OMEGA-TRANSAMINASE MUTANT OBTAINED BY DNA SYNTHETIC SHUFFLING COMBINED MUTATION AND USE

Abstract

The present invention discloses a ω-transaminase mutant obtained through DNA synthetic shuffling combined mutation. The ω-transaminase mutant is obtained through point mutation of a wild type ω-transaminase from Aspergillus terrus. The amino acid sequence of the wild type ω-transaminase is shown in SEQ ID NO: 1. The mutation site of the ω-transaminase mutant is any one of: (1) F115L-H210N-M150C-M280C; (2) F115L-H210N; (3) F115L-H210N-E253A-I295V; (4) I77L-F115L-E133A-H210N-N245D; (5) I77L-Q97E-F115L-L118T-E253A-G292D; (6) I77L-E133A-N245D-G292D; and (7) H210N-N245D-E253A-G292D. According to the present invention, forward mutations obtained in the previous stage are randomly combined through a DNA synthetic shuffling combined mutation method. It is verified through experiments that this method can effectively improve the probability of forward mutation and increase experimental efficiency and feasibility, and is capable of obtaining mutant enzymes with thermodynamic stability remarkably superior to that of wild enzymes via screening.

Claims

1. A ω-transaminase mutant obtained by DNA synthetic shuffling combined mutation, wherein the ω-transaminase mutant is obtained by point mutation of a wild type ω-transaminase from Aspergillus terrus, the amino acid sequence of the wild type ω-transaminase is shown in SEQ ID NO:1, and the mutation site of the ω-transaminase mutant is any one of: (1) F115L-H210N-M150C-M280C; (2) F115L-H210N; (3) F115L-H210N-E253A-I295V; (4) I77L-F115L-E133A-H210N-N245D; (5) I77L-Q97E-F115L-L118T-E253A-G292D; (6) I77L-E133A-N245D-G292D; and (7) H210N-N245D-E253A-G292D.

2. A method for catalyzing (R)-(+)-α-methylbenzylamine to produce acetophenone comprising the step of utilizing the ω-transaminase mutant according to claim 1.

3. A method for catalyzing (R)-(+)-α-methylbenzylamine to produce acetophenone comprising the step of using the ω-transaminase mutant according to claim 1 as a catalytic enzyme, wherein a reaction system comprises a substrate solution and an enzyme solution added into the substrate solution, the substrate solution and the enzyme solution being added in a volume ratio of 9:1, wherein the substrate solution comprises: 2.5 mM (R)-(+)-α-methylbenzylamine, 2.5 mM pyruvic acid and 0.1 mM PLP; the enzyme solution comprises 0.3 mg/mL catalytic enzyme; a reaction temperature is 25-55° C., and pH is 8.0.

4. A gene encoding the ω-transaminase mutant according to claim 1.

5. The gene according to claim 4, wherein the nucleotide sequences are those of SEQ ID NOs: 3-9.

6. A method for catalyzing (R)-(+)-α-methylbenzylamine to produce acetophenone comprising the step of utilizing the gene according to claim 4.

7. A recombinant expression vector containing the gene according to claim 4.

8. A genetically engineered bacterium containing the recombinant expression plasmid according to claim 7.

9. A method for catalyzing (R)-(+)-α-methylbenzylamine to produce acetophenone comprising the step of utilizing the genetically engineered bacterium according to claim 8.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0017] FIG. 1 is a diagram of a catalytic process in which a ω-transaminase depends on coenzyme pyridoxal phosphate (PLP) to reversely catalyze the transfer of amino groups to prochiral ketones to prepare chiral amine compounds.

[0018] FIG. 2 is a flowchart of DNA synthetic shuffling combined mutation and solid plate screening.

[0019] FIG. 3 is an SDS-PAGE electrophoretic analysis result graph of mutants, in which lanes are respectively as follows: M: protein marker; 1: F115L-H210N-E253A-I295V, 2:H210N-N245D-E253A-G292D, 3: I77L-E133A-N245D-G292D, 4:I77L-Q97E-F115L-L118T-E253A-G292D, 5: I77L-F115L-E133A-H210N-N245D, 6:F115L-H210N; and 7: F115L-H210N-M150C-M280C.

[0020] FIG. 4 shows half-life period t.sub.1/2 results of different mutant enzymes and wide type enzymes in example 1.

[0021] FIG. 5 shows half-inactivation temperature T.sub.50.sup.10 results of different mutant enzymes and wide type enzymes in example 1.

[0022] FIG. 6 shows pyrolysis folding results T.sub.m of transaminases and mutant enzymes thereof measured by a differential fluorescence scanning method.

