Promoter and a method for producing L-amino acid using the same

Abstract

The present disclosure relates to a novel promoter and a method for producing L-amino acids using the promoter, and more specifically, to a novel polynucleotide having promoter activity, a vector and a microorganism of the genus Corynebacterium comprising the polynucleotide, a method for producing L-amino acids using the microorganism, and a fermented composition.

Claims

1. A polynucleotide comprising a nucleotide sequence having promoter activity, wherein the nucleotide sequence having promoter activity consists of SEQ ID NO: 1.

2. The polynucleotide according to claim 1, wherein the nucleotide sequence having promoter activity is operably linked to a gene encoding a target protein.

3. A vector comprising the polynucleotide of claim 1, wherein a gene encoding a target protein is operably linked to the nucleotide sequence having promoter activity.

4. The vector of claim 3, wherein the target protein is lactate dehydrogenase.

5. A microorganism of the genus Corynebacterium, comprising the polynucleotide of claim 1; wherein a gene encoding a target protein is operably linked to the nucleotide sequence having promoter activity.

6. The microorganism according to claim 5, wherein the target protein is lactate dehydrogenase.

7. The microorganism according to claim 5, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

8. A method for producing a target substance, comprising: culturing the microorganism of the genus Corynebacterium of claim 5 in a medium; and recovering the target substance from the cultured medium.

9. The method according to claim 8, wherein the target substance is an amino acid.

10. A method for preparing a fermented composition, comprising fermenting by culturing the microorganism of the genus Corynebacterium of claim 5 in a medium.

11. The microorganism according to claim 7, wherein the target protein is lactate dehydrogenase.

12. The method of claim 8, wherein the target protein is lactate dehydrogenase.

Description

DETAILED DESCRIPTION OF THE EMBODIMENT

(1) Hereinbelow, the present disclosure will be described in detail with accompanying exemplary embodiments. However, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present disclosure.

Example 1

Selection of Mutant Strain for Reducing Lactic Acid Productivity

Example 1-1

Induction of Random Mutation by UV Irradiation

(2) In order to select mutant strains in which the productivity of L-glutamic acid, which is a target product of fermentation, is improved and in which the productivity of lactic acid, which reduces the palatability of a fermented product, is decreased, wild-type Corynebacterium glutamicum (ATCC13869) was plated on nutrient media containing agar and cultured at 30° C. for 16 hours. Hundreds of the thus-obtained colonies were irradiated with UV at room temperature to induce a random mutation on the genome in the strain.

Example 1-2

Experiment on Fermentation Titer of Mutation-Inducting Strain and Selection of Strain

(3) Thereafter, the experiment on fermentation titer of the mutant strains, in which the random mutation had been induced, was carried out.

(4) Each colony was subcultured in the nutrient media, and then cultured in fermentation media for 5 hours. Thereafter, 25% tween 40 was added to each medium at a concentration of 0.4%, and then each colony was cultured again for 32 hours.

(5) Nutrient Medium

(6) Glucose 1%, meat juice 0.5%, polypeptone 1%, sodium chloride 0.25%, yeast extract 0.5%, agar 2%, urea 0.2%, pH 7.2

(7) Fermentation Medium

(8) Raw sugar 6%, calcium carbonate 5%, ammonium sulfate 2.25%, potassium monophosphate 0.1%, magnesium sulfate 0.04%, iron sulfate (10 mg/L), biotin (0.3 mg/L), thiamine hydrochloride (0.2 mg/L)

(9) Each of the colonies was cultured under the conditions above, and then mutant strains producing L-glutamic acid, the produced amount of which is equal to or greater than that produced by wild-type Corynebacterium glutamicum (ATCC13869), were selected. In addition, with respect to the selected mutant strains, the concentration of L-glutamic acid was measured by YSI, and the concentration of lactic acid was measured by HPLC. The measured concentrations of L-glutamic acid and lactic acid are shown in Table 1.

