Visualized Screening Method for Aspergillus Recombinant Strains with Multigene Editing

Abstract

The present disclosure discloses a visualized screening method for an Aspergillus recombinant strain with multigene editing and belongs to the technical field of gene engineering. CRISPR-Cas9 is used in the disclosure to cleave spore color change-related genes and a target gene in Aspergillus at the same time, such that editing of the target gene is visualized and an Aspergillus niger strain with multigene editing can be rapidly and efficiently screened out through spore phenotypes. Through different combinations of visualized genes and non-phenotypic change genes, rapid screening of the strain with multigene editing and simultaneous screening of multiple visualized genes are realized, and use of resistance genes in industrial strains is reduced.

Claims

1. A method for visualized screening of an Aspergillus strain with gene editing, wherein using CRISPR-Cas9 gene editing technology to simultaneously knock out genes (a) and (b) in the Aspergillus; wherein (a) are genes affecting a spore color change; (b) are genes with unchanged phenotypes of Aspergillus before and after knockout; and the genes affecting a spore color change are fwnA, pptA and/or brnA.

2. The method according to claim 1, wherein the genes with unchanged phenotypes of Aspergillus before and after knockout are amyA and/or ammA; and the amyA has a nucleotide sequence as set forth in SEQ ID NO:52 and the ammA has a nucleotide sequence as set forth in SEQ ID NO:53.

3. The method according to claim 2, wherein the fwnA has a nucleotide sequence as set forth in SEQ ID NO:24, the pptA has a nucleotide sequence as set forth in SEQ ID NO:50 and the brnA has a nucleotide sequence as set forth in SEQ ID NO: 51.

4. The method according to claim 3, wherein sgRNA is released by using Aspergillus endogenous tRNAs and the endogenous tRNAs comprise tRNA.sup.Ala, tRNA.sup.Arg, tRNA.sup.Cys, tRNA.sup.Ile, tRNA.sup.Leu, tRNA.sup.Lys, tRNA.sup.Met, tRNA.sup.Phe, tRNA.sup.Ser, tRNA.sup.Thr, tRNA.sup.Val, tRNA.sup.Glu, tRNA.sup.Pro, tRNA.sup.Glu, tRNA.sup.Gln and tRNA.sup.Gly.

5. The method according to claim 4, wherein when a single gene is edited, a first tRNA after a promoter is tRNA.sup.Ala; and the tRNA.sup.Ala has a nucleotide sequence as set forth in SEQ ID NO:10.

6. The method according to claim 4, wherein when two genes are edited, a first tRNA after a promoter is tRNA.sup.Ala and a second tRNA is tRNA.sup.Arg or tRNA.sup.Phe; and the tRNA.sup.Arg and the tRNA.sup.Phe respectively have a nucleotide sequence as set forth in SEQ ID NO:20 and SEQ ID NO:16.

7. The method according to claim 4, wherein when multiple genes are edited, a first tRNA after a promoter is tRNA.sup.Ala, a second tRNA is tRNA.sup.Phe, and a tRNA in a last sgRNA is tRNA.sup.Arg or tRNA.sup.Ile; and the tRNA.sup.Ile has a nucleotide sequence as set forth in SEQ ID NO:19.

8. The method according to claim 7, wherein a Pu6 promoter and a Tu6 terminator are used to separately promote and terminate an expression of the last sgRNA; the Pu6 promoter has a nucleotide sequence as set forth in SEQ ID NO:3; and the Tu6 terminator has a nucleotide sequence as set forth in SEQ ID NO:5.

9. The method according to claim 3, wherein the Aspergillus comprises Aspergillus flavus, Aspergillus niger, Aspergillus fumigatus, Aspergillus versicolor and Aspergillus nidulans.

10. A visualized system for gene knockout in Aspergillus, wherein the visualized system comprises a gene encoding a Cas9 protein, an sgRNA expression cassette and a screening marker; the sgRNA expression cassette contains target sequences of genes affecting a spore color change and target sequences of genes not affecting phenotypes of Aspergillus; and the genes affecting a spore color change comprise fwnA, pptA or brnA.

11. The visualized system according to claim 10, wherein the genes with unchanged phenotypes of Aspergillus before and after knockout are amyA and/or ammA; and the amyA has a nucleotide sequence as set forth in SEQ ID NO:52 and the ammA has a nucleotide sequence as set forth in SEQ ID NO:53.