DETAILED DESCRIPTION OF THE EMBODIMENTS

Example 1

[0023] 1. Experimental Materials

[0024] (1) LB culture medium: 10 g/L tryptone (available from Oxoid), 5 g/L yeast powder (available from Oxoid), 10 g/L sodium chloride (available from Shenggong Bioengineering Co., Ltd. (Shanghai)), and pH 7.0. LB solid culture medium: 2% (mass percent) agar powder was added into an LB liquid culture medium.

[0025] Sodium chloride, glycerol, calcium chloride, imidazole, glacial acetic acid, disodium hydrogen phosphate, sodium dihydrogen phosphate, 5-pyridoxal phosphate, a Coomassie brilliant blue protein concentration determination kit, a Ni-NTA chromatography medium, isopropyl-β-D-thiogalactoside (IPTG), kanamycin sulfate, horseradish peroxidase, ampicillin, DNA and protein Marker were available from Shenggong Bioengineering Co., Ltd. (Shanghai). In the present invention, the ω-transaminase gene (ω-TA gene) optimized by codons was entrusted to Universal Biosystems (Anhui) Co., Ltd. for full gene synthesis, and the pET-21a plasmid was used as a cloning vector in the gene synthesis service.

[0026] (2) Dimethyl sulfoxide (DMSO), pyruvic acid, (R)-(+)-α-methylbenzylamine, 3,3-diaminobenzidine tetrahydrochloride hydrate (DAB) were available from Aladdin Biochemical Technology Co., Ltd. The PrimeSTAR Max DNA polymerase was available from TaKaRa Company; a nucleic acid transfer membrane (imprinting membrane) was available from GE Healthcare Company, and DpnI was available from Thermo Scientific Company.

[0027] (3) Formula of buffer:

[0028] 20 mmol/L elution buffer: 50 mmol/L sodium dihydrogen phosphate, 300 mmol/L sodium chloride, 20 mmol/L imidazole, and pH 8.0; 50 mmol/L elution buffer: 50 mmol/L sodium dihydrogen phosphate, 300 mmol/L sodium chloride, 50 mmol/L imidazole, and pH 8.0; 100 mmol/L elution buffer: 50 mmol/L sodium dihydrogen phosphate, 300 mmol/L sodium chloride, 100 mmol/L imidazole, and pH 8.0; 250 mmol/L elution buffer: 50 mmol/L sodium dihydrogen phosphate, 300 mmol/L sodium chloride, 250 mmol/L imidazole, and pH 8.0.

[0029] Gel dyeing solution: 45.4 mL of methanol, 9.2 mL of glacial acetic acid and 0.05 g of Coomassie brilliant blue R250 were dissolved into 100 mL of deionized water; gel decolorizing solution: 5 mL of methanol and 7.5 mL of glacial acetic acid were dissolved into 100 mL of deionized water; electrophoretic buffer: 3.03 g of Tris, 14.4 g of glycine and 1 g of SDS were metered with deionized water until a constant volume of 1 L was reached, suction filtration was conducted with 0.22 μm filter paper, and refrigeration was performed at 4° C.

[0030] 2. Combined Mutation

[0031] Forward mutations obtained in the previous stage were randomly combined through DNA synthetic shuffling by using a combined mutation method so as to further improve the thermal stability of transaminase. Oligonucleotide primers for creating a combinatorial gene library are based on a method described by Ness, etc., and allow any required mutations by using degenerate codons, wherein the degenerate base S represents G/C, N represents A/T/C/G, R represents A/G, M represents A/C, K represents G/T, and Y represents C/T.

