377197 0.208634207 519 Q [stop] 0.248535487 0.209163595 572 N I 0.24524576 0.164550203 888 R I 0.248471987 0.104169936 959 E [stop] 0.245144817 0.219795779 491 G C 0.248444417 0.204717262 527 N S 0.245098015 0.16437657 527 N K 0.248397784 0.121054149 321 P S 0.245086017 0.160736605 893 L V 0.248370955 0.162725859 579 N K 0.244981546 0.165374413 379 P H 0.248321642 0.237522233 707 A P 0.244857358 0.22019856 900 F L 0.248316685 0.187112489 414 G A 0.244717702 0.113316145 974 ----- KPAV (SEQ 0.24830974 0.09950399 963 S G 0.244450471 0.188301401 ID NO: 3518)[stop] 409 H R 0.248289463 0.198716638 108 D H 0.244382837 0.099322593 278 I T 0.248133293 0.145997719 19 T R 0.244301214 0.22638105 230 ----- DACMG 0.248087937 0.141736439 457 R S 0.244059876 0.203207391 (SEQ ID NO: 3342) 412 ------ DWGKVY 0.248000785 0.085936492 735 R Q 0.243928198 0.170841115 (SEQ ID NO: 3370) 548 E V 0.244464905 0.11615159 280 L P 0.243719915 0.122012762 135 P H 0.247697198 0.24068468 529 Y C 0.241113191 0.148105236 824 V E 0.247676063 0.211426874 102 P S 0.241100901 0.126616893 250 H N 0.247644364 0.173527273 568 P R 0.241086845 0.174639843 101 Q [stop] 0.247598429 0.141658982 416 V L 0.24098406 0.086334529 364 F S 0.247520151 0.139448351 834 G S 0.240965197 0.161966438 420 A G 0.247498728 0.234162787 322 L M 0.240965197 0.161073617 627 Q P 0.243601279 0.172067752 538 G s 0.240933783 0.072861862 571 -- VN 0.243561744 0.078796567 536 K E 0.240888218 0.130971778 25 T A 0.243399906 0.118102255 676 P s 0.240757682 0.111329254 129 C S 0.243399597 0.045331126 108 D E 0.240718917 0.12602791 522 G S 0.243323907 0.089702225 217 N K 0.240713475 0.15867648 695 E K 0.243320032 0.148139423 342 D E 0.24062135 0.069616641 603 L V 0.243217969 0.148743728 471 D H 0.240564636 0.181535186 404 H Q 0.242964457 0.173626579 218 S N 0.240529528 0.151826239 469 E Q 0.242802772 0.126770274 191 R I 0.240513696 0.229207246 484 KWY NSS 0.242735572 0.182387025 963 --- SFY 0.240421887 0.098315268 797 L V 0.2425558 0.204091719 77 K N 0.240381155 0.116252284 928 I F 0.242416049 0.232458614 637 ---- TFER (SEQ 0.240288787 0.148900082 ID NO: 3744) 974 K R 0.242320513 0.114367362 571 V L 0.240279118 0.074639743 687 P L 0.242304633 0.20007901 346 M T 0.240147015 0.108146398 885 T R 0.242245862 0.204992576 512 Y [stop] 0.240104852 0.068415116 768 T S 0.242193729 0.178836886 430 G C 0.240047705 0.20806366 588 ---- GKRQ (SEQ 0.242084293 0.124769338 599 D G 0.239869359 0.206138755 ID NO: 3440) 262 ------ ANLKD1 0.242084293 0.137081914 462 F s 0.23971457 0.144092402 (SEQ ID NO: 3325) 246 I C 0.242084293 0.107590717 724 S R 0.239681347 0.127922837 288 E [stop] 0.242056668 0.219648186 61 T S 0.239626948 0.164373644 978 -[stop] YV 0.242009218 0.097706533 525 K [stop] 0.239380142 0.131802154 110 R [stop] 0.241965346 0.120709959 296 V E 0.239355864 0.120748179 741 L M 0.241912289 0.193137515 968 K Q 0.238999998 0.129755167 72 D Y 0.241758248 0.224435844 617 E K 0.238964823 0.084548152 653 N Y 0.24166971 0.0887834 120 E K 0.238945442 0.100801456 324 R [stop] 0.241651421 0.106997792 44 L V 0.238860984 0.10949901 293 Y D 0.241440886 0.202068751 315 G R 0.238751925 0.215543005 695 E A 0.241330438 0.115436697 87 E [stop] 0.238731064 0.177299521 798 -------- SKTLAQYT 0.241309883 0.196326087 204 S C 0.236855446 0.164372504 (SEQ ID NO: 3714) 866 S G 0.241237257 0.109329768 82 H Q 0.236837713 0.172606609 818 S G 0.238509249 0.201919192 861 ------- VVKDLSVE 0.236770505 0.195127344 (SEQ ID NO: 3837) 189 G V 0.238447609 0.179422249 493 P L 0.236700832 0.181806123 394 A D 0.238439863 0.125867824 474 E G 0.236695789 0.180206764 861 - V 0.238439176 0.202222792 302 I F 0.236588615 0.136160472 357 K E 0.238434177 0.184905545 109 Q R 0.236576305 0.166840659 353 L V 0.23831895 0.17206072 97 S R 0.236508024 0.179878709 488 D V 0.2382354 0.188903119 40 L V 0.236210141 0.21459356 684 ----- LGNPT (SEQ 0.2382268 0.157487774 761 F C 0.236145536 0.170046245 ID NO: 3549) 376 A V 0.238191318 0.142572457 50 K N 0.236137845 0.22219675 349 N D 0.238174065 0.053089179 205 N K 0.236073257 0.12180008 331 F S 0.238131141 0.093269792 399 G D 0.236045787 0.181873656 971 E D 0.238076025 0.194709418 521 D Y 0.235934057 0.180076567 775 Y F 0.238057448 0.214475137 665 A D 0.235822456 0.220273467 730 A T 0.238038323 0.175731569 252 K R 0.235675801 0.120466673 631 --- ALF 0.237949975 0.190053084 646 S R 0.235675637 0.183914638 504 D H 0.23794567 0.139048842 102 P A 0.235653058 0.16760539 94 G D 0.237937578 0.15570335 810 S N 0.235539825 0.164257896 291 E [stop] 0.237828954 0.19900832 936 R S 0.235496123 0.188093786 871 R I 0.237759309 0.236033629 111 K R 0.235492778 0.118354865 761 F Y 0.237669703 0.128380283 220 A V 0.235467868 0.198253635 910 ---- VCLN (SEQ 0.237633429 0.152561858 855 --- RYK 0.235222552 0.156668306 ID NO: 3768) 731 D Y 0.237566392 0.167223625 354 I N 0.235178848 0.098023234 245 D A 0.237553897 0.189220496 158 C F 0.235135625 0.169427052 979 L-E VWS 0.237546222 0.150693183 689 H R 0.235102048 0.220671524 208 V E 0.237546113 0.17752812 594 E--F GRII (SEQ ID 0.235051862 0.132444365 NO: 3451) 483 Q R 0.23746372 0.159123209 154 Y D 0.234980588 0.232501764 634 V M 0.237398857 0.152995502 870 D V 0.234951394 0.118777361 837 T I 0.237183554 0.104666535 198 I N 0.234906329 0.184047389 479 E Q 0.237085358 0.157162064 76 M I 0.234796263 0.126238567 555 F V 0.237065318 0.182110462 434 H N 0.234726089 0.143174214 872 LS PV 0.23698628 0.179042308 570 E Q 0.232497705 0.099759258 601 L P 0.236954247 0.122470012 645 D E 0.2323596 0.127143455 127 F L 0.236892252 0.129435749 54 I N 0.23228755 0.182788712 484 --KW NSSL (SEQ 0.234680329 0.165662856 725 K R 0.232253631 0.11253677 ID NO: 3599) 49 K [stop] 0.234415257 0.114263318 771 A S 0.232158252 0.16845905 896 L P 0.234287413 0.192149813 896 L V 0.232108864 0.141878039 530 L V 0.234192802 0.173965176 487 G V 0.232053935 0.22651513 643 V A 0.234106948 0.176627185 655 I V 0.231994505 0.148078533 711 E K 0.234002178 0.154011045 708 K R 0.231988811 0.183732743 918 ----- THAAEQ 0.23373891 0.117744474 699 E D 0.231934703 0.178386576 (SEQ ID NO: 3747) 473 D E 0.233630727 0.181285916 446 A P 0.231896096 0.131534649 666 V E 0.233615017 0.210063502 902 H P 0.231793863 0.226418313 610 ------- LANGRVIE 0.233598549 0.098900798 555 F S 0.231772683 0.154329003 (SEQ ID NO: 3538) 463 V A 0.233582437 0.13705941 685 G R 0.231646911 0.113490558 771 A V 0.233335501 0.144017771 430 G A 0.231581897 0.168869877 89 Q H 0.233314663 0.120225936 423 R G 0.231294589 0.188648387 18 N D 0.233234266 0.100130745 773 R S 0.231238362 0.139470334 547 P A 0.233232691 0.192665943 148 --- GKP 0.231166477 0.084708483 628 D H 0.233191566 0.113338873 795 TY PG 0.231166477 0.229360354 290 I V 0.233178351 0.147527858 598 N S 0.230890539 0.114382772 837 ---- TTIN (SEQ ID 0.233038063 0.141130326 109 Q [stop] 0.230738213 0.089332392 NO: 3761) 909 -- FV 0.233038063 0.131142006 481 ---- KLQK (SEQ 0.23071553 0.20441951 ID NO: 3513) 260 R G 0.232970656 0.120191772 592 -GR DNQ 0.230655892 0.071944702 707 ------- AKEVEQR 0.232896265 0.116012039 254 I T 0.2306357 0.069580284 (SEQ ID NO: 3314) 638 F S 0.232893598 0.149395863 530 L R 0.230571343 0.193066361 671 D A 0.232880356 0.163658679 365 W [stop] 0.230333383 0.12753339 443 S T 0.232784832 0.170920909 131 Q R 0.2302555 0.206903114 392 K N 0.232687633 0.108105318 244 Q E 0.230190451 0.222512927 500 N I 0.232640715 0.1305158 900 F I 0.230181139 0.149890666 111 K E 0.232613623 0.097737029 318 E Q 0.230160478 0.212890421 610 L V 0.229644521 0.180175813 312 L M 0.230110955 0.204915228 847 E G 0.229640073 0.111868196 106 N S 0.230101564 0.155287559 636 -- LT 0.229485665 0.192188426 968 K R 0.230017803 0.168949701 665 A G 0.229408129 0.212381399 631 A P 0.229723383 0.159718894 82 H R 0.229295108 0.108155794 864 D G 0.226094276 0.177950676 371 Y D 0.229277426 0.117283148 140 K R 0.226067524 0.114127554 148 G V 0.229238098 0.159823444 814 F S 0.225959256 0.114511043 443 S I 0.229142738 0.169822985 215 G D 0.225350951 0.086324983 660 G C 0.229029418 0.194710612 138 V L 0.225143743 0.155359682 181 V D 0.228966959 0.164951106 192 A T 0.22512485 0.144695235 832 A P 0.228767879 0.092204547 502 I S 0.225038868 0.197567126 152 T A 0.228705386 0.182569685 494 F V 0.224968248 0.143764694 685 G A 0.228675631 0.17392363 162 E D 0.224950043 0.153078143 112 L P 0.22866263 0.221195984 788 Y [stop] 0.22492674 0.129943744 214 I T 0.22857342 0.11423526 263 N I 0.224722541 0.117014395 610 L M 0.22841473 0.205382368 918 ------- THAAEQA 0.224719714 0.202778103 (SEQ ID NO: 3748) 110 R G 0.228257249 0.086720324 272 G A 0.224696933 0.211543463 590 R S 0.228041456 0.143022556 322 L V 0.2246772 0.156881144 596 I M 0.227907909 0.117874099 132 C R 0.224659007 0.146010501 1 Q P 0.227785203 0.168369144 657 I F 0.224649177 0.161870244 567 V E 0.227660557 0.156302233 917 - E 0.224592553 0.150266826 32 L V 0.227635279 0.12966479 704 ------ IQAAKE 0.224567514 0.109443666 (SEQ ID NO: 3481) 65 N S 0.22749218 0.063907676 328 --- FPS 0.224567514 0.088644166 291 E G 0.227296993 0.128103388 455 W R 0.224240948 0.159412878 635 A V 0.22713711 0.159876533 528 -- LY 0.224210461 0.204469226 894 S I 0.227093532 0.165363718 289 G A 0.224158556 0.07475664 675 C R 0.227077437 0.19145584 477 RCE SFS 0.224109734 0.175971589 863 K E 0.227027728 0.176903569 290 I M 0.224106784 0.121750806 130 S N 0.226933191 0.162445952 699 EK AV 0.223971566 0.120407858 187 K E 0.226883263 0.185467572 190 ------ QRALDFY 0.223971566 0.118248938 (SEQ ID NO: 3646) 330 S G 0.226753105 0.138020012 287 K [stop] 0.223966216 0.119362605 224 V A 0.226536103 0.153342124 33 V A 0.223884337 0.200194354 802 A T 0.226368502 0.154358709 321 P R 0.223833871 0.153353055 148 G S 0.226168476 0.097680006 149 K [stop] 0.221989288 0.160692576 732 D E 0.226134547 0.109002487 230 --- DAC 0.221929991 0.119956442 350 V L 0.223803585 0.123552417 559 -I TV 0.221929991 0.162385076 598 N D 0.223755594 0.127015451 125 S T 0.221924231 0.192354491 784 A V 0.22374846 0.140061096 738 A P 0.221764129 0.166374434 540 L P 0.223660834 0.130300184 389 K L 0.221512528 0.096823472 330 S R 0.2236138 0.142019721 829 K M 0.22130603 0.111760034 162 E Q 0.223613045 0.201165398 435 I V 0.221227154 0.143247597 128 A V 0.223401934 0.126557909 626 R S 0.221038435 0.198631408 296 V L 0.223401818 0.13392173 135 P R 0.221017429 0.116069626 634 V E 0.223309652 0.118175475 203 E Q 0.22076143 0.119826394 356 E Q 0.22323735 0.143945409 783 T I 0.220740744 0.134860122 289 G V 0.223202197 0.145913012 672 P S 0.220729114 0.141569742 805 T N 0.223188037 0.139245678 361 G D 0.220639166 0.141910298 599 D Y 0.223008187 0.183323322 690 I M 0.220631897 0.180897111 246 I M 0.222998811 0.092368092 552 A G 0.220614882 0.110523427 36 M K 0.222893666 0.113406903 441 R I 0.220543521 0.155159451 476 C [stop] 0.222743024 0.176188321 218 S R 0.220420945 0.153071466 464 I V 0.222701858 0.18421718 917 ------ ETHAAE 0.220288736 0.09840913 (SEQ ID NO: 3400) 224 V L 0.222626458 0.136476862 204 S R 0.220214876 0.101819626 42 E G 0.22255062 0.189996134 255 K E 0.220080844 0.12573371 832 A S 0.222538216 0.190249328 479 E D 0.220079089 0.099777598 734 V I 0.222476682 0.141366416 438 E G 0.219979549 0.120742867 146 D H 0.22246095 0.16577062 605 T 1 0.219976898 0.126979027 755 AN DS 0.222404547 0.10970681 109 Q E 0.219959218 0.140761458 581 I V 0.222357666 0.17105795 744 Y C 0.219956045 0.132833086 698 K [stop] 0.222296953 0.103211977 930 ------ RSWLFL 0.219822658 0.120132898 (SEQ ID NO: 3689) 507 G D 0.22225927 0.153400026 172 H Q 0.219757029 0.10461302 246 I V 0.222098073 0.120973819 329 P A 0.219753668 0.110968401 47 L P 0.222066189 0.162841956 783 T S 0.219504994 0.118049041 301 VI CL 0.222059585 0.122617461 610 L P 0.219499239 0.160199117 210 PL DR 0.222059585 0.108090576 433 --- KHI 0.216309574 0.092546366 174 ------ PEANDE 0.222059585 0.182232379 375 E [stop] 0.216261145 0.199757211 (SEQ ID NO: 3616) 160 --- VSE 0.222059585 0.137662445 297 V A 0 216143366 0.15509483 68 K E 0.222044865 0.16348242 148 ------- GKPHTNYF 0.216132461 0.211503255 (SEQ ID NO: 3439) 38 P A 0.219404694 0.107368636 645 D V 0.21604012 0.117781298 446 A V 0.218887024 0.176662627 147 KG R- 0.215998635 0.103939398 41 R K 0.218858764 0.128896181 292 A S 0.215943856 0.157240024 810 S R 0.21870856 0.129689435 387 R G 0.215798372 0.151215331 83 V L 0.218625171 0.138945755 157 R T 0.215790548 0.152247144 474 E D 0.218570822 0.130400355 203 E K 0.215703649 0.168783031 712 Q [stop] 0.218254094 0.091444311 123 T S 0.21570133 0.105624839 371 Y H 0.218137961 0.189187449 383 S G 0.215603433 0.137401501 35 V L 0.218110612 0.095949997 310 Q [stop] 0.21551735 0.135329921 687 P R 0.21806458 0.159278352 592 G A 0.215456343 0.13373272 621 Y N 0.218036238 0.089590425 562 K R 0.215325036 0.122831356 753 I N 0.21792347 0.101271232 951 N S 0.21531813 0.214926405 337 Q L 0.217694196 0.180223104 823 R I 0.215273573 0.191310901 366 Q E 0.217564323 0.195945495 723 A P 0.215193332 0.108699964 156 G R 0.217510036 0.186872459 713 R T 0.215008884 0.104394548 813 G A 0.217404463 0.109971024 878 N I 0.214931515 0.11752804 911 C W 0.217360044 0.181625646 145 N H 0.214892161 0.185408691 896 L Q 0.217312492 0.09770592 338 A T 0.21480521 0.15310635 395 R S 0.217267056 0.103436045 169 L V 0.214751891 0.163877193 506 S R 0.217238346 0.104753923 30 T P 0.214714414 0.144104489 459 KA NR 0.217171538 0.126085081 164 E A 0.214693055 0.151750991 605 T S 0.217140582 0.104288213 734 V F 0.214507965 0.184315198 147 K R 0.217113942 0.165662771 841 G V 0.21449654 0.163419397 358 K R 0.217018444 0.148484962 848 G D 0.214491489 0.166744246 710 V E 0.216906218 0.158321415 93 VGL WA [stop] 0.21434042 0.171347302 948 T N 0.216794988 0.204294035 747 T K 0.214238165 0.122971462 62 S T 0.216604466 0.167204921 688 T K 0.214222271 0.126368648 827 K E 0.216603742 0.107241416 878 N Y 0.214205323 0.111547616 457 R G 0.216513116 0.052626339 190 Q E 0.214170887 0.122424442 159 N K 0.216507269 0.109954763 901 ------ SHRPVQE 0.212684828 0.084903934 (SEQ ID NO: 3707) 177 N D 0.216431319 0.179290406 459 K E 0.212680715 0.093525423 921 ------- AEQAALN 0.216389396 0.149922966 228 L V 0.212591965 0.092947468 (SEQ ID NO: 3308) 633 -- FV 0.216309574 0.179645361 831 T I 0.212576099 0.16705965 523 VKKLN (SEQ 0.214126014 0.14801882 819 A T 0.212522918 0.164976137 ID NO: 3782) 792 --- PSK 0.214126014 0.088425611 645 D G 0.21251225 0.121902674 171 --- PHK 0.214126014 0.186440571 794 K R 0.212502396 0.178916123 918 -- TH 0.214126014 0.10224323 859 Q P 0.212311083 0.170329714 833 T S 0.214086868 0.0993742 738 A G 0.212248976 0.161293316 72 D E 0.214062412 0.115630034 409 H Q 0.212187222 0.201696134 560 N K 0.213945541 0.173784949 192 ----- ALDFY (SEQ 0.212165997 0.132724298 ID NO: 3317) 906 Q L 0.213845132 0.187470303 782 ------ LTAKLA 0.212165997 0.121732843 (SEQ ID NO: 3580) 461 S I 0.21384342 0.180386801 86 EEF DCL 0.212165997 0.090389548 622 N I 0.213809938 0.161761781 251 Q H 0.212109948 0.151365816 768 T I 0.213809607 0.08102538 197 S R 0.211641987 0.087103971 204 --- SNH 0.21345676 0.114570097 196 Y C 0.211596178 0.195825393 944 - Q 0.213449244 0.157411492 125 S I 0.211507893 0.117116373 49 K R 0.213334728 0.181645679 237 A T 0.211485023 0.118730598 411 E [stop] 0.213222053 0.149931485 574 N S 0.211257767 0.135650502 719 S A 0.213134782 0.140566151 73 Y C 0.211200986 0.169366394 731 D E 0.213022905 0.120709041 380 Y [stop] 0.21093329 0.132735624 475 F S 0.213010505 0.137035236 219 C Y 0.210905605 0.190298454 305 N K 0.213008678 0.108878566 777 R S 0.210879382 0.15535129 30 TL PC 0.212945774 0.075648365 799 ------ KTLAQYT 0.210719207 0.130227708 (SEQ ID NO: 3530) 611 A G 0.212935031 0.195766935 79 A T 0.210637972 0.047863719 266 DI AV 0.212926287 0.127744646 654 L R 0.210450467 0.143325776 730 ---- ADDM (SEQ 0.212926287 0.097551919 479 E K 0.210277517 0.147945245 ID NO: 3302) 684 -- LG 0.212926287 0.093015719 595 F I 0.208631842 0.129889087 979 LE[stop]GSPG VSSKDLK 0.212926287 0.091900005 765 G R 0.208575469 0.10091353 (SEQ ID NO: (SEQ ID NO: 3251) 3808) 241 ---- TKYQ (SEQ 0.212926287 0.1464038 506 S G 0.208540925 0.155512988 ID NO: 3751) 949 T I 0.212862846 0.194719268 408 K R 0.208534867 0.133392724 709 E G 0.212846074 0.116849712 171 P A 0.208511912 0.145333852 926 -- LN 0.212734596 0.151263965 953 -- DK 0.208375969 0.185478366 587 F E 0.210211385 0.204490333 518 W C 0.208374964 0.121746678 444 E Q 0.210197326 0.171958409 34 R G 0.208371871 0.100655798 546 K Q 0.210196739 0.176398222 663 ---- IPAV (SEQ ID 0.208314284 0.125213293 NO: 3479) 645 D Y 0.210085231 0.190055155 737 T S 0.208225559 0.129504354 67 N S 0.210019556 0.13100266 6 I N 0.208110644 0.078448603 403 L P 0.209919624 0.075615563 677 L M 0.208075234 0.142372791 452 L P 0.209882094 0.127675947 456 L Q 0.208040599 0.142959764 733 M V 0.209851123 0.136163056 190 Q R 0.207948331 0.189816674 872 L P 0.209831548 0.152338232 382 S G 0.207889255 0.137324724 882 S R 0.209789855 0.108285285 953 D H 0.207762178 0.180457041 679 R T 0.209762925 0.169692137 522 G R 0.207711735 0.201735272 553 ------- NRFYTVI 0.209733011 0.13607198 655 I F 0.207554053 0.114186846 (SEQ ID NO: 3596) 650 ---- KPMN (SEQ 0.209706804 0.099600175 345 D N 0.207459671 0.194429167 ID NO: 3523) 802 AQ DR 0.209706804 0.100831295 619 T A 0.20742287 0.107807162 415 K R 0.209696722 0.172211853 273 L M 0.207369167 0.150911133 470 A P 0.209480997 0.11945606 695 E G 0.207324806 0.170023455 389 K R 0.209459216 0.190864781 662 N S 0.207198335 0.146245893 233 M K 0.209263613 0.148910419 102 P R 0.2071 03872 0.104479817 846 V A 0.209194154 0.132301095 212 E G 0.207077093 0.167731322 803 Q R 0.209112961 0.157007924 118 G V 0.20699607 0.113451465 594 -EF GRI 0.209067243 0.142920346 841 G R 0.20698149 0.160303912 418 D Y 0.208952621 0.201914561 501 S R 0.206963691 0.188972116 424 I N 0.208940616 0.184257414 402 L M 0.206953352 0.103953797 152 ----- TNYFG (SEQ 0.208921679 0.069015043 642 ------- EVLDSSN 0.206944663 0.088763805 ID NO: 3756) (SEQ ID NO: 3406) 184 ------- SLGKFGQ 0.208921679 0.145515626 448 S C 0.205480956 0.165327281 (SEQ ID NO: 3717) 944 ---- QTNK (SEQ 0.208921679 0.115799997 341 V L 0.205333121 0.121382241 ID NO: 3652) 435 IK DR 0.208921679 0.100379476 351 K [stop] 0.205260708 0.137391414 926 LN PV 0.208921679 0.122257143 408 K [stop] 0.205233141 0.101895161 31 L P 0.208720548 0.120146815 626 R [stop] 0.204917321 0.133170214 426 ------ KKVEGLS 0.206944663 0.120828794 426 K N 0.204813329 0.115277631 (SEQ ID NO: 3507) 273 -- LA 0.206944663 0.200099204 217 N D 0.204605492 0.15571936 631 AL DR 0.206944663 0.132545056 55 P A 0.204494052 0.203454056 75 E V 0.206746722 0.108008381 979 L--E VSSK (SEQ 0.204463305 0.104199954 ID NO: 3797) 159 ------ NVSEHER 0.206678079 0.108971025 789 EG GD 0.204429605 0.094907378 (SEQ ID NO: 3606) 974 - K 0.206678079 0.087902725 174 P H 0.204410022 0.192547659 13 L T 0.206678079 0.17404612 37 T I 0.20435056 0.108024009 135 P L 0.206613655 0.11493052 230 D Y 0.204310577 0.163888419 576 D N 0.206571359 0.197674836 369 A D 0.204246596 0.143255593 396 -- YQ 0.206474109 0.165665557 567 V L 0.204221782 0.133245956 426 K R 0.206261752 0.175070461 356 E G 0.204079788 0.096784994 720 R S 0.206187746 0.130762963 826 E G 0.204045427 0.079692638 731 D H 0.206140141 0.18515674 234 ------ GAVASF 0.203921342 0.148635343 (SEQ ID NO: 3423) 792 ----- PSKTY (SEQ 0.206037621 0.119445689 791 - LP 0.203921342 0.086381396 ID NO: 3623) 470 ------ ADKDEFC 0.206037621 0.160849031 550 F Y 0.203856294 0.154808557 (SEQ ID NO: 3306) 846 ---- VEGQ (SEQ 0.205946011 0.115023996 139 Y H 0.203748432 0.112669732 ID NO: 3773) 730 ----- ADDMV 0.205946011 0.203904239 842 K E 0.203739019 0.14619773 (SEQ ID NO: 3303) 195 F S 0.205931771 0.0997168 565 E D 0.203689065 0.115937226 763 R G 0.205931024 0.177755816 667 IA TV 0.203650432 0.146532587 668 A G 0.205831825 0.181720031 554 ----- RFYTV (SEQ 0.203650432 0.085651298 ID NO: 3666) 123 T I 0.205810457 0.169798366 481 ----- KLQKW 0.203650432 0.173739202 (SEQ ID NO: 3514) 394 A G 0.205790009 0.129212763 64 A V 0.203579261 0.147026682 776 T N 0.205770287 0.088016724 429 E K 0.203478388 0.197959656 779 E D 0.205703015 0.117547264 659 R W 0.203469266 0.155374384 787 A G 0.205542455 0.113825299 644 L M 0.201626647 0.191409491 775 Y [stop] 0.203457477 0.112309611 326 K E 0.201516415 0.172628702 420 A P 0.203276202 0.137871454 584 P T 0.201277532 0.157595812 844 -- LK 0.20327417 0.108693201 216 G A 0.201151425 0.135718161 543 KK DR 0.20327417 0.081409516 158 C R 0.200895575 0.132515505 483 QK DR 0.203103924 0.108226373 557 T P 0.20079665 0.175823626 661 E---N DHSRD (SEQ 0.203103924 0.080468187 615 ------- VIEKTLY 0.20079665 0.14533527 ID NO: 3355) (SEQ ID NO: 3779) 591 -------- QGREFIWN 0.203103924 0.127711804 121 R I 0.200425228 0.146944719 (SEQ ID NO: 3637) 434 ----- HIKLE (SEQ 0.203103924 0.128782985 67 N K 0.200404848 0.19495599 ID NO: 3461) 192 A D 0.203101012 0.088663269 258 E G 0.200396788 0.144009482 979 LE VW 0.203097285 0.114357374 232 -- CM 0.200312143 0.13867079 905 V E 0.2029568 0.158582123 526 -- LN 0.200312143 0.15960761 648 N K 0.202865781 0.076554962 202 -RE SSS 0.200312143 0.113603268 811 N D 0.202736819 0.184175153 68 K T 0.200238961 0.196349346 573 F Y 0.202703202 0.143842683 448 S Y 0.200204468 0.144800694 388 K E 0.202623765 0.1173393 837 --- TTI 0.200162181 0.089943784 265 K [stop] 0.202622408 0.159704419 158 ----- CNVSE (SEQ 0.200162181 0.088327822 ID NO: 3339) 511 Q E 0.202512176 0.199826141 796 ------- YLSKTLA 0.200048174 0.1285851 (SEQ ID NO: 3852) 375 E Q 0.202480508 0.162732896 276 -- PK 0.200048174 0.079289415 106 N K 0.202431652 0.125127347 801 ---- LAQY (SEQ 0.200048174 0.196038539 ID NO: 3540) 52 E G 0.202421366 0.17180627 651 ----- PMNLI (SEQ 0.200048174 0.135317157 ID NO: 3620) 597 W [stop] 0.202346989 0.135138719 756 - N 0.200048174 0.172777109 153 N K 0.202320957 0.084739162 149 ------ KPHTNY 0.200048174 0.109852809 (SEQ ID