12. The visualized system according to claim 11, wherein sgRNA is released by using Aspergillus endogenous tRNAs and the endogenous tRNAs comprise tRNA.sup.Ala, tRNA.sup.Arg, tRNA.sup.Cys, tRNA.sup.Ile, tRNA.sup.Leu, tRNA.sup.Lys, tRNA.sup.Met, tRNA.sup.Phe, tRNA.sup.Ser, tRNA.sup.Thr, tRNA.sup.Val, tRNA.sup.Glu, tRNA.sup.Pro, tRNA.sup.Glu, tRNA.sup.Gln and tRNA.sup.Gly.

13. The visualized system according to claim 12, wherein when a single gene is edited, a first tRNA after a promoter is tRNA.sup.Ala; when two genes are edited, a first tRNA after a promoter is tRNA.sup.Ala and a second tRNA is tRNA.sup.Arg, when multiple genes are edited, a first tRNA after a promoter is tRNA.sup.Ala, a tRNA in a last sgRNA is tRNA.sup.Arg or tRNA.sup.Ile; or a first tRNA after a promoter is tRNA.sup.Ala, a tRNA in a last sgRNA is tRNA.sup.Arg or tRNA.sup.Ile and a Pu6 promoter and a Tu6 terminator are used to separately promote and terminate an expression of the last sgRNA; the Pu6 promoter has a nucleotide sequence as set forth in SEQ ID NO:3; the Tu6 terminator has a nucleotide sequence as set forth in SEQ ID NO:5; and the tRNA.sup.Ala has a nucleotide sequence as set forth in SEQ ID NO:10; the tRNA.sup.Arg and the tRNA.sup.Phe respectively have a nucleotide sequence as set forth in SEQ ID NO:20 and SEQ ID NO:16; and the tRNA.sup.Ile has a nucleotide sequence as set forth in SEQ ID NO:19.

Description

BRIEF DESCRIPTION OF FIGURES

[0040] FIG. 1 is a map of an Aspergillus niger Cas9 expression plasmid pUC19-Cas9.

[0041] FIG. 2 is a map of an Aspergillus niger sgRNA co-expression plasmid pUC19-sgRNA.

[0042] FIG. 3A is a map of an Aspergillus niger non-phenotypic gene sgRNA and a visualized phenotypic gene sgRNA co-expression plasmid pUC19-sgRNA-1.

[0043] FIG. 3B is a map of an Aspergillus niger non-phenotypic gene sgRNA and a visualized phenotypic gene sgRNA co-expression plasmid pUC19-sgRNA-2.

[0044] FIG. 3C is a map of an Aspergillus niger non-phenotypic gene sgRNA and a visualized phenotypic gene sgRNA co-expression plasmid pUC19-sgRNA-3.

[0045] FIG. 4 shows comparison of a spore color of an Aspergillus niger visualized transformant with gene editing.

DETAILED DESCRIPTION

[0046] (I) Culture Medium

[0047] PDA culture medium: 200 g of potatoes, 20 g of glucose, 15-20 g of agar and the balanced water to a constant volume of 1 L.

[0048] LB culture medium: 10 g of peptone, 5 g of yeast powder, 10 g of NaCl and the balanced water to a constant volume of 1 L.

[0049] (II) Reagent Formula

[0050] STC buffer solution: 1.2 M sorbitol, 50 mM CaCl.sub.2 and 10 mM Tris, and pH of 7.5-8.

[0051] PEG buffer solution: 25% PEG 6000, 50 mM CaCl.sub.2 and 10 mM Tris, and pH of 7.5-8.

TABLE-US-00001 TABLE 1 PCR primers for verification of targeted sites Name of primers Sequence pptA-F TAACCCAACCCCTCACTTCACCT SEQ ID NO: 25 pptA-R TGGAGACGTATTCCAGGAAGGCT SEQ ID NO: 26 brnA-F TGTTTGGATCTGATGCCGAGGC SEQ ID NO: 27 brnA-R GGCTTGACGCTGATCTTGGT SEQ ID NO: 28 fwnA-F GACCAATGACAAGACTCTGTGGGT SEQ ID NO: 29 fwnA-R TCTTCTTCCCCTCCGCAGTGAC SEQ ID NO: 30 kusA-F TCAAATGCGCCTATCACTTCATGC SEQ ID NO: 31 kusA-R CCGCCGGTTAATACGATGTCATAT SEQ ID NO: 32 amyA-F GCAGGGCATCATCGACAAGGT SEQ ID NO: 33 amyA-R GGTGGTATCGAGATCAGGCAAGG SEQ ID NO: 34 pepA-F TCCATCATGACGGCTGCCA SEQ ID NO: 35 pepA-R CGAACTCGGAGCTGATCTTGC SEQ ID NO: 36 ammA-F GACGCTGTTCTGTCGCTTTGT SEQ ID NO: 37 ammA-R GATCAGGCAGTATGGGTGGAAGT SEQ ID NO: 38