TABLE-US-00001 TABLE 1 Combined mutation primers and sequences thereof Primer name Sequence 5′-3′ F1 ATGGCCAGTATGGATAAGGTTTTTGCAGGCTAT GCTGCCCGTCAAGCAATC F2 CCCGTTTGCCAAAGGAATTGCCTGGGTCGAAGG GGAACTCGTTCCTTTAGCTGAAGCACG F3 GCTTCATGCACTCCGATCTGACCTACGACGTAC CGTCTGTTTGGGATGGGCGATTTTTTC F4 TGGAAGCAAGCTGCACCAAGCTGAGGCTGCGTC TACCCTTACCACGTGATSAAGTTAAAC F5 AATCTGGTATTCGGGATGCATTNGTTGAATTGA TAGTCACCCGCGGTCTTAAAGGGGTGC F5-a AATCTGGTATTCGGGATGCATTNGTTGAAACGA TAGTCACCCGCGGTCTTAAAGGGGTGC F6 TAGTGAACAACCTGTACATGTTTGTGCAGCCGT ACGTGTGGGTTATGGAGCCGGATATGC F6-a TAGTGAACAACCTGTACATGTTTGTGCAGCCGT ACGTGTGGGTTTGCGAGCCGGATATGC F7 TGGTGGCTAGGACCGTCCGCCGGGTACCACCGG GCGCTATTGATCCGACCGTCAAGAATC F8 TGTTCGTGGAATGTTTGAAGCGGCTGATCGTGG CGCAACATATCCCTTCCTTACCGACGG F9 GATCGGGTTTTAATATAGTATTAGTCAAAGATG GCGTCCTGTATACGCCAGATCGCGGGG  F10 AGTCCGTTATCRACGCTGCTGAAGCCTTTGGAA TAGMAGTGCGGGTTGAGTTCGTTCCAG  F11 TGACGAGATTTTCATGTGCACGACGGCGGGTGG CATTATGCCTATCACAACATTGGACGG F11-a TGACGAGATTTTCATGTGCACGACGGCGGGTGG CATTTGCCCTATCACAACATTGGACGG  F12 AARTTGGGCCTATTACGAAAAAAATATGGGACG GTTATTGGGCGATGCATTATGACGCCG R1 CAATTCCTTTGGCAAACGGGTTCGTAGTTTCGG TACTTTCTAAGATTGCTTGACGGGCAG R2 CAGATCGGAGTGCATGAAGCCCTGATCGAGGAG TGGAATGCGTGCTTCAGCTAAAGGAAC R3 GTGCAGCTTGCTTCCAGGCGTGTAAKATGATCA TCTAAACGAAAAAATCGCCCATCCCAA R4 CATCCCGAATACCAGATTTTGCGACCATTTCCA CCAGGATTTGTTTAACTTSATCACGTG R5 CATGTACAGGTTGTTCACTATATCTKCCGGACG AGTTCCTCGCACCCCTTTAAGACCGCG R6 GCGGACGGTCCTAGCCACCACTGCGCTGCCGCC TACGCGCTGCATATCCGGCTCCATAAC R6-a GCGGACGGTCCTAGCCACCACTGCGCTGCCGCC TACGCGCTGCATATCCGGCTCGCAAAC R7 CTTCAAACATTCCACGAACAAGATCACCCCACT GAAGATTCTTGACGGTCGGATCAATAG R8 TACTATATTAAAACCCGATCCTTCAGTCAGGTK CGCATCGCCGTCGGTAAGGAAGGGATA R9 GCAGCGTYGATAACGGACTTGCGAGTCACTCCC TGCAGCACCCCGCGATCTGGCGTATAC  R10 GCACATGAAAATCTCGTCACACCGGTAGGCCAG CTCAACTGGAACGAACTCAACCCGCAC  R11 TTTCGTAATAGGCCCAAYTTGCCCAYCATTTAC AGGCATACCGTCCAATGTTGTGATAGG  R12 CTAATTTCTCTCATTATAGTCGATCTCGAACGA ATACGCGGCGTCATAATG ATA-F GGCTAGCATGACTGGTGGACATGCACCACCACC ACCACCACATGGCCAGTATGGATAAGGTTTTTG ATA-R GAGTGCGGCCGCAAGCTTGTCTAATTTCTCTCA TTATAGTCGATCTCGAAC PET-21a-F ACAAGCTTGCGGCCGCAC PET-21a-R GTCCACCAGTCATGCTAGCCATATG Notes: the underline represents a mutation site, a primer name with F represents an upstream primer, and a primer name with R represents a downstream primer.

[0032] The mutation library and complete target gene fragments were obtained by three-step independent PCR (two-step assembling PCR and one-step amplification PCR), then connecting PCR products with a pET-21a vector through primer seamless cloning and transferring the connected product into competent Escherichia coli BL21(DE3) (containing pRST-DAAO plasmids)

[0033] (1) The first-step PCR used primers (F1-R12) in Table 1, each group of PCR used four adjacent oligonucleotide primers (two forward primers and two reverse primers), a PCR amplification system: 25 μL of PrimeSTAR Max Premix 2×; 0.4 μL of inner primer (10 μM), 2 μL of outer primer (10 μM), and ultrapure water sterilized at high temperature was supplemented so that a total volume was 50 μL. PCR amplification conditions: denature for 20 seconds at 98° C., anneal for 15 seconds at 55° C., extend for 30 seconds at 72° C., and 30 cycles. 5 μL of PCR product was evenly mixed with loading buffer and then tested via 1% agarose gel electrophoresis, and then 5 μL of each of 11 groups of PCR products obtained was taken respectively and mixed, and then purified through a PCR product purification kit.

[0034] (2) There were about 60 bp of overlaps between every adjacent two groups of PCR products in the first step, and PCR in the second step was to assemble the mixed fragments into a complete target gene. A 50 μL PCR amplification system contained 10 μL of purified PCR product mixture, 25 μL of PrimeSTAR Max Premix 2× and 15 μL of ultrapure water sterilized at high temperature. PCR amplification conditions: denature for 30 seconds at 94° C., extend for 120 seconds at 68° C., and 20 cycles. The PCR product was purified by a purification kit.