NO: 3521) 471 D E 0.202309983 0.069685161 494 -- FA 0.200048174 0.123840308 486 Y H 0.202105792 0.189019359 181 V I 0.19996686 0.166465973 732 D V 0.202045584 0.172766987 616 I M 0.19990025 0.183539616 833 T I 0.202003023 0.114654955 264 -- LK 0.198353725 0.107390522 220 A D 0.201986226 0.167650811 296 ---- VVAQ (SEQ 0.198353725 0.116995821 ID NO: 3835) 386 D G 0.201893421 0.144223833 152 T I 0.198333224 0.117839718 271 N K 0.201821721 0.136225013 720 R G 0.198275202 0.180739318 236 VA -C 0.201781577 0.118494484 236 V L 0.198162379 0.091047961 661 E Q 0.201717523 0.126595353 903 R [stop] 0.197764314 0.184873287 227 A - 0.199865011 0.119483676 190 Q [stop] 0.197676182 0.135507554 866 S R 0.199834101 0.105100812 19 TK PG 0.197606812 0.087295898 664 ------ PAVIALT 0.199723054 0.116432821 554 R [stop] 0.197270424 0.119115645 (SEQ ID NO: 3612) 955 R W 0.199719648 0.122422647 63 R K 0.197266572 0.156106069 507 G A 0.199700659 0.133738835 671 D Y 0.197186873 0.193857965 925 ---- ALNI (SEQ 0.199681554 0.112069534 380 YL T[stop] 0.197159823 0.186882164 ID NO: 3320) 419 --- EAW 0.199681554 0.151874009 210 P R 0.197120998 0.088119535 663 I N 0.199667187 0.147345549 637 T S 0.196993711 0.074085124 845 K R 0.199649448 0.119477749 657 I M 0.196919314 0.094328263 782 L V 0.199620025 0.156520261 458 -- AK 0.196819897 0.136384351 173 K E 0.199587002 0.098249426 304 V F 0.196773726 0.171052025 615 ------- VIEKTLYN 0.199584873 0.182641156 263 N K 0.196728929 0.082784462 (SEQ ID NO: 3780) 630 P A 0.199530215 0.103804567 601 L V 0.196677335 0.163553469 446 AQ DR 0.199529716 0.10633379 545 I N 0.196522854 0.15815205 374 Q [stop] 0.199329379 0.131990493 571 VN AV 0.196419899 0.093569564 778 M K 0.199291554 0.158456568 284 ----- PHTKE (SEQ 0.196419899 0.146831822 ID NO: 3618) 858 R S 0.199265103 0.108121324 163 -HE PTR 0.196323235 0.180126799 579 N I 0.19915895 0.103520322 57 P L 0.196165872 0.129483671 63 R G 0.199095742 0.127135026 659 R P 0.196165872 0.140190097 646 S I 0.199062518 0.104634011 784 A P 0.196137855 0.183129066 90 K E 0.199052878 0.198240775 323 Q H 0.196115938 0.150227482 203 -- ES 0.19897765 0.14607778 763 R W 0.195967691 0.113028792 439 E Q 0.198907882 0.179263601 257 N Y 0.195936425 0.189617104 621 Y C 0.198885865 0.125823263 125 s G 0.19588405 0.126337645 310 Q H 0.198723557 0.146313995 787 A T 0.195855224 0.170500255 60 N K 0.198659421 0.192782927 213 Q L 0.195810372 0.164285983 299 Q R 0.1986231 0.112149973 979 --- VSS 0.195756097 0.115771783 279 T s 0.198506775 0.126696973 440 E Q 0.192625703 0.16228978 278 I N 0.198457202 0.188794837 698 K N 0.192440231 0.067040488 462 -- FV 0.198353725 0.132924725 757 L Q 0.192392703 0.11735809 466 G D 0.195631404 0.128114426 446 ---- AQSK (SEQ 0.192307738 0.188279486 ID NO: 3329) 388 K R 0.195529616 0.155892093 91 D Y 0.192222499 0.161107527 767 R K 0.195477683 0.182282632 65 N K 0.192152721 0.086051749 673 E V 0.195473785 0.111723182 228 L Q 0.192019982 0.075226208 864 D Y 0.195306139 0.092331083 107 I N 0.191587572 0.153969194 885 T K 0.195258477 0.131521124 307 N S 0.191540821 0.186358955 856 Y C 0.195214677 0.129834532 944 QT PV 0.191451442 0.133263263 205 N S 0.194826059 0.070507432 526 ------ LNLYLI (SEQ 0.191451442 0.098341333 ID NO: 3565) 696 S R 0.194740876 0.106074027 750 -A LS 0.191451442 0.07841082 498 A V 0.194435389 0.108630638 651 --- PMN 0.191451442 0.159749911 281 P H 0.194325757 0.164586878 370 ----- GYKRQ (SEQ 0.191451442 0.172523736 ID NO: 3456) 106 N D 0.194156411 0.113601316 654 L V 0.191441378 0.100236525 756 --- NLS 0.194120313 0.113317678 332 P L 0.191427852 0.132400599 591 ---- QGRE (SEQ 0.194120313 0.089464524 724 S G 0.191322798 0.152424888 ID NO: 3635) 572 N D 0.194049735 0.182872987 206 H D 0.191266107 0.183831734 762 G S 0.193891502 0.138436771 594 E D 0.191101272 0.114552929 41 R [stop] 0.193882715 0.149226534 525 K E 0.190973602 0.101119046 370 G D 0.193873435 0.131402011 576 D E 0.190942249 0.134849057 58 I T 0.193827338 0.18015548 663 I V 0.190923863 0.098130963 64 A S 0.193814684 0.163559402 225 G A 0.190920356 0.167486936 203 E G 0.193809853 0.182009134 227 A V 0.190541259 0.158522801 318 E K 0.193618764 0.182298755 539 ---- KLRF (SEQ 0.190525892 0.118424918 ID NO: 3515) 867 V L 0.193526313 0.149480344 336 ------- RQANEVD 0.190525892 0.095546149 (SEQ ID NO: 3676) 343 W [stop] 0.193259223 0.086409476 511 --- QYN 0.190525892 0.10542285 920 ---- AAEQ (SEQ 0.1932196 0.09807778 182 -- TY 0.190525892 0.095282059 ID NO: 3298) 559 I N 0.193172208 0.185545361 955 R K 0.190477708 0.163763612 577 D E 0.193102893 0.104761592 936 ------ RSQEYK 0.188141846 0.120467426 (SEQ ID NO: 3686) 721 K N 0.193081281 0.123219324 428 VE AV 0.188141846 0.111936388 767 R S 0.19293341 0.180949858 419 ---- EAWE (SEQ 0.188141846 0.161004571 ID NO: 3378) 353 L P 0.192916533 0.142447603 148 ------ GKPFITN 0.188141846 0.126152225 (SEQ ID NO: 3437) 662 N D 0.192798707 0.113762689 972 ------ VWICPA 0.188141846 0.100559027 (SEQ ID NO: 3838) 87 E G 0.192780117 0.1542337 328 F S 0.188082476 0.152191585 347 V G 0.192656101 0.11936042 596 I N 0.188043065 0.141822306 669 L V 0.190343627 0.076107876 482 L V 0.187880246 0.186391629 492 K Q 0.190290589 0.150334427 582 I V 0.18725447 0.136748728 721 K E 0.190242607 0.123347897 699 E Q 0.187137878 0.176072109 389 K E 0.190239723 0.177951808 758 S I 0.18709104 0.158068821 619 T I 0.190153498 0.116807589 113 1 N 0.187005943 0.142849404 93 V E 0.190153374 0.163133537 968 K E 0.186636923 0.128956962 336 R G 0.190122687 0.099072113 168 ----- LLSPH (SEQ 0.186576707 0.08269231 ID NO: 3560) 878 N K 0.190097445 0.16631012 833 TGWM (SEQ PAG[stop] 0.186576707 0.125195246 ID NO: 3289) 847 -- EG 0.190063819 0.165413398 272 ------- GLAFPK 0.186576707 0.060722091 (SEQ ID NO: 3442) 481 --- KLQ 0.190063819 0.144467422 529 ----- YLIIN (SEQ 0.186576707 0.104569212 ID NO: 3851) 655 I N 0.190024208 0.138898845 261 ------- LANLKD 0.186576707 0.081389931 (SEQ ID NO: 3539) 696 S- TG 0.189908515 0.068382259 884 W [stop] 0.18656617 0.16960295 55 P R 0.189907461 0.115309052 719 S F 0.186508523 0.176978743 269 S N 0.18989023 0.150359662 825 L M 0.185209061 0.126954087 210 P L 0.189875815 0.142379934 727 K M 0.185134776 0.155871835 798 S Y 0.18982788 0.189131471 28 M K 0.1848853 0.176098567 258 E K 0.189676636 0.183203558 404 H R 0.184633168 0.163423927 190 Q P 0.189645523 0.168321089 394 A T 0.184555363 0.1424277 377 L V 0.189542806 0.136436344 581 I F 0.184470581 0.083013305 500 N S 0.189535073 0.180860478 766 K M 0.184394313 0.16735316 295 N S 0.18951855 0.108197323 547 P L 0.184346525 0.155161861 974 K [stop] 0.189482309 0.139647592 275 F S 0.184250266 0.085183481 54 I V 0.189429698 0.1555694 537 G V 0.184185986 0.146420736 736 N D 0.189336313 0.075796871 873 S N 0.184149692 0.143102895 505 I N 0.189099927 0.151637022 198 -I CL 0.184139991 0.106675461 396 Y H 0.189044775 0.129353397 639 --- ERR 0.184139991 0.11669463 117 D V 0.188915066 0.132090825 287 -K CL 0.184067988 0.105370778 8 K M 0.188755388 0.159809948 404 H N 0.183958455 0.132891407 699 E K 0.188739566 0.092771182 710 ----- VEQRR (SEQ 0.183918384 0.104439918 ID NO: 3776) 132 C G 0.188700628 0.133537793 889 S P 0.183788189 0.164091129 338 A V 0.188698117 0.151434141 144 V L 0.183743996 0.065170935 641 R [stop] 0.188367145 0.11062471 165 R K 0.183736362 0.17610787 208 V L 0.188333358 0.080207667 28 M V 0.183560659 0.134087452 207 P T 0.188302368 0.15553127 611 A T 0.183558778 0.136945744 879 N K 0.186386792 0.12079248 148 GK DR 0.183483799 0.153480995 712 Q L 0.186379419 0.129128012 515 A C 0.183483799 0.109594032 583 L P 0.186146799 0.156442099 367 N S 0.183341948 0.159877593 323 ---- QRLK (SEQ 0.186069265 0.110701992 868 E K 0.183187044 0.163165035 ID NO: 3648) 358 ---- KEDG (SEQ 0.18604741 0.119601341 306 L Q 0.183120006 0.156397405 ID NO: 3492) 835 -- WM 0.18604741 0.100790291 216 G D 0.183066489 0.119789101 839 ------- INGKELK 0.18604741 0.115878922 728 N Y 0.183065668 0.166304554 (SEQ ID NO: 3477) 463 V E 0.186017541 0.06776571 879 N I 0.183004606 0.128653405 299 Q H 0.185842115 0.085070655 126 G V 0.182789208 0.179342988 832 A C 0.185822701 0.103905008 35 V M 0.182763396 0.156289233 127 F Y 0.185786991 0.140080792 443 S N 0.182633222 0.162446869 159 N S 0.185693031 0.145375399 951 N D 0.182629417 0.175906154 532 -- IN 0.185685948 0.088889817 410 G S 0.182624091 0.128840332 439 ----- EERRS (SEQ 0.185685948 0.095520154 382 SS CL 0.180218478 0.105067529 ID NO: 3382) 152 -- TN 0.185685948 0.085877547 369 AG DS 0.180218478 0.132171137 684 --- LGN 0.18563709 0.122810431 757 LS PV 0.180218478 0.120148198 718 Y [stop] 0.185557954 0.073476523 674 -------- GCPLSRFK 0.180218478 0.119094301 (SEQ ID NO: 3425) 585 L P 0.185474446 0.130833458 418 -- DE 0.180218478 0.162709755 85 W R 0.185353654 0.134359698 702 ------- RTIQAAK 0.180179308 0.102882749 (SEQ ID NO: 3693) 931 ----- SWLFL (SEQ 0.185304071 0.113870586 81 L P 0.180116381 0.137095425 ID NO: 3735) 543 ---- KKIK (SEQ 0.185304071 0.066752877 939 --- EYK 0.18007812 0.13192478 ID NO: 3501) 547 ------- PEAFEAN 0.185304071 0.089391329 31 L Q 0.180015666 0.152602881 (SEQ ID NO: 3615) 91 D G 0.1853036 0.092089443 213 ----- QIGGN (SEQ 0.179890016 0.080439406 ID NO: 3638) 766 K R 0.185284272 0.110005204 379 -- PY 0.179789203 0.118280148 461 ----- SFVIE (SEQ 0.185264915 0.156592075 331 F Y 0.179617168 0.14637274 ID NO: 3698) 950 ----- GNTDK (SEQ 0.185264915 0.154386625 540 L M 0.179584486 0.167412262 ID NO: 3446) 233 M V 0.182567289 0.115088116 693 I V 0.179569128 0.124539552 96 M L 0.182378018 0.128312349 776 T S 0.179453432 0.075575874 753 ------ IFANLS (SEQ 0.182269944 0.088037483 264 L V 0.179340275 0.144429387 ID NO: 3472) 634 V A 0.182243984 0.121794563 547 P R 0.179333799 0.110886672 556 Y S 0.182208476 0.102238152 820 D E 0.179273983 0.124243775 972 ------- VWKPAV 0.182135365 0.122971859 604 E K 0.17907609 0.153006263 (SEQ ID NO: 3839)[stop] 716 G D 0.182118038 0.088377906 651 P S 0.17907294 0.16496086 419 E G 0.182093842 0.165354368 382 S C 0.179061797 0.042397129 145 N K 0.181832601 0.074663212 680 F Y 0.179026865 0.083849485 652 M R 0.181725898 0.15882275 552 A V 0.178983921 0.137645246 183 Y [stop] 0.181723054 0.087766244 693 I F 0.178916903 0.17080226 229 S R 0.18162155 0.118611624 151 HT LS 0.178787645 0.11267363 589 K E 0.181594685 0.120760487 190 ----- QRALD (SEQ 0.178787645 0.150480322 ID NO: 3645) 304 V I 0.181591972 0.14363826 208 ----- VKPLE (SEQ 0.178787645 0.112763983 ID NO: 3783) 873 S C 0.181321853 0.144241543 194 D V 0.178645393 0.146182868 114 P S 0.181260379 0.131437002 767 RT Sc 0.176164273 0.119651092 100 A S 0.181149523 0.170663024 678 S N 0.176147348 0.146692604 413 W [stop] 0.181066052 0.139390154 817 T A 0.176123605 0.120992816 166 L M 0.180963828 0.128703075 635 A G 0.176061926 0.119367224 496 ------ IEAENS (SEQ 0.180890191 0.096196015 212 E A 0.175873239 0.11085302 ID NO: 3468) 504 D V 0.180843532 0.116307526 821 Y [stop] 0.175384143 0.118184345 199 H Q 0.180819165 0.098967075 447 Q R 0.175284629 0.123528707 675 C W 0.180770613 0.172891211 257 N S 0.175186561 0.099304683 94 G S 0.180639091 0.140246364 618 K R 0.175178956 0.153225543 212 E D 0.180617877 0.126552831 217 N S 0.175170771 0.153898212 557 T N 0.180519556 0.15369828 852 Y [stop] 0.175104531 0.090584521 753 I S 0.180492647 0.165598334 255 K R 0.175069831 0.070668507 872 L V 0.180432435 0.164444609 430 --- GLS 0.175035484 0.093564105 596 ------ IWNDLL 0.180218478 0.160627748 827 ---- KLKK (SEQ 0.175035484 0.069987475 (SEQ ID NO: ID NO: 3510) 3487) 163 H R 0.178633884 0.108142143 796 --- YLS 0.175035484 0.092544675 383 S I 0.178486259 0.158810182 414 --------- GKVYDEAW 0.175035484 0.140128399 E (SEQ ID NO: 3441) 156 G D 0.178426488 0.134868493 547 ----- PEAFE (SEQ 0.175035484 0.118947618 ID NO: 3614) 234 G E 0.178414368 0.12320748 186 ------ GKFGQR 0.175035484 0.092907507 (SEQ ID NO: 3435) 804 Y [stop] 0.178116642 0.169884859 580 L R 0.174993228 0.092760152 582 I N 0.177915368 0.151449157 422 E K 0.174900558 0.171745203 655 I T 0.177824888 0.131979099 285 H Y 0.174862549 0.137793142 129 C Y 0.177764169 0.131217004 737 T I 0.174757975 0.115488534 20 K [stop] 0.177744686 0.162022223 455 W G 0.174674459 0.156270727 852 Y C 0.177655192 0.126363222 401 L P 0.174440338 0.064966394 179 E Q 0.177438027 0.163530401 953 - DKR 0.174181069 0.090682808 365 W S 0.177330558 0.12784352 953 ---- DKRA (SEQ 0.174181069 0.085814279 ID NO: 3359) 245 D E 0.177288135 0.128142583 360 D N 0.174161173 0.117286104 593 R G 0.177150053 0.165372274 520 K E 0.174117735 0.143263172 838 T S 0.177144418 0.166381063 255 K M 0.171890748 0.139268571 979 LE[stop]G VSSR (SEQ 0.177037198 0.160568847 675 -- CP 0.171877476 0.064917248 ID NO: 3834) 265 K E 0.176890073 0.124809095 853 Y C 0.171733581 0.087723362 440 E D 0.176868582 0.097257257 631 A V 0.171731995 0.15053602 107 I M 0.176863119 0.14397234 668 A V 0.171647872 0.129168631 22 A P 0.176753805 0.123959084 508 F S 0.17126701 0.136692573 292 A G 0.176665583 0.159949136 925 AL DR 0.17104041 0.083554381 803 Q [stop] 0.176624558 0.101059884 437 -- LE 0.17104041 0.06885585 329 P S 0.176586746 0.173503743 853 -- YN 0.17104041 0.123300185 196 Y [stop] 0.176517802 0.122355941 797 ------ LSKTLA 0.17104041 0.064415402 (SEQ ID NO: 3574) 758 S N 0.176368261 0.089480066 815 --- TIT 0.17104041 0.104377719 298 A T 0.176357721 0.087659893 462 --FV ERL[stop] 0.17104041 0.089353273 333 L V 0.176333899 0.163860363 471 -- DK 0.17104041 0.0730883 518 W R 0.176185261 0.104632883 418 ----- DEAWE (SEQ 0.170904662 0.126366449 ID NO: 3348) 459 KA -V 0.176164273 0.103778218 213 --- QIG 0.170882441 0.117196646 192 AL DR 0.176164273 0.079837153 703 ---- TIQA (SEQ 0.170763645 0.147647998 ID NO: 3750) 979 LE----[stop]G VSSKDLQA 0.176164273 0.074531926 356 E A 0.170659559 0.127216719 (SEQ ID NO: 3810) 35 VMT ETA 0.176164273 0.104758915 869 L V 0.170596065 0.1158133 145 N D 0.174107257 0.119744646 106 NI TV 0.170299453 0.164756763 819 ---- ADYD (SEQ 0.174068679 0.17309276 160 V L 0.170273865 0.111449611 ID NO: 3307) 561 K [stop] 0.174057181 0.086009056 163 H Q 0.170101095 0.104599592 761 F S 0.17403349 0.168753775 210 P T 0.170021527 0.150133417 563 S P 0.173902999 0.138700996 748 QD R- 0.169874659 0.074658631 70 L P 0.173882613 0.120818159 775 ------ YTRMED 0.169874659 0.080414628 (SEQ ID NO: 3859) 24 K [stop] 0.173808747 0.113872328 513 N I 0.169811112 0.150139289 834 G A 0.173722333 0.117168406 743 -- YY 0.169783049 0.088429509 167 I N 0.173700086 0.14772793 467 ------- LKEADKD 0.169783049 0.163043441 (SEQ ID NO: 3556) 496 -------- IEAENSILD 0.173653508 0.110162475 859 QNVVK (SEQ 0.167565632 0.122604368 (SEQ ID NO: ID NO: 3643) 3470) 618 K [stop] 0.173508668 0.101750483 719 S P 0.167206156 0.083551442 297 V E 0.173261294 0.132967549 712 Q R 0.167205037 0.147128575 426 K E 0.173245682 0.081642461 964 F S 0.166884399 0.138397154 182 T K 0.173138422 0.156579716 359 E G 0.16680448 0.139659272 660 G S 0.17299716 0.158169348 191 R K 0.166577954 0.144007057 805 T S 0.172972548 0.12868971 339 N D 0.166374831 0.157063101 458 A S 0.172827968 0.144714634 212 E K 0.166305352 0.157035199 731 D V 0.172739834 0.130565896 413 WG LS 0.166270685 0.125303472 829 K E 0.172710008 0.121812751 149 -- KP 0.166270685 0.076773688 859 Q [stop] 0.172627299 0.130823394 284 ---- PHTK (SEQ 0.166270685 0.139854804 ID NO: 3617) 305 -- NL 0.172611068 0.12831984 146 D N 0.166006779 0.113823305 178 - DE 0.172611068 0.108355628 686 N D 0.165853975 0.141480032 652 M V 0.172566944 0.106266804 492 K R 0.16571672 0.088451245 582 I M 0.172413921 0.144870464 580 LI PV 0.165563978 0.079217211 335 E G 0.172324707 0.120749484 661 --- ENI 0.165563978 0.126675099 940 -- YK 0.172247171 0.104630004 829 K R 0.165378823 0.103172827 450 A D 0.172235862 0.15659478 608 L V 0.165024412 0.161094218 187 K T 0.172165735 0.159986695 451 --- ALT 0.164823895 0.158152194 289 GI AV 0.172163889 0.117287191 581 II TV 0.164823895 0.074002626 579 NL DR 0.172163889 0.094383078 297 ---- VAQI (SEQ 0.164823895 0.107420642 ID NO: 3765) 843 E G 0.172115298 0.163114025 783 - T 0.164823895 0.135845679 259 K E 0.171933606 0.128545463 496 I V 0.164665656 0.140996169 663 -I CL 0.169783049 0.106475808 979 LE[stop]G VSSE (SEQ 0.164491714 0.145714149 ID NO: 3795) 803 ------ QYTSKT 0.169772888 0.094792337 932 ---- WLFL (SEQ 0.164491714 0.083188044 (SEQ ID NO: ID NO: 3841) 3655) 808 ------ TCSNCG 0.169772888 0.089412307 637 ------ TFERRE 0.164491714 0.152633112 (SEQ ID NO: (SEQ ID NO: 3739) 3745) 845 K E 0.169715078 0.127028772 325 --- LKG 0.164491714 0.125129505 552 A T 0.169382091 0.146396839 764 ------ QGKRTFM 0.163440941 0.098647738 (SEQ ID NO: 3634) 476 C F 0.169278987 0.093974927 107 I T 0.163178218 0.154967966 711 E D 0.169174495 0.118203075 633 FVAL (SEQ LWP[stop] 0.163026367 0.076347451 ID NO: 3259) 631 A S 0.169116909 0.130583861 213 -- QI 0.163026367 0.09979216 303 W [stop] 0.169003266 0.078930757 186 ----- GKFGQ (SEQ 0.163026367 0.114909103 ID NO: 3434) 561 K I 0.168954178 0.166308652 592 G D 0.162807696 0.109433096 157 -- RC 0.168739459 0.094824256 257 N K 0.162725471 0.091658038 721 K R 0.168620063 0.147491806 473 DE YH 0.162404215 0.086992333 614 R [stop] 0.168568195 0.15863634 975 P A 0.162340126 0.074611129 611 A D 0.168315642 0.157590847 833 T A 0.162275301 0.096163195 78 K [stop] 0.168282214 0.125424128 871 R S 0.162178581 0.080758991 917 ---- ETHA (SEQ 0.168207257 0.122439321 909 ----- FVCLN (SEQ 0.162125073 0.14885021 ID NO: 3398) ID NO: 3421) 756 NL DR 0.168207257 0.079944251 341 -- VD 0.162125073 0.111287809 678 S G 0.168124453 0.111226188 57 PI DS 0.162125073 0.110736083 525 K I 0.16804127 0.142310409 83 VY AV 0.162125073 0.121259318 653 N K 0.167953422 0.124668308 643 --- VLD 0.162125073 0.148280778 37 T N 0.16794635 0.137106698 561 K N 0.161973573 0.145314105 174 P S 0.167775884 0.122107474 349 N K 0.161796683 0.105713204 756 ---- NLSR (SEQ 0.167679572 0.073550026 318 E R 0.161659235 0.066441966 ID NO: 3594) 168 ------ LLSPHK 0.167679572 0.081935755 554 -- RF 0.161611946 0.149093192 (SEQ ID NO: 3561) 160 ------- VSEHERLI 0.167679572 0.116191677 505 I F 0.161489243 0.076235653 (SEQ ID NO: 3791) 630 ---- PALF (SEQ 0.164491714 0.073996533 102 P T 0.161386248 0.119400583 ID NO: 3610) 343 ----- WWDMV 0.164491714 0.076194534 514 CA LS 0.16113532 0.083183292 (SEQ ID NO: 3846) 642 -- EV 0.164491714 0.162646605 979 ------ VSSKDLQ 0.161025471 0.108550491 (SEQ ID NO: 3809) 419 ----- EAWER (SEQ 0.164491714 0.082157078 445 D Y 0.161008394 0.118993907 ID NO: 3379) 360 -- DG 0.164491714 0.073133393 143 Q K 0.160693826 0.130109004 408 K E 0.16446662 0.067392631 547 P S 0.160635883 0.144061844 48 R G 0.164301321 0.157884797 29 K N 0.158279304 0.142748603 613 G D 0.164218988 0.127296459 372 K R 0.158267712 0.11920003 175 ----- EANDE (SEQ 0.164149182 0.111610409 275 F L 0.158241303 0.120299703 ID NO: 3377) 671 D E 0.164120916 0.112217289 741 L P 0.158158865 0.120228264 794 ------- KTYLSKT 0.16411942 0.087804343 430 G V 0.158115277 0.126566194 (SEQ ID NO: 3531) 599 ------ DLLSLE 0.16411942 0.120903184 921 --- AEQ 0.158108573 0.11103467 (SEQ ID NO: 3364) 58 I- LS 0.16411942 0.094001227 242 K E 0.158032112 0.1512035 826 E D 0.163807302 0.112540279 148 GK RQ 0.158026029 0.155853601 889 S [stop] 0.163771981 0.149267099 295 -- NV 0.157603522 0.100157866 199 ---H PRLY (SEQ 0.163715064 0.07899198 876 ---- SVNN (SEQ 0.157603522 0.131358152 ID NO: 3622) ID NO: 3732) 916 FET VQA 0.163715064 0.085074401 215 G A 0.157466168 0.125711629 496 ------- IEAENSI 0.163715064 0.073631578 319 A V 0.15742503 0.144655841 (SEQ ID NO: 3469) 164 ---- ERLI (SEQ ID 0.163715064 0.124419929 222 G A 0.157400391 0.107390901 NO: 3394) 345 D G 0.16357556 0.12500461 523 V D 0.157098281 0.069302906 134 Q [stop] 0.163522049 0.142382805 753 ------- IFANLSR 0.157085986 0.062378414 (SEQ ID NO: 3473) 43 R Q 0.160624353 0.132247177 177 N S 0.157058654 0.117427271 317 D E 0.160609141 0.14140596 461 S R 0.157014829 0.122688776 807 K [stop] 0.160484146 0.104229856 823 R T 0.156977695 0.125466793 572 N S 0.160431799 0.062377966 427 K M 0.156963925 0.118535881 644 LD PV 0.160242602 0.128569608 111 K [stop] 0.156885345 0.101390983 699 EK DR 0.160242602 0.092172248 253 V L 0.156787797 0.082680225 850 I V 0.160226988 0.152692033 91 D V 0.156758895 0.14763673 100 AQ LS 0.160110772 0.101933413 71 T I 0.156624998 0.127600056 558 VI CL 0.160110772 0.10892714 592 ------ GREFIW 0.156575371 0.050528735 (SEQ ID NO: 3450) 270 -- AN 0.160110772 0.124579798 847 ----- EGQIT (SEQ 0.156575371 0.108055014 ID NO: 3386) 979 LE[stop]GS- VSSKDLQAS 0.160110772 0.049257177 111 KL S[stop] 0.156575371 0.112953961 PGIK (SEQ ID NT (SEQ ID NO: NO: 3816) 3279)[stop] 484 K---WYGD NSSLSASF 0.160110772 0.077521171 979 L-E[stop] VSSN (SEQ 0.156575371 0.054922359 (SEQ ID NO: (SEQ ID NO: ID NO: 3829) 3274) 3602) 205 NH LS 0.160110772 0.08695461 717 G E 0.15414714 0.124750031 281 P C 0.160110772 0.141761431 667 I V 0.154117319 0.147646705 939 E R 0.160110772 0.106121188 623 ----- RRTRQ (SEQ 0.153993707 0.122323206 ID NO: 3682) 672 - S 0.160110772 0.105653932 773 R G 0.153915262 0.146586561 894 ------- SLLKKRFS 0.160110772 0.071577892 433 -- KH 0.153881949 0.097541884 (SEQ ID NO: 3722) 199 HV T[stop] 0.160110772 0.129212095 35 V G 0.153666817 0.124448628 47 L Q 0.159718064 0.101565653 211 L V 0.153538313 0.134546484 262 A V 0.159650297 0.156994685 26 G D 0.15349539 0.149545585 788 ------ YEGLPS 0.159522485 0.129386966 279 ----- TLPPQ (SEQ 0.15339361 0.125011235 (SEQ ID NO: ID NO: 3754) 3848) 529 Y N 0.159442162 0.135286632 664 ------ PAVIAL 0.15339361 0.13972264 (SEQ ID NO: 3611) 604 E V 0.159292857 0.097301034 377 ---- LLPY (SEQ 0.15339361 0.12480719 ID NO: 3559) 284 P S 0.159001205 0.153355474 53 N D 0.15332875 0.117758231 750 A D 0.158401706 0.125762435 140 K N 0.153228737 0.097346381 950 G A 0.158324371 0.153957854 694 GE DR 0.153190779 0.097274205 688 T I 0.158292674 0.119969439 741 ---- LLYY (SEQ 0.153190779 0.13376095 