TABLE-US-00002 TABLE 2 Sequence of tRNA Name Sequence tRNA.sup.Pro GCCCGGGTGGTCTAGTGGTATGATTCTCGCTTAGGGATAC SEQ ID NO: 9  AAACCCAAGCATATCTGCGAGAGGTCCCGCGTTCGATCCG CGGCTCGGGCC tRNA.sup.Ala GGGGCTGTGGTTTAGTGGTATAATATTCCCTTAGCATGGG SEQ ID NO: 10 AGAGGtCCGGGGTTCGATTCCCCGCAGCTCCA tRNA.sup.Gly ACAACCATACGTTAATTGGTAAACTAGTCGTCTTCCAAAC SEQ ID NO: 11 GATAAtTGTGAGTTCGAACCTCACTGGTTGTA tRNA.sup.Thr GCTTCTATGGCTCAGTTGGTAGAGCGCATGACTAGTAATC SEQ ID NO: 12 ATGAGGtCCGCGGTTCGAATCCGCGTGGAAGCA tRNA.sup.Val GGCCGGATGGTGTAGTTGGTtATCACGTATCGTTAACACC SEQ ID NO: 13 GATAAGGtCCTGGGATCGAGCCCCAGTCTGGTCA tRNA.sup.Ser GTCAGTGTGGCCGAGTGGTtAAGGCGATAGACTAGAAATCT SEQ ID NO: 14 ATTGGGTTCGCCCGCACAGGTTCGAGTCCTGTCGCTGACG tRNA.sup.Leu GGCAAGATGGCCGAGTTGGTCCAAGGCGTCAGGTTAAGGT SEQ ID NO: 15 CCACCTTAATACCCAGCTTCACAGCTTCCTGATCATCGTA AGATGGCGTGGGTTCGAATCCCACTCTTGTCA tRNA.sup.Phe GGGGCAATGGCGCATCTGGGAGCGCGTCAGACTGAAGATC SEQ ID NO: 16 TGGAGGtGGCCGGTTCAAGCCCGGCTTGCCCCA tRNA.sup.Lys GCCCGGCTAGCTCAATCGGTAGAGCGTGAGACTCTTAATC SEQ ID NO: 17 TCAAGGcTGCGGGTTCGAGCCCCGCGTTGGGCT tRNA.sup.Glu TCCGATATGGTGTAGTGGCtAACATCGCCGTCTCTCACAC SEQ ID NO: 18 GGCAGCCGGGGGTTCGATTCCCCCTATCGGAG tRNA.sup.Ile GGTCCCATAGCTCAGTTGGTtAGAGCGTGACGCTAATAAC SEQ ID NO: 19 GTCAAAGtCGAGGGTTCGAGCCCCTCTGGGACCA tRNA.sup.Arg GGCCTGCTGGCCCAATGGTAAGGCGCTTGACTACGGATCA SEQ ID NO: 20 AGAGAtTGCAGGTTCGAGTCCTGCGTAGGTCA tRNA.sup.Met AGCATGTTAGCTCAGGGGAAGAGCGCCGGGCTCATAACCC SEQ ID NO: 21 GGAGGtCCCTGGATCGAAACCAGGACATGCTA tRNA.sup.Gln GGTTGTGTAGTGTAATGGTcATCACTCTGGATTCTGATTC SEQ ID NO: 22 CAGCAATCCCGGTTCGATCCCGGGCACGACCT tRNA.sup.Cys GGGCCGGTAGCTCAGGGGTAGAGCGTGGGACTGCAGATCT SEQ ID NO: 23 TAAGGtCACGCGTTCAAATCGCGTTCGGCCCT

Example 1: Construction of Visualized Recombinant Aspergillus niger Strain with Single Gene Editing by Using CRISPR-Cas9

[0052] A CRISPR-Cas9 system included a gene encoding a Cas9 protein (a Cas9 gene), sgRNA and a screening marker.