[0035] (3) After the assembling in the second step, primers were designed online so that there were about 15-20 bp of transaminases between the primers and the target genes and between the primers and the vectors, and the primers were further designed to add histidine tags at the N end of the protein. According to the primer ATA-F, ATA-R was subjected to third-step PCR, so as to increase the quantity of reassembled complete genes. PCR amplification system: 25 μL of PrimeSTAR Max Premix 2×; 2 μL of upstream primer (10 μM), 2 μL of downstream primer (10 μM), 1 μL of PCR product template (100 ng/μL), and ultrapure water sterilized at high temperature was added so that a total volume was 50 μL. PCR amplification conditions: denature for 1 min at 98° C.; denature for 20 seconds at 98° C., anneal for 15 seconds at 55° C., extend for 2 min at 72° C., and 30 cycles; extend for 7 min at 72° C. The PCR products were correctly detected by electrophoresis.

[0036] (4) pET-21a vector PCR: pET-21a-R was subjected to vector PCR using primer pET-21a-F so that the vector was linearized and there was a 15-′20 bp homologous arm between the vector and the target gene. PCR amplification system: 25 μL of PrimeSTAR Max Premix 2×; 2 μL of upstream primer (10 μM), 2 μL of downstream primer (10 μM), 1 μL of plasmid template (10 ng)/μL), and ultrapure water sterilized at high temperature was added so that a total volume was 50 μL. PCR amplification conditions: denature for 1 min at 98° C.; denature for 20 seconds at 98° C., anneal for 15 seconds at 55° C., extend for 2 min at 72° C., and 30 cycles; extend for 7 min at 72° C. PCR products were correctly detected by electrophoresis and recycled by a gel recycle kit. The methylated mother template in the obtained gel recycled product was identified by using Dpn I and degraded. Digestion reaction: 17 μL of PCR product, 2 μL of Buffer and 1 μL of Dpn I. Digest for 2 hours at 37° C.

[0037] (5) Homologous recombination: a target gene was ligated with a linearized vector. Cloning vector usage=[0.02× logarithm of cloning vector base]ng (0.03 pm), inserted fragment usage=[0.04×logarithm of cloning vector base]ng (0.03 pm). 10 μL of recombination reaction system was prepared on ice: 2 μL of pET-21a linearized vector (100 ng/μL), 2 μL of target gene fragment (40 ng/μL), 5 μL of ClonExpress Mix 2×, 1 μL of ddH.sub.2O. Reconstitution conditions: ligate for 30 min at 50° C., decrease the temperature to 4° C., or immediately cool on ice.

[0038] The ligation product was transferred into E. coli BL 21 competent cells (containing pRSF DAAO plasmids) by using a heat shock method.

[0039] 3. Preparation of Competent Escherichia coli BL21 (DE3) Containing Single Plasmid pRSF-DAAO

[0040] (1) The fresh Escherichia coli single colonies were picked and inoculated into 5 mL of LB liquid culture medium and cultured overnight at 37° C. and 160 r/min until OD.sub.600 was about 0.6-0.8.

[0041] (2) 2 mL of the above culture solution was inoculated into 200 mL of LB liquid culture medium in a ratio of 1% (v/v), and cultured for 2 h at 37° C. and 180 r/min until OD.sub.600 was about 0.4.

[0042] (3) The culture solution was placed for 0.5 h in an ice-water bath, and centrifuged for 10 min at 4° C. and 4500 r/min to collect bacteria.

[0043] (4) The bacterial cells were re-suspended with 10 mL of pre-cooled 10 mM CaCl.sub.2, placed for 15 min in ice-water bath, and centrifuged for 10 min at 4° C. and 4500 r/min to collect bacteria.

[0044] (5) Step (4) was repeated.

[0045] (6) 6 mL of pre-cooled 10 mM CaCl.sub.2 solution (containing 15% glycerol) was added into the bacteria. The bacterial cells were re-suspended, placed for 3-5 min on ice, packaged into sterile EP tubes, and then stored in a −80° C. refrigerator.