ID NO: 3562) 203 ------ ESNHPV 0.156575371 0.141927058 592 ----- GREFI (SEQ 0.153190779 0.103123693 (SEQ ID NO: ID NO: 3449) 3396) 230 DA LS 0.156575371 0.105363533 684 ------ LGNPTHI 0.153147895 0.112048537 (SEQ ID NO: 3550) 408 ----- KHGED (SEQ 0.156575371 0.140706352 532 --- INY 0.153147895 0.072663729 ID NO: 3497) 606 ------- GSLKLAN 0.156575371 0.154364417 311 K N 0.153086255 0.08609524 (SEQ ID NO: 3454) 166 L Q 0.156435151 0.079474192 678 ----- SRFKD (SEQ 0.152422378 0.09122337 ID NO: 3728) 213 Q H 0.156012357 0.091435578 969 LK PV 0.152422378 0.0541377 447 Q E 0.155900092 0.095629939 419 EAWERIDKK RPGRESTRR 0.152422378 0.081179935 V (SEQ ID W (SEQ ID NO: 3256) NO: 3674) 689 H P 0.155877877 0.131928361 670 -- TD 0.152422378 0.096788119 335 E Q 0.155876225 0.110366115 383 --- SEE 0.152422378 0.066189551 84 Y D 0.155784728 0.135489779 880 --- DIS 0.15109455 0.085164607 531 I N 0.155410746 0.152604803 296 VV DR 0.15109455 0.140218943 103 A S 0.155352263 0.149390311 293 YN DS 0.15109455 0.094395956 661 E V 0.155230224 0.090301063 359 ED AV 0.15109455 0.062026733 865 ------- LSVELDR 0.15478543 0.145114034 210 PL RQ 0.15109455 0.109823159 (SEQ ID NO: 3579) 677 LS PV 0.15478543 0.108120931 758 S- TG 0.15109455 0.105413113 570 E G 0.154599098 0.10691093 232 CM LS 0.15109455 0.096388212 762 G D 0.154432235 0.117428168 930 RSWLFL EAGCS (SEQ 0.15109455 0.077157167 (SEQ ID NO: ID NO: 3287) 3376)[stop] 177 N K 0.15431964 0.1416948 886 KG C- 0.15109455 0.085064934 484 K N 0.154291635 0.117621744 594 EF DC 0.15109455 0.055097165 592 GRE-- DNQVG (SEQ 0.154254957 0.077027283 140 K [stop] 0.150604639 0.124522684 ID NO: 3368) 704 ----- IQAAK (SEQ 0.154254957 0.108682368 979 LE[stop]GS- VSSKDI (SEQ 0.150527572 0.113935287 ID NO: 3480) ID NO: 3803) 285 ----- HTKEG (SEQ 0.154254957 0.106587271 979 L-E[stop]G VSSKA (SEQ 0.150527572 0.106493096 ID NO: 3464) ID NO: 3798) 721 KY TV 0.154254957 0.124126134 851 T A 0.150513073 0.138774627 650 ------- KPMNLIG 0.154254957 0.151047576 615 V A 0.150425208 0.101961366 (SEQ ID NO: 3524) 403 ---- LHLE (SEQ 0.152422378 0.132942463 359 - E 0.150399286 0.136024193 ID NO: 3551) 389 KG TV 0.152422378 0.11037889 508 ------ FSKQYN 0.150399286 0.049469473 (SEQ ID NO: 3416) 850 ----- ITYYN (SEQ 0.152422378 0.102611165 202 R-------- SSSLASGL 0.150399286 0.07744146 ID NO: 3484) (SEQ ID NO: 3731)[stop] 230 ------- DACMGAV 0.152422378 0.082337669 884 ----- WTKGR 0.150399286 0.084711675 (SEQ ID NO: (SEQ ID NO: 3343) 3844) 461 ---- SFVI (SEQ ID 0.152422378 0.085894307 399 ------ GDLLLH 0.150399286 0.08514719 NO: 3697) (SEQ ID NO: 3426) 673 E- DR 0.152422378 0.059554386 39 D G 0.150354378 0.13986784 257 N D 0.152411625 0.106853984 891 E V 0.150263535 0.113865674 590 R G 0.152081011 0.117905973 450 A P 0.150166455 0.146935336 737 T N 0.151886476 0.142783247 240 ---- LTKY (SEQ 0.147451251 0.080958956 ID NO: 3581) 790 G E 0.151825437 0.098317165 942 KY NC 0.147451251 0.116243971 831 T S 0.151806143 0.14386859 47 LR C- 0.147451251 0.058888218 906 QE PV 0.151695593 0.100183043 807 KT -C 0.147451251 0.120603495 99 V D 0.151565952 0.12300149 603 LE PV 0.147451251 0.066385351 959 --- ETW 0.151393972 0.086210639 873 --- SEE 0.147451251 0.078348652 520 K R 0.151365824 0.113621271 15 KD R- 0.147451251 0.123855007 852 Y N 0.151328449 0.137543743 206 HP DS 0.147451251 0.064383902 444 E G 0.151257656 0.118296919 599 DL -- 0.147451251 0.079608104 147 --- KGK 0.15109455 0.054833005 979 L-E[stop]GS VSSKDP 0.147451251 0.049212446 (SEQ ID NO: 3822) 171 -- PH 0.15109455 0.08380172 979 LE[stop]GS- VSSNDLQAS 0.147451251 0.067765787 PGIK (SEQ ID NK (SEQ ID NO: NO: 3833) 3279)[stop] 925 --- ALN 0.15109455 0.138412128 448 -- SK 0.147451251 0.090898875 539 ----- KLRFK (SEQ 0.15109455 0.128926028 505 I- LS 0.147451251 0.077683234 ID NO: 3516) 334 ------- VERQANE 0.15109455 0.059721295 398 FG SV 0.147451251 0.073631355 (SEQ ID NO: 3777) 484 KW TG 0.15109455 0.091510022 512 -Y DS 0.147451251 0.05128316 848 G- AV 0.15109455 0.104352239 345 ---- DMVC (SEQ 0.147451251 0.06441585 ID NO: 3366) 236 ------ VASFLT 0.15109455 0.088006138 177 ND-- FTG[stop] 0.147451251 0.085413531 (SEQ ID NO: 3767) 429 E D 0.149933575 0.107236607 36 MT C- 0.147451251 0.118494367 77 K E 0.148931072 0.079170957 953 D- AV 0.147451251 0.040719542 259 ------- KRLANLKD 0.148805792 0.108390156 451 AL DR 0.147451251 0.096339405 (SEQ ID NO: 3528) 978 [stop]L GI 0.148805792 0.119775179 631 A C 0.147319263 0.109020371 386 D- AV 0.148805792 0.079572543 848 G A 0.147279724 0.093306967 748 QD PV 0.148805792 0.094563395 239 F S 0.147177048 0.142500129 609 KL DR 0.148805792 0.060702366 270 A T 0.147117218 0.13621963 699 EK DC 0.148805792 0.122863259 352 K N 0.147067273 0.12109567 279 --- TLP 0.148805792 0.138832536 563 S T 0.147049099 0.111696976 24 K M 0.148782741 0.14630409 612 N K 0.146927237 0.108594483 798 S T 0.148583442 0.105674096 569 M V 0.146754771 0.119310335 349 N S 0.148310626 0.138528822 855 R G 0.144425593 0.123370913 403 -- LH 0.148273333 0.102736 617 E V 0.144206082 0.126166622 967 ------ KKLKEVW 0.148059201 0.11964291 918 -------- THAAEQAA 0.143857661 0.070236443 (SEQ ID NO: (SEQ ID NO: 3504) 3749) 157 RC LS 0.14801524 0.133243315 733 ---- MVRN (SEQ 0.143791778 0.090612696 ID NO: 3585) 493 PF TV 0.14801524 0.059147928 217 NS TG 0.143791778 0.113745581 188 ------ FGQRALD 0.14801524 0.10137508 657 ----- IARGE (SEQ 0.143791778 0.039293361 (SEQ ID NO: ID NO: 3466) 3412) 898 KR TG 0.14801524 0.120213578 533 N S 0.14375365 0.085993529 186 -- GK 0.14801524 0.114746024 185 ------- LGKFGQRA 0.14367777 0.094952199 (SEQ ID NO: 3548) 328 F- LS 0.14801524 0.071716609 616 ------- IEKTLYN 0.14367777 0.110151228 (SEQ ID NO: 3471) 204 ------ SNHPVKP 0.14801524 0.094645672 668 ------ ALTDPE 0.14367777 0.113895553 (SEQ ID NO: (SEQ ID NO: 3724) 3323) 314 -- IG 0.14801524 0.075655093 259 ---- KRLA (SEQ 0.14367777 0.070148108 ID NO: 3527) 422 ER AV 0.14801524 0.044733928 175 E- DR 0.14367777 0.049065425 64 AN DS 0.14801524 0.108571015 610 ------ LANGRV 0.14367777 0.105216814 (SEQ ID NO: 3537) 855 -- RY 0.14801524 0.108772293 507 ------- GFSKQYN 0.14367777 0.101689858 (SEQ ID NO: 3430) 504 D E 0.147876758 0.098656217 487 --- GDL 0.14367777 0.046711447 342 D H 0.147844774 0.140125334 731 DD CL 0.14367777 0.067816779 86 EE DR 0.147451251 0.143531987 265 KD R- 0.14367777 0.130304386 940 -Y SV 0.14673352 0.076906931 386 --- DRK 0.14367777 0.092432212 794 KT NC 0.14673352 0.093083088 790 ----- GLPSK (SEQ 0.14367777 0.104428158 ID NO: 3444) 487 ---- GDLR (SEQ 0.14673352 0.141269601 147 -------- KGKPHTNY 0.140217655 0.060731949 ID NO: 3427) (SEQ ID NO: 3496) 717 -- GY 0.14673352 0.129086357 979 LE[stop]GS- VSSKDV 0.140217655 0.126849347 (SEQ ID NO: 3824) 468 ---- KEAD (SEQ 0.14673352 0.112176586 342 - D 0.140217655 0.083180031 ID NO: 3490) 102 P L 0.146729077 0.094784801 701 ------ QRTIQA 0.140217655 0.094973524 (SEQ ID NO: 3650) 462 F V 0.146714745 0.123539268 588 G R 0.140077599 0.123307802 291 E Q 0.146533408 0.078647294 248 L V 0.139838145 0.132091481 657 ------ IDRGEN 0.146511494 0.145489762 641 R G 0.139811399 0.120984089 (SEQ ID NO: 3467) 32 L F 0.146467882 0.099225719 375 E G 0.13977585 0.117490416 619 T N 0.146372017 0.145146105 179 E K 0.139614148 0.122113279 355 N K 0.146341962 0.141209887 285 --- HTK 0.139514563 0.076217964 132 C S 0.146274101 0.131138669 166 -- LI 0.139514563 0.075733937 831 T A 0.146217161 0.113775751 786 ---- LAYE (SEQ 0.139514563 0.068877295 ID NO: 3541) 868 E V 0.145780526 0.143894902 274 AF TV 0.139413376 0.092095094 231 A P 0.14576396 0.105172115 578 -- PN 0.139413376 0.112737023 944 ----- QTNKT (SEQ 0.14564914 0.125394667 775 ----- YTRME (SEQ 0.13869596 0.096841774 ID NO: 3653) ID NO: 3858) 236 ----- VASFL (SEQ 0.14564914 0.09085897 838 TING (SEQ PSTA (SEQ 0.13869596 0.135948561 ID NO: 3766) ID NO: 3290) ID NO: 3624) 709 -- EV 0.14564914 0.119119066 75 E K 0.138622423 0.112055782 865 L P 0.145527367 0.10928669 556 Y C 0.138477684 0.131330328 510 ---- KQYN (SEQ 0.145296444 0.112653295 98 R [stop] 0.138179687 0.102036322 ID NO: 3525) 959 -- ET 0.145296444 0.114339851 460 A T 0.137813435 0.108501414 414 G V 0.1451247 0.140131131 111 K N 0.137723187 0.11828435 465 E G 0.144909944 0.124547249 566 I F 0.137434779 0.130961132 300 I T 0.144877384 0.129206612 438 ------ EEERRS 0.137192189 0.064149715 (SEQ ID NO: 3380) 215 G S 0.144824715 0.07809376 58 I M 0.13705694 0.089110339 288 E G 0.144744415 0.110082872 913 NCGFET EAAVQA 0.134611486 0.113195929 (SEQ ID NO: (SEQ ID NO: 3282) 3372) 16 D N 0.144678092 0.139073977 11 -R AS 0.134611486 0.123271552 774 QY PV 0.14367777 0.076535556 978 [stop]LE[stop] YVSSKDLQA 0.134611486 0.087096491 GS-PG (SEQ (SEQ ID NO: ID NO: 3251) 3864) 910 -- VC 0.14367777 0.024273265 247 ------ ILEHQK 0.134611486 0.104206673 (SEQ ID NO: 3476) 484 KW DR 0.14367777 0.094175463 517 I T 0.134524102 0.104605605 20 -- CL 0.14367777 0.08704024 18 N Y 0.134422379 0.132333464 847 -------- EGQITYYN 0.14367777 0.054370233 804 ---- YTSK (SEQ 0.134383084 0.102298299 (SEQ ID NO: ID NO: 3860) 3389) 114 P L 0.143623976 0.107371623 872 ------- LSEESVN 0.134383084 0.104954479 (SEQ ID NO: 3573) 294 N S 0.143486731 0.084830242 743 Y H 0.134286698 0.08203884 473 D G 0.143465301 0.122194432 250 H Q 0.134238241 0.111012466 376 A T 0.1434567 0.101440197 268 A P 0.134027791 0.098451313 637 T A 0.143296115 0.114711319 978 [stop]LE[stop] YVSSKDLQ 0.134010909 0.133274253 GSPG (SEQ (SEQ ID NO: ID NO: 3251) 3863) 365 W C 0.143131818 0.093254266 664 -- PA 0.134010909 0.124393367 559 I S 0.142993499 0.107801059 979 LE[stop]G- VSSND (SEQ 0.133919467 0.126494561 ID NO: 3830) 671 D S 0.142731931 0.123439168 241 T N 0.133870518 0.110803484 487 ----- GDLRGK 0.14265438 0.086040474 153 N S 0.133623126 0.12555263 (SEQ ID NO: 3428) 211 LEQIG (SEQ RNRSA (SEQ 0.14265438 0.100691421 196 Y H 0.133619017 0.107174466 ID NO: 3280) ID NO: 3670) 26 GP CL 0.14265438 0.067388407 744 Y- LS 0.133358224 0.114892564 421 -- WE 0.14265438 0.084239003 633 F S 0.133277029 0.122435158 211 ---- LEQI (SEQ ID 0.14265438 0.118588014 619 T S 0.133139525 0.08963831 NO: 3543) 767 R [stop] 0.141592128 0.123403074 742 L P 0.133131448 0.09127341 290 I N 0.141531787 0.136370873 809 C [stop] 0.133028515 0.072072201 774 Q [stop] 0.141517184 0.125118121 86 E D 0.132733699 0.128073996 341 V E 0.14127686 0.094518287 473 D V 0.132562245 0.055193421 176 A S 0.140653486 0.112098857 568 -- PM 0.130626359 0.119168349 562 K N 0.140512419 0.126501373 362 K R 0.130604026 0.105840846 317 D H 0.140493859 0.124148887 359 E V 0.130475561 0.064946527 941 ------ KKYQTN 0.140217655 0.077001548 426 ---- KKVE (SEQ 0.130424348 0.109290243 (SEQ ID NO: ID NO: 3506) 3508) 826 E K 0.136937076 0.066669616 300 IV DR 0.130424348 0.08495594 955 R T 0.136388186 0.086919652 893 -- LS 0.130424348 0.106896252 400 ----- DLLLH (SEQ 0.136321349 0.064628042 256 KN TV 0.130424348 0.057621352 ID NO: 3361) 163 -------- HERLILL 0.136321349 0.117792482 767 ---- RTFM (SEQ 0.130424348 0.06446722 (SEQ ID NO: ID NO: 3691) 3460) 950 - G 0.136321349 0.089773613 324 R G 0.13036573 0.130162815 353 ------- LINEKKE 0.136321349 0.11384298 460 A P 0.129809906 0.111386576 (SEQ ID NO: 3554) 469 -------- EADKDEFC 0.136321349 0.136235916 744 Y S 0.129801283 0.120155085 (SEQ ID NO: 3373) 298 ------ AQIVIW 0.136321349 0.124259801 297 V L 0.1296923 0.098130283 (SEQ ID NO: 3328) 967 --- KKL 0.136321349 0.087024226 979 LE VP 0.129554025 0.068280994 834 G D 0.136317736 0.131556677 595 ------- FIWNDLL 0.129554025 0.083916268 (SEQ ID NO: 3414) 675 C S 0.135933989 0.124817499 909 F C 0.129452838 0.12013501 295 N D 0.135903192 0.116385268 39 D N 0.128914064 0.121593627 489 L P 0.135710175 0.113005835 263 N D 0.128846416 0.111193487 316 R W 0.135665116 0.08159144 403 ------- LHLEKKH 0.128586666 0.071668629 (SEQ ID NO: 3553) 782 L P 0.135444097 0.094158481 979 LE[stop]GS-G VSSKDLV 0.128586666 0.121567211 (SEQ ID NO: 3821) 252 K I 0.135215444 0.118419704 876 ------ SVNNDI 0.128586666 0.054233667 (SEQ ID NO: 3733) 703 -- TI 0.135116856 0.093813019 228 ------ LSDACMG 0.128586666 0.126842965 (SEQ ID NO: 3571) 671 --- DPE 0.135116856 0.117221994 701 ---- QRTI (SEQ ID 0.128586666 0.098093616 NO: 3649) 763 R Q 0.135073853 0.130952104 549 ------- AFEANRFY 0.127406426 0.084837264 (SEQ ID NO: 3310) 815 T S 0.135026549 0.096980291 979 LE[stop]GSPG VSSKDLQE 0.127187739 0.092227907 I (SEQ ID NO: (SEQ ID NO: 3278) 3817) 141 L M 0.134960075 0.098794232 445 D E 0.127007554 0.122060316 789 E K 0.134893603 0.120008321 82 H N 0.126805938 0.104486705 36 M L 0.13488937 0.122340012 676 P L 0.126754121 0.080812602 278 I F 0.134789571 0.111040576 951 ---- NTDK (SEQ 0.126641231 0.099218396 ID NO: 3604) 358 K I 0.132508402 0.120198091 979 LE[stop]GS- VSSKDLQAS 0.126641231 0.095848514 PGIK (SEQ ID NN (SEQ ID NO: NO: 3815) 3279)[stop] 476 - C 0.132326289 0.087739647 204 ---- SNHP (SEQ 0.126641231 0.07625836 ID NO: 3723) 953 DK E- 0.132326289 0.066036843 426 KK DR 0.126641231 0.097925475 770 ------ MAERQY 0.132326289 0.083381966 923 QAA PV- 0.126641231 0.093158654 (SEQ ID NO: 3584) 887 ------- GRSGEAL 0.132326289 0.072961347 101 QP ET 0.126641231 0.062121806 (SEQ ID NO: 3453) 630 P S 0.132221835 0.08064538 942 K-Y NCL 0.126641231 0.088910569 290 I T 0.132066117 0.101441805 826 EK AV 0.126641231 0.091897908 81 L Q 0.132063026 0.114766305 292 ----- AYNNV (SEQ 0.126641231 0.106376872 ID NO: 3338) 809 C F 0.131888449 0.093326725 879 ------ NDISSWT 0.126641231 0.078787272 (SEQ ID NO: 3590) 497 ------ EAENSIL 0.131863052 0.100142921 181 VTYSLGKFG - 0.126641231 0.089695218 (SEQ ID NO: Q (SEQ ID SHTAWASSD 3374) NO: 3296) (SEQ ID NO: 3709) 717 ----- GYSRK (SEQ 0.131863052 0.112950153 137 YV DR 0.126641231 0.109693213 ID NO: 3458) 386 ---- DRKK (SEQ 0.131863052 0.08146183 548 ---- EAFE (SEQ 0.126641231 0.095888318 ID NO: 3369) ID NO: 3375) 68 KL TV 0.131863052 0.070945883 670 ------ TDPEGCP 0.12652671 0.087582312 (SEQ ID NO: 3743) 700 KQ DR 0.131863052 0.063471315 344 -- WD 0.12652671 0.059784458 831 TAT PPP 0.131863052 0.067816715 589 K [stop] 0.126002643 0.117169902 157 ----- RCNVS (SEQ 0.131863052 0.080937513 670 T I 0.125333365 0.115123087 ID NO: 3659) 953 ------ DKRAFV 0.131771442 0.07848717 843 E K 0.125307936 0.1170313 (SEQ ID NO: 3360) 978 [stop]L GF 0.131771442 0.061548024 209 --- KPL 0.125145098 0.058688797 979 LE[stop]G VSCK (SEQ 0.131568591 0.101292375 256 ----- KNEKR (SEQ 0.125145098 0.118773295 ID NO: 3788) ID NO: 3517) 855 R S 0.131540317 0.054730727 627 ------- QDEPALF 0.125145098 0.11944079 (SEQ ID NO: 3633) 128 A T 0.13150991 0.131075942 637 TF S- 0.125145098 0.075022945 225 G R 0.131348437 0.12857841 846 ------ VEGQIT 0.125145098 0.095200634 (SEQ ID NO: 3774) 874 E D 0.131154993 0.12741404 112 LI PV 0.125145098 0.061303825 54 I T 0.130796445 0.072189843 592 GRE- DNQV (SEQ 0.125145098 0.061215515 ID NO: 3367) 797 -------- LSKTLAQYT 0.128586666 0.060991971 273 ------- LAFPKIT 0.125145098 0.062360109 (SEQ ID NO: (SEQ ID NO: 3575) 3535) 14 VK AG 0.128586666 0.085310723 773 ---- RQYT (SEQ 0.125145098 0.098790624 ID NO: 3680) 423 RI LS 0.128586666 0.084850033 274 AF DS 0.125145098 0.089301627 583 -- LP 0.128586666 0.051620503 686 N- TV 0.125145098 0.106327975 979 LE[stop]GS- VSSNDLQAS 0.128586666 0.102476858 549 - A 0.125145098 0.111251903 PGIK (SEQ ID N (SEQ ID NO: 3279) NO: 3832) 979 LE[stop]GS- FSSKDLQAS 0.128586666 0.093654912 615 --- VIE 0.125145098 0.115519537 PGIK (SEQ ID NK (SEQ ID NO: NO: 3420) 3279)[stop] 533 -- NY 0.128586666 0.127517343 486 Y [stop] 0.12498861 0.117668911 563 ---- SGEI (SEQ ID 0.128586666 0.112169649 479 E G 0.124803485 0.119823525 NO: 3702) 979 L-E[stop]GS VSSKDH 0.128586666 0.096285329 225 G E 0.124549307 0.110077498 (SEQ ID NO: 3802) 755 ---- ANLS (SEQ 0.12851771 0.091942401 123 T N 0.123826195 0.091669684 ID NO: 3326) 461 S N 0.128271168 0.11452282 436 K E 0.123328926 0.10928445 864 D E 0.128210448 0.108842691 139 Y [stop] 0.123256307 0.11429924 84 Y C 0.128022871 0.110536014 669 - L 0.119637812 0.05675251 720 ---- RKYA (SEQ 0.127406426 0.102905352 845 ------ KVEGQI 0.119637812 0.06612892 ID NO: 3669) (SEQ ID NO: 3532) 416 VYDEAWE CTMRPG 0.127406426 0.059900059 400 ------ DLLLHL 0.119637812 0.07276695 (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: 3297) 3340)- 3362) 808 ---- TCSN (SEQ 0.127406426 0.082184056 757 L R 0.119502434 0.108713549 ID NO: 3738) 791 ------ LPSKTY 0.127406426 0.108127962 578 P L 0.119430629 0.116829607 (SEQ ID NO: 3568) 162 ------ EHERLI (SEQ 0.127406426 0.099109571 634 VA LS 0.119372647 0.100712827 ID NO: 3390) 858 ------ RQNVVKDL 0.126641231 0.065591267 510 K-- SHL 0.119372647 0.080479619 (SEQ ID NO: 3679) 231 A C 0.126641231 0.070173983 979 LE[stop]G ASSK (SEQ 0.119372647 0.074447954 ID NO: 3332) 898 KRF NCL 0.126641231 0.049641927 798 -S TA 0.119372647 0.036802807 789 EG AV 0.126641231 0.10544887 653 NL DR 0.119372647 0.061028998 640 RR TG 0.126641231 0.104632778 854 -N LS 0.119372647 0.074161693 303 ----- WVNLN 0.126641231 0.064376538 420 A S 0.119261972 0.115184751 (SEQ ID NO: 3845) 640 R- TV 0.126641231 0.051697037 519 --- QKD 0.119051026 0.108753459 890 GE DR 0.126641231 0.058497447 600 LLS PV- 0.119011185 0.056536344 513 ------- NCAFIWQK 0.126641231 0.110534935 271 ------- NGLAFPK 0.119011185 0.073725244 (SEQ ID NO: (SEQ ID NO: 3589) 3592) 36 MT TV 0.126641231 0.096682191 51 P L 0.118978183 0.099712186 979 -- AV 0.126641231 0.031136061 403 ----- LHLEK (SEQ 0.118963684 0.11518549 ID NO: 3552) 607 --- SLK 0.126641231 0.117782054 457 ----- RAKAS (SEQ 0.118963684 0.088377062 ID NO: 3656) 979 LE[stop]G FSSK (SEQ 0.126627253 0.064240928 776 ---- TRME (SEQ 0.118963684 0.083809802 ID NO: 3418) ID NO: 3759) 29 KT LS 0.126627253 0.070400509 320 KPLQRL SHCRD (SEQ 0.118677331 0.073630679 (SEQ ID NO: ID NO: 3270) 3704)[stop] 510 KQ-Y SHLQ (SEQ 0.126602218 0.092982894 685 GNPT (SEQ ATLH (SEQ 0.118677331 0.086334956 ID NO: 3705) ID NO: 3263) ID NO: 3334) 960 --- TWQ 0.12652671 0.053263565 178 ---- DELV (SEQ 0.118677331 0.101525884 ID NO: 3352) 665 --- AVI 0.12652671 0.057438099 160 ----- VSEHE (SEQ 0.113504256 0.099167463 ID NO: 3789) 675 - C 0.12652671 0.103567494 745 ----- AVTQD (SEQ 0.113504256 0.111375922 ID NO: 3336) 451 ------- ALTDWLR 0.12652671 0.081452296 570 E K 0.1130503 0.100973674 (SEQ ID NO: 3324) 805 ----- TSKTC (SEQ 0.12652671 0.07786947 368 L P 0.111983406 0.095724154 ID NO: 3760) 890 GE VAKPLLQQ 0.12652671 0.093632788 275 F Y 0.111191948 0.100665217 (SEQ ID NO: 3764) 885 -- TK 0.12652671 0.12280066 521 D E 0.111133748 0.10058089 831 T N 0.123113024 0.105004336 562 K E 0.110566391 0.097349138 147 ------ KGKPHTN 0.123112897 0.091739528 136 L Q 0.110244812 0.107286129 (SEQ ID NO: 3495) 256 --- KNE 0.122844147 0.106923843 411 E G 0.110174632 0.097582202 179 EL A- 0.122844147 0.091584443 381 LS PV 0.110164473 0.095898615 406 ----- EKKHG (SEQ 0.122844147 0.089153499 616 I V 0.109853606 0.094001833 ID NO: 3392) 295 ------ NVVAQ (SEQ 0.122844147 0.103819809 843 E R 0.109803145 0.097494217 ID NO: 3607) 658 D E 0.122389699 0.080353294 676 P H 0.109607681 0.091744681 206 H Q 0.122384978 0.08971464 484 KWYG (SEQ NSSL (SEQ 0.109535927 0.106819917 ID NO: 3273) ID NO: 3600) 689 H Q 0.122256431 0.089420446 511 QY PV 0.109451554 0.106726398 306 LN PV 0.121921649 0.07283705 979 LE[stop]GSP VSSKDV 0.108902792 0.077647274 (SEQ ID NO: 3824) 620 LY PV 0.121921649 0.084823364 420 A V 0.108649806 0.097722159 910 -- SG 0.121685511 0.114110877 53 N K 0.108567111 0.086753227 508 -------- FSKQYNCA 0.121235544 0.060533533 114 P A 0.108538006 0.106859466 (SEQ ID NO: 3417) 314 I F 0.120726616 0.074980055 637 ------- TFERREV 0.108360722 0.063051456 (SEQ ID NO: 3746) 746 VT C- 0.120516649 0.087097894 286 TK DR 0.108360722 0.053025872 910 VC CL 0.119637812 0.085877084 249 EH AV 0.108360722 0.095653705 621 ------ YNRRTR 0.119637812 0.065553526 67 NK DR 0.108360722 0.039884349 (SEQ ID NO: 3853) 467 ------ LKEAD (SEQ 0.119637812 0.109940477 944 ------- QTNKTTG 0.108360722 0.078648908 ID NO: 3555) (SEQ ID NO: 3654) 827 - KL 0.119637812 0.054530509 513 ------ NCAFIW 0.108360722 0.045078115 (SEQ ID NO: 3588) 374 --- QEA 0.119637812 0.063378708 429 ---- EGLS (SEQ 0.108360722 0.046808088 ID NO: 3384) 145 --- NDK 0.119637812 0.051846935 615 VI AV 0.108360722 0.089957198 979 LE[stop]GSPG FSSKDLQ 0.119637812 0.067517262 927 ---- NIAR (SEQ 0.108360722 0.096224338 (SEQ ID NO: (SEQ ID NO: ID NO: 3593) 3251) 3419) 338 --- ANE 0.119637812 0.103007188 56 Q V 0.108360722 0.076115958 389 KG R- 0.119637812 0.050940425 852 YY C- 0.108360722 0.054744482 587 ------ FGKRQG 0.118677331 0.110043529 816 IT LS 0.108360722 0.074232993 (SEQ ID NO: 3411) 783 ------ TAKLAY 0.118677331 0.076704941 210 P S 0.108088041 0.085752595 (SEQ ID NO: 3736) 542 -- FK 0.118677331 0.098685141 251 --- QKV 0.107840626 0.092439 733 ------ MVRNTAR 0.118677331 0.078476963 351 ---- KKLI (SEQ 0.107840626 0.05939446 (SEQ ID NO: ID NO: 3502) 3586) 396 ---- YQFG (SEQ 0.118677331 0.08225792 962 ------ QSFYRKK 0.107840626 0.060903469 ID NO: 3855) (SEQ ID NO: 3651) 837 ----- TTING (SEQ 0.118677331 0.059978646 594 EFI DCL 0.107840626 0.078577001 ID NO: 3762) 729 L P 0.118360335 0.091091038 600 --- LLS 0.107840626 0.107212137 194 D E 0.117679069 0.090466918 979 LE[stop]GS- ASSKDLQAS 0.107840626 0.073484536 PGIK (SEQ ID N (SEQ ID NO: 3279) NO: 3333) 582 ILP SC- 0.11732562 0.090313521 606 --- GSL 0.107840626 0.104907627 901 --- SHR 0.11712133 0.108439325 604 --- ETG 0.107840626 0.105428162 67 N D 0.116939695 0.113264127 473 ------- DEFCRCE 0.107840626 0.072973962 (SEQ ID NO: 3351) 309 W R 0.116671977 0.111491729 798 ------ SKTLAQ 0.107840626 0.085530107 (SEQ ID NO: 3713) 74 T S 0.11653877 0.0855649 607 ----- SLKLA (SEQ 0.107840626 0.087611083 ID NO: 3178) 838 T N 0.116394614 0.094955966 705 Q- ET 0.107840626 0.102652999 137 Y [stop] 0.116334699 0.088258455 215 GG CL 0.105199237 0.057087854 591 Q [stop] 0.116290785 0.093561727 886 KG TV 0.105199237 0.077099458 686 N K 0.116232458 0.062605741 198 -I TV 0.105199237 0.087584827 445 ----- DAQSK (SEQ 0.115532631 0.10378499 878 NN DS 0.105199237 0.079694461 ID NO: 3344) 134 Q P 0.114967131 0.11371497 76 MK IC 0.105199237 0.090203405 698 - KE 0.114412847 0.098843087 227 ALSDA (SEQ SPERR (SEQ 0.105199237 0.101107303 ID NO: 3252) ID NO: 3727) 701 QR PV 0.114412847 0.104102361 134 Q-P HCL 0.105199237 0.057452451 281 --- PPQ 0.114412847 0.077542482 794 K-T NCL 0.105199237 0.055344005 708 K [stop] 0.113715295 0.106986973 532 ----- INYFK (SEQ 0.105199237 0.091675146 ID NO: 3478) 696 SYK LQR 0.113676993 0.07036758 558 VI AV 0.105199237 0.093989814 703 -- TIQ 0.113676993 0.062517799 610 -- LA 0.105199237 0.085523633 596 I F 0.113504467 0.107709004 82 -H DS 0.105199237 0.045790293 197 ------ SIHVTRE 0.108360722 0.081689422 780 DW AV 0.105199237 0.092887336 (SEQ ID NO: 3710) 510 KQYNCA SHLQNS 0.108360722 0.044585998 708 ------------- KEVEQR 0.105052225 0.060231645 (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: 3271) 3706) 3493) 953 D C 0.108360722 0.098828046 548 EAFE (SEQ RPSR (SEQ 0.105052225 0.087924295 ID NO: 3255) ID NO: 3675) 63 RA SC 0.108360722 0.091093584 251 ----- QKVIK (SEQ 0.105052225 0.044504449 ID NO: 3642) 597 ----- WNDLL (SEQ 0.108360722 0.065802495 ID NO: 3842) 497 EA AV 0.105052225 0.084527693 208 VK CL 0.108360722 0.044537036 841 ------- GKELKVE 0.105052225 0.091417746 (SEQ ID NO: 3433) 468 ------- KEADKDE 0.108360722 0.074432186 575 F- LS 0.105052225 0.076582865 (SEQ ID NO: 3491) 84 -Y DS 0.108360722 0.088490546 910 ----- VCLNC (SEQ 0.105052225 0.090851749 ID NO: 3769) 496 -- IE 0.108360722 0.07371372 570 ----- EVNFN (SEQ 0.104207678 0.100821855 ID NO: 3407) 672 P---E SGCV (SEQ 0.108360722 0.07159837 661 -- EN 0.104134797 0.102286534 ID NO: 3701)[stop] 910 VC AV 0.108360722 0.062775349 500 --- NSI 0.104134797 0.058937244 868 EL DR 0.108360722 0.050620256 420 ------- AWERIDK 0.104134797 0.06870659 (SEQ ID NO: 3337) 235 -- AV 0.108360722 0.094955272 285 ------- HTKEGIE 0.10063092 0.059060467 (SEQ ID NO: 3465) 332 PL RQ 0.108360722 0.062876398 347 --- VCN 0.10063092 0.070834064 461 ------- SFVIEGLK 0.108360722 0.064022496 671 - D 0.10063092 0.070617109 (SEQ ID NO: 3699) 562 KSGEI (SEQ SPAR (SEQ 0.108360722 0.067954904 103 AP DS 0.10063092 0.044259819 ID NO: 3272) ID NO: 3726)- 556 ------ YTVINKK 0.108360722 0.070852948 584 --- PLA 0.10063092 0.096095285 (SEQ ID NO: 3861) 121 RLT SC- 0.108360722 0.070897115 685 GN DS 0.10063092 0.057986016 868 EL NW 0.108360722 0.108128749 837 ------- TTINGKE 0.10063092 0.070942034 (SEQ ID NO: 3763) 745 ---- AVTQ (SEQ 0.108360722 0.088762315 509 ---- SKQY (SEQ 0.10063092 0.078527136 ID NO: 3335) ID NO: 3711) 674 ------ GCPLSR 0.107840626 0.089241733 914 -C LS 0.10063092 0.094652044 (SEQ ID NO: 3424) 185 ------- LGKFGQR 0.107840626 0.068363178 932 --- WLF 0.10063092 0.060195605 (SEQ ID NO: 3547) 344 WD LS 0.107840626 0.066070011 979 LE[stop]G VSRK (SEQ 0.10063092 0.052097814 ID NO: 3794) 274 - AF 0.107840626 0.075101467 194 ------ DFYSIH (SEQ 0.10063092 0.073983623 ID NO: 3354) 577 D G 0.1075508 0.10472372 596 ---- IWND (SEQ 0.10063092 0.075782386 ID NO: 3486) 700 K M 0.107451835 0.099853237 32 L S 0.099998377 0.098160777 641 -- RE 0.106527066 0.104478931 822 D E 0.099951571 0.083423411 599 ---- DLLS (SEQ 0.106527066 0.100649327 957 F S 0.099918571 0.054364404 ID NO: 3363) 564 GE DR 0.106527066 0.090487961 902 ---- HRPV (SEQ 0.099764722 0.080515888 ID NO: 3462) 836 MT IC 0.106527066 0.100530022 474 ----- EFCRC (SEQ 0.099764722 0.089224756 ID NO: 3383) 853 ----- YNRYK (SEQ 0.106527066 0.088862545 242 --- KYQ 0.099764722 0.054563676 ID NO: 3854) 586 ---- AFGK (SEQ 0.106527066 0.08642655 342 D C 0.099764722 0.075335971 ID NO: 3311) 275 -F SV 0.106527066 0.099879454 413 -- WG 0.099764722 0.079591734 429 -- EG 0.106527066 0.066947062 149 ------- KPHTNYF 0.099764722 0.070518497 (SEQ ID NO: 3522) 612 N T 0.106459427 0.08415093 510 KQY SHL 0.099764722 0.087972807 611 --- ANG 0.105912094 0.09807063 775 ---- YTRM (SEQ 0.097097924 0.054287911 ID NO: 3857) 563 ----- SGEIV (SEQ 0.105912094 0.10402865 607 -- SL 0.097097924 0.071187897 ID NO: 3703) 203 E- DR 0.10545658 0.048953383 897 -K TE 0.097097924 0.05492748 872 -- LS 0.10545658 0.08227801 118 GN DS 0.097097924 0.083309653 291 EA -C 0.10545658 0.078263499 425 D V 0.096834118 0.093228512 894 S- TG 0.10545658 0.077864616 704 -- IQ 0.096824625 0.053400496 851 -T LS 0.10545658 0.071676834 207 ---- PVKPLE 0.096824625 0.074740089 (SEQ ID NO: 3630) 251 -- QK 0.105199237 0.101057895 154 -- YF 0.096824625 0.067984555 194 ----- DFYSI (SEQ 0.105199237 0.05958457 668 ---- ALTD (SEQ 0.096824625 0.088221952 ID NO: 3353) ID NO: 3322) 236 --- VAS 0.105199237 0.084024149 386 -- DR 0.096824625 0.067625309 899 RF SC 0.105199237 0.046835281 388 ---- KKGK (SEQ 0.096824625 0.060426936 ID NO: 3498) 533 ---- NYFK (SEQ 0.104134797 0.074535749 880 ---- DISS (SEQ ID 0.096824625 0.089590245 ID NO: 3609) NO: 3358) 747 --- TQD 0.104134797 0.072847901 783 -------- TAKLAYEG 0.096824625 0.064829377 (SEQ ID NO: 3737) 371 -- YK 0.104134797 0.087850723 643 -------- VLDSSNIK 0.096824625 0.089286037 (SEQ ID NO: 3785) 625 TR -Q 0.104134797 0.077810682 157 --- RCN 0.096824625 0.095145301 195 -- FY 0.104134797 0.074775738 576 ------- DDPNLII 0.096824625 0.040738988 (SEQ ID NO: 3346) 464 -- IE 0.103802674 0.096071807 296 ----- VVAQI (SEQ 0.096824625 0.081486595 ID NO: 3836) 451 A T 0.103708002 0.093659384 559 -I CL 0.096824625 0.07248553 245 DII ETV 0.10291048 0.070762893 979 LE-[stop] VSIK (SEQ ID 0.096824625 0.050151323 NO: 3792) 504 ---- DISG (SEQ ID 0.10291048 0.066659076 767 ------ RTFMAE 0.096824625 0.057097889 NO: 3356) (SEQ ID NO: 3692) 323 -Q IH 0.10291048 0.071312882 820 ------- DYDRVLE 0.091736446 0.087280678 (SEQ ID NO: 3371) 638 ----- FERRE (SEQ 0.10291048 0.096842919 415 KVY NC- 0.091736446 0.087802292 ID NO: 3409) 593 ------- REFIWNDLL 0.10291048 0.079136445 674 GCPL (SEQ DAH[stop] 0.091736446 0.089744971 (SEQ ID NO: ID NO: 3260) 3663) 730 ------ ADDMVR 0.10291048 0.102673345 705 QA -C 0.091736446 0.071260814 (SEQ ID NO: 3304) 827 KL TV 0.10291048 0.094773598 307 -N TD 0.091736446 0.071147866 138 VY C- 0.10291048 0.091363063 370 G- AV 0.091736446 0.051182414 310 QK DR 0.10291048 0.068590108 954 KRA T-V 0.091736446 0.081861067 524 KKL RN [stop] 0.102360708 0.063041226 326 KGFPS (SEQ RASLA (SEQ 0.091644836 0.054125593 ID NO: 3267) ID NO: 3657) 940 ----- YKKYQ (SEQ 0.102324952 0.078047936 289 GI LS 0.091644836 0.069499341 ID NO: 3850) 918 --- THA 0.102324952 0.066375654 142 -E CL 0.091644836 0.064151435 979 LE[stop]GSPG VSSNDLQ 0.102324952 0.073267994 10 RR TG 0.091644836 0.090788699 (SEQ ID NO: (SEQ ID NO: 3251) 3831) 4 K Q 0.101594625 0.098660596 193 LDFYSIH RTSTAST 0.091277438 0.058446074 (SEQ ID NO: (SEQ ID NO: 3276) 3694) 589 ----- KRQGR (SEQ 0.101233118 0.096410486 979 LE[stop]GS- VSIKDLQAS 0.091277438 0.055852497 ID NO: 3529) PGIK (SEQ ID NK (SEQ ID NO: NO: 3793) 3279)[stop] 211 ----- LEQIG (SEQ 0.101233118 0.097193308 590 ----- RQGRE (SEQ 0.091277438 0.07404543 ID NO: 3544) ID NO: 3678) 649 I N 0.101148579 0.091521137 308 --- LWQ 0.091277438 0.063930973 220 ------ ASGPVG 0.099764722 0.05025267 311 -------- KLKIGRDEA 0.091277438 0.090951045 (SEQ ID NO: (SEQ ID NO: 3330) 3509) 787 AYEG (SEQ PTRD (SEQ 0.099764722 0.069079749 585 ------ LAFGKR 0.091277438 0.057801256 ID NO: 3253) ID NO: 3629) (SEQ ID NO: 3534) 888 ----- RSGEA (SEQ 0.099764722 0.094243718 466 ------- GLKEADK 0.091277438 0.064806465 ID NO: 3685) (SEQ ID NO: 3443) 504 ------ DISGFS (SEQ 0.099764722 0.091750112 414 -- GK 0.089604136 0.067494445 ID NO: 3357) 323 QR RD 0.099764722 0.040967673 979 LE[stop]GSPG ISSKDLQ 0.089062173 0.071078934 (SEQ ID NO: (SEQ ID NO: 3251) 3482) 647 SN DS 0.099764722 0.071118435 300 ---- IVIW (SEQ ID 0.089062173 0.052509601 NO: 3485) 740 DLLY (SEQ SAV- 0.099753827 0.050146089 209 KP TV 0.089062173 0.046404323 ID NO: 3254) 38 - A 0.099114744 0.090540757 851 -T CL 0.089062173 0.047830666 261 LA PV 0.099083678 0.060781559 466 GL LS 0.089062173 0.060367604 255 ---- KKNE (SEQ 0.098543421 0.07624083 202 RE-- SSSL (SEQ ID 0.089062173 0.059904595 ID NO: 3505) NO: 3730) 280 ---- LPPQ (SEQ 0.098543421 0.069822078 291 EA DC 0.089062173 0.078319771 ID NO: 3567) 308 LW PV 0.097993366 0.087176639 871 RL LS 0.089062173 0.055570451 753 --- IFA 0.097806547 0.045793305 874 EE DR 0.089062173 0.077193595 205 N I 0.097706358 0.075812724 868 ELDR (SEQ NWT- 0.089062173 0.059312334 ID NO: 3257) 142 E Q 0.097553503 0.074603349 301 VI AV 0.089062173 0.083633904 717 ------- GYSRKYAS 0.097097924 0.054767341 208 ---- VKPLEQI 0.089062173 0.046334388 (SEQ ID NO: (SEQ ID NO: 3459) 3784) 979 LE[stop]GSPG VSSKDLH 0.097097924 0.068112769 305 -N TT 0.089062173 0.072049193 (SEQ ID NO: (SEQ ID NO: 3251) 3806) 527 NLYL (SEQ TCT[stop] 0.097097924 0.089930288 978 [stop]L GP 0.089062173 0.071277586 ID NO: 3283) 230 D T 0.097097924 0.061172404 866 S- TG 0.089062173 0.056446779 595 ---- FIWN (SEQ 0.097097924 0.075559339 628 DE LS 0.089062173 0.070268313 ID NO: 3413) 526 LN PV 0.097097924 0.065035268 651 -P TA 0.089062173 0.05500823 928 IA TV 0.096824625 0.059262285 276 --- PKI 0.089062173 0.06318371 694 --- GES 0.096824625 0.04858003 299 - V 0.089062173 0.08531757 190 --- QRA 0.096824625 0.080026424 346 -- MV 0.089062173 0.060831249 601 ------- LSLETGS 0.096824625 0.078527715 742 LY PV 0.089062173 0.087665343 (SEQ ID NO: 3576) 150 -- PH 0.096482996 0.069152449 743 YY ET 0.089062173 0.059923968 307 --- NLW 0.096482996 0.053647152 751 ML RQ 0.089062173 0.045208162 808 --- TCS 0.096381808 0.086676449 894 -S RQ 0.089062173 0.071980752 687 ------- PTHILRI 0.095815136 0.067505643 433 KH TV 0.089062173 0.061328218 (SEQ ID NO: 3628) 469 --- EAD 0.095416799 0.081758814 899 RF LS 0.089062173 0.083069213 181 VTYS (SEQ SHTA (SEQ 0.095412022 0.081952005 582 --- ILP 0.089062173 0.053169618 ID NO: 3295) ID NO: 3708) 814 F C 0.095092296 0.090308339 979 LE[stop]GS- VSSKDLHAS 0.087252372 0.071793737 PGIK (SEQ ID N (SEQ ID NO:) NO: 3807) 389 K [stop] 0.094408724 0.074513611 735 ------ RNTARD 0.087252372 0.052948743 (SEQ ID NO: 3672) 663 I C 0.094255793 0.075689829 227 ------------ ALSDACM 0.087252372 0.073258454 (SEQ ID NO: 3321) 979 L I 0.092483102 0.077877212 151 HTNYFGRCN TPTTSADAT 0.087252372 0.05854259 V (SEQ ID C (SEQ ID NO: 3264) NO: 3758) 290 I- LS 0.092483102 0.055600721 875 ------ ESVNND 0.087252372 0.069839022 (SEQ ID NO: 3397) 202 R-------E SSSLASGL 0.092483102 0.051559995 151 -H CL 0.087252372 0.072166234 (SEQ ID NO: 3731)[stop] 130 S I 0.092259428 0.091849472 517 ----- IWQKD (SEQ 0.087252372 0.059389612 ID NO: 3488) 237 A V 0.092157582 0.073154252 294 NN ET 0.087252372 0.054113615 550 F- LS 0.091736446 0.078399586 979 LE[stop]GS- VSSEDLQAS 0.087252372 0.053550045 PGIK (SEQ ID NK (SEQ ID NO: NO: 3796) 3279)[stop] 352 --- KLI 0.091736446 0.062601185 280 LP C- 0.087252372 0.046361662 257 ------ NEKRLA 0.091736446 0.074344692 973 WK CL 0.087252372 0.043130788 (SEQ ID NO: 3591) 978 [stop]LE QVS 0.091736446 0.070305933 859 - Q 0.087252372 0.049734005 878 NN ET 0.091736446 0.057372719 383 ----- SEEDR (SEQ 0.087252372 0.079531899 ID NO: 3695) 484 -KWYGD NSSLSA 0.091736446 0.051261975 193 -------- LDFYSIHVT 0.087252372 0.075700876 (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: 3274) 3601) 3542) 796 -- YL 0.08954136 0.077067905 731 ---- DDMV (SEQ 0.087252372 0.055852115 ID NO: 3345) 872 --- LSE 0.089427419 0.072631533 586 --- AFG 0.087252372 0.059593552 388 ----- KKGKK (SEQ 0.089427419 0.050485092 11 RR GD 0.087252372 0.07840862 ID NO: 3499) 211 LEQIGG RNRSAA 0.089427419 0.058037112 979 LE[stop]G VPSK (SEQ 0.086010969 0.05573546 (SEQ ID NO: (SEQ ID NO: ID NO: 3787) 3281) 3671) 193 LDFYSIHV RTSTAST 0.089427419 0.06189365 671 D V 0.084756133 0.072837893 (SEQ ID NO: (SEQ ID NO: 3277) 3694)[stop] 769 FMAERQY LWPRGST 0.089427419 0.048645432 462 --- FVI 0.083590457 0.068208408 (SEQ ID NO: (SEQ ID NO: 3258) 3582) 558 --- VIN 0.089427419 0.08506841 619 TLYNRRTR PCTTGEPD 0.083590457 0.071170573 (SEQ ID NO: (SEQ ID NO: 3292) 3613) 973 --- WKP 0.089427419 0.059845159 337 QA PV 0.083590457 0.078536227 285 ---- HTKE (SEQ 0.089427419 0.058488636 418 ---- DEAW (SEQ 0.083590457 0.038813523 ID NO: 3463) ID NO: 3347) 353 -- LI 0.089427419 0.055053978 426 -- KK 0.083590457 0.07413354 950 ---- GNTD (SEQ 0.089427419 0.068410765 208 VK AV 0.083590457 0.037512118 ID NO: 3445) 642 ----- EVLDS (SEQ 0.089427352 0.04064403 519 -- QK 0.083590457 0.082570582 ID NO: 3405) 586 AF ET 0.089427352 0.026351335 122 LT D[stop] 0.083590457 0.076976074 147 KG C- 0.089427352 0.03353623 659 RG PV 0.083590457 0.0659041 473 ----- DEFCR (SEQ 0.089427352 0.087380064 160 ------- VSEHERL 0.083590457 0.081613302 ID NO: 3350) (SEQ ID NO: 3790) 62 SR CL 0.089427352 0.085389222 278 IT TA 0.083590457 0.047460329 946 N C 0.089427352 0.086906423 242 KY CL 0.083590457 0.045794039 341 ----- VDWWD 0.089427352 0.088291312 518 WQ GR 0.08340916 0.072293259 (SEQ ID NO: 3772) 546 --- KPE 0.089427352 0.070048864 513 ---- NCAF (SEQ 0.08340916 0.058923148 ID NO: 3587) 979 LE[stop]G-- VSSKDLQAC 0.089062173 0.059857989 31 L C 0.082126328 0.081561344 SPGI (SEQ ID L (SEQ ID NO: 3278) NO: 3811) 944 --- QTN 0.089062173 0.066135158 868 E G 0.081974564 0.070868354 170 SP RQ 0.089062173 0.059574685 771 ----- AERQY (SEQ 0.089062173 0.079594468 681 ----- KDSLG (SEQ 0.080796062 0.070617083 ID NO: 3309) ID NO: 3489) 808 TC DS 0.089062173 0.069853908 552 -- AN 0.080796062 0.080329675 347 -- VC 0.089062173 0.085265549 168 --- LLS 0.080796062 0.076933587 554 RF SC 0.089062173 0.05713278 418 -------- DEAWERID 0.080796062 0.062400841 (SEQ ID NO: 3349) 419 EA LS 0.089062173 0.062902243 356 ----- EKKED (SEQ 0.080428937 0.076250147 ID NO: 3391) 184 ------ SLGKFG 0.089062173 0.066443269 904 -- PV 0.077521024 0.061782081 (SEQ ID NO: 3716) 524 K-K ETE 0.089062173 0.078642197 8 KIR ETG 0.075979618 0.06718831 544 KI NC 0.089062173 0.051439626 963 ---- SFYR (SEQ 0.075979618 0.064323698 ID NO: 3700 417 ------ YDEAWE 0.089062173 0.084599468 34 RV SC 0.075979618 0.063118319 (SEQ ID NO: 3847) 911 CL DR 0.089062173 0.07167912 369 ------ AGYKRQ 0.075979618 0.050848396 (SEQ ID NO: 3313) 735 -------- RNTARDLLY 0.089062173 0.058412514 242 KY TV 0.075979618 0.056127246 (SEQ ID NO: 3673) 305 N D 0.089057834 0.075458081 297 VAQIV (SEQ WPRS (SEQ 0.075979618 0.07433917 ID NO: 3293) ID NO: 3843)[stop] 886 KGR RAD 0.08869535 0.056741957 672 -P LS 0.075979618 0.056690099 235 A P 0.088591922 0.085721293 650 KP TV 0.075979618 0.062837656 494 ------- FAIEAEN 0.088487772 0.046582849 454 DW AV 0.075979618 0.049282705 (SEQ ID NO: 3408) 957 F Y 0.088355066 0.088244344 312 LK PV 0.075979618 0.074673373 670 ----- TDPEG (SEQ 0.087352311 0.070989739 636 LT PV 0.075651042 0.051037357 ID NO: 3742) 388 -- KK 0.087352311 0.077174067 325 ----- LKGFP (SEQ 0.075651042 0.068819815 ID NO: 3557) 294 -- NN 0.087352311 0.079627552 669 L E 0.075651042 0.075396635 748 ------ QDAMLI 0.087352311 0.070738039 79 A V 0.074780904 0.074608034 (SEQ ID NO: 3632) 978 [stop]LE[stop] SVSSK (SEQ 0.087252372 0.078631278 887 GRSGEA 0.073542892 0.072424639 G ID NO: 3734) (SEQ ID NO: 3452) 743 ------ YYAVTQ 0.087252372 0.074424467 404 EIL DR 0.073542892 0.054184233 (SEQ ID NO: 3865) 90 KDP NCL 0.087252372 0.062483354 190 Q-R HVA 0.073542892 0.04828771 459 --- KAS 0.087252372 0.077679223 811 NC DS 0.073542892 0.073088889 319 -------- AKPLQRLK 0.087252372 0.077741662 824 ---- VLEK (SEQ 0.073542892 0.055393108 (SEQ ID NO: ID NO: 3786) 3316) 844 ------- LKVEGQI 0.087252372 0.078010123 63 RA TV 0.073542892 0.069467367 (SEQ ID NO: 3558) 964 ----- FYRKK (SEQ 0.087252372 0.061717189 350 VK AV 0.072378636 0.048322939 ID NO: 3422) 510 ----- KQYNC (SEQ 0.087252372 0.072460113 690 ILRI (SEQ ID PEN- 0.072378636 0.05860973 ID NO: 3526) NO: 3265) 211 LE C- 0.087252372 0.072615166 384 EED D-C 0.072378636 0.064425519 154 --- YFG 0.087252372 0.050562832 349 ------- NVKKLIN 0.071251281 0.055420168 (SEQ ID NO: 3605) 428 - V 0.087252372 0.070602271 427 KVE NCL 0.071251281 0.037488341 328 ------- FPSFPLV 0.087252372 0.050986167 537 GGKLRFK AASCGSR 0.071251281 0.047685675 (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: 3415) 3261) 3301) 334 --- VER 0.087252372 0.083245674 486 ----- YGDLR (SEQ 0.071251281 0.057530417 ID NO: 3849) 635 --- ALT 0.087252372 0.058640453 586 ------- AFGKRQG 0.071251281 0.055531439 (SEQ ID NO: 3312) 87 EF DC 0.087252372 0.084662756 850 ---- ITYY (SEQ 0.071251281 0.070061657 ID NO: 34843) 763 ---- RQGK (SEQ 0.087252372 0.06272177 929 --- ARS 0.071251281 0.070844259 ID NO: 3677) 525 ---- KLNL (SEQ 0.087252372 0.087055601 617 EK AV 0.071251281 0.056273969 ID NO: 3511) 482 LQK PLM 0.087252372 0.0864173 977 V[stop] AV 0.071036023 0.057250091 228 -- LS 0.087252372 0.071648918 522 --- GVK 0.071036023 0.066325629 149 ---- KPHT (SEQ 0.087252372 0.063809398 903 RP LS 0.070891186 0.042147704 ID NO: 3520) 14 VKDSNTK SRTATQR 0.087252372 0.086609324 689 HI P- 0.070270828 0.063050321 (SEQ ID NO: (SEQ ID NO: 3294) 3729) 567 VP C- 0.087252372 0.05902513 663 - I 0.070270828 0.06150934 275 -- FP 0.080428937 0.059363481 649 IK RQ 0.070270828 0.060647973 308 ------ LWQKLK 0.080428937 0.078547724 258 -- EK 0.070270828 0.058125711 (SEQ ID NO: 3583) 15 KDSNTKK RTATQRR 0.080428937 0.072523813 152 TN DS 0.070270828 0.059660679 (SEQ ID NO: (SEQ ID NO: 3266) 3690) 979 LE[stop]GSPG VSSKDLQG 0.080428937 0.070440346 351 ----- KKLINE 0.070270828 0.061736597 I (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: 3278) 3818) 3503) 425 --- DKK 0.080428937 0.056582403 763 -- RQ 0.070270828 0.05541295 288 EGI RAS 0.080428937 0.054809688 666 VI DS 0.070270828 0.069953364 849 QI R- 0.080428937 0.058314054 186 GK RQ 0.066783091 0.059043838 526 ----- LNLYL (SEQ 0.080428937 0.073029285 242 ------- KYQDHLE 0.066783091 0.058248788 ID NO: 3564) (SEQ ID NO: 3533) 546 ---- KPEA (SEQ 0.080428937 0.06983999 190 ------- QRALDFYS 0.066783091 0.060436783 ID NO: 3519) 792 -- PS 0.080428937 0.067496853 484 --KWYGDL NSSLSASF 0.061911903 0.060235262 (SEQ ID NO: (SEQ ID NO: 3275) 3603) 706 -------- AAKEVEQR 0.080428937 0.075434091 416 VY CT 0.061911903 0.058375882 (SEQ ID NO: 3300) 710 ---- VEQR (SEQ 0.080165897 0.064037522 900 FS SV 0.060850202 0.045333847 ID NO: 3775) 949 -T LS 0.080165897 0.057028434 550 FE CL 0.060850202 0.050669807 224 V C 0.080165897 0.062705318 169 LS -P 0.059253838 0.055169203 202 ----- RESNH (SEQ 0.08002463 0.069004172 487 GD CL 0.058561444 0.050771143 ID NO: 3664) 380 YLS -T[stop] 0.079267535 0.078743084 800 ------ TLAQYT 0.058239485 0.054115265 (SEQ ID NO: 3753) 617 --- EKT 0.079267535 0.066283102 863 KD RI 0.058239485 0.041340026 237 AS TA 0.079267535 0.061120875 407 KKHGE (SEQ RSTAR (SEQ 0.058239485 0.049050481 ID NO: 3268) ID NO: 3687) 416 VYD C-T 0.07889536 0.067603097 593 ------ REFIW (SEQ 0.058239485 0.057097188 ID NO: 3662) 554 -------- RFYTVINKK 0.078495111 0.06923226 979 LE[stop]G-SP VSSKVLQ 0.050653241 0.049828056 (SEQ ID NO: (SEQ ID NO: 3667) 3827) 619 TLYN (SEQ PC-T 0.078181072 0.043873495 42 ER A- 0.050653241 0.043693463 ID NO: 3291) 487 ------ GDLRGKP 0.072378636 0.071208648 897 -- KK 0.050653241 0.046680114 (SEQ ID NO: 3429) 644 L [stop] 0.072378636 0.060246346 294 NN DS 0.049177787 0.048944158 544 KI TV 0.072378636 0.05442277 186 GKFGQRAL ASSDREPWT 0.049177787 0.048777834 DFY (SEQ ID ST (SEQ ID NO: 3262) NO: 3331) 933 ---- LFLR (SEQ 0.072378636 0.06374014 696 SYK -LQ 0.049177787 0.048584657 ID NO: 3546) 276 PKITLP (SEQ LRSPCL 0.072378636 0.070970251 552 AN DS 0.049177787 0.044744659 ID NO: 3284) (SEQ ID NO: 3570) 808 ------- TCSNCGFT 0.072378636 0.065622369 979 LE[stop]G- VSSKYLQAS 0.049086177 0.048688856 (SEQ ID NO: SPGIK (SEQ NK (SEQ ID 3740) ID NO: NO: 3828) 3279)[stop] 978 [stop]LE[stop] YVSSKDL 0.072378636 0.066035046 413 -------- WGKVYDEA 0.048681821 0.046101055 GS- (SEQ ID NO: (SEQ ID NO: 3862) 3840) 919 HA PV 0.072378636 0.058676376 920 ----- AAEQA (SEQ 0.048224673 0.046055533 ID NO: 3299) 378 -------- LPYLSSE 0.072378636 0.071574474 (SEQ ID NO: 3569) 858 RQ LS 0.072378636 0.04290216 152 -------- TNYFGRCN 0.072378636 0.054244402 (SEQ ID NO: 3757) 859 ------ QNVVKD 0.072378636 0.069366552 (SEQ ID NO: 3644) 226 KA LS 0.071324732 0.06748566 849 ------ QITYYN 0.071251281 0.061753986 (SEQ ID NO: 3640) 376 ---- ALLP (SEQ 0.071251281 0.046839434 ID NO: 3318) 660 --- GEN 0.071251281 0.063597301 (SEQ ID NO: 3647) 615 VI DS 0.066783091 0.065544343 295 NVVAQI 0.066783091 0.066726619 (SEQ ID NO: 3608) 549 AFE PTR 0.066783091 0.063274062 924 -AL PSG 0.066783091 0.057049314 979 LE[stop] VSR 0.06547263 0.059545386 284 P L 0.06489326 0.063807972 620 -- LY 0.06268489 0.052769076 668 -A LS 0.06268489 0.057930418 651 ---- PMNL (SEQ 0.06268489 0.054376534 ID NO: 3619) 723 --SK PPLL (SEQ ID 0.061911903 0.057719078 NO: 3621) 788 YEG TRD 0.061911903 0.061258021 572 NF DS 0.061911903 0.059419672 943 ---- YQTN (SEQ 0.061911903 0.05179175 ID NO: 3856) 979 LE[stop]GS-P VSSKDVQ 0.061911903 0.05324798 (SEQ ID NO: 3825) 49 KK RS 0.061911903 0.057783548 745 -A LS 0.061911903 0.055420231 262 -AN ETD 0.061911903 0.056977155 726 ---- AKNL (SEQ 0.061911903 0.05965082 ID NO: 3315) 583 ---- LPLA (SEQ 0.061911903 0.053222838 ID NO: 3566) 585 -- LA 0.061911903 0.047677961 347 -------- VCNVKKLI 0.061911903 0.060561898 (SEQ ID NO: 3771) 735 RN Q- 0.061911903 0.057911259 176 AN TD 0.061911903 0.042711394 979 LE[stop]GSPG VSSKDFQ 0.047884408 0.043419619 (SEQ ID NO: (SEQ ID NO: 3251) 3801) 423 RIDKKV ---NRQ 0.046868759 0.045505043 (SEQ ID NO: 3286) 162 EH AV 0.043166861 0.040108447 741 LLY CC- 0.041101883 0.039741701 443 SEDAQS RGRPI (SEQ 0.041101883 0.03770041 (SEQ ID NO: ID NO: 3288) 3668)[stop] 767 RT TA 0.041101883 0.040956261
    [stop] represent a stop codon, so that amino acids that follow are additional amino acids after a stop codon. (−) holds the position for the insertion shown in the adjacent “Alteration” column. Pos.: Position; Ref.: Reference; Alt.: Alternation; Med. Enrich.: Median Enrichment.