[0053] (1) Construction of Cas9 Expression Vector

[0054] An Aspergillus promoter PglaA (with a nucleotide sequence as set forth in SEQ ID NO:7) or Ptef1 (with a nucleotide sequence as set forth in SEQ ID NO:6) and other Aspergillus strong promoters were used to express a Cas9 protein (with a nucleotide sequence as set forth in SEQ ID NO:1).

[0055] A ClonExpress® II One Step Cloning Kit (Vazyme) was used, pUC19 was used as a vector framework, an Aspergillus promoter sequence, a gene sequence encoding a Cas9 protein, a resistance gene and an AMA1 (GenBank: X78051.1) sequence were subjected to homologous recombination twice to obtain a Cas9 expression plasmid pUC19-Cas9 (a plasmid map was shown in FIG. 1). A nuclear localization signal (NLS) sequence (CCCAAGAAGAAGCGCAAGGTC, SEQ ID NO:56) was added at a or a C-terminal of a gene encoding a Cas9 protein (as set forth in SEQ ID NO:1).

[0056] (2) Construction of sgRNA Expression Cassette

[0057] A promoter Pu3, a protospacers sequence of a target gene (See Table 3), a gRNA backbone sequence (a nucleotide sequence as set forth in SEQ ID NO:8) and a terminator Tu3 are used to construct an sgRNA expression cassette.

TABLE-US-00003 TABLE 3 Sequence listing of target gene protospacers Target gene Target gene sequence fwnA AGTGGGATCTCAAGAACTAC SEQ ID NO: 39 pptA GGCGGGTGTCGATGTACCAC SEQ ID NO: 40 brnA ACCATGCCAATGGATTCCGG SEQ ID NO: 41 kusA CGAGCACTGGTAGATGATGA SEQ ID NO: 42

[0058] Screening markers included filamentous fungal markers of similar effects as hygromycin B (hygB), orotidine-5′-phosphate dehydrogenase, acetamidase and the like commonly used in Aspergillus. A hygromycin resistance gene in a recombinant plasmid was obtained from a plasmid PAN7-1, expression cassette primers Hyg-F/R were shown in Table 4, and hyg in other resistance replaceable expression cassettes were selected for construction.

TABLE-US-00004 TABLE 4 Listing of primers Name of primers Primer sequence Hyg-F GAATTCCCTTGTATCTCTAC SEQ ID NO: 43 ACACAG Hyg-R TGAAGAACGAATACCGCGAC SEQ ID NO: 44 ATCCAACCCATC

[0059] A ClonExpress® II One Step Cloning Kit (Vazyme) was used and pUC19 was used as a vector framework for recombination with the sgRNA expression cassette to construct an sgRNA expression plasmid (a plasmid map was shown in FIG. 2).

[0060] (3) Transformation of Cas9 Expression Plasmid and sgRNA Expression Cassette

[0061] The Cas9 expression plasmid and the sgRNA expression cassette were transferred into a host by using a protoplast transformation method.

[0062] Aspergillus niger hyphae were cultured in a PDA culture medium overnight and mycelia were collected and washed three times with normal saline; the washed mycelia were enzyme-digested with a Lysozyme for 3 h and filtered with four layers of lens paper to prepare a protoplast; the protoplast was collected by centrifugation at 4° C., and 1,000 rpm and washed 2-3 times with pre-cooled STC; and 100 μL of the prepared protoplast was taken, into which 10 μL of the Cas9 expression plasmid and 10 μL of the sgRNA expression cassette were added and mixed evenly, 2 mL of PEG 6000 was added, and the corresponding resistance was added to the culture medium for screening. The culture was conducted at 30° C. for 5-7 d, a genome of a transformant was extracted, and editing of a targeting site of a target gene was verified by PCR.

[0063] A positive single colony was picked and transferred to a plate, and each single colony was transferred three times (that is, a single colony was picked to a new culture medium for culture).