[0046] 4. Construction of Mutation Library

[0047] E. coli BL 21 competent cells (containing pRSF-DAAO plasmids) deposited at −80° C. were taken and thawed on ice, then a homologous recombinant ligation product solution (5-10 μL) was added, the above substances were gently and evenly shaken and then placed for 30 min on ice. The obtained mixture was subjected to heat shock for 90 seconds in water bath at 42° C., and then quickly placed on ice to be fully cooled for 3 min. 0.8 mL of LB liquid culture medium was into the tube to culture for 1 hour at 37° C. so that the bacteria were restored to be in a normal growth state, and kanamycin resistance and ampicillin resistance genes encoded by double plasmids were expressed. 100 μL of bacterial solution was taken and evenly coated on an LB plate (containing 50 μg/mL kanamycin and 100 μg/mL ampicillin) covered with a Hybond-N imprinting membrane, the front surface of the plate was placed upward for 0.5 hour. After the bacterial solution was completely absorbed by the culture medium, the plate was reversely placed, and the bacterial solution was cultured for 16 hours at 37° C. The membrane was imprinted on a motherboard so that the bacteria continued to grow for 12 hours at 37° C., and then stored in a 4° C. refrigerator. Then, the membrane was transferred to an LB plate containing 0.2 mm isopropyl-β-D-thiogalactoside (IPTG), 50 μg/mL kanamycin and 100 μg/mL ampicillin, and put in a 25° C. incubator to culture for 20 hours, and then the membrane was stored in −80° C. refrigerator.

[0048] The single colony was randomly picked from the above plate and inoculated into 5 mL of LB culture medium containing 50 μg/mL kanamycin and 100 μg/mL ampicillin, cultured for 3-4 hours at 37° C. and 200 r/min. 1-2 ul of bacterial solution was diluted by 100 volumes, and the bacterial solution was subjected to PCR for 10-15 min in boiling water bath to verify the existence of double plasmids. pET21a-ATA (Colony-F/R) and pRSF-DAAO (DAA0-F/R) plasmids were used as templates to design a primer colony PCR system as follows: 25 μL of PrimeSTAR Max Premix 2×; 1 μL of upstream primer (10 μM), 1 μL of downstream primer (10 μM), 2 μL of template, and ultrapure water sterilized at high temperature was supplemented so that a total volume was 50 μL. Electrophoresis detection was conducted with 1% agarose gel.

[0049] 5. Primary Screening and Secondary Screening of Mutation Library

[0050] The pre-screening solution containing horseradish peroxidase (0.1 mg/mL), pyruvic acid (0.2 mg/mL) and 50 mM PBS (pH 8.0) was pre-soaked on filter paper. An NC membrane was paved on the filter paper and placed for 1 h at room temperature. The membrane was frozen with liquid nitrogen and then transferred to pre-soaked filter paper, which contained the colorimetric assay solution: 1×3,3′-diaminobenzidine tablets (Maclin), 10 mM substrate, horseradish peroxide enzyme (0.1 mg/mL) and 50 mM PBS (pH 8.0). The membrane was placed at room temperature. The change in color can be observed over time.

[0051] The single colonies whose colors changed on a corresponding mother plate were picked with a sterile toothpick and inoculated into a 96-well deep plate containing 1 mL of LB culture solution (containing 50 mg/mL and 100 mg/mL kanamycin) per well one by one, cultured for 8 hours at 37° C. and 200 r/min until the later stage of exponential growth was reached. 2004, of bacterial solution was taken from each well of the mother plate and inoculated into the corresponding well of a seed plate, 100 μL of glycerin (50%) was added into each well, and the above bacterial solution was evenly mixed and stored in a −80° C. medical refrigerator. The remaining bacterial solution in each well of the mother plate was supplemented with 200 μL of LB culture solution (containing 2.5 mM IPTG), induced for 20 hours at 25° C. and 150 r/min. After induction was ended, the mother plate was centrifuged for 120 min at 4500 r/min, and the bacteria were collected. The bacteria were washed twice with PBS (pH 8.0) buffer and centrifuged under the same conditions, and the supernatant was discarded. After being frozen overnight in an ultra-low temperature refrigerator, the mother plate was thawed for 30 min at room temperature, frozen for 20 min at an ultra-low temperature, and the freezing-thawing was repeated for three times. 250 μL of lysozyme (5 mg/mL) was added into each well of the mother plate to re-suspend the bacteria. The mother plate was subjected to constant-temperature incubation for 30 min at 37° C. and 200 r/min to fully lyse the cells to release intracellular enzymes, and then centrifuged for 10 min (4500 r/min) to separate a crude enzyme solution from the bacteria.

[0052] 80 μL of supernatant (crude enzyme solution) was taken from each well of the mother plate and placed in the corresponding well of a 96-well microplate, and the 96-well microplate was sealed with a membrane and put in a PCR instrument to conduct constant-temperature treatment for 10 min at 50° C. and placed for 10 min in an ice bath. Each 20 μL of crude enzyme solution was mixed with 180 μL of substrate solution, and the enzyme activity of the crude enzyme solution for catalytic transamination reaction before and after thermal treatment was detected by a microplate reader, and the enzyme activity of a corresponding enzyme not subjected to thermal treatment was defined as 100%. The residual enzyme percentage of the crude enzyme solution subjected to thermal treatment was calculated, and mutons whose residual enzyme activity percentages were higher than those of wild types were selected. Finally, forward mutons whose residual enzyme activity percentages were on TOP10 were selected, activated and then sent to Anhui General Biological Company for sequencing and analysis.