(10) TABLE-US-00001 TABLE 1 Strain L-Glutamic acid (g/L) Lactic acid (g/L) ATCC13869 14.5 1.5 ATCC13869-m1 15.1 1.2 ATCC13869-m2 14.0 0.7 ATCC13869-m3 17.7 1.5 ATCC13869-m4 13.9 2.0 ATCC13869-m5 14.4 1.8 ATCC13869-m6 16.7 0.9 ATCC13869-m7 18.8 0.4 ATCC13869-m8 16.2 0.7 ATCC13869-m9 18.9 0.1 ATCC13869-m10 12.4 2.1 ATCC13869-m11 13.8 2.1 ATCC13869-m12 15.7 1.4 ATCC13869-m13 15.3 0.8 ATCC13869-m14 16.4 1.0 ATCC13869-m15 17.2 1.1 ATCC13869-m16 18.2 0.7

(11) Based on Table 1, “ATCC13869-m7” and “ATCC13869-m9” were selected as the strains in which the amount of L-glutamic acid produced was increased and the amount of lactic acid produced was decreased compared to those produced in the wild-type strain.

Example 2

Confirmation of Mutation Through Gene Sequencing

(12) In order to confirm the gene mutation of the mutant strains, genes in the strains ATCC13869-m7 and ATCC13869-m9 were compared with those of the wild-type strain.

(13) As a result, it was found that the strains ATCC13869-m7 and ATCC13869-m9 contained the same mutation at a specific position in the promoter region of a gene encoding lactate dehydrogenase.

(14) Specifically, it was confirmed that ATCC13869-m7 and ATCC13869-m9 contained a mutation in which the 37.sup.th nucleotide, T, in the sequence of the promoter region of SEQ ID NO: 2 is substituted with G. It was confirmed that the promoter region of SEQ ID NO: 2 was a sequence commonly included in a microorganism of the genus Corynebacterium, more specifically, the wild-type Corynebacterium glutamicum (ATCC13032, ATCC13869, and ATCC14067).

(15) Therefore, in Examples 3 and 4, attempts were made to confirm whether the mutation above affected the production amounts of glutamic acid and lactic acid in the microorganism of the genus Corynebacterium.

Example 3

Preparation of Strain Introduced with Mutation and Confirmation of Production Amount of Lactic Acid

Example 3-1

Preparation of Strain Introduced with Mutation

(16) An attempt was made to prepare a mutant strain introduced with the mutation confirmed in Example 2. Specifically, in order to introduce the mutation into the wild-type Corynebacterium glutamicum ATCC13869 and ATCC13032 (i.e., in order to substitute the 37.sup.th nucleotide of the polynucleotide sequence of SEQ ID NO: 2 with G), the oligonucleotide in a reverse direction, which contains a target mutation, was designed with a 75-mer length.

(17) Specifically, the oligonucleotide (30 μg) of SEQ ID NO: 5 was transformed into the wild-type Corynebacterium glutamicum strains ATCC13869 and ATCC13032 using an electric pulse method (Appl. Microbiol. Biotechnol., 1999, 52:541-545), and then a complex liquid medium (1 mL) was added thereto. The resultants were then cultured at 30° C. for 30 minutes while shaking at 160 rpm. Thereafter, the culture medium was incubated on ice for 10 minutes, centrifuged at 4000 rpm at 4° C. for 10 minutes, and then the supernatant was removed to obtain microbial cells. Thereafter, 1 mL of a 10% glycerol solution (4° C.) was added thereto and mixed, and then the resultants were centrifuged at 4000 rpm at 4° C. for 10 minutes. The supernatant was removed and then the microbial cells were washed. Such procedure was repeated once more to wash the microbial cells again, and a 10% glycerol solution (4° C. and 0.1 mL) was added thereto to prepare the strains for the next transformation. Thereafter, the process for the transformation was repeated 10 times with the oligonucleotide of SEQ ID NO: 5 using the electric pulse method described above, and then the resultants were plated on a complex plate medium to obtain colonies (Nat. Protoc., 2014 October; 9(10): 2301-16).