[0064] A spore color of a starting strain of Aspergillus niger CCTCC M 2018881 (the strain has been disclosed in the patent application document with the publication number of CN110438018A) was used as a control, changes in a color phenotype of Aspergillus niger spores after transformation were observed, after fwnA or pptA were destroyed, a spore color was changed from brown to white, and after brnA was destroyed, the spore color was changed from brown to olive (See FIG. 4). When a non-phenotypic change gene kusA was destroyed, phenotypes of microorganisms did not change. A spore color change transformant had significantly improved gene editing efficiency, where, a color mutant strain accounted for 14%, the color mutant strain has gene editing efficiency of brnA for 30% and editing efficiency of fwnA or pptA for 100% and editing efficiency of kusA for 4.16%.

Example 2: Visualized Screening for Recombinant Aspergillus niger Strain with Double Gene Editing

[0065] (1) Construction of Cas9 Expression Vector

[0066] The specific implementation referred to step (1) in Example 1.

[0067] (2) Construction of sgRNA Expression Cassette

[0068] A Pu3 mutant promoter (to facilitate assembly of multiple sgRNAs, a BsaI site related with the sgRNAs was mutated to facilitate subsequent assembly, specifically a BsaI site mutation of a nucleotide sequence of the Pu3 promoter sequence as set forth in SEQ ID NO:2 was mutated from GAGACC to ACCCAC), target gene protospacers sequences pptA, fwnA and brnA (See Table 1), an amyA sequence (See Table 5), an sgRNA expression cassette realized by using tRNA.sup.Gly, a gRNA backbone sequence (with a nucleotide sequence as set forth in SEQ ID NO:8), a terminator Tu3 (with a nucleotide sequence as set forth in SEQ ID NO:4) were used to construct the sgRNA expression cassette.

TABLE-US-00005 TABLE 5 Sequence listing of target gene protospacers Target gene Target gene sequence amyA TCTCTTCGGCCCTTCATGAG SEQ ID NO: 45

[0069] Screening markers included filamentous fungal markers of similar effects as hygromycin B (hygB), orotidine-5′-phosphate dehydrogenase, acetamidase and the like commonly used in Aspergillus. A hygromycin resistance gene in a recombinant plasmid was obtained from a plasmid PAN7-1, expression cassette primers Hyg-F/R were shown in Table 3, and hygB in other resistance replaceable expression cassettes were selected for construction.

[0070] A ClonExpress® II One Step Cloning Kit (Vazyme) was used, pUC19 was used as a vector framework, an Aspergillus promoter sequence, a gene sequence encoding a Cas9 protein, a resistance gene and an AMA1 sequence were subjected to homologous recombination twice to pUC19 to obtain a Cas9 expression plasmid pUC19-Cas9 (a plasmid map was shown in FIG. 1). A nuclear localization signal (NLS) sequence (CCCAAGAAGAAGCGCAAGGTC, SEQ ID NO:56) was added to a N-terminal or a C-terminal of a gene encoding a Cas9 protein (as set forth in SEQ ID NO:1).

[0071] A ClonExpress® II One Step Cloning Kit (Vazyme) was used, pUC19 was used as a vector framework, an sgRNA expression cassette was recombined to the pUC19 to construct a double sgRNA expression plasmid PUC19-sgRNA-1 plasmid containing the sgRNA expression cassette with two protospacers sequences, and tRNA.sup.Gly was used to release different sgRNAs. The sgRNA expression cassette included a visualized gene sgRNA and a non-phenotypic sgRNA, and the visualized gene sgRNA was pptA-sgRNA, fwnA-sgRNA or brnA-sgRNA, and the other non-phenotypic gene sgRNA was amyA-sgRNA (a plasmid map was shown in FIG. 3).

[0072] (3) Transformation of Cas9 Expression Plasmid and sgRNA Expression Cassette

[0073] The Cas9 expression plasmid and the double sgRNA expression cassette (including any one of pptA-sgRNA and amyA-sgRNA or fwnA-sgRNA and amyA-sgRNA, or brnA-sgRNA and amyA-sgRNA) were transferred into a host by protoplast transformation, and the sgRNA was directly connected with the tRNA to construct a strain containing the double sgRNA expression cassette.

[0074] Aspergillus niger hyphae were cultured in a PDA culture medium overnight and mycelia were collected and washed three times with normal saline; the washed mycelia were enzyme-digested with a Lysozyme for 3 h and filtered with four layers of lens paper to prepare a protoplast; the protoplast was collected by centrifugation at 4° C., and 1,000 rpm and washed 2-3 times with pre-cooled STC; and 100 μL of the prepared protoplast was taken, into which 10 μL of the Cas9 expression plasmid and 10 μL of the sgRNA expression cassette were added and mixed evenly, 2 mL of PEG 6000 was added, and the corresponding resistance was added to the culture medium for screening. The culture was conducted at 30° C. for 5-7 d and a single colony transformant of white spores were picked for sequencing verification.