[0053] 6. Expression and Purification of Mutants

[0054] Some forward mutations with higher residual viability were obtained after about 3000 colonies were screened through the plate. E. coli BL 21 competent cells and transaminase mutant plasmids with correct sequencing were placed for 5 min in ice-water bath, 10 μL of plasmids were added into the competent cells, the plasmids and the competent cells were gently and evenly mixed, the obtained mixture was placed for 30 min on ice, subjected to heat shock for 90s in a 42° C. water bath pot and quickly put back for 3 min in ice bath, 600 μL of LB culture medium was added, and the above mixed solution was revived for 50 min at 37° C. and 180 r/min. 1504, of culture medium was evenly coated on a LB solid plate (containing 50 μg/mL kanamycin and 100 μg/mL ampicillin), cultured for 30 min in a 37° C. incubator, and then cultured overnight by reversing the plate.

[0055] The single colonies were picked, inoculated into a tube containing 5 mL of LB liquid culture medium, and cultured overnight at 37° C. and 200 r/min. The cultured bacterial solution was inoculated to 200 mL of LB culture medium containing 50 μg/mL kanamycin and 100 μg/mL ampicillin) in an inoculation amount of 1% ratio (volume ratio), cultured at 37° C. and 200 r/min until the value of OD.sub.600 was 0.4-0.5, at this moment, a proper volume of IPTG (final concentration was 1 mmol/L) was added, the bacterial solution was subjected to induction culture for 18 hours at 16-30° C. and 150-200 r/min, and then the bacteria were collected.

[0056] The collected bacteria were washed twice with phosphate buffer and suspended in 50 ml of cell breaking buffer (50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 20 mM imidazole, and pH 8.0). Under the condition of ice bath, the bacterial cells were broken in a homogenizer. The cell breaking solution was centrifuged for 30 min at 12000 r/min and 4° C., and the supernatant was collected to obtain a crude enzyme solution containing ω-transaminase.

[0057] The crude enzyme solution was separated and purified by Ni-NTA affinity chromatography. After loading, cleaning and eluting, the eluent was collected and dialyzed to remove small molecules to obtain a pure enzyme. After being appropriately diluted, the concentration of the pure enzyme was determined by the Coomassie brilliant blue method. Specific purification steps:

[0058] (1) Equilibrium Ni-NTA affinity chromatography column: the column was washed with 3 column volumes of 20% ethanol, deionized water and 20 mM imidazole buffer, respectively;

[0059] (2) Loading: the crude enzyme solution was sucked with a syringe and filtered with the 0.45 μm filtration membrane, and a recombinant protein with 6 histidine tags was specifically bound to a filler;

[0060] (3) Washing: 2-3 column volumes of 50 mM imidazole buffer, and whether hybrid proteins were completely removed was detected by Bradford solution;

[0061] (4) Eluting: 5 mL of 100 mM elution buffer, and 5 mL of 250 mM elution buffer;

[0062] (5) Storing the column: the column was washed with 3 column volumes of 20 mM imidazole buffer, deionized water and 20% ethanol, respectively, and finally stored in 20% ethanol.

[0063] 7. SDS-PAGE Analysis of Transaminase Mutants

[0064] A protein content standard curve was built by using an improved Bradford protein concentration determination kit to determine the concentration of the pure enzyme. The preparation steps of the protein standard curve refer to an instruction. The molecular weight and purity of the purified protein were identified by SDS-PAGE (12% separation gel and 5% concentrated gel).

[0065] Sample treatment: 40 μL of crude enzyme solution and 10 μL of 5× Protein sampling buffer were evenly mixed, and the obtained mixed solution was placed in boiling water bath for 10 min.

[0066] Loading: 5 μL of protein marker, and 104, of sample.

[0067] Electrophoretic conditions: conduct electrophoresis for about 45 min under the voltage of 170V, stop electrophoresis when bromine phenol blue indicator moved to a position distanced from the edge lower end of gel by about 1 cm.

[0068] Dyeing: a dying solution immersed the gel and heated for 1 min in a microwave oven, and then dying was conducted for 25 min in a shaking table.

[0069] Decolorization: the dyeing solution was recycled, a decolorization solution was used, and the decolorization solution changed every hour until protein bands were clear.

[0070] SDS-PAGE analysis of transaminase mutant 1118T is shown in FIG. 3. The molecular weight of the protein is close to a theoretical molecular weight 36.1 kDa of wild-type enzyme.