(18) As a result of carrying out the analysis of the gene sequence of the obtained colonies, it was confirmed that the target mutation was introduced into the strains. In addition, the strains into which the mutation was introduced were named as “ATCC13869::ldh-pro-1mt” and “ATCC13032::ldh-pro-1mt”.

Example 3-2

Confirmation of Production Amount of Lactic Acid

(19) The mutant strains ATCC13869::ldh-pro-1mt and ATCC13032::ldh-pro-1mt, which were prepared in Example 3-1, and their wild-type Corynebacterium glutamicum strains ATCC13869 and ATCC13032 were cultured in the same manner as in Example 1-2.

(20) After the cultivation was completed, the concentrations of L-glutamic acid and lactic acid in each medium were measured. The measured concentrations of L-glutamic acid and lactic acid are shown in Table 2 below.

(21) TABLE-US-00002 TABLE 2 Strain L-Glutamic acid (g/L) Lactic acid (g/L) ATCC13869 14.5 1.5 ATCC13869::ldh-pro-1mt 19.2 0.0 ATCC13032 8.2 2.7 ATCC13032::ldh-pro-1mt 10.8 0.3

(22) As shown in Table 2, it was confirmed that the concentration of L-glutamic acid produced by the Corynebacterium glutamicum strain ATCC13869::ldh-pro-1mt, into which the mutation was introduced, was higher than that produced by the wild-type Corynebacterium glutamicum strain ATCC13869 by about 4.7 g/L (about 32%). On the other hand, the wild-type Corynebacterium glutamicum strain ATCC13869 produced 1.5 g/L of lactic acid, but lactic acid was not measured in the medium in which the strain ATCC13869::ldh-pro-1mt was cultured.

(23) Additionally, it was confirmed that the concentration of L-glutamic acid produced by the Corynebacterium glutamicum strain ATCC13032::ldh-pro-1mt, into which the mutation was introduced, was higher than that produced by the wild-type Corynebacterium glutamicum strain ATCC13032 by about 2.6 g/L (about 32%). On the other hand, the wild-type Corynebacterium glutamicum strain ATCC13032 produced 2.7 g/L of lactic acid, but a trace amount of lactic acid (0.3 g/L) was measured in the medium in which the strain ATCC13032::ldh-pro-1mt was cultured.

(24) That is, it was confirmed that the mutation increased the L-glutamic acid productivity and reduced the lactic acid productivity in the microorganisms.

(25) Additionally, the strain ATCC13869::ldh-pro-1mt was named as CA02-9209 and deposited at the Korean Culture Center of Microorganisms (KCCM), which is an international depositary authority under the Budapest Treaty, on Feb. 28, 2018, and was assigned Accession No. KCCM12227P.

Example 4

Confirmation of Enzyme Activity and Amount of Lactic Acid Produced in strain KFCC11074 into which mutation is introduced

Example 4-1

Preparation of Vector in to which Mutation is Introduced

(26) In order to confirm whether the mutation exhibits the same effect in the strains with improved productivity of glutamic acid, in addition to the wild-type strains, attempts were made to introduce the mutation into the strain KFCC11074 (Korean Patent No. 10-0292299), which is known as a glutamic acid-producing strain.

(27) Specifically, a vector for gene substitution was constructed in order to substitute the 37.sup.th nucleotide of the polynucleotide sequence of SEQ ID NO: 2, which is contained in the strain, with G. The gene fragments for constructing the vector were obtained by PCR using ATCC13869 genomic DNA as a template. Based on information on genes and adjacent sequences of the Corynebacterium glutamicum (ATCC13869) registered in the National Institutes of Health GenBank (NIH GenBank), primers including the polynucleotides of SEQ ID NOS: 6, 7, 8, and 9 were prepared.