[0075] A spore color of a starting strain of Aspergillus niger CCTCC M 2018881 was used as a control and changes of color phenotypes of Aspergillus niger spores after transformation were observed. After fwnA was knocked out, the spore color changed from black to white, a total of 4% of single colony on a plate showed white, the white single colony was directly picked, and the results showed that in the white single colony, a homozygous transformant with double-copy destroy of an amyA gene accounted for 25% and a positive selection rate of a transformant with multigene editing was improved. Editing of the double copies of the amyA gene did not require new resistance markers, which was beneficial to industrial production.

Comparative Example 1

[0076] A same method was used as Example 2, a single-copy recombinant strain with gene amyA editing was constructed. A same method was used, the recombinant strain was cultured until a single colony was grown, the single colony was picked and gene editing efficiency was calculated. The gene editing efficiency was 5%.

Example 3: Visualized Screening for Recombinant Aspergillus niger Strain with Multigene Editing

[0077] The specific implementation referred to Example 2. The difference was that tRNA.sup.Gly behind a promoter in Example 2 was replaced by tRNA.sup.Ala and a second tRNA was replaced by tRNA.sup.Phe.

[0078] The tRNA.sup.Ala and the tRNA.sup.Phe were used to ligate with different sgRNAs. A visualized gene sgRNA expression cassette was a fwnA-sgRNA expression cassette and the other non-phenotypic gene sgRNA expression cassette was an amyA-sgRNA expression cassette (a plasmid map was shown in FIG. 3).

[0079] A spore color of a starting strain of Aspergillus niger CCTCC M 2018881 was used as a control and changes in color phenotypes of Aspergillus niger spores after transformation were observed. After fwnA was knocked out, the spore color changed from black to white, 36% of transformants had a white phenotype, the white single colony was directly picked, a positive selection rate of a transformant with multigene editing was improved, time for strain purification was saved, and the amyA gene editing efficiency was 90%. Editing of the amyA gene did not require new resistance markers, which was beneficial to industrial production.

Comparative Example 2

[0080] A same method was used as Example 3, a recombinant strain with double gene fwnA and amyA editing was constructed by using tRNA.sup.Gly. A same method was used, the recombinant strain was cultured until a single colony was grown, the single colony was picked and gene editing efficiency was calculated. The results showed that 6% was a white mutant and the amyA gene editing efficiency was 36%.

Comparative Example 3

[0081] A same method was used as Example 3, a recombinant strain with fwnA and amyA gene editing was constructed by using tRNA.sup.Ala. A same method was used, the recombinant strain was cultured until a single colony was grown, the single colony was picked and gene editing efficiency was calculated. The results showed that 37% was a white mutant and the amyA gene editing efficiency was 70%.

Comparative Example 4

[0082] A same method was used as Example 3, a single copy recombinant strain with gene fwnA and amyA editing was constructed by using tRNA.sup.Phe. A same method was used, the recombinant strain was cultured until a single colony was grown, the single colony was picked and gene editing efficiency was calculated. The results showed that 15% was a white mutant and the amyA gene editing efficiency was 80%.

Example 4: Visualized Multi-Phenotype Screening for Recombinant Aspergillus Niger Strain with Gene Editing

[0083] The specific implementation referred to Example 2. The difference was that the amyA gene in Example 2 was replaced by pepA or ammA (sequence listing of protospacers was shown in Table 6), the tRNA.sup.Gly behind a promoter in Example 2 was replaced by tRNA.sup.Ala and a second tRNA was replaced by tRNA.sup.Arg

TABLE-US-00006 TABLE 6 Sequence listing of target gene protospacers Target gene Target gene sequence pepA CGGTGTCAAAGTCCAGATGG SEQ ID NO: 46 ammA CTGCCCCAGGATACTGCTGA SEQ ID NO: 47

[0084] The tRNA.sup.Ala and the tRNA.sup.Arg were used to release different sgRNAs. A visualized gene sgRNA expression cassette was a fwnA-sgRNA expression cassette and the other non-phenotypic sgRNA expression cassette was a pepA-sgRNA expression cassette or an ammA-sgRNA expression cassette (a plasmid map was shown in FIG. 3B).