[0071] 8. Concentration of Mutant Enzyme

[0072] The molecular weight of the transaminase was about 36.1 kDa. Generally, the molecular weight cut off was between ⅕ and ⅓ of a molecular weight of a target protein. A concentration tube with a molecular weight cut off of 10 kDa was selected.

[0073] Pretreatment of concentration tube: the concentration tube was washed with 20% ethanol, deionized water and PBS buffer (pH 8.0) successively, and centrifuged for 10 min at 4° C. and 4000 r/min.

[0074] Concentration of enzyme: 5 mL of enzyme to be concentrated was added into a concentration tube, centrifuged for 15-20 min at 4° C. and 4000 r/min until the volume of the enzyme solution was about 1 mL. Then, multiple volumes of PBS buffer (pH 8.0) were added, the resulting mixed solution was centrifuged for 20 min at 4° C. and 4000 r/min, and the step were repeated twice. The concentrated enzyme solution in the inner tube was taken and stored at a low temperature.

[0075] Posttreatment of concentration tube: the concentration tube was washed with PBS buffer, deionized water and 20% ethanol successively, centrifuged for 10 min at 4° C. and 4000 r/min, and finally 20% ethanol was added into the inner tube to immerse the upper end of the membrane, and the tube was stored in a 4° C. refrigerator.

[0076] 9. Determination of Mutant Enzyme Activity

[0077] With (R)-(+)-α-methylbenzylamine and pyruvic acid were used as substrates, and a substrate solution was prepared from phosphate buffer (50 mm, pH 8.0). 200 μL of reaction system comprised 180 μL of substrate solution (0.25% DMSO, 2.5 mm (R)-(+)-α-methylbenzylamine, 2.5 mM pyruvic acid, and 0.1 mM PLP) and 20 μL of pure enzyme solution (about 0.3 mg/ml). The variation curve of an OD value with time at a wavelength of 245 nm was detected by a microplate reader. The calculation method of enzyme activity is shown in Formula 1:

[00001]$U\text{/}\mathrm{mg}=\frac{\Delta {\mathrm{OD}}_{245}.Math.V}{d.Math.\mathrm{.Math.}.Math.V_E.Math.\left[E\right]}$

[0078] Wherein, ΔOD.sub.245: change in absorbance per minute at 245 nm; V: a total volume of an enzyme reaction system (200 μL); d: an optical diameter (0.6 cm); ε: a molar absorption coefficient of acetophenone (12000 L/(mol.Math.cm)); V.sub.E: a volume of an enzyme in the reaction system (20 μL); [E]: an concentration (mg/mL) of an enzyme. The results are shown in Table 2.

TABLE-US-00002 TABLE 2 Dynamic parameters of wild types and mutants K.sub.cat.sup.pyruvate K.sub.m.sup.pyruvate k.sub.cat/K.sub.m.sup.pyruvate k.sub.cat.sup.α-MBA K.sub.m.sup.α-MBA k.sub.cat/K.sub.m.sup.α-MBA Name (s.sup.−1) (mM) (L/(s .Math. mmol)) (s.sup.−1) (mM) (L/(s .Math. mmol)) WT-ATA 0.50 ± 0.01 0.23 ± 0.02 2.22 0.64 ± 0.01 0.23 ± 0.03 2.82 F115L-H210N- 3.87 ± 0.03 2.67 ± 0.02 1.45 1.85 ± 0.03 0.26 ± 0.01 7.12 M150C-M280C F115L-H210N 2.55 ± 0.01 1.49 ± 0.02 1.71 1.98 ± 0.02 0.55 ± 0.02 3.6 F115L-H210N- 3.17 ± 0.01 1.56 ± 0.07 2.03 2.48 ± 0.01 0.80 ± 0.03 3.1 E253A-I295V I77L-F115L- 1.96 ± 0.03 1.99 ± 0.02 0.99 1.44 ± 0.01 0.55 ± 0.01 2.62 E133A-H210N- N245D I77L-Q97E- 2.76 ± 0.01 2.08 ± 0.03 1.33 2.00 ± 0.01 0.84 ± 0.02 2.38 F115L-L118T- E253A-G292D I77L-E133A- 3.05 ± 0.02 2.59 ± 0.02 1.18 2.02 ± 0.05 0.84 ± 0.05 2.40 N245D-G292D H210N-N245D- 1.89 ± 0.03 0.63 ± 0.01 3.01 1.73 ± 0.01 0.32 ± 0.03 5.42 E253A-G292D