    Example 5: Cleavage Activity of Selected CasX Variant Proteins and Variant Protein:sgRNA Pairs

    [0353] The effect of select CasX variant proteins on CasX protein activity, using a reference sgRNA scaffold (SEQ ID NO: 5) and E6 and/or E7 spacers is shown in Table 29 below and FIGS. 10 and 11.

    [0354] In brief, EGFP HEK293T reporter cells were seeded into 96-well plates and transfected according to the manufacturer's protocol with lipofectamine 3000 (Life Technologies) and 50-200 ng plasmid DNA encoding the variant CasX protein, P2A-puromycin fusion and the reference sgRNA. The next day cells were selected with 1.5 μg/ml puromycin for 2 days and analyzed by fluorescence-activated cell sorting 7 days after selection to allow for clearance of EGFP protein from the cells EGFP disruption via editing was traced using an Attune NxT Flow Cytometer and high-throughput autosampler.

    TABLE-US-00041 TABLE 29 Effect of CasX Protein Variants. Norm SD Mut. SEQ ID NO 3.56 0.479918161 L379R + C477K + A708K + [P793] + T620P 3866 3.44 0.065473567 M771A 3867 3.25 0.243066966 L379R + A708K + [P793] + D732N 3868 3.2 0.065443719 W782Q 3869 3.08 0.06581193 M771Q 3870 3.06 0.098482124 R458I + A739V 3871 2.99 0.249667198 L379R + A708K + [P793] + M771N 3872 2.98 0.226829483 L379R + A708K + [P793] + A739T 3873 2.98 0.230093698 L379R + C477K + A708K + [P793] + D489S 3874 2.95 0.225022742 L379R + C477K + A708K + [P793] + D732N 3875 2.95 0.048047426 V711K 3876 2.85 0.244869555 L379R + C477K + A708K + [P793] + Y797L 3877 2.84 0.16661152 L379R + A708K + [P793] 3878 2.82 0.219742241 L379R + C477K + A708K + [P793] + M771N 3879 2.75 0.215673641 A708K + [P793] + E386S 3880 2.71 0.10301172 L379R + C477K + A708K + [P793] 3881 2.62 0.066259269 L792D 3882 2.61 0.069056066 G791F 3883 2.56 0.138158681 A708K + [P793] + A739V 3884 2.52 0.110846334 L379R + A708K + [P793] + A739V 3885 2.5 0.070762901 C477K + A708K + [P793] 3886 2.47 0.180431811 L249I, M771N 3887 2.46 0.050035486 V747K 3888 2.42 0.14702229 L379R + C477K + A708K + [P793] + M779N 3889 2.36 0.045498608 F755M 3890 2.3 0.179759799 L379R + A708K + [P793] + G791M 3891 2.29 0.16573206 E386R + F399L + [P793] 3892 2.24 0.000278715 A708K + [P793] 3893 2.23 0.243365847 L404K 3894 2.16 0.019745961 E552A 3895 2.13 0.002238075 A708K 3896 2.08 0.316339196 M779N 3897 2.08 0.062500445 P793G 3898 2.07 0.117354932 L379R + C477K + A708K + [P793] + A739V 3899 2.03 0.057771128 L792K 3900 2.01 0.186905281 L379R + A708K + [P793] + M779N 3901 2.01 0.080358848 {circumflex over ( )}AS797 3902 1.95 0.218366091 C477H 3903 1.95 0.040076499 Y857R 3904 1.94 0.032799694 L742W 3905 1.94 0.038256856 I658V 3906 1.93 0.055533894 C477K + A708K + [P793] + A739V 3907 1.9 0.028572575 S932M 3908 1.84 0.115143156 T620P 3909 1.81 0.18802403 E385P 3910 1.81 0.049828835 A708Q 3911 1.76 0.043121298 L307K 3912 1.7 0.03352434 L379R + A708K + [P793] + D489S 3913 1.7 0.170748704 C477Q 3914 1.65 0.051918988 Q804A 3915 1.64 0.169459451 F399L 3916 1.64 0.02984323 L379R + A708K + [P793] + Y797L 3917 1.64 0.168799771 L379R + C477K + A708K + [P793] + G791M 3918 1.63 0.035361733 D733T 3919 1.63 0.062042898 P793Q 3920 1.6 0.000928887 A739V 3921 1.59 0.208295832 E386S 3922 1.58 0.00189514 F536S 3923 1.57 0.204148363 D387K 3924 1.55 0.198137682 E386N 3925 1.52 0.000291529 C477K 3926 1.51 0.00032232 C477R 3927 1.49 0.095600844 A739T 3928 1.46 0.051799824 S219R 3929 1.41 0.000272809 K416E & A708K 3930 1.4 4.65E−05 L379R 3931 1.38 0.043395969 E385K 3932 1.36 0.000269797 G695H 3933 1.35 0.02584186 L379R + C477K + A708K + [P793] + A739T 3934 1.35 0.158192737 E292R 3935 1.34 0.184524879 L792K 3936 1.31 0.064556939 K25R 3937 1.31 0.08768015 K975R 3938 1.31 0.062237773 V959M 3939 1.29 0.092916832 D489S 3940 1.29 0.137197584 K808S 3941 1.28 0.181775511 N952T 3942 1.27 0.031730102 K975Q 3943 1.25 0.030353503 S890R 3944 1.23 0.350374014 [P793] 3945 1.21 8.61E−05 A788W 3946 1.21 0.057483618 Q338R + A339E 3947 1.21 0.116491085 I7F 3948 1.21 0.061416272 QT945KI 3949 1.21 0.091585825 K682E 3950 1.19 0.000423928 E385A 3951 1.19 0.053255444 P793S 3952 1.18 0.043774095 E385Q 3953 1.18 0.124987984 D732N 3954 1.17 0.101573595 E292K 3955 1.16 0.000245107 S794R + Y797L 3956 1.15 0.160445636 G791M 3957 1.14 0.098217225 I303K 3958 1.12 0.000275601 {circumflex over ( )}AS793 3959 1.11 0.037923895 S603G 3960 1.08 6.48E−05 Y797L 3961 1.08 0.034990079 A377K 3962 1.08 0.059730153 K955R 3963 1.04 0.000376903 T886K 3964 1.03 0.036131932 Q338R + A339K 3965 1.03 0.031397109 P283Q 3966 1.01 0.000158685 D600N 3967 1.01 0.095937558 S867R 3968 1.01 0.079977243 E466H 3969 1 0.086320071 E53K 3970 0.98 0.123364563 L792E 3971 0.97 5.98E−05 Q338R 3972 0.96 0.059312097 H152D 3973 0.95 0.122246867 V254G 3974 0.94 0.072611815 TT949PP 3975 0.93 0.091846036 I279F 3976 0.93 0.031803852 L897M 3977 0.92 0.000288973 K390R 3978 0.91 0.000565042 K390R 3979 0.89 0.001316868 L792G 3980 0.89 0.000623156 A739V 3981 0.89 0.033874895 R624G 3982 0.88 0.103894502 C349E 3983 0.86 0.11267313 E498K 3984 0.85 0.079415017 R388Q 3985 0.84 0.000115651 I55F 3986 0.84 0.000383356 E712Q 3987 0.83 0.025220431 E475K 3988 0.81 0.000172705 {circumflex over ( )}AS796 3989 0.8 0.111675911 Q628E 3990 0.79 0.000114918 C479A 3991 0.79 0.001115871 Q338E 3992 0.78 0.000744903 K25Q 3993 0.76 0.000269223 {circumflex over ( )}AS795 3994 0.74 0.000437653 L481Q 3995 0.73 0.0001773 E552K 3996 0.72 0.000298273 T153I 3997 0.69 0.000273628 N880D 3998 0.68 0.000192096 G791M 3999 0.67 0.000295463 C233S 4000 0.67 0.000123996 Q367K + I425S 4001 0.67 0.000188025 L685I 4002 0.66 0.000169478 K942Q 4003 0.66 0.000374718 N47D 4004 0.66 0.138212411 V635M 4005 0.64 0.067027049 G27D 4006 0.63 0.000195863 C479L 4007 0.63 0.000439659 [P793] + P793AS 4008 0.62 0.000211625 T72S 4009 0.62 0.000217614 S270W 4010 0.61 0.00019414 A751S 4011 0.6 0.066962306 Q102R 4012 0.57 0.052391074 M734K 4013 0.53 0.000621789 {circumflex over ( )}AS795 4014 0.53 0.145184217 F189Y 4015 0.5 0.038258832 W885R 4016 0.48 0.000505099 A636D 4017 0.47 0.030480379 K416E 4018 0.46 0.428767546 R693I 4019 0.45 0.593145404 m29R 4020 0.45 0.144374311 T946P 4021 0.44 0.000253022 {circumflex over ( )}L889 4022 0.42 0.000171566 E121D 4023 0.37 0.042821047 P224K 4024 0.37 0.683382544 K767R 4025 0.36 0.026543344 E480K 4026 0.34 0.000998618 I546V 4027 0.27 0.164274898 K188E 4028 0.22 0.00106697 Y789T 4029 0.21 0.000512104 F495S 4030 0.18 0.023184407 m29E 4031 0.18 0.096249035 A238T 4032 0.17 0.000141352 d231N 4033 0.17 9.49E−05 I199F 4034 0.17 0.031218317 N737S 4035 0.16 3.87E−05 {circumflex over ( )}G661A 4036 0.12 4.08E−05 K460N 4037 0.08 0.000897639 k210R 4038 0.08 3.47E−05 G492P 4039 0.07 0.000266253 R591I 4040 0.04 6.41E−05 {circumflex over ( )}T696 4041 0.03 0.022802297 S507G + G508R 4042 0.02 0.028138538 Y723N 4043 −0.01 0.000529731 {circumflex over ( )}P696 4044 −0.01 0.038340599 g226R 4045 −0.02 0.052026759 W974G 4046 −0.04 0.000176981 {circumflex over ( )}M773 4047 −0.04 0.07902452 H435R 4048 −0.06 0.069143378 A724S 4049 −0.06 0.060317972 T704K 4050 −0.06 0.017155351 Y966N 4051 −0.08 0.036299549 H164R 4052 −0.15 0.032952207 F556I, D646A, G695D, A751S, A820P 4053 −0.17 0.04149111 D659H 4054 −0.21 0.064777446 T806V 4055 −0.24 0.001280151 Y789D 4056 −0.31 0.05332531 C479A 4057 −0.35 0.066448437 L212P 4058 Norm = Normalized Editing Activity (avg, 2 spacer n = 6); SD = Standard Deviation; Mut = Mutation Descriptor. Mutations are relative to SEQ ID NO: 2. [ ] indicate deletions, and ({circumflex over ( )}) indicate insertions at the specified positions of SEQ ID NO: 2. E6 and E7 spacers were used, and the data are the average of N = 6 replicates. St. Dev. = Standard Deviation. Editing activity was normalized to that of the reference CasX protein of SEQ ID NO: 2.

    [0355] Selected CasX variant proteins from the DME screen and CasX variant proteins comprising combinations of mutations were assayed for their ability to disrupt via cleavage and indel formation GFP reporter expression. CasX variant proteins were assayed with two targets, with 6 replicates. FIG. 10 shows the fold improvement in activity over the reference CasX protein of SEQ ID NO: 2 of select variants carrying single mutations, assayed with the reference sgRNA scaffold of SEQ ID NO: 5.

    [0356] FIG. 11 shows that combining single mutations, such as those shown in FIG. 10, can produce CasX variant proteins, that can improve editing efficiency by greater than two-fold. The most improved CasX variant proteins, which combine 3 or 4 individual mutations, exhibit activity comparable to Staphylococcus aureus Cas9 (SaCas9) which is used in the clinic (Maeder et al. 2019, Nature Medicine 25(2):229-233).

    [0357] FIGS. 12A-12B shows that CasX variant proteins, when combined with select sgRNA variants, can achieve even greater improvements in editing efficiency. For example, a protein variant comprising L379K and A708K substitutions, and a P793 deletion of SEQ ID NO: 2, when combined with the truncated stem loop T10C sgRNA variant more than doubles the fraction of disrupted cells.

    Example 6: RNP Assembly

    [0358] Purified wild-type and RNP of CasX and single guide RNA (sgRNA) were either prepared immediately before experiments or prepared and snap-frozen in liquid nitrogen and stored at −80° C. for later use. To prepare the RNP complexes, the CasX protein was incubated with sgRNA at 1:1.2 molar ratio. Briefly, sgRNA was added to Buffer #1 (25 mM NaPi, 150 mM NaCl, 200 mM trehalose, 1 mM MgCl2), then the CasX was added to the sgRNA solution, slowly with swirling, and incubated at 37° C. for 10 min to form RNP complexes. RNP complexes were filtered before use through a 0.22 μm Costar 8160 filters that were pre-wet with 200111 Buffer #1. If needed, the RNP sample was concentrated with a 0.5 ml Ultra 100-Kd cutoff filter, (Millipore part #UFC510096), until the desired volume was obtained. Formation of competent RNP was assessed as described in Example 12.

    Example 7: Assessing Binding Affinity to the Guide RNA

    [0359] Purified wild-type and improved CasX will be incubated with synthetic single-guide RNA containing a 3′ Cy7.5 moiety in low-salt buffer containing magnesium chloride as well as heparin to prevent non-specific binding and aggregation. The sgRNA will be maintained at a concentration of 10 pM, while the protein will be titrated from 1 pM to 100 μM in separate binding reactions. After allowing the reaction to come to equilibrium, the samples will be run through a vacuum manifold filter-binding assay with a nitrocellulose membrane and a positively charged nylon membrane, which bind protein and nucleic acid, respectively. The membranes will be imaged to identify guide RNA, and the fraction of bound vs unbound RNA will be determined by the amount of fluorescence on the nitrocellulose vs nylon membrane for each protein concentration to calculate the dissociation constant of the protein-sgRNA complex. The experiment will also be carried out with improved variants of the sgRNA to determine if these mutations also affect the affinity of the guide for the wild-type and mutant proteins. We will also perform electromobility shift assays to qualitatively compare to the filter-binding assay and confirm that soluble binding, rather than aggregation, is the primary contributor to protein-RNA association.

    Example 8: Assessing Binding Affinity to the Target DNA

    [0360] Purified wild-type and improved CasX will be complexed with single-guide RNA bearing a targeting sequence complementary to the target nucleic acid. The RNP complex will be incubated with double-stranded target DNA containing a PAM and the appropriate target nucleic acid sequence with a 5′ Cy7.5 label on the target strand in low-salt buffer containing magnesium chloride as well as heparin to prevent non-specific binding and aggregation. The target DNA will be maintained at a concentration of 1 nM, while the RNP will be titrated from 1 pM to 100 μM in separate binding reactions. After allowing the reaction to come to equilibrium, the samples will be run on a native 5% polyacrylamide gel to separate bound and unbound target DNA. The gel will be imaged to identify mobility shifts of the target DNA, and the fraction of bound vs unbound DNA will be calculated for each protein concentration to determine the dissociation constant of the RNP-target DNA ternary complex.

    Example 9: Assessing Differential PAM Recognition In Vitro

    [0361] Purified wild-type and engineered CasX variants will be complexed with single-guide RNA bearing a fixed targeting sequence. The RNP complexes will be added to buffer containing MgCl2 at a final concentration of 100 nM and incubated with 5′ Cy7.5-labeled double-stranded target DNA at a concentration of 10 nM. Separate reactions will be carried out with different DNA substrates containing different PAMs adjacent to the target nucleic acid sequence. Aliquots of the reactions will be taken at fixed time points and quenched by the addition of an equal volume of 50 mM EDTA and 95% formamide. The samples will be run on a denaturing polyacrylamide gel to separate cleaved and uncleaved DNA substrates. The results will be visualized and the rate of cleavage of the non-canonical PAMs by the CasX variants will be determined.

    Example 10: Assessing Nuclease Activity for Double-Strand Cleavage

    [0362] Purified wild-type and engineered CasX variants will be complexed with single-guide RNA bearing a fixed PM22 targeting sequence. The RNP complexes will be added to buffer containing MgCl2 at a final concentration of 100 nM and incubated with double-stranded target DNA with a 5′ Cy7.5 label on either the target or non-target strand at a concentration of 10 nM. Aliquots of the reactions will be taken at fixed time points and quenched by the addition of an equal volume of 50 mM EDTA and 95% formamide. The samples will be run on a denaturing polyacrylamide gel to separate cleaved and uncleaved DNA substrates. The results will be visualized and the cleavage rates of the target and non-target strands by the wild-type and engineered variants will be determined. To more clearly differentiate between changes to target binding vs the rate of catalysis of the nucleolytic reaction itself, the protein concentration will be titrated over a range from 10 nM to 1 uM and cleavage rates will be determined at each concentration to generate a pseudo-Michaelis-Menten fit and determine the kcat* and KM*. Changes to KM* are indicative of altered binding, while changes to kcat* are indicative of altered catalysis.

    Example 11: Assessing Target Strand Loading for Cleavage

    [0363] Purified wild-type and engineered CasX 119 will be complexed with single-guide RNA bearing a fixed PM22 targeting sequence. The RNP complexes will be added to buffer containing MgCl2 at a final concentration of 100 nM and incubated with double-stranded target DNA with a 5′ Cy7.5 label on the target strand and a 5′ Cy5 label on the non-target strand at a concentration of 10 nM. Aliquots of the reactions will be taken at fixed time points and quenched by the addition of an equal volume of 50 mM EDTA and 95% formamide. The samples will be run on a denaturing polyacrylamide gel to separate cleaved and uncleaved DNA substrates. The results will be visualized and the cleavage rates of both strands by the variants will be determined. Changes to the rate of target strand cleavage but not non-target strand cleavage would be indicative of improvements to the loading of the target strand in the active site for cleavage. This activity could be further isolated by repeating the assay with a dsDNA substrate that has a gap on the non-target strand, mimicking a pre-cleaved substrate. Improved cleavage of the non-target strand in this context would give further evidence that the loading and cleavage of the target strand, rather than an upstream step, has been improved.

    Example 12: CasX:gNA In Vitro Cleavage Assays

    [0364] 1. Determining Cleavage-competent Fraction

    [0365] The ability of CasX variants to form active RNP compared to reference CasX was determined using an in vitro cleavage assay. The beta-2 microglobulin (B2M) 7.37 target for the cleavage assay was created as follows. DNA oligos with the sequence TGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCTCGC GCT (SEQ ID NO: 4059; non-target strand, NTS) and TGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCTCGC GCT (SEQ ID NO: 4060; target strand, TS) were purchased with 5′ fluorescent labels (LI-COR IRDye 700 and 800, respectively). dsDNA targets were formed by mixing the oligos in a 1:1 ratio in 1× cleavage buffer (20 mM Tris HCl pH 7.5, 150 mM NaCl, 1 mM TCEP, 5% glycerol, 10 mM MgCl.sub.2), heating to 95° C. for 10 minutes, and allowing the solution to cool to room temperature.

    [0366] CasX RNPs were reconstituted with the indicated CasX and guides (see graphs) at a final concentration of 1 μM with 1.5-fold excess of the indicated guide in 1× cleavage buffer (20 mM Tris HCl pH 7.5, 150 mM NaCl, 1 mM TCEP, 5% glycerol, 10 mM MgCl2) at 37° C. for 10 min before being moved to ice until ready to use. The 7.37 target was used, along with sgRNAs having spacers complementary to the 7.37 target.

    [0367] Cleavage reactions were prepared with final RNP concentrations of 100 nM and a final target concentration of 100 nM. Reactions were carried out at 37° C. and initiated by the addition of the 7.37 target DNA. Aliquots were taken at 5, 10, 30, 60, and 120 minutes and quenched by adding to 95% formamide, 20 mM EDTA. Samples were denatured by heating at 95° C. for 10 minutes and run on a 10% urea-PAGE gel. The gels were imaged with a LI-COR Odyssey CLx and quantified using the LI-COR Image Studio software. The resulting data were plotted and analyzed using Prism. We assumed that CasX acts as essentially as a single-turnover enzyme under the assayed conditions, as indicated by the observation that sub-stoichiometric amounts of enzyme fail to cleave a greater-than-stoichiometric amount of target even under extended time-scales and instead approach a plateau that scales with the amount of enzyme present. Thus, the fraction of target cleaved over long time-scales by an equimolar amount of RNP is indicative of what fraction of the RNP is properly formed and active for cleavage. The cleavage traces were fit with a biphasic rate model, as the cleavage reaction clearly deviates from monophasic under this concentration regime, and the plateau was determined for each of three independent replicates. The mean and standard deviation were calculated to determine the active fraction (Table 30). The graphs are shown in FIG. 24.

    [0368] Apparent active (competent) fractions were determined for RNPs formed for CasX2+guide 174+7.37 spacer, CasX119+guide 174+7.37 spacer, and CasX459+guide 174+7.37 spacer. The determined active fractions are shown in Table 30. Both CasX variants had higher active fractions than the wild-type CasX2, indicating that the engineered CasX variants form significantly more active and stable RNP with the identical guide under tested conditions compared to wild-type CasX. This may be due to an increased affinity for the sgRNA, increased stability or solubility in the presence of sgRNA, or greater stability of a cleavage-competent conformation of the engineered CasX:sgRNA complex. An increase in solubility of the RNP was indicated by a notable decrease in the observed precipitate formed when CasX457 was added to the sgRNA compared to CasX2. Cleavage-competent fractions were also determined for CasX2.2.7.37, CasX2.32.7.37, CasX2.64.7.37, and CasX2.174.7.37 to be 16±3%, 13±3%, 5±2%, and 22±5%, as shown in FIG. 25.

    [0369] The data indicate that both CasX variants and sgRNA variants are able to form a higher degree of active RNP with guide RNA compare to wild-type CasX and wild-type sgRNA. 2. In vitro Cleavage Assays—Determining kcleave for CasX variants compared to wild-type reference CasX

    [0370] The apparent cleavage rates of CasX variants 119 and 457 compared to wild-type reference CasX were determined using an in vitro fluorescent assay for cleavage of the target 7.37.

    [0371] CasX RNPs were reconstituted with the indicated CasX (see FIG. 26) at a final concentration of 1 μM with 1.5-fold excess of the indicated guide in 1× cleavage buffer (20 mM Tris HCl pH 7.5, 150 mM NaCl, 1 mM TCEP, 5% glycerol, 10 mM MgCl2) at 37° C. for 10 min before being moved to ice until ready to use. Cleavage reactions were set up with a final RNP concentration of 200 nM and a final target concentration of 10 nM. Reactions were carried out at 37° C. and initiated by the addition of the target DNA. Aliquots were taken at 0.25, 0.5, 1, 2, 5, and 10 minutes and quenched by adding to 95% formamide, 20 mM EDTA. Samples were denatured by heating at 95° C. for 10 minutes and run on a 10% urea-PAGE gel. The gels were imaged with a LI-COR Odyssey CLx and quantified using the LI-COR Image Studio software. The resulting data were plotted and analyzed using Prism, and the apparent first-order rate constant of non-target strand cleavage (kcleave) was determined for each CasX:sgRNA combination replicate individually. The mean and standard deviation of three replicates with independent fits are presented in Table 30, and the cleavage traces are shown in FIG. 25.