[0085] The Cas9 expression plasmid and the sgRNA expression cassette were transferred into a host and obtained by sequencing.

[0086] A spore color of a starting strain of Aspergillus niger CCTCC M 2018881 was used as a control and changes in color phenotypes of Aspergillus niger spores after transformation were observed. After fwnA was knocked out, the spore color changed from black to white, a white single colony was picked, the gene editing efficiency was calculated, and the pepA or ammA gene editing efficiency was 75% and 80% respectively. The method was beneficial to perform an in-vivo screening for an active protospacers sequence of a target gene of Aspergillus niger, and saved time and cost of molecular operation.

Example 5: Visualized Multi-Phenotype Screening for Recombinant Aspergillus Niger Strain with Gene Editing

[0087] The specific implementation referred to Example 2. The difference was that the amyA gene in Example 2 was replaced by ammA, at the same time, a third amyA-sgRNA (sequence listing of protospacers was shown in Table 7) was ligated with tRNA.sup.Ala, the tRNA.sup.Gly behind a promoter in Example 2 was replaced by tRNA.sup.Ala and a second tRNA was replaced by tRNA.sup.Phe.

TABLE-US-00007 TABLE 7 Sequence listing of target gene protospacers Target gene Target gene sequence ammA CTGCCCCAGGATACTGCTGA SEQ ID NO: 48 amyA TCTCTTCGGCCCTTCATGAG SEQ ID NO: 49

[0088] The tRNA.sup.Ala, the tRNA.sup.Arg and the tRNA.sup.Phe were used to release different sgRNAs. A visualized gene sgRNA was fwnA-sgRNA and the other two non-phenotypic gene sgRNAs were pepA-sgRNA and ammA-sgRNA, respectively.

[0089] The Cas9 expression plasmid and the sgRNA expression cassette were transferred into a host and obtained by sequencing.

[0090] A spore color of a starting strain of Aspergillus niger CCTCC M 2018881 was used as a control and changes in color phenotypes of Aspergillus niger spores after transformation were observed. After fwnA was knocked out, the spore color changed from black to white. In an optimized three-gene knockout white transformant, the ammA gene editing efficiency was 50%, the amyA gene editing efficiency was 100% and the double gene co-editing efficiency was 50%.

[0091] The method was beneficial to perform an in-vivo screening of an active protospacers sequence of multiple target genes of Aspergillus niger, and saved time and cost of molecular operation.

Example 6: Visualized Multi-Phenotype Screening for Recombinant Aspergillus Niger Strain with Gene Editing

[0092] The specific implementation referred to Example 2. The difference was that the amyA gene in Example 2 was replaced by ammA, the tRNA.sup.Gly behind a promoter in Example 2 was replaced by tRNA.sup.Ala and a second tRNA.sup.Gly was replaced by tRNA.sup.Phe; and at the same time, an sgRNA expression cassette was added, tRNA.sup.Ile was used for release, and a Pu6 promoter (with a nucleotide sequence as set forth in SEQ ID NO:3) and a Tu6 terminator (with a nucleotide sequence as set forth in SEQ ID NO:5) were used to express tRNA.sup.Ile and ammA-sgRNA.

[0093] The tRNA.sup.Ala, the tRNA.sup.Arg and the tRNA.sup.Phe were used to release different sgRNAs. A visualized gene sgRNA expression cassette was fwnA-sgRNA and the other two non-phenotypic gene sgRNAs were ammA-sgRNA and amyA-sgRNA.

[0094] The Cas9 expression plasmid and the sgRNA expression cassette were transferred into a host and subjected to sequencing verification.

[0095] A spore color of a starting strain of Aspergillus niger CCTCC M 2018881 was used as a control and changes in color phenotypes of Aspergillus niger spores after transformation were observed. After fwnA was knocked out, the spore color changed from black to white. In an optimized three-gene knockout white transformant, the ammA gene editing efficiency was 69%, the amyA gene editing efficiency was 100% and the two gene co-editing efficiency was 69%. The method was beneficial to perform an in-vivo screening of an active protospacers sequence of multiple target genes of Aspergillus niger, and saved time and cost of molecular operation.

[0096] Although the disclosure has been disclosed as above in the preferred examples, it is not intended to limit the disclosure. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the disclosure. Therefore, the protection scope of the disclosure should be as defined in the claims.