[0079] 10. Determination of Thermal Stability Parameters of Mutant Enzyme

[0080] The purified wild enzyme and mutant enzyme were incubated for 10 min in 25-55° C. water bath, and then quickly cooled for 10 min on ice. The substrate solution was prepared from phosphate buffer (50 mmol/L and pH 8.0), 200 μL of reaction system comprised 180 μL of substrate solution (0.25% DMSO, 2.5 mmol/1 (R)-(+)-α-methylbenzylamine ((R)-α-MBA), 2.5 mmol/L pyruvic acid and 0.1 mmol/L PLP) and 20 μL of pure enzyme solution (about 0.3 mg/mL), and the corresponding enzyme activity of the enzyme at 245 nm was detected by MD190 microplate reader (Purmonen M, Valjakka J, Takkinen K, et al. Molecular dynamics studies on the thermostability of family 11 xylanases [J]. Protein engineering design and selection, 2007, 20 (11): 551-559).

[0081] The temperature was used as the abscissa and a ratio of enzyme activities after and after thermal treatment was used as the ordinate, and Boltzmann S-type function fitting was conducted by Origin 8.0 software to calculate the half-inactivation temperature (T.sub.50.sup.10).

[0082] The wild enzyme and the mutant enzyme were incubated for 2-50 min at 40° C. respectively. After incubation, the wild enzyme and the mutant enzyme were quickly cooled for 10 min. The enzyme activity was measured by the above method. Plotting was conducted by using time was used as the abscissa and using a ratio of specific activities before and after thermal treatment as the ordinate, the nonlinear equation y=exp (−K.sub.d.Math.t) was fitted by Origin 8.0 software. The first-order rate constant (k.sub.d) was determined by nonlinear regression, and the corresponding half-life period (t.sub.1/2) when the enzyme activity decreased to 50% was calculated.

[0083] The experimental results are shown in Table 3, FIG. 4 and FIG. 5.

[0084] 11. Characterization of Thermodynamic Stability of Mutant Enzyme

[0085] A differential scanning fluorometry (DSF) method is a rapid and low-cost method to study the stability of proteins and an interaction between proteins and small molecules. A pure enzyme to be analyzed (concentrated to remove imidazole) (0.1 mg/mL) and fluorescent dye SYPRO Orange dye 2× were properly diluted, 50 mM PBS buffer (pH 8.0) was mixed with 150 mM NaCl, total volume was 50 μL, an enzyme buffer was used as negative control, and three groups were measured for each sample in parallel. A PCR tube containing a sample to be analyzed was put into a real-time fluorescence quantitative PCR instrument for programmed temperature, and a temperature rising rate is 0.7° C./30s. The change of fluorescence intensity of enzyme samples from 25° C. to 70° C. was recorded by the real-time fluorescence quantitative PCR instrument. Where, an excitation wavelength was 490 nm and an emission wavelength was 605 nm. Plotting was conducted by fluorescence intensity vs. temperature, and the curve is S-shaped, wherein the inflection point of the curve is the pyrolysis folding temperature (Tm) of the protein.

[0086] The thermodynamic analysis of the enzyme adopts a two-state equilibrium model, and the Tm value is calculated according to Boltzmann Formula 2.

[00002]$y=UF+\frac{\left(NF-UF\right)}{1+e^{\frac{\left(T_m-x\right)}{\alpha }}}$

[0087] Wherein, y represents fluorescence intensities at different temperatures, UF is a fluorescence intensity of an enzyme in a natural folding state, NF is the maximum fluorescence intensity in an unfolding state, x refers to a temperature, and dx is a slope of a relationship curve between the fluorescence intensity and the temperature. Fitting was conducted by software Origin 8.0 to obtain Tm.

TABLE-US-00003 TABLE 3 Stability parameters of wild types and mutants Name T.sub.50.sup.15(° C.) t.sub.1/2(min) T.sub.m WT-ATA 38.50 ± 0.50  6.90 ± 0.60 41.40 ± 0.20 F115L-H210N-M150C- 52.20 ± 0.42 172.70 ± 3.68  55.30 ± 0.29 M280C F115L-H210N 49.78 ± 0.50 101.20 ± 0.13  54.30 ± 0.25 F115L-H210N-E253A- 47.86 ± 0.28 65.54 ± 1.00 50.00 ± 0.34 I295V I77L-F115L-E133A- 47.65 ± 0.22 60.80 ± 0.70 53.80 ± 0.28 H210N-N245D I77L-Q97E-F115L- 45.62 ± 0.44 41.68 ± 0.90 49.90 ± 0.13 L118T-E253A-G292D I77L-E133A-N245D- 44.81 ± 0.45 37.40 ± 2.40 48.70 ± 0.34 G292D H210N-N245D-E253A- 41.80 ± 0.53 12.55 ± 0.48 44.30 ± 0.33 G292D

[0088] Experimental results are shown in Table 3 and FIG. 6.