    [0372] Apparent cleavage rate constants were determined for wild-type CasX2, and CasX variants 119 and 457 with guide 174 and spacer 7.37 utilized in each assay. Under the assayed conditions, the kcleave of CasX2, CasX119, and CasX457 were 0.51±0.01 min-1, 6.29±2.11 min-1, and 3.01±0.90 min-1 (mean±SD), respectively (see Table 30 and FIG. 26). Both CasX variants had improved cleavage rates relative to the wild-type CasX2, though notably CasX119 has a higher cleavage rate under tested conditions than CasX457. As demonstrated by the active fraction determination, however, CasX457 more efficiently forms stable and active RNP complexes, allowing different variants to be used depending on whether the rate of cutting or the amount of active holoenzyme is more important for the desired outcome.

    [0373] The data indicate that the CasX variants have a higher level of activity, with Kcleave rates approximately 5 to 10-fold higher compared to wild-type CasX2. 3. In vitro Cleavage Assays: Comparison of guide variants to wild-type guides

    [0374] Cleavage assays were also performed with wild-type reference CasX2 and reference guide 2 compared to guide variants 32, 64, and 174 to determine whether the variants improved cleavage. The experiments were performed as described above. As many of the resulting RNPs did not approach full cleavage of the target in the time tested, we determined initial reaction velocities (VO) rather than first-order rate constants. The first two timepoints (15 and 30 seconds) were fit with a line for each CasX:sgRNA combination and replicate. The mean and standard deviation of the slope for three replicates were determined.

    [0375] Under the assayed conditions, the VO for CasX2 with guides 2, 32, 64, and 174 were 20.4±1.4 nM/min, 18.4±2.4 nM/min, 7.8±1.8 nM/min, and 49.3±1.4 nM/min (see Table 30 and FIG. 27). Guide 174 showed substantial improvement in the cleavage rate of the resulting RNP (˜2.5-fold relative to 2, see FIG. 28), while guides 32 and 64 performed similar to or worse than guide 2. Notably, guide 64 supports a cleavage rate lower than that of guide 2 but performs much better in vivo (data not shown). Some of the sequence alterations to generate guide 64 likely improve in vivo transcription at the cost of a nucleotide involved in triplex formation. Improved expression of guide 64 likely explains its improved activity in vivo, while its reduced stability may lead to improper folding in vitro.

    TABLE-US-00042 TABLE 30 Results of cleavage and RNP formation assays RNP Initial Competent Construct k.sub.cleave* velocity* fraction   2.2.7.37 20.4 ± 1.4 nM/min 16 ± 3%   2.32.7.37 18.4 ± 2.4 nM/min 13 ± 3%   2.64.7.37  7.8 ± 1.8 nM/min  5 ± 2%  2.174.7.37 0.51 ± 0.01 min.sup.−1 49.3 ± 1.4 nM/min 22 ± 5% 119.174.7.37 6.29 ± 2.11 min.sup.−1 35 ± 6% 457.174.7.37 3.01 ± 0.90 min.sup.−1 53 ± 7% *Mean and standard deviation

    Example 13: CasX Variant Proteins can Affect PAM Specificity

    [0376] The purpose of the experiment was to demonstrate the ability of CasX variant 2 (SEQ ID NO:2), and scaffold variant 2 (SEQ ID NO:5), to edit target gene sequences at ATCN, CTCN, and TTCN PAMs in a GFP gene. ATCN, CTCN, and TTCN spacers in the GFP gene were chosen based on PAM availability without prior knowledge of potential activity.

    [0377] To facilitate assessment of editing outcomes, HEK293T-GFP reporter cell line was first generated by knocking into HEK293T cells a transgene cassette that constitutively. expresses GFP. The modified cells were expanded by serial passage every 3-5 days and maintained in Fibroblast (FB) medium, consisting of Dulbecco's Modified Eagle Medium (DMEM; Corning Cellgro, #10-013-CV) supplemented with 10% fetal bovine serum (FBS; Seradigm, #1500-500), and 100 Units/mL penicillin and 100 mg/mL streptomycin (100×-Pen-Strep; GIBCO #15140-122), and can additionally include sodium pyruvate (100×, Thermofisher #11360070), non-essential amino acids (100× Thermofisher #11140050), HEPES buffer (100× Thermofisher #15630080), and 2-mercaptoethanol (1000× Thermofisher #21985023). The cells were incubated at 37° C. and 5% CO2. After 1-2 weeks, GFP+ cells were bulk sorted into FB medium. The reporter lines were expanded by serial passage every 3-5 days and maintained in FB medium in an incubator at 37° C. and 5% CO2. Clonal cell lines were generated by a limiting dilution method.

    [0378] HEK293T-GFP reporter cells, constructed using cell line generation methods described above were used for this experiment. Cells were seeded at 20-40k cells/well in a 96 well plate in 100 μL of FB medium and cultured in a 37*C incubator with 5% CO2. The following day, cells were transfected at ˜75% confluence using lipofectamine 3000 and manufacturer recommended protocols. Plasmid DNA encoding CasX and guide construct (e.g., see table for sequences) were used to transfect cells at 100-400 ng/well, using 3 wells per construct as replicates. A non-targeting plasmid construct was used as a negative control. Cells were selected for successful transfection with puromycin at 0.3-3 μg/ml for 24-48 hours followed by recovery in FB medium. Edited cells were analyzed by flow cytometry 5 days after transduction. Briefly, cells were sequentially gated for live cells, single cells, and fraction of GFP-negative cells.

    Results:

    [0379] The graph in FIG. 15 shows the results of flow cytometry analysis of Cas-mediated editing at the GFP locus in HEK293T-GFP cells 5 days post-transfection. Each data point is an average measurement of 3 replicates for an individual spacer. Reference CasX reference protein (SEQ ID NO: 2) and gRNA (SEQ ID NO: 5) RNP complexes showed a clear preference for TTC PAM (FIG. 15). This served as a baseline for CasX protein and sgRNA variants that altered specificity for the PAM sequence. FIG. 16 shows that select CasX variant proteins can edit both non-canonical and canonical PAM sequences more efficiently than the reference CasX protein of SEQ ID NO: 2 when assayed with various PAM and spacer sequences in HEK293 cells. The construct with non-targeting spacer resulted in no editing (data not shown). This example demonstrates that, under the conditions of the assay, CasX with appropriate guides can edit at target sequences with ATCN, CTCN and TTCN PAMs in HEK293T-GFP reporter cells, and that improved CasX variants increase editing activity at both canonical and non-canonical PAMs.

    Example 14: Reference Planctomycetes CasX RNPs are Highly Specific

    [0380] Reference CasX RNP complexes were assayed for their ability to cleave target sequences with 1-4 mutations, with results shown in FIGS. 17A-17F. Reference Planctomycetes CasX RNPs were found to be highly specific and exhibited fewer off-target effects than SpCas9 and SauCas9.

    Example 15: Editing of gene targets PCSK9, PMP22, TRAC, SOD1, B2M and HTT

    [0381] The purpose of this study was to evaluate the ability of the CasX variant 119 and gNA variant 174 to edit nucleic acid sequences in six gene targets.

    Materials and Methods

    [0382] Spacers for all targets except B2M and SOD1 were designed in an unbiased manner based on PAM requirements (TTC or CTC) to target a desired locus of interest. Spacers targeting B2M and SOD1 had been previously identified within targeted exons via lentiviral spacer screens carried out for these genes. Designed spacers for the other targets were ordered from Integrated DNA Technologies (IDT) as single-stranded DNA (ssDNA) oligo pairs. ssDNA spacer pairs were annealed together and cloned via Golden Gate cloning into a base mammalian-expression plasmid construct that contains the following components: codon optimized Cas X 119 protein+NLS under an EF1A promoter, guide scaffold 174 under a U6 promoter, carbenicillin and puromycin resistance genes. Assembled products were transformed into chemically-competent E. coli, plated on Lb-Agar plates (LB: Teknova Cat #L9315, Agar: Quartzy Cat #214510) containing carbenicillin and incubated at 37° C. Individual colonies were picked and miniprepped using Qiagen Qiaprep spin Miniprep Kit (Qiagen Cat #27104) following the manufacturer's protocol. The resulting plasmids were sequenced through the guide scaffold region via Sanger sequencing (Quintara Biosciences) to ensure correct ligation.

    [0383] HEK 293T cells were grown in Dulbecco's Modified Eagle Medium (DMEM; Corning Cellgro, #10-013-CV) supplemented with 10% fetal bovine serum (FBS; Seradigm, #1500-500), 100 Units/ml penicillin and 100 mg/ml streptomycin (100×-Pen-Strep; GIBCO #15140-122), sodium pyruvate (100×, Thermofisher #11360070), non-essential amino acids (100× Thermofisher #11140050), HEPES buffer (100× Thermofisher #15630080), and 2-mercaptoethanol (1000× Thermofisher #21985023). Cells were passed every 3-5 days using Tryp1E and maintained in an incubator at 37° C. and 5% CO2.

    [0384] On day 0, HEK293T cells were seeded in 96-well, flat-bottom plates at 30k cells/well. On day 1, cells were transfected with 100 ng plasmid DNA using Lipofectamine 3000 according to the manufacturer's protocol. On day 2, cells were switched to FB medium containing puromycin. On day 3, this media was replaced with fresh FB medium containing puromycin. The protocol after this point diverged depending on the gene of interest. Day 4 for PCSK9, PMP22, and TRAC: cells were verified to have completed selection and switched to FB medium without puromycin. Day 4 for B2M, SOD1, and HTT: cells were verified to have completed selection and passed 1:3 using Tryp1E into new plates containing FB medium without puromycin. Day 7 for PCSK9, PMP22, and TRAC: cells were lifted from the plate, washed in dPBS, counted, and resuspended in Quick Extract (Lucigen, QE09050) at 10,000 cells/μ1. Genomic DNA was extracted according to the manufacturer's protocol and stored at −20° C. Day 7 for B2M, SOD1, and HTT: cells were lifted from the plate, washed in dPBS, and genomic DNA was extracted with the Quick-DNA Miniprep Plus Kit (Zymo, D4068) according to the manufacturer's protocol and stored at −20° C.

    [0385] NGS Analysis: Editing in cells from each experimental sample was assayed using next generation sequencing (NGS) analysis. All PCRs were carried out using the KAPA HiFi HotStart ReadyMix PCR Kit (KR0370). The template for genomic DNA sample PCR was 5 μl of genomic DNA in QE at 10k cells/μL for PCSK9, PMP22, and TRAC. The template for genomic DNA sample PCR was 400 ng of genomic DNA in water for B2M, SOD1, and HTT. Primers were designed specific to the target genomic location of interest to form a target amplicon. These primers contain additional sequence at the 5′ ends to introduce Illumina read and 2 sequences. Further, they contain a 7 nt randomer sequence that functions as a unique molecular identifier (UMI). Quality and quantification of the amplicon was assessed using a Fragment Analyzer DNA analyzer kit (Agilent, dsDNA 35-1500 bp). Amplicons were sequenced on the Illumina Miseq according to the manufacturer's instructions. Resultant sequencing reads were aligned to a reference sequence and analyzed for indels. Samples with editing that did not align to the estimated cut location or with unexpected alleles in the spacer region were discarded.

    Results

    [0386] In order to validate the editing effected by the CasX:gNA 119.174 at a variety of genetic loci, a clonal plasmid transfection experiment was performed in HEK 293T cells. Multiple spacers (Table 31) were designed and cloned into an expression plasmid encoding the CasX 119 nuclease and guide 174 scaffold. HEK 293T cells were transfected with plasmid DNA, selected with puromycin, and harvested for genomic DNA six days post-transfection. Genomic DNA was analyzed via next generation sequencing (NGS) and aligned to a reference DNA sequence for analysis of insertions or deletions (indels). CasX:gNA 119.174 was able to efficiently generate indels across the 6 target genes, as shown in FIGS. 29 and 30. Indel rates varied between spacers, but median editing rates were consistently at 60% or higher, and in some cases, indel rates as high as 91% were observed. Additionally, spacers with non-canonical CTC PAMs were demonstrated to be able to generate indels with all tested target genes (FIG. 31).

    [0387] The results demonstrate that the CasX variant 119 and gNA variant 174 can consistently and efficiently generate indels at a wide variety of genetic loci in human cells. The unbiased selection of many of the spacers used in the assays shows the overall effectiveness of the 119.174 RNP molecules to edit genetic loci, while the ability to target to spacers with both a TTC and a CTC PAM demonstrates its increased versatility compared to reference CasX that edit only with the TTC PAM.

    TABLE-US-00043 TABLE 31 Spacer sequences targeting each genetic locus. SEQ ID Gene Spacer PAM Spacer Sequence NO PCSK9  6.1 TTC GAGGAGGACGGCCTGGCCGA 4061 PCSK9  6.2 TTC ACCGCTGCGCCAAGGTGCGG 4062 PCSK9  6.4 TTC GCCAGGCCGTCCTCCTCGGA 4063 PCSK9  6.5 TTC GTGCTCGGGTGCTTCGGCCA 4064 PCSK9  6.3 TTC ATGGCCTTCTTCCTGGCTTC 4065 PCSK9  6.6 TTC GCACCACCACGTAGGTGCCA 4066 PCSK9  6.7 TTC TCCTGGCTTCCTGGTGAAGA 4067 PCSK9  6.8 TTC TGGCTTCCTGGTGAAGATGA 4068 PCSK9  6.9 TTC CCAGGAAGCCAGGAAGAAG 4069 G PCSK9  6.10 TTC TCCTTGCATGGGGCCAGGAT 4070 PMP22 18.16 TTC GGCGGCAAGTTCTGCTCAGC 4071 PMP22 18.17 TTC TCTCCACGATCGTCAGCGTG 4072 PMP22 18.18 CTC ACGATCGTCAGCGTGAGTGC 4073 PMP22 18.1 TTC CTCTAGCAATGGATCGTGGG 4074 TRAC 15.3 TTC CAAACAAATGTGTCACAAAG 4075 TRAC 15.4 TTC GATGTGTATATCACAGACAA 4076 TRAC 15.5 TTC GGAATAATGCTGTTGTTGAA 4077 TRAC 15.9 TTC AAATCCAGTGACAAGTCTGT 4078 TRAC 15.10 TTC AGGCCACAGCACTGTTGCTC 4079 TRAC 15.21 TTC AGAAGACACCTTCTTCCCCA 4080 TRAC 15.22 TTC TCCCCAGCCCAGGTAAGGGC 4081 TRAC 15.23 TTC CCAGCCCAGGTAAGGGCAGC 4082 HTT  5.1 TTC AGTCCCTCAAGTCCTTCCAG 4083 HTT  5.2 TTC AGCAGCAGCAGCAGCAGCA 4084 G HTT  5.3 TTC TCAGCCGCCGCCGCAGGCAC 4085 HTT  5.4 TTC AGGGTCGCCATGGCGGTCTC 4086 HTT  5.5 TTC TCAGCTTTTCCAGGGTCGCC 4087 HTT  5.7 CTC GCCGCAGCCGCCCCCGCCGC 4088 HTT  5.8 CTC GCCACAGCCGGGCCGGGTGG 4089 HTT  5.9 CTC TCAGCCACAGCCGGGCCGGG 4090 HTT  5.10 CTC CGGTCGGTGCAGCGGCTCCT 4091 SOD1  8.56 TTC CCACACCTTCACTGGTCCAT 4092 SOD1  8.57 TTC TAAAGGAAAGTAATGGACCA 4093 SOD1  8.58 TTC CTGGTCCATTACTTTCCTTT 4094 SOD1  8.2 TTC ATGTTCATGAGTTTGGAGAT 4095 SOD1  8.68 TTC TGAGTTTGGAGATAATACAG 4096 SOD1  8.59 TTC ATAGACACATCGGCCACACC 4097 SOD1  8.47 TTC TTATTAGGCATGTTGGAGAC 4098 SOD1  8.62 CTC CAGGAGACCATTGCATCATT 4099 B2M  7.120 TTC GGCCTGGAGGCTATCCAGCG 4100 B2M  7.37 TTC GGCCGAGATGTCTCGCTCCG 27 B2M  7.43 CTC AGGCCAGAAAGAGAGAGTA 28 G B2M  7.119 CTC CGCTGGATAGCCTCCAGGCC 4101 B2M  7.14 TTC TGAAGCTGACAGCATTCGGG 25

    Example 16: Design and Evaluation of Improved CasX Variants by Deep Mutational Evolution

    [0388] The purpose of the experiments was to identify and engineer novel CasX variant proteins with enhanced genome editing efficiency relative to wild-type CasX. To cleave DNA efficiently in living cells, the CasX protein must efficiently perform the following functions: i) form and stabilize the R-loop structure consisting of a targeting guide RNA annealed to a complementary genomic target site in a DNA:RNA hybrid; and ii) position an active nuclease domain to cleave both strands of the DNA at the target sequence. These two functions can each be enhanced by altering the biochemical or structural properties of the protein, specifically by introducing amino acid mutations or exchanging protein domains in an additive or combinatorial fashion.

    [0389] To construct CasX variant proteins with improved properties, an overall approach was chosen in which bacterial assays and hypothesis-driven approaches were first used to identify candidate mutations to enhance particular functions, after which increasingly stringent human genome editing assays were used in a stepwise manner to rationally combine cooperatively function-enhancing mutations in order to identify CasX variants with enhanced editing properties.

    Materials and Methods:

    Cloning and Media

    [0390] Restriction enzymes, PCR reagents, and cloning strains of E. coli were obtained from New England Biolabs. All molecular biology and cloning procedures were performed according to the manufacturer's instructions. PCR was performed using Q5 polymerase unless otherwise specified. All bacterial culture growth was performed in 2XYT media (Teknova) unless otherwise specified. Standard plasmid cloning was performed in Turbo® E. coli unless otherwise specified. Standard final concentrations of the following antibiotics were used where indicated: carbenicillin: 100 μg/mL; kanamycin: 60 μg/mL; chloramphenicol: 25 μg/mL.

    Molecular Biology of Protein Library Construction

    [0391] Four libraries of CasX variant proteins were constructed using plasmid recombineering in E. coli strain EcNR2 (Addgene ID: 26931), and the overall approach to protein mutagenesis was termed Deep Mutational Evolution (DME), which is schematically shown in FIG. 32. Three libraries were constructed corresponding to each of three cleavage-inactivating mutations made to the reference CasX protein open reading frame of Planctomycetes, SEQ 1D NO:2 (“STX2”), rendering the CasX catalytically dead (dCasX). These three mutations are referred to as D1 (with a D659A substitution), D2 (with a E756A substitution), or D3 (with a D922A substitution). A fourth library was composed of all three mutations in combination, referred to as DDD (D659A; E756A; D922A substitutions). These libraries were constructed by introducing desired mutations to each of the four starting plasmids. Briefly, an oligonucleotide library was obtained from Twist Biosciences and prepared for recombineering (see below). A final volume of 50 μL of 1 μM oligonucleotides, plus 10 ng of pSTX1 encoding the dCasX open reading frame (composed of either D1, D2, or D3) was electroporated into 50 μL of induced, washed, and concentrated EcNR2 using a 1 mm electroporation cuvette (BioRad GenePulser). A Harvard Apparatus ECM 630 Electroporation System was used with settings 1800 kV, 200 Ω, 25 μF. Three replicate electroporations were performed, then individually allowed to recover at 30° C. for 2 hr in 1 mL of SOC (Teknova) without antibiotic. These recovered cultures were titered on LB plates with kanamycin to determine the library size. 2XYT media and kanamycin was then added to a final volume of 6 mL and grown for a further 16 hours at 30° C. Cultures were miniprepped (QIAprep Spin Miniprep Kit) and the three replicates were then combined, completing a round of plasmid recombineering. A second round of recombineering was then performed, using the resulting miniprepped plasmid from round 1 as the input plasmid.

    [0392] Oligo library synthesis and maturation: A total of 57751 unique oligonucleotide sequences designed to result in either amino acid insertion, substitution, or deletion at each codon position along the STX 2 open reading frame were synthesized by Twist Biosciences, among which were included so-called ‘recombineering oligos’ that included one codon to represent each of the twenty standard amino acids and codons with flanking homology when encoded in the plasmid pSTX1. The oligo library included flanking 5′ and 3′ constant regions used for PCR amplification. Compatible PCR primers include oSH7: 5′AACACGTCCGTCCTAGAACT (SEQ ID NO: 4102; universal forward) and oSH8: 5′ACTTGGTTACGCTCAACACT (SEQ ID NO: 4103; universal reverse) (see reference table). The entire oligo pool was amplified as 400 individual 100 μL reactions. The protocol was optimized to produce a clean band at 164 bp. Finally, amplified oligos were digested with a restriction enzyme (to remove primer annealing sites, which would otherwise form scars during recombineering), and then cleaned, for example, with a PCR clean-up kit (to remove excess salts that may interfere with the electroporation step). Here, a 600 μL final volume BsaI restriction digest was performed, with 30 μg DNA+30 μL BsaI enzyme, which was digested for two hours at 37° C.

    [0393] For DME1: after two rounds of recombineering were completed, plasmid libraries were cloned into a bacterial expression plasmid, pSTX2. This was accomplished using a BsmbI Golden Gate Cloning approach to subclone the library of STX genes into an expression compatible context, resulting in plasmid pSTX3. Libraries were transformed into Turbo® E. coli (New England Biolabs) and grown in chloramphenicol for 16 hours at 37° C., followed by miniprep the next day.

    [0394] For DME2: protein libraries from DME1 were further cloned to generate a new set of three libraries for further screening and analysis. All subcloning and PCR was accomplished within the context of plasmid pSTX1. Library D1 was discontinued and libraries D2 and D3 were kept the same. A new library, DDD, was generated from libraries D2 and D3 as follows. First, libraries D2 and D3 were PCR amplified such that the Dead 1 mutation, E756A, was added to all plasmids in each library, followed by blunt ligation, transformation, and miniprep, resulting in library A (D1+D2) and library B (D1+D3). Next, another round of PCR was performed to add either mutation D3 or D2, respectively, to library A and B, generating PCR products A′ and B′. At this point, A′ and B′ were combined in equimolar amounts, then blunt ligated, transformed, and miniprepped to generate a new library, DDD, containing all three dead mutations in each plasmid.

    Bacterial CRISPR Interference (CRISPRi) Screen

    [0395] A dual-color fluorescence reporter screen was implemented, using monomeric Red Fluorescent Protein (mRFP) and Superfolder Green Fluorescent Protein (sfGFP), based on Qi L S, et al. Cell 152:1173-1183 (2013). This screen was utilized to assay gene-specific transcriptional repression mediated by programmable DNA binding of the CasX system. This strain of E. coli expresses bright green and red fluorescence under standard culturing conditions or when grown as colonies on agar plates. Under a CRISPRi system, the CasX protein is expressed from an anhydrotetracycline (aTc)-inducible promoter on a plasmid containing a p15A replication origin (plasmid pSTX3; chloramphenicol resistant), and the sgRNA is expressed from a minimal constitutive promoter on a plasmid containing a ColE1 replication origin (pSTX4, non-targeting spacer, or pSTX5, GFP-targeting spacer #1; carbenicillin resistant). When the CRISPRi E. coli strain is co-transformed with both plasmids, genes targeted by the spacer in pSTX4 are repressed; in this case GFP repression is observed, the degree to which is dependent on the function of the targeting CasX protein and sgRNA. In this system, RFP fluorescence can serve as a normalizing control. Specifically, RFP fluorescence is unaltered and independent of functional CasX based CRISPRi activity. CRISPRi activity can be tuned in this system by regulating the expression of the CasX protein; here, all assays used an induction concentration of 20 nM aTc final concentration in growth media.

    [0396] Libraries of CasX protein were initially screened using the above CRISPRi system. After co-transformation and recovery, libraries were either: 1) plated on LB agar plus appropriate antibiotics and titered such that individual colonies could be picked, or 2) grown for eight hours in 2XYT media with appropriate antibiotics and sorted on a MA900 flow cytometry instrument (Sony). Variants of interest were detected using either standard Sanger sequencing of picked colonies (UC Berkeley Barker Sequencing Facility) or NGS sequencing of miniprepped plasmid (Massachusetts General Hospital CCIB DNA Core Next-Generation Sequencing Service).

    [0397] Plasmids were miniprepped and the protein sequence was PCR-amplified, then tagmented using a Nextera kit (Illumina) to fragment the amplicon and introduce indexing adapters for sequencing on a 150 paired end HiSeq 2500 (UC Berkeley Genomics Sequencing Lab).

    Bacterial ccdB Plasmid Clearance Selection

    [0398] A dual-plasmid selection system was used to assay clearance of a toxic plasmid by CasX DNA cleavage. Briefly, the arabinose-inducible plasmid pBLO63.3 expressing toxic protein ccdB results in death when transformed into E. coli strain BW25113 and grown under permissive conditions. However, growth is rescued if the plasmid is cleared successfully by dsDNA cleavage, and in particular by plasmid pSTX3 co-expressing CasX protein and a guide RNA targeting the plasmid pBLO63.3. CasX protein libraries from DME1, without the catalytically inactivating mutations D1, D2, or D3, were subcloned to plasmid pSTX3. These plasmid libraries were transformed into BW25113 carrying pBLO63.3 by electroporation (200 ng of plasmid into 50 uL of electrocompetent cells) and allowed to recover in 2 mL of SOC media at 37° C. at 200 rpm shaking for 25 minutes, after which luL of 1M IPTG was added. Growth was continued for an additional 40 minutes, after which cultures were evenly divided across a 96-well deep-well block and grown in selective media for 4.5 hrs at 37° C. or 45° C. at 750 rpm. Selective media consists of the following: 2XYT with chloramphenicol+10 mM arabinose+500 μM IPTG+2 nM aTc (concentrations final). Following growth, plasmids were miniprepped to complete one round of selection, and the resulting DNA was used as input for a subsequent round. Seven rounds of selection were performed on CasX protein libraries. CasX variant Sanger sequencing or NGS was performed as described above.

    NGS Data Analysis

    [0399] Paired end reads were trimmed for adapter sequences with cutadapt (version 2.1), and aligned to the reference with bowtie2 (v2.3.4.3). The reference was the entire amplicon sequence prior to tagmentation in the Nextera protocol. Each catalytically inactive CasX variant was aligned to its respective amplicon sequence. Sequencing reads were assessed for amino acid variation from the reference sequence. In short, the read sequence and aligned reference sequence were translated (in frame), then realigned and amino acid variants were called. Reads with poor alignment or high error rates were discarded (mapq <20 and estimated error rate >4%; Estimated error rate was calculated using per-base phred quality scores). Mutations at locations of poor-quality sequencing were discarded (phred score <20). Mutations were labeled for being single substitutions, insertions, or deletions, or other higher-order mutations, or outside the protein-coding sequence of the amplicon. The number of reads that supported each set of mutations was determined. These read counts were normalized for sequencing depth (mean normalization), and read counts from technical replicates were averaged by taking the geometric mean. Enrichment was calculated within each CasX variant by averaging the enrichment for each gate.

    Molecular Biology of Variants

    [0400] In order to screen variants of interest, individual variants were constructed using standard molecular biology techniques. All mutations were built on STX2 using a staging vector and Gibson cloning. To build single mutations, universal forward (5′.fwdarw.3′) and reverse (3′.fwdarw.5′) primers were designed on either end of the protein sequence that had homology to the desired backbone for screening (see Table 32). Primers to create the desired mutations were also designed (F primer and its reverse complement) and used with the universal F and R primers for amplification, thus producing two fragments. In order to add multiple mutations, additional primers with overlap were designed and more PCR fragments were produced. For example, to construct a triple mutant, four sets of F/R primers were designed. The resulting PCR fragments were gel extracted and the screening vector was digested with the appropriate restriction enzymes then gel extracted. The insert fragments and vector were then assembled using Gibson assembly master mix, transformed, and plated using appropriate LB agar+antibiotic. The clones were Sanger sequenced and correct clones were chosen.

    [0401] Finally, spacer cloning was performed to target the guide RNA to a gene of interest in the appropriate assay or screen. The sequence verified non-targeting clone was digested with the appropriate golden gate enzyme and cleaned using DNA Clean and Concentrator kit (Zymo). The oligos for the spacer of interest were annealed. The annealed spacer was ligated into digested and cleaned vector using a standard Golden Gate Cloning protocol. The reaction was transformed and plated on LB agar+antibiotic. The clones were sanger sequenced and correct clones were chosen.

    TABLE-US-00044 TABLE 32 Primer sequences Screening vector F primer sequence R primer sequence pSTX6 SAH24: SAH25: TTCAGGTTGGACCGGTGCCACCATGGCC TTTTGGACTAGTCACGGCGGGC CCAAAGAAGAAGCGGAAGGTCAGCCAAG TTCCAG (SEQ ID NO: AGATCAAGAGAATCAACAAGATCAGA 4105) (SEQ ID NO: 4104) pSTX16 or oIC539: oIC540: pSTX34 ATGGCCCCAAAGAAGAAGCGGAAGGTCT TACCTTTCTCTTCTTTTTTGGA CTAGACAAG (SEQ ID NO: 4106) CTAGTCACGG (SEQ ID NO: 4107)

    GFP Editing by Plasmid Lipofection of HEK293T Cells

    [0402] Either doxycycline inducible GFP (iGFP) reporter HEK293T cells or SOD1-GFP reporter HEK293T cells were seeded at 20-40k cells/well in a 96 well plate in 100 μl of FB medium and cultured in a 37° C. incubator with 5% CO2. The following day, confluence of seeded cells was checked. Cells were ˜75% confluent at time of transfection. Each CasX construct was transfected at 100-500 ng per well using Lipofectamine 3000 following the manufacturer's protocol, into 3 wells per construct as replicates. SaCas9 and SpyCas9 targeting the appropriate gene were used as benchmarking controls. For each Cas protein type, a non-targeting plasmid was used as a negative control. After 24-48 hours of puromycin selection at 0.3-3 μg/ml to select for successfully transfected cells, followed by 1-7 days of recovery in FB medium, GFP fluorescence in transfected cells was analyzed via flow cytometry. In this process, cells were gated for the appropriate forward and side scatter, selected for single cells and then gated for reporter expression (Attune Nxt Flow Cytometer, Thermo Fisher Scientific) to quantify the expression levels of fluorophores. At least 10,000 events were collected for each sample. The data were then used to calculate the percentage of edited cells.

    GFP Editing by Lentivirus Transduction of HEK293T Cells

    [0403] Lentivirus products of plasmids encoding CasX proteins, including controls, CasX variants, and/or CasX libraries, were generated in a Lenti-X 293T Cell Line (Takara) following standard molecular biology and tissue culture techniques. Either iGFP HEK293T cells or SOD1-GFP reporter HEK293T cells were transduced using lentivirus based on standard tissue culture techniques. Selection and fluorescence analysis was performed as described above, except the recovery time post-selection was 5-21 days. For Fluorescence-Activated Cell Sorting (FACS), cells were gated as described above on a MA900 instrument (Sony). Genomic DNA was extracted by QuickExtract™ DNA Extraction Solution (Lucigen) or Genomic DNA Clean & Concentrator (Zymo).

    Engineering of CasX Protein 2 to CasX 119

    [0404] Prior work had demonstrated that CasX RNP complexes composed of functional wild-type CasX protein from Planctomycetes (hereafter referred to as CasX protein 2 {or STX2, or STX protein 2, SEQ ID NO:2} and CasX sgRNA 1 {or STX sgRNA 1, SEQ ID NO:4}) are capable of inducing dsDNA cleavage and gene editing of mammalian genomes (Liu, J J et al Nature, 566, 218-223 (2019)). However, previous observations of cleavage efficiency were relatively low (˜30% or less), even under optimal laboratory conditions. These poor rates of genome editing are insufficient for the wild-type CasX CRISPR systems to serve as therapeutic genome-editing molecules. In order to efficiently perform genome editing, the CasX protein must effectively perform two central functions: (i) form and stabilize the R-loop, and (ii) position the nuclease domain for cleavage of both DNA strands. Under conditions in which CasX RNP can access genomic DNA, genome editing rates will be partly governed by the ability of the CasX protein to perform these functions (the other controlling component being the guide RNA). The optimization of both functions is dependent on the complex sequence-function relationship between the linear chain of amino acids encoding the CasX protein and the biochemical properties of the fully formed, cleavage competent RNP. As amino acid mutations that enhance each of these functions can be combined to cumulatively result in a highly engineered CasX protein exhibiting greatly enhanced genome editing efficiency sufficient for human therapeutics, an overall engineering approach was devised in which mutations enhancing function (i) were identified, mutations enhancing function (ii) were identified, and then rational stacking of multiple beneficial mutations would be used to construct CasX variants capable of efficient genome editing. Function (i), stabilization of the R-loop, is by itself sufficient to interfere with gene expression in living cells even in the absence of DNA nuclease activity, a phenomenon known as CRISPR interference (CRISPRi). It was determined that a bacterial CRISPRi assay would be well-suited to identifying mutations enhancing this function. Similarly, a bacterial assay testing for double-stranded DNA (dsDNA) cleavage would be capable of identifying mutations enhancing function (ii). A toxic plasmid clearance assay was chosen to serve as a bacterial selection strategy and identify relevant amino acid changes. These sets of mutations were then validated to provide an enhancement to human genome editing activity, and served as the foundation for more extensive and rational combinatorial testing across increasingly stringent assays.

    [0405] The identification of mutations enhancing core functions was performed in an engineering cycle of protein library design, molecular biology construction of libraries, and high-throughput assay of the libraries. Potential improved variants of the STX2 protein were either identified by NGS of a high-throughput biological assay, sequenced directly as clones from a population, or designed de novo for specific hypothesis testing. For high-throughput assays of functions (i) or (ii), a comprehensive and unbiased design approach to mutagenesis was desired for initial diversification. Plasmid recombineering was chosen as a sufficiently comprehensive and rapid method for library construction and was performed in a promoterless staging vector pSTX1 in order to minimize library bias throughout the cloning process. A comprehensive oligonucleotide pool encoded all possible single amino acid substitutions, insertions, and deletions in the STX2 sequence was constructed by DME; the first round of library construction and screening is hereafter referred to as DME1 (FIG. 1). While recombineering is known to produce substantially biased mutation libraries (even from initially uniform pools of oligonucleotides), we deemed this tradeoff acceptable in exchange for an accelerated experimental timeline to improved activity levels. Two high-throughput bacterial assays were chosen to identify potential improved variants from the diverse set of mutations in DME1. As discussed above, we reasoned that a CRISPRi bacterial screen would identify mutations enhancing function (i). While CRISPRi uses a catalytically inactive form of the CasX protein, many specific characteristics together influence the total enhancement of this function, such as expression efficiency, folding rate, protein stability, or stability of the R-loop (including binding affinity to the sgRNA or DNA). DME1 libraries were constructed on the dCasX mutant templates and individually screened. Screening was performed as Fluorescence-Activated Cell Sorting (FACS) of GFP repression in a previously validated dual-color CRISPRi scheme.

    Results:

    [0406] For each of DME1, DME2 and DME3, the three libraries exhibited a different baseline CRISPRi activity, thereby serving as independent, yet related, screens. For each library, gates of varying stringency were drawn around the population of interest, and sorted cell populations were deep sequenced to identify CasX mutations enhancing GFP repression (FIG. 33). A second high-throughput bacterial assay was developed to assess dsDNA cleavage in E. coli by way of selection (see methods). When this assay is performed under selective conditions, a functional STX2 RNP can exhibit ˜1000- to 10,000-fold increase in colony forming units compared to nonfunctional CasX protein (FIG. 34). Multiple rounds of liquid media selections were performed for the cleavage-competent libraries of DME1. Sequential rounds of colony picking and sequencing identified mutations to enhance function (ii). Several mutations were observed with increasing frequency with prolonged selection. One mutation of note, the deletion of proline 793, was first observed in round four at a frequency of two out of 36 sequenced colonies. After round five, the frequency increased to six out of 36 sequenced colonies. In round seven, it was observed in ten out of 48 sequenced colonies. This round-over-round enrichment suggested mutations observed in these assays could potentially enhance function (ii) of the CasX protein. Selected mutations observed across these assays can be found in Table 33 as follows:

    TABLE-US-00045 TABLE 33 Selected mutations observed in bacterial assays for function (i) or (ii) Pos. Ref. Alternative* Assay 2 Q R 45 C ccdb colony 72 T S D2 CRISPRi 80 A T 37 C ccdb colony 111 R K 45 C ccdb colony 119 G C 45 C ccdb colony 121 E D 37 C ccdb colony 153 T I 37 C ccdb colony 166 R S D2 CRISPRi 203 R K 45 C ccdb colony 270 S W 37 C ccdb colony 346 D Y 45 C ccdb colony 361 D A D1 CRISPRi 385 E A D3 CRISPRi 386 E R 45 C ccdb colony 390 K R D3 CRISPRi 399 F L 45 C ccdb colony 421 A G D2 CRISPRi 433 S N 45 C ccdb colony 489 D S D3 CRISPRi 536 F S D3 CRISPRi 546 I V D2 CRISPRi 552 E A D3 CRISPRi 591 R I 37 C ccdb colony 595 E G D3 CRISPRi 636 A D D3 CRISPRi 657 — G DI CRISPRi 661 — L DI CRISPRi 661 — A D1 CRISPRi 663 N S DI CRISPRi 679 S N D2 CRISPRi 695 G H 45 C ccdb colony 696 — P 45 C ccdb colony 707 A D D3 CRISPRi 708 A K 45 C ccdb colony 712 D Q 37 C ccdb colony 732 D P D1 CRISPRi 751 A S D3 CRISPRi 774 — G DI CRISPRi 788 A W D2 CRISPRi 789 Y T DI CRISPRi 789 Y D D2 CRISPRi 791 G M 45 C ccdb colony 792 L E 45 C ccdb colony 793 P — 45 C ccdb colony 793 — AS 45 C ccdb colony 793 P T 45 C ccdb colony 793 P — DI CRISPRi 793 — F D2 CRISPRi 794 — PG 45 C ccdb colony 794 — PS 45 C ccdb colony 795 — AS 37 C ccdb colony 795 — AS 45 C ccdb colony 796 — AG 37 C ccdb colony 797 — AS 45 C ccdb colony 797 Y L 45 C ccdb colony 799 S A D3 CRISPRi 867 S G 45 C ccdb colony 889 — L 37 C ccdb colony 897 L M 45 C ccdb colony 922 D K Dl CRISPRi 963 Q P D2 CRISPRi 975 K Q D2 CRISPRi *substitution, insertion, or deletion; Pos.: Position

    [0407] The mutations observed in the bacterial assays above were selected for their potential to enhance CasX protein functions (i) or (ii), but desirable mutations will enhance at least one function while simultaneously remaining compatible with the other. To test this, mutations were tested for their ability to improve human cell genome editing activity overall, which requires both functions acting in concert. A HEK293T GFP editing assay was implemented in which human cells containing a stably-integrated inducible GFP (iGFP) gene were transduced with a plasmid that expresses the CasX protein and sgRNA 2 with spacers to target the RNP to the GFP gene. Mutations identified in bacterial screens, bacterial selections, as well as mutations chosen de novo from biochemical hypotheses resulting from inspection of the published Cryo-EM structure of the homologous DpbCasX protein, were tested for their relative improvement to human genome editing activity as quantified relative to the parent protein STX 2 (FIG. 35), with the greatest improvement demonstrated for construct 119, shown at the bottom of FIG. 35. Several dozen of the proposed function-enhancing mutations were found to improve human cell genome editing substantially, and selected mutations from these assays can be found in Table 34 as follows:

    TABLE-US-00046 TABLE 34 Selected single mutations observed to enhance genome editing Fold-Improvement (average of Position Reference Alternative* two GFP spacers) 379 L R 1.4 708 A K 2.13 620 T P 1.84 385 E P 1.19 857 Y R 1.95 658 I V 1.94 399 F L 1.64 404 L K 2.23 793 P — 1.23 252 Q K 1.12** *substitution, insertion, or deletion **calculated as the average improvement across four variants with and without the mutation

    [0408] The overall engineering approach taken here relies on the central hypothesis that individual mutations enhancing each function can be additively combined to obtain greatly enhanced CasX variants with improved editing capability. FIGS. 20A-20B are a pair of plots that demonstrate that specific subsets of changes discovered by DME of the CasX are more likely to predict improvements of activity. To test this, the single mutations were first identified if they enhanced overall editing activity. Of particular note here, a substitution of the hydrophobic leucine 379 in the helical II domain to a positively charged arginine resulted in a 1.40 fold-improvement in editing activity. This mutation might provide favorable ionic interactions with the nearby phosphate backbone of the DNA target strand (between PAM-distal bp 22 and 23), thus stabilizing R-loop formation and thereby enhancing function (i). A second hydrophobic to charged mutation, alanine 708 to lysine, increased editing activity by 2.13-fold, and might provide additional ionic interactions between the RuvC domain and the sgRNA 5′ end, thus plausibly enhancing function (i) by increasing the binding affinity of the protein for the sgRNA and thereby increasing the rate of R-loop formation. The deletion of proline 793 improved editing activity by 1.23-fold by shortening a loop between an alpha helix and a beta sheet in the RuvC domain, potentially enhancing function (ii) by favorably altering nuclease positioning for dsDNA cleavage. Overall, several dozen single mutations were found to improve editing activity, including mutations identified from each of the bacterial assays as well as mutations proposed from de novo hypothesis generation. To further identify those mutations that enhanced function in a cooperative manner, rational CasX variants composed of combinations of multiple mutations were tested (FIG. 35). An initial small combinatorial set was designed and assayed, of which CasX variant 119 emerged as the overall most improved editing molecule, with a 2.8-fold improved editing efficiency compared to the STX2 wild-type protein. Variant 119 is composed of the three single mutations L379R, A708K, and [P793], demonstrating that their individual contributions to enhancement of function are additive.

    SOD1-GFP Assay Development.

    [0409] To assess CasX variants with greatly improved genome-editing activity, we sought to develop a more stringent genome editing assay. The iGFP assay provides a relatively facile editing target such that STX protein 2 in the assays above exhibited an average editing efficiency of 41% and 16% with GFP targeting spacers 4.76 and 4.77 respectively. As protein variants approach 2-fold or greater efficiency improvements, the assay becomes saturated. Therefore a new HEK293T cell line was developed with the GFP sequence integrated in-frame at the C-terminus of the endogenous human gene SOD1, termed the SOD1-GFP line. This cell line served as a new, more stringent, assay to measure the editing efficiency of several hundred additional CasX variant proteins (FIG. 36). Additional mutations were identified from bacterial assays, including a second iteration of DME library construction and screening, as well as utilizing hypothesis-driven approaches. Further exploration of combinatorial improved variants was also performed in the SOD1-GFP assay.

    [0410] In light of the SOD1-GFP assay results, measured efficiency improvements were no longer saturated, and CasX variant 119 (indicated by the star in FIG. 36) exhibited a 23.9-fold improvement relative to the wild-type CasX (average of two spacers), with several constructs exhibiting enhanced activity relative to the CasX 119 construct. Alternatively, the dynamic range of the iGFP assay could be increased (though perhaps not completely unsaturated) by reducing the baseline activity of the WT CasX protein, namely by using sgRNA variant 1 rather than 2. Under these more stringent conditions of the iGFP assay, CasX variant 119 exhibited a 15.3-fold improvement relative to the wild-type CasX using the same spacers. Intriguingly, CasX variant 119 also exhibited substantial editing activity with spacers utilizing each of the four NTCN PAM sequences, while WT CasX only edited above 1% with spacers utilizing TTCN and ATCN PAM sequences (FIG. 37), demonstrating the ability of the CasX variant to effectively edit using an expanded spectrum of PAM sequences.

    CasX Function Enhancement by Extensive Combinatorial Mutagenesis.

    [0411] Potential improved variants tested in the variety of assays above provided a dataset from which to select candidate lead proteins. Over 300 proteins were assessed in individual clonal assays and of these, 197 single mutations were assessed; the remaining ˜100 proteins contained combinatorial combinations of these mutations. Protein variants were assessed via three different assays (plasmid p6 by iGFP, plasmid p6 by SOD1-GFP, or plasmid p16 by SOD1-GFP). While single mutants led to significant improvements in the iGFP assay (with fraction GFP—greater than 50%), these single-mutants all performed poorly in the SOD1-GFP p6 backbone assay (fraction GFP—less than 10%). However, proteins containing multiple, stacked mutations were able to successfully inactivate GFP in this more stringent assay, indicating that stacking of improved mutations could substantially improve cleavage activity.

    [0412] Individual mutations observed to enhance function often varied in their capacity to additively improve editing activity when combined with additional mutations. To rationally quantify these epistatic effects and further improve genome editing activity, a subset of mutations was identified that had each been added to a protein variant containing at least one other mutation, and where both proteins (with and without the mutation) were tested in the same experimental context (assay and spacer; 46 mutations total). To determine the effect due to that mutation, the fraction GFP—was compared with and without the mutation. For each protein/experimental context, the mutation effect was quantified as: 1) substantially improving the activity (fv>1.1 f0 where f0 is the fraction GFP—without the mutation, and fv is the fraction GFP—with the mutation), 2) substantially worsening the activity (fv<0.9f0), or 3) not affecting activity (neither of the other conditions are met). An overall score per mutation was calculated (s), based on the fraction of protein/experiment contexts in which the mutation substantially improved activity, minus the fraction of contexts in which the mutation substantially worsened activity. Out of the 46 mutations obtained, only 13 were associated with consistently increased activity (s≥0.5), and 18 mutations substantially decreased activity (s≤−0.5). Importantly, the distinction between these mutations was only clear when examining epistatic interactions across a variety of variant contexts: all of these mutations had comparable activity in the iGFP assay when measured alone.

    [0413] The above quantitative analysis allowed the systematic design of an additional set of highly engineered CasX proteins composed of single mutations enhancing function both individually and in combination. First, seven out of the top 13 mutations were chosen to be stacked (the other 6 variants comprised the three variants A708K, [P793] and L379R that were included in all proteins, and another two that affected redundant positions; see FIGS. 14A-14F). These mutations were iteratively stacked onto three different versions of the CasX protein: CasX 119, 311, and 365; proceeding to add only one mutation (for example, Y857R), to adding several mutations in combination. In order to maximize the combination of enhancements for both function (i) and function (ii), individual mutations were rationally chosen to maintain a diversity of biochemical properties—i.e., multiple mutations that substitute a hydrophobic residue with a negatively charged residue were avoided. The resulting ˜30 protein variants had between five and 10 individual mutations relative to STX2 (mode=7 mutations). The proteins were tested in a lipofection assay in a new backbone context (p34) with guide scaffold 64, and most showed improvement relative to protein 119. The most improved variant of this set, protein 438, was measured to be >20% improved relative to protein 119 (see Table 35 below).

    Lentiviral Transduction iGFP Assay Development

    [0414] As discussed above regarding the iGFP assay, enhancements to the CasX system had likely resulted in the lipofection assay becoming saturated—that is, limited by the dynamic range of the measurement. To increase the dynamic range, a new assay was designed in which many fewer copies of the CasX gene are delivered to human cells, consisting of lentiviral transductions in a new backbone context, plasmid pSTX34. Under this more stringent delivery modality, the dynamic range was sufficient to observe the improvements of CasX variant protein 119 in the context of a further improved sgRNA, namely sgRNA variant 174. Improved variants of both the protein and sgRNA were found to additively combine to produce yet further improved CasX CRISPR systems. Protein variant 119 and sgRNA variant 174 were each measured to improve iGFP editing activity by approximately an order of magnitude when compared with wild-type CasX protein 2 (SEQ ID NO:2) in complex with sgRNA 1 (SEQ ID NO:4) under the lipofection iGFP assay (FIG. 38). Moreover, improvements to editing activity from the protein and sgRNA appear to stack nearly linearly; while individually substituting CasX 2 for CasX 119, or substituting sgRNA 174 for sgRNA 1, produces a ten-fold improvement, substituting both simultaneously produces at least another ten-fold improvement (FIG. 39). Notably, this range of activity improvements exceeds the dynamic range of either assay. However, the overall activity improvement can be estimated by calculating the fold change relative to the sample 2.174, which was measured precisely in both assays. The enhancement of the highly engineered CasX CRISPR system 119.174 over wild type CasX CRISPR system 2.1 resulted in a 259-fold improvement in genome editing efficiency in human cells (+/−58, propagated standard deviation), supporting that, under the conditions of the assay, the engineering of both the CasX and the guide led to dramatic improvements in editing efficiency compared to wild-type CasX and guide.

    Engineering of Domain Exchange Variants

    [0415] One problematic limitation of mutagenesis-based directed evolution is the combinatorial increase of possible sequences as one takes larger steps in sequence-space. To overcome this, swapping of protein domains from homologous sequences was evaluated as an alternative approach. To take advantage of the phylogenetic data available for the CasX CRISPR system, alignments were made between the CasX 1 (SEQ ID NO:1) and CasX 2 (SEQ ID NO:2) protein sequences, and domains were annotated for exchange in the context of improved CasX variant protein 119. To benchmark CasX 119 against the top designed combinatorial CasX variant proteins and the top domain exchanged variants, all within the context of improved sgRNA 174, a stringent iGFP lentiviral transduction assay was performed. Protein variants from each class were identified as improved relative to CasX variant 119 (FIG. 40), and fold changes are represented in Table 35. For example, at day 13, CasX 119.174 with GFP spacer 4.76 leads to phenotype disruption in only ˜60% of cells, while CasX variant 491 in the same context results in >90% phenotypic editing. To summarize, the compared proteins contained the following number of mutations relative to the WT CasX protein 2: 119=3 point mutations; 438 =7 point mutations; 488=protein 119, with NTSB and helical Ib domains from CasX 1 (67 mutations total); 491=5 point mutations, with NTSB and helical Ib domains from CasX 1 (69 mutations total).

    TABLE-US-00047 TABLE 35 CasX variant improvements over CasX variant 119 in the iGFP lentiviral transduction assay, in the context of improved sgRNA 174. Fold-change Fold-change Cas X editing activity, editing activity, Protein spacer 4.76* spacer 4.77* 119 1.00 1.00 438 1.22 1.21 488 1.41 2.43 491 1.55 3.03 *relative to CasX 119

    [0416] The results demonstrate that the application of rationally-designed libraries, screening, and analysis methods into a technique we have termed Deep Mutational Evolution to scan fitness landscapes of both the CasX protein and guide RNA enabled the identification and validation of mutations which enhanced specific functions, contributing to the improvement of overall genome editing activity. These datasets enabled the rational combinatorial design of further improved CasX and guide variants disclosed herein.

    Example 17: Design and Evaluation of Improved Guide RNA Variants

    [0417] The existing CasX platform based on wild-type sequences for dsDNA editing in human cells achieves very low efficiency editing outcomes when compared with alternative CRISPR systems (Liu, J J et al Nature, 566, 218-223 (2019)). Cleavage efficiency of genomic DNA is governed, in large part, by the biochemical characteristics of the CasX system, which in turn arise from the sequence-function relationship of each of the two components of a cleavage-competent CasX RNP: a CasX protein complexed with a sgRNA. The purpose of the following experiments was to create and identify gRNA scaffold variants with enhanced editing properties relative to wild-type CasX:gNA RNP through a program of comprehensive mutagenesis and rational approaches.

    Methods

    [0418] Methods for High-Throughput sgRNA Library Screens
    1) Molecular Biology of sgRNA Library Construction

    [0419] To build a library of sgRNA variants, primers were designed to systematically mutate each position encoding the reference gRNA scaffold of SEQ ID NO: 5, where mutations could be substitutions, insertions, or deletions. In the following in vivo bacterial screens for sgRNA mutations, the sgRNA (or mutants thereof) was expressed from a minimal constitutive promoter on the plasmid pSTX4. This minimal plasmid contains a ColE1 replication origin and carbenicillin antibiotic resistance cassette, and is 2311 base pairs in length, allowing standard Around-the-Horn PCR and blunt ligation cloning (using conventional methodologies). Forward primers KST223-331 and reverse primers KST332-440 tile across the sgRNA sequence in one base-pair increments and were used to amplify the vector in two sequential PCR steps. In step 1, 108 parallel PCR reactions are performed for each type of mutation, resulting in single base mutations at each designed position. Three types of mutations were generated. To generate base substitution mutations, forward and reverse primers were chosen in matching pairs beginning with KST224+KST332. To generate base insertion mutations, forward and reverse primers were chosen in matching pairs beginning with KST223+KST332. To generate base deletion mutations, forward and reverse primers were chosen in matching pairs beginning with KST225+KST332. After Step 1 PCR, samples were pooled into an equimolar manner, blunt-ligated, and transformed into Turbo E. coli (New England Biolabs), followed by plasmid extraction the next day. The resulting plasmid library theoretically contained all possible single mutations. In Step 2, this process of PCR and cloning was then repeated using the Step 1 plasmid library as the template for the second set of PCRs, arranged as above, to generate all double mutations. The single mutation library from Step 1 and the double mutation library from Step 2 were pooled together.

    [0420] After the above cloning steps, the library diversity was assessed with next generation sequencing (see below section for methods) (see FIG. 41). It was confirmed that the majority of the library contained more than one mutation (‘other’) category. A substantial fraction of the library contained single base substitutions, deletions, and insertions (average representation within the library of 1/18,000 variants for single substitutions, and up to 1/740 variants for single deletions).

    2) Assessing Library Diversity with Next Generation Sequencing.

    [0421] For NGS analysis, genomic DNA was amplified via PCR with primers specific to the scaffold region of the bacterial expression vector to form a target amplicon. These primers contain additional sequence at the 5′ ends to introduce Illumina read (see Table 36 for sequences). Typical PCR conditions were: 1× Kapa Hifi buffer, 300 nM dNTPs, 300 nM each primer, 0.75 ul of Kapa Hifi Hotstart DNA polymerase in a 50 μl reaction. On a thermal cycler, incubate for 95° C. for 5 min; then 16-25 cycles of 98° C. for 15 s, 60° C. for 20 s, 72° C. for 1 min; with a final extension of 2 min at 72° C. Amplified DNA product was purified with Ampure XP DNA cleanup kit, with elution in 30 μl of water. A second PCR step was done with indexing adapters to allow multiplexing on the Illumina platform. 20 μl of the purified product from the previous step was combined with 1× Kapa GC buffer, 300 nM dNTPs, 200 nM each primer, 0.75 of Kapa Hifi Hotstart DNA polymerase in a 50 μl reaction. On a thermal cycler, cycle for 95° C. for 5 min; then 18 cycles of 98° C. for 15 s, 65° C. for 15 s, 72° C. for 30 s: with a final extension of 2 min at 72° C. Amplified DNA product was purified with Ampure XP DNA cleanup kit, with elution in 30 μl of water. Quality and quantification of the amplicon was assessed using a Fragment Analyzer DNA analyzer kit (Agilent, dsDNA 35-1500 bp).

    TABLE-US-00048 TABLE 36 primer sequences. Primer SEQ ID NO PCR1 Fwd 4108 PCR2 Rvs 4109 PCR2 Fwd 4110 PCR2_Rvs_v1_001 4111 PCR2_Rvs_v1_002 4112 PCR2_Rvs_v1_003 4113 PCR2_Rvs_v1_004 4114 PCR2_Rvs_v1_005 4115 PCR2_Rvs_v1_006 4116 PCR2_Rvs_v1_007 4117 PCR2_Rvs_v1_008 4118 PCR2_Rvs_v1_009 4119 PCR2_Rvs_v1_010 4120 PCR2_Rvs_v1_011 4121 PCR2_Rvs_v1_012 4122 PCR2_Rvs_v1_013 4123 PCR2_Rvs_v1_014 4124 PCR2_Rvs_v1_015 4125 PCR2_Rvs_v1_016 4126 PCR2_Rvs_v1_017 4127 PCR2_Rvs_v1_018 4128 PCR2_Rvs_v1_019 4129 PCR2_Rvs_v1_020 4130 PCR2_Rvs_v1_021 4131 PCR2_Rvs_v1_022 4132 PCR2_Rvs_v1_023 4133 PCR2_Rvs_v1_024 4134 PCR2_Rvs_v1_025 4135 PCR2_Rvs_v1_026 4136 PCR2_Rvs_v1_027 4137 PCR2_Rvs_v1_028 4138 PCR2_Rvs_v1_029 4139 PCR2_Rvs_v1_030 4140 PCR2_Rvs_v1_031 4141 PCR2_Rvs_v1_032 4142 PCR2_Rvs_v1_033 4143 PCR2_Rvs_v1_034 4144 PCR2_Rvs_v1_035 4145 PCR2_Rvs_v1_036 4146 PCR2_Rvs_v1_037 4147 PCR2_Rvs_v1_038 4148 PCR2_Rvs_v1_039 4149 PCR2_Rvs_v1_040 4150 PCR2_Rvs_v1_041 4151 PCR2_Rvs_v1_042 4152 PCR2_Rvs_v1_043 4153 PCR2_Rvs_v1_044 4154 PCR2_Rvs_v1_045 4155 PCR2_Rvs_v1_046 4156 PCR2_Rvs_v1_047 4157 PCR2_Rvs_v1_048 4158 PCR2_Rvs_v2_001 4159 PCR2_Rvs_v2_002 4160 PCR2_Rvs_v2_003 4161 PCR2_Rvs_v2_004 4162 PCR2_Rvs_v2_005 4163 PCR2_Rvs_v2_006 4164 PCR2_Rvs_v2_007 4165 PCR2_Rvs_v2_008 4166 PCR2_Rvs_v2_009 4167 PCR2_Rvs_v2_010 4168 PCR2_Rvs_v2_011 4169 PCR2_Rvs_v2_012 4170 PCR2_Rvs_v2_013 4171 PCR2_Rvs_v2_014 4172 PCR2_Rvs_v2_015 4173 PCR2_Rvs_v2_016 4174 PCR2_Rvs_v2_017 4175 PCR2_Rvs_v2_018 4176 PCR2_Rvs_v2_019 4177 PCR2_Rvs_v2_020 4178 PCR2_Rvs_v2_021 4179 PCR2_Rvs_v2_022 4180 PCR2_Rvs_v2_023 4181 PCR2_Rvs_v2_024 4182 PCR2_Rvs_v2_025 4183 PCR2_Rvs_v2_026 4184 PCR2_Rvs_v2_027 4185

    3) Bacterial CRISPRi (CRISPR Interference) Assay

    [0422] A dual-color fluorescence reporter screen was implemented, using monomeric Red Fluorescent Protein (mRFP) and Superfolder Green Fluorescent Protein (sfGFP), based on Qi L S, et al. (Cell 152, 5, 1173-1183 (2013)). This screen was utilized to assay gene-specific transcriptional repression mediated by programmable DNA binding of the CasX system). This strain of E. coli expresses bright green and red fluorescence under standard culturing conditions or when grown as colonies on agar plates. Under a CRISPRi system, the CasX protein is expressed from an anhydrotetracycline (aTc)-inducible promoter on a plasmid containing a p15A replication origin (plasmid pSTX3; chloramphenicol resistant), and the sgRNA is expressed from a minimal constitutive promoter on a plasmid containing a ColE1 replication origin (pSTX4, non-targeting spacer, or pSTX5, GFP-targeting spacer #1; carbenicillin resistant). When the E. coli strain is co-transformed with both plasmids, genes targeted by the spacer in pSTX4 are repressed; in this case GFP repression is observed, the degree to which is dependent on the function of the targeting CasX protein and sgRNA. In this system, RFP fluorescence can serve as a normalizing control. Specifically, RFP fluorescence should be unaltered and independent of functional CasX based CRISPRi activity. CRISPRi activity can be tuned in this system by regulating the expression of the CasX protein; here, all assays used an induction concentration of 20 nM aTc final concentration in growth media.

    [0423] Libraries of sgRNA were constructed to assess the activity of sgRNA variants in complex with three cleavage-inactivating mutations made to the reference CasX protein open reading frame of Planctomycetes, SEQ ID NO: 2, rendering the CasX catalytically dead (dCasX). These three mutations are referred to as D1 (with a D659A substitution), D2 (with a E756A substitution), or D3 (with a D922A substitution). A fourth library, composed of all three mutations in combination is referred to as DDD (D659A; E756A; D922A substitutions).

    [0424] Libraries of sgRNA were screened for activity using the above CRISPRi system with either D2, D3, or DDD. After co-transformation and recovery, libraries were grown for 8 hours in 2xyt media with appropriate antibiotics and sorted on a Sony MA900 flow cytometry instrument. Each library version was sorted with three different gates (in addition to the naive, unsorted library). Three different sort gates were employed to extract GFP—cells: 10%, 1%, and “F” which represents ˜0.1% of cells, ranked by GFP repression. Finally, each sort was done in two technical replicates. Variants of interest were detected using either Sanger sequencing of picked colonies (UC Berkeley Barker Sequencing Facility) or NGS sequencing of miniprepped plasmid (Massachusetts General Hospital CCIB DNA Core Next-Generation Sequencing Service) or NGS sequencing of PCR amplicons, produced with primers that introduced indexing adapters for sequencing on an Illumina platform (see section above). Amplicons were sent for sequencing with Novogene (Beijing, China) for sequencing on an Illumina Hiseq, with 150 cycle, paired-end reads. Each sorted sample had at least 3 million reads per technical replicate, and at least 25 million reads for the naive samples. The average read count across all samples was 10 million reads.

    4) NGS Data Analysis

    [0425] Paired end reads were trimmed for adapter sequences with cutadapt (version 2.1), merged to form a single read with flash2 (v2.2.00), and aligned to the reference with bowtie2 (v2.3.4.3). The reference was the entire amplicon sequence, which includes ˜30 base pairs flanking the Planctomyces reference guide scaffold from the plasmid backbone having the sequence:

    TABLE-US-00049 (SEQ ID NO: 4221) TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTTACTGGCGCTTTTAT CTCATTACTTTGAGAGCCATCACCAGCGACTATGTCGTATGGGTAAAGC GCTTATTTATCGGAGAGAAATCCGATAAATAAGAAGCATCAAAGCTGGA GTTGTCCCAATTCTTCTAGAG.

    [0426] Variants between the reference and the read were determined from the bowtie2 output. In brief, custom software in python (analyzeDME/bin/bam_to_variants.py) extracted single-base variants from the reference sequence using the cigar string and and string from each alignment. Reads with poor alignment or high error rates were discarded (mapq <20 and estimated error rate >4%; estimated error rate was calculated using per-base phred quality scores). Single-base variants at locations of poor-quality sequencing were discarded (phred score <20). Immediately adjacent single-base variants were merged into one mutation that could span multiple bases. Mutations were labeled for being single substitutions, insertions, or deletions, or other higher-order mutations, or outside the scaffold sequence.

    [0427] The number of reads that supported each set of mutations was determined. These read counts were normalized for sequencing depth (mean normalization), and read counts from technical replicates were averaged by taking the geometric mean.

    [0428] To obtain enrichment values for each scaffold variant, the number of normalized reads for each sorted sample were compared to the average of the normalized read counts for D2 and D3, which were highly correlated (FIG. 41). The naive DDD sample was not sequenced. To obtain the enrichment for each catalytically dead CasX variant, the log of the enrichment values across the three sort gates were averaged.

    Methods for Individual Validation of sgRNA Activity in Human Cell Assays
    1) Individual sgRNA Variant Construction

    [0429] In order to screen variants of interest, individual variants were constructed using standard molecular biology techniques. All mutations were built on the reference CasX (SEQ ID NO:2) using a staging vector and Gibson cloning. To build single mutations, a universal forward (5′.fwdarw.3′) and reverse (3′.fwdarw.5′) primer were designed on either end of the encoded protein sequence that had homology to the desired backbone for screening (see Table 37 below). Primers to create the desired mutations were also designed (F primer and its reverse complement) and used with the universal F and R primers for amplification; thus producing two fragments. In order to add multiple mutations, additional primers with overlap were designed and more PCR fragments were produced. For example, to construct a triple mutant, four sets of F/R primers were designed. The resulting PCR fragments were gel extracted. These fragments were subsequently assembled into a screening vector (see Table 37), by digesting the screening vector backbone with the appropriate restriction enzymes and gel extraction. The insert fragments and vector were then assembled using Gibson assembly master mix, transformed, and plated using appropriate LB agar+antibiotic. The clones were Sanger sequenced and correct clones were chosen.

    [0430] Finally, spacer cloning was performed to target the guide RNA to a gene of interest in the appropriate assay or screen. The sequence-verified non-targeting clone was digested with the appropriate Golden Gate enzyme and cleaned using DNA Clean and Concentrator kit (Zymo). The oligos for the spacer of interest were annealed. The annealed spacer was ligated into a digested and cleaned vector using a standard Golden Gate Cloning protocol. The reaction was transformed into Turbo E. coli and plated on LB agar+carbenicillin, and allowed to grow overnight at 37° C. Individual colonies were picked the next day, grown for eight hours in 2XYT +carbenicillin at 37° C., and miniprepped. The clones were Sanger sequenced and correct clones were chosen.

    TABLE-US-00050 TABLE 37 screening vectors and associated primer sequences Screening vector F primer sequence R primer sequence pSTX6 SAH24: SAH25: TTCAGGTTGGACCGGTGCCACCATGGCC TTTTGGACTAGTCACGGCGGGC CCAAAGAAGAAGCGGAAGGTCAGCCAAG TTCCAG (SEQ ID NO: AGATCAAGAGAATCAACAAGATCAGA 4105) (SEQ ID NO: 4104) pSTX16 or oIC539: oIC540: pSTX34 ATGGCCCCAAAGAAGAAGCGGAAGGTCT TACCTTTCTCTTCTTTTTTGGA CTAGACAAG (SEQ ID NO: 4106) CTAGTCACGG (SEQ ID NO: 4107)

    2) GFP Editing by Plasmid Lipofection of HEK293T Cells

    [0431] Either doxycycline-inducible GFP (iGFP) reporter HEK293T cells or SOD1-GFP reporter HEK293T cells were seeded at 20-40 k cells/well in a 96 well plate in 100 μl of FB medium and cultured in a 37° C. incubator with 5% CO2. The following day, confluence of seeded cells was checked. Cells were ˜75% confluent at time of transfection. Each CasX construct was transfected at 100-500 ng per well using Lipofectamine 3000 following the manufacturer's protocol, into 3 wells per construct as replicates. SaCas9 and SpyCas9 targeting the appropriate gene were used as benchmarking controls. For each Cas protein type, a non-targeting plasmid was used as a negative control.

    [0432] After 24-48 hours of puromycin selection at 0.3-3 μg/ml to select for successfully transfected cells, followed by 1-7 days of recovery in FB medium, GFP fluorescence in transfected cells was analyzed via flow cytometry. In this process, cells were gated for the appropriate forward and side scatter, selected for single cells and then gated for reporter expression (Attune Nxt Flow Cytometer, Thermo Fisher Scientific) to quantify the expression levels of fluorophores. At least 10,000 events were collected for each sample. The data were then used to calculate the percentage of edited cells.

    3) GFP Editing by Lentivirus Transduction of HEK293T Cells

    [0433] Lentivirus products of plasmids encoding CasX proteins, including controls, CasX variants, and/or CasX libraries, were generated in a Lenti-X 293T Cell Line (Takara) following standard molecular biology and tissue culture techniques. Either iGFP HEK293T cells or SOD1-GFP reporter HEK293T cells were transduced using lentivirus based on standard tissue culture techniques. Selection and fluorescence analysis was performed as described above, except the recovery time post-selection was 5-21 days. For Fluorescence-Activated Cell Sorting (FACS), cells were gated as described above on a MA900 instrument (Sony). Genomic DNA was extracted by QuickExtract™ DNA Extraction Solution (Lucigen) or Genomic DNA Clean & Concentrator (Zymo).

    Results:

    [0434] Engineering of sgRNA 1 to 174
    1) sgRNA Derived from Metagenomics of Bacterial Species Improved Function in Human Cells

    [0435] An initial improvement in CasX RNP cleavage activity was found by assessing new metagenomic bacterial sequences for possible CasX guide scaffolds. Prior work demonstrated that Deltaproteobacteria sgRNA (SEQ ID NO:4) could form a functional RNA-guided nuclease complex with CasX proteins, including the Deltaproteobacteria CasX (SEQ ID NO:1 or Planctomycetes CasX (SEQ ID NO:2). Structural characterization of this complex allowed identification of structural elements within the sgRNA (FIG. 42). However, a sgRNA scaffold from Planctomycetes was never tested. A second tracrRNA was identified from Planctomycetes, which was made into an sgRNA with the same method as was used for Deltaproteobacteria tracrRNA-crRNA (SEQ ID NO:5) (Liu, J J et al Nature, 566, 218-223 (2019)). These two sgRNA had similar structural elements, based on RNA secondary structure prediction algorithms, including three stem loop structures and possible triplex formation (FIG. 43).

    [0436] Characterization the activity of Planctomycetes CasX protein complexed with the Deltaproteobacteria sgRNA (hereafter called RNP 2.1, wherein the CasX protein has the sequence of SEQ ID NO:2) and Planctomycetes CasX protein complexed with scaffold 2 sgRNA (hereafter called RNP 2.2) showed clear superiority of RNP 2.2 compared to the others in a GFP-lipofection assay (see Methods) (FIG. 44). Thus, this scaffold formed the basis of our molecular engineering and optimization.

    2) Improving Activity of CasX RNP Through Comprehensive RNA Scaffold Mutagenesis Screen.

    [0437] To find mutations to the guide RNA scaffold that could improve dsDNA cleavage activity of the CasX RNP, a large diversity of insertions, deletions and substitutions to the gRNA scaffold 2 were generated (see Methods). This diverse library was screened using CRISPRi to determine variants that improved DNA-binding capabilities and ultimately improved cleavage activity in human cells. The library was generated through a process of pooled primer cloning as described in the Materials and Methods. The CRISPRi screen was carried out using three enzymatically-inactive versions of CasX (called D2, D3, and DDD; see Methods). Library variants with improved DNA binding characteristics were identified through a high-throughput sorting and sequencing approach. Scaffold variants from cells with high GFP repression (i.e., low fluorescence) were isolated and identified with next generation sequencing. The representation of each variant in the GFP—pool was compared to its representation in the naive library to form an enrichment score per variant (see Materials and Methods). Enrichment was reproducible across the three catalytically dead-CasX variants (FIG. 46).

    [0438] Examining the enrichment scores of all single variants revealed mutable locations within the guide scaffold, especially the extended stem (FIG. 45). The top-20 enriched single variants outside of the extended stem are listed in Table 38. In addition to the extended stem, these largely cluster into four regions: position 55 (scaffold stem bubble), positions 15-19 (triplex loop), position 27 (triplex), and in the 5′ end of the sequence (positions 1, 2, 4, 8). While the majority of these top-enriched variants were consistently enriched across all three catalytically dead CasX versions, the enrichment at position 27 was variable, with no evident enrichment in the D3 CasX (data not shown).

    [0439] The enrichment of different structural classes of variants suggested that the RNP activity might be improved by distinct mechanisms. For example, specific mutations within the extended stem were enriched relative to the WT scaffold. Given that this region does not substantially contact the CasX protein (FIG. 42A), we hypothesize that mutating this region may improve the folding stability of the gRNA scaffold, while not affecting any specific protein-binding interaction interfaces. On the other hand, 5′ mutations could be associated with increased transcriptional efficiency. In a third mechanism, it was reasoned that mutations to the scaffold stem bubble or triplex could lead to increased stability through direct contacts with the CasX protein, or by affecting allosteric mechanisms with the RNP. These distinct mechanisms to improve RNP binding support that these mutations could be stacked or combined to additively improve activity.

    TABLE-US-00051 TABLE 38 Top enriched single-variants outside of extended stem. log2 Position Annotation Reference Alternate enrichment Region 55 insertion — G 2.37466 scaffold stem bubble 55 insertion — T 1.93584 scaffold stem bubble 15 insertion — T 1.65155 triplex loop 17 insertion — T 1.56605 triplex loop 4 deletion T — 1.48676 5′ end 27 insertion — C 1.26385 triplex 16 insertion — C 1.26025 triplex loop 19 insertion — T 1.25306 triplex loop 18 insertion — G 1.22628 triplex loop 2 deletion A — 1.17690 5′ end 17 insertion — A 1.16081 triplex loop 18 substitution C T 1.10247 triplex loop 18 insertion — A 1.04716 triplex loop 16 substitution C T 0.97399 triplex loop 8 substitution G C 0.95127 pseudoknot 16 substitution C A 0.89373 triplex loop 27 insertion — A 0.86722 triplex 1 substitution T C 0.83183 5′ end 18 deletion C — 0.77641 triplex loop 19 insertion — G 0.76838 triplex loop
    3) Assessing RNA Scaffold Mutants in dsDNA Cleavage Assay in Human Cells

    [0440] The CRISPRi screen is capable of assessing binding capacity in bacterial cells at high throughput; however it does not guarantee higher cleavage activity in human cell assays. We next assessed a large swath of individual scaffold variants for cleavage capacity in human cells using a plasmid lipofection in HEK cells (see Materials and Methods). In this assay, human HEK293T cells containing a stably-integrated GFP gene are transduced with a plasmid (p16) that expresses reference CasX protein (Stx2) (SEQ ID NO: 2) and sgRNA comprising the gRNA scaffold variant and spacers 4.76 (having sequence UGUGGUCGGGGUAGCGGCUG (SEQ ID NO: 4222) and 4.77 (having sequence UCAAGUCCGCCAUGCCCGAA (SEQ ID NO: 4223)) to target the RNP to knockdown the GFP gene. Percent GFP knockdown was assayed using flow cytometry. Over a hundred scaffold variants were tested in this assay.

    [0441] The assay resulted in largely reproducible values across different assay dates for spacer 4.76, while exhibiting more variability for spacer 4.77 (FIG. 51). Spacer 4.77 was generally less active for the wild-type RNP complex, and the lower overall signal may have contributed to this increased variability. Comparing the cleavage activity across the two spacers showed generally correlated results (r=0.652; FIG. 52). Because of the increased noise in spacer 4.77 measurements, the reported cleavage activity per scaffold was taken as the weighted average between the measurements on each scaffold, with the weights equal to the inverse squared error. This weighting effectively down-weights the contribution from high-error measurements.

    [0442] A subset of sequences was tested in both the HEK-iGFP assay and the CRISPRi assay. Comparing the CRISPRi enrichment score to the GFP cleavage activity showed that highly-enriched variants had cleavage activity at or exceeding the wildtype RNP (FIG. 45C). Two variants had high cleavage activity with low enrichment scores (C18G and T17G); interestingly, these substitutions are at the same position as several highly-enriched insertions (FIG. 53).

    [0443] Examining all scaffolds tested in the HEK-iGFP assay revealed certain features that consistently improved cleavage activity. We found that the extended stem could often be completely swapped out for a different stem, with either improved or equivalent activity (e.g., compare scaffolds of SEQ ID NO: 2101-2105, 2111, 2113, 2115; all of which have replaced the extended stem, with increased activity relative to the reference, as seen in Table 27). We specifically focused on two stems with different origins: a truncated version of the wildtype stem, with the loop sequence replaced by the highly stable UUCG tetraloop (stem 42). The other (stem 46) was derived from Uvsx bacteriophage T4 mRNA, which in its biological context is important for regulation of reverse transcription of the bacteriophage genome (Tuerk et al. Proc Natl Acad Sci USA. 85(5):1364 (1988)). The top-performing gRNA scaffolds all had one of these two extended stem versions (e.g., SEQ ID NOS: 2160 and 2161).

    [0444] Appending ribozymes to the 3′ end often resulted in functional scaffolds (e.g., see SEQ ID NO: 2182 with equivalent activity to the WT guide in this assay {Table 27}). On the other hand, adding to the 5′ end generally hurt cleavage activity. The best-performing 5′ ribozyme construct (SEQ ID NO:2208) had cleavage activity <40% of the WT guide in the assay.

    [0445] Certain single-point mutations were generally good, or at least not harmful, including T 10C, which was designed to increase transcriptional efficiency in human cells by removing the four consecutive T's at the 5′ start of the scaffold (Kiyama and Oishi. Nucleic Acids Res., 24:4577 (1996)). C18G was another helpful mutation, which was obtained from individual colony picking from the CRISPRi screen. The insertion of C at position 27 was highly-enriched in two out of the three dCasX versions of the CRISPRi screen; however, it did not appear to help cleavage activity. Finally, insertion at position 55 within the RNA bubble substantially improved cleavage activity (i.e., compare SEQ ID NO: 2236, with a {circumflex over ( )}G55 insertion to SEQ ID NO:2106 in Table 27).

    4) Further Stacking of Variants in Higher-Stringency Cleavage Assays

    [0446] Scaffold mutations that proved beneficial were stacked together to form a set of new variants that were tested under more stringent criteria: a plasmid lipofection assay in human HEK-293t cells with the GFP gene knocked into the SOD1 allele, which we observed was generally harder to knock down. Of this batch of variants, guide scaffold 158 was identified as a top-performer (FIG. 47). This scaffold had a modified extended stem (Uvsx), with additional mutations to fully base pair the extended stem ([A99] and G65U). It also contained mutations in the triplex loop (C18G) and in the scaffold stem bubble ({circumflex over ( )}G55).

    [0447] In a second validation of improved DNA editing capacity, sgRNAs were delivered to cells with low-MOI lentiviral transduction, and with distinct targeting sequences to the SOD1 gene (see Methods); spacers were 8.2 (having sequence AUGUUCAUGAGUUUGGAGAU (SEQ ID NO: 4224)), and 8.4 (having sequence UCGCCAUAACUCGCUAGGCC (SEQ ID NO: 4225)) (results shown in FIG. 48). Additionally, 5′ truncations of the initial GT of guide scaffolds 158 and 64 were deleted (forming scaffolds 174 and 175 respectively). This assay showed dominance of guide scaffold 174: the variant derived from guide scaffold 158 with 2 bases truncated from the 5′ end (FIG. 48). A schematic of the secondary structure of scaffold 174 is shown in FIG. 49.

    [0448] In sum, our improved guide scaffold 174 showed marked improvement over our starting reference guide scaffold (scaffold 1 from Deltaproteobacteria, SEQ ID NO:4), and substantial improvement over scaffold 2 (SEQ ID NO:5) (FIG. 50). This scaffold contained a swapped extended stem (replacing 32 bases with 14 bases), additional mutations in the extended stem ([A99] and G65U), a mutation in the triplex loop (C18G), and in the scaffold stem bubble (AG55) (where all the numbering refers to the scaffold 2). Finally, the initial T was deleted from scaffold 2, as well as the G that had been added to the 5′ end in order to enhance transcriptional efficiency. The substantial improvements seen with guide scaffold 174 came collectively from the indicated mutations.

    Example 18: Design of Improved Guides Based on Predicted Secondary Structure Stability Methods

    [0449] A computational method was employed to predict the relative stability of the ‘target’ secondary structure, compared to alternative, non-functional secondary structures. First, the ‘target’ secondary structure of the gRNA was determined by extracting base-pairs formed within the RNA in the CryoEM structure for CasX 1.1. For prediction of RNA secondary structure, the program RNAfold was used (version 2.4.14). The ‘target’ secondary structure was converted to a ‘constraint string’ that enforces bases to be paired with other bases, or to be unpaired. Because the triplex is unable to be modeled in RNAfold, the bases involved in the triplex are required to be unpaired in the constraint string, whereas all bases within other stems (pseudoknot, scaffold, and extended stems) were required to be appropriately paired. For guide scaffolds 2 (SEQ ID NO:5), 174 (SEQ ID NO:2238), and 175 (SEQ ID NO:2239), this constraint string was constructed based on sequence alignment between the scaffold and scaffold 1 (SEQ ID NO: 4) outside of the extended stem, which can have minimal sequence identity. Within the extended stem, bases were assumed to be paired according to the predicted secondary structure for the isolated extended stem sequence. See Table 39 for a subset of sequences and their constraint strings.

    TABLE-US-00052 TABLE 39 Constraint strings to represent the ‘target secondary structure’ in RNAfold algorithm. Name Constraint string Scaffold 1 (w/5′ (((((.xxx.........xxxxx))))).((.((((((((...))))).)))))...(((((((((((((((. truncation as in ......))))))))))).))))..xxxxx CryoEM structure) Scaffold 2 ....(((((.xxx.........xxxxx.)))))....((((((((...))))).))).....((.(((((((((( (((......)))))))))))))..))..xxxxx Scaffold 174 ...(((((.xxx.........xxxxx.)))))....((((((((...)))))..))).....((((((((....)) ))))))..xxxxx Scaffold 175 ...(((((.xxx.........xxxxx.)))))....((((((((...))))).))).....((.(((((((((... .)))))))))..))..xxxxx

    [0450] Secondary structure stability of the ensemble of structures that satisfy the constraint was obtained, using the command: ‘RNAfold-p0--noPS-C’ And taking the ‘free energy of ensemble’ in kcal/mol (ΔG_constraint). The prediction was repeated without the constraint to get the secondary structure stability of the entire ensemble that includes both the target and alternative structures, using the command: ‘RNAfold-p0--noPS’ and taking the ‘free energy of ensemble’ in kcal/mol (ΔG_all).

    [0451] The relative stability of the target structure to alternate structures was quantified as the difference between these two ΔG values: ΔΔG=ΔG_constraint−ΔG_all. A sequence with a large value for LAG is predicted to have many competing alternate secondary structures that would make it difficult for the RNA to fold into the target binding-competent structure. A sequence with a low value for ΔΔG is predicted to be more optimal in terms of its ability to fold into a binding-competent secondary structure.

    Results

    [0452] A series of new scaffolds was designed to improve scaffold activity based on existing data and new hypotheses. Each new scaffold comprised a set of mutations that, in combination, were predicted to enable higher activity of dsDNA cleavage. These mutations fell into the following categories: First, mutations in the 5′ unstructured region of the scaffold were predicted to increase transcription efficiency or otherwise improve activity of the scaffold. Most commonly, scaffolds had the 5′ “GU” nucleotides deleted (scaffolds 181-220: SEQ ID NOS: 2242-2280). The “U” is the first nucleotide (U1) in the reference sequence SEQ ID NO:5. The G was prepended to increase transcription efficiency by U6 polymerase. However, removal of these two nucleotides was shown, surprisingly, to increase activity (FIG. 66). Additional mutations at the 5′ end include (a) combining the GU deletion with A2G, such that the first transcribed base is the G at position 2 in the reference scaffold (scaffold 199: SEQ ID NO:2259); (b) deleting only U1 and keeping the prepended G (scaffold 200: SEQ ID NO:2260); and (c) deleting the U at position 4, which is predicted to be unstructured and was found to be beneficial when added to scaffold 2 in a high-throughput CRISPRi assay (scaffold 208: SEQ ID NO:2268).

    [0453] A second class of mutations was to the extended stem region. The sequence for this region was chosen from three possible options: (a) a “truncated stem loop” which has a shorter loop sequence than the reference sequence extended stem (the scaffolds 64 and 175 contain this extended stem: SEQ ID NOS: 2106 and 2239, respectively) (b) Uvsx hairpin with additional loop-distal mutations [A99] and G65U to fully base-pair the extended stem (the scaffold 174: SEQ ID NO: 2238) contains this extended stem); or (c) an “MS2(U15C)” hairpin with the same additional loop-distal mutations [A99] and G65U as in (b). These three extended stems classes were present in scaffolds with high activity (e.g. see FIG. 65), and their sequences can be found in Table 40.

    TABLE-US-00053 TABLE 40 Sequences of extended stem regions used in novel scaffolds. Incorporated in Scaffolds Extended stem name Extended stem sequence (SEQ ID NO) truncated stem GCGCUUACGGACUUCGGUCCGUAAG 2239, 2242-2244, 2246, loop AAGC (SEQ ID NO: 4226) 2255-2258 UvsX, -99 G65U GCUCCCUCUUCGGAGGGAGC (SEQ 2238, 2245, 2250-2254, ID NO: 4227) 2259-2280 MS2(U15C), -99 GCUCACAUGAGGAUCACCCAUGUGA 2249 G65U GC (SEQ ID NO: 4228)

    [0454] Thirdly, a set of mutations was designed to the triplex loop region. This region was not resolved in the CryoEM structure of CasX 1.1, likely because it does not form base-pairs and thus is more flexible. This region tolerates mutations, with certain mutations having beneficial effects on RNP binding, based on CRISPRi data from scaffold 2 (FIG. 63). The C18G substitution within the triplex loop was already incorporated in the scaffold 174. The following mutations were added to scaffold 174, that were not immediately adjacent to the C18G substitution in order to limit potential negative epistasis between these mutations: {circumflex over ( )}U15 (insertion of U before nucleotide 15 in scaffold 2), {circumflex over ( )}U17, and C16A (scaffolds 208, 210, and 209: SEQ ID NOS: 2268, 2270, 2269, respectively).

    [0455] Fourth, a set of mutations was designed to systematically stabilize the target secondary structure for the scaffold. For background, RNA polymers fold into complex three-dimensional structures that enforce their function. In the CasX RNP, the RNA scaffold forms a structure comprising secondary structure elements such as the pseudoknot stem, a triplex, a scaffold stem-loop, and an extended stem-loop, as evident in the Cryo-EM characterization of the CasX RNP 1.1. These structural elements likely help enforce a three dimensional structure that is competent to bind the CasX protein, and in turn enable conformational transitions necessary for enzymatic function of the RNP. However, an RNA sequence can fold into alternate secondary structures that compete with the formation of the target secondary structure. The propensity of a given sequence to fold into the target versus alternate secondary structures was quantified using computational prediction, similar to the method described in (Jarmoskaite, I., et al. 2019. A quantitative and predictive model for RNA binding by human pumilio proteins. Molecular Cell 74(5), pp. 966-981.e18.) for correcting observed binding equilibrium constants for a distinct protein-RNA interaction, and using RNAfold (Lorenz, R., Bernhart, S. H., Honer Zu Siederdissen, C., et al. 2011. ViennaRNA Package 2.0. Algorithms for Molecular Biology 6, p. 26) to predict secondary structure stability (see Methods).

    [0456] A series of mutations were chosen that were predicted to help stabilize the target secondary structure, in the following regions: The pseudoknot is a base-paired stem that forms between the 5′ sequence of the scaffold and sequence 3′ of the triplex and triplex loop. This stem is predicted to comprise 5 base-pairs, 4 of which are canonical Watson-Crick pairs and the fifth is a noncanonical G:A wobble pair. Converting this G:A wobble to a Watson Crick pair is predicted to stabilize alternative secondary structures relative to the target secondary structure (high ΔΔG between target and alternative secondary structure stabilities; Methods). This aberrant stability comes from a set of secondary structures in which the triplex bases are aberrantly paired. However, converting the G to an A or a C (for an A:A wobble or C:A wobble) was predicted to lower the ΔΔG value (G8C or G8A added to scaffolds 174 and 175+C18G). A second set of mutations was in the triplex loop: including a U15C mutation and a C18G mutation (for scaffold 175 that does not already contain this variant). Finally, the linker between the pseudoknot stem and the scaffold stem was mutated at position 35 (U35A), which was again predicted to stabilize the target secondary structure relative to alternatives.

    [0457] Scaffolds 189-198 (SEQ ID NOS:2250-2258) included these predicted mutations on top of scaffolds 174 or 175, individually and in combination. The predicted change in ΔΔG for each of these scaffolds is given in Table 41 below. This algorithm predicts a much stronger effect on ΔΔG with combining multiple of these mutations into a single scaffold.

    TABLE-US-00054 TABLE 41 Predicted effect on target secondary structure stability of incorporating specific mutations individually or in combination to scaffolds 174 or 175. Effect of mutations(s) ΔΔG_mut- Starting Scaffold ΔΔG ΔΔG_starting_scaffold scaffold Mutation(s) (kcal/mol) (kcal/mol) 174 — 0.17 — 174 G8A −0.74 −0.91 174 G8C −0.32 −0.49 174 U15C −0.02 −0.19 174 U35A −0.22 −0.39 174 G8A, U15C, −1.34 −1.51 U35A 175 — 3.23 — 175 G8A 3.15 −0.08 175 G8C 3.15 −0.08 175 U35A 3.07 −0.16 175 U15C 0.78 −2.45 175 C18G 0.43 −2.80 175 G8A, T15C, −1.03 −4.26 C18G, T35A

    [0458] A fifth set of mutations was designed to test whether the triplex bases could be replaced by an alternate set of three nucleotides that are still able to form triplex pairs (Scaffolds 212-220: SEQ ID NOS:2272-2280). A subset of these substitutions are predicted to prevent formation of alternate secondary structures.

    [0459] A sixth set of mutations were designed to change the pseudoknot-triplex boundary nucleotides, which are predicted to have competing effects on transcription efficiency and triplex formation. These include scaffolds 201-206 (SEQ ID NOS:2261-2266).