(28) After denaturation at 95° C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: denaturation at 95° C. for 20 seconds, annealing at 55° C. for 20 seconds, and polymerization at 72° C. for 30 seconds. Thereafter, the polymerization reaction was carried out at 72° C. for 5 minutes. More specifically, the polynucleotide (500 bp) amplified using the primers of SEQ ID NOS: 6 and 7 and the polynucleotide (500 bp) amplified using the primers of SEQ ID NOS: 8 and 9 were obtained. The obtained two DNA fragments were ligated to the vector pDZ (Korean Patent No. 10-0924065 and International Publication No. 2008-033001), which had been digested with restriction enzymes BamHI and SalI, by using an infusion enzyme, and thereby a vector for gene substitution was prepared. The prepared vector was named as “pDZ-ldh-pro-1mt”. The information on the primer sequences used for the vector preparation is shown in Table 3 below.

(29) TABLE-US-00003 TABLE 3 SEQ ID NO: Primer Sequence (5′ to 3′) 6 ldh-pro- CGGTACCCGGGGATCCTGTGGGTGGCGTTGTA 1mt-AF 7 ldh-pro- CTTTGTTACACCTTTACTTATGCCCGATTATGT 1mt-AR 8 ldh-pro- GTAAAGGTGTAACAAAGGAATCCGGGCACAAGC 1mt-BF 9 ldh-pro- ATGCCTGCAGGTCGACCCACACTGCGTAGGTC 1mt-BR

Example 4-2

Preparation of KFCC11074 into which mutation is introduced and confirmation of production amount of lactic acid

(30) The vector for gene substitution, which had been prepared in Example 4-1, was introduced into the strain KFCC11074 to prepare “KFCC11074::ldh-pro-1mt”, which is the glutamic acid-producing strain into which the mutation is introduced. The Corynebacterium glutamicum strain KFCC11074, into which the mutation was not introduced, and the strain KFCC11074::ldh-pro-1mt were each cultured in the same manner as in Example 1-2.

(31) After completion of the culture, the concentrations of L-glutamic acid and lactic acid in each medium were measured. The measured concentrations of L-glutamic acid and lactic acid are shown in Table 4 below.

(32) TABLE-US-00004 TABLE 4 Strain L-Glutamic acid (g/L) L-Lactic acid (g/L) KFCC11074 9.1 22.5 KFCC11074::ldh-pro-1mt 17.1 6.5

(33) As shown in Table 4, it was confirmed that the concentration of L-glutamic acid produced by the Corynebacterium glutamicum strain KFCC11074::ldh-pro-1mt, into which the mutation is introduced, was higher than that produced by the Corynebacterium glutamicum strain KFCC11074, into which the mutation is not introduced, by about 8 g/L (about 88%).

(34) On the other hand, it was confirmed that the concentration of lactic acid produced by the strain KFCC11074::ldh-pro-1mt was lower than that produced by the Corynebacterium glutamicum strain KFCC11074, into which the mutation is not introduced, by 17 g/L.

(35) That is, it was once again confirmed that the mutation increased the L-glutamic acid productivity in the microorganisms and decreased the lactic acid productivity.

Example 4-3

Confirmation of Activity of Enzyme LDH of KFCC11074 into which Mutation is Introduced

(36) Since the mechanism for the reduction of the lactic acid productivity in the strain KFCC11074::ldh-pro-1mt, which had been prepared in Example 4-2, was confirmed, and since it was confirmed that the mutation was contained in the promoter of lactate dehydrogenase (LDH), attempts were made to identify the activity of lactate dehydrogenase, which is a lactic acid-producing enzyme, depending on the mutation.

(37) Specifically, the activity of the enzyme was evaluated in the following manner. First, cells were cultured in medium #3 (25 mL), which has the composition below, in a flask (250 mL) at 200 rpm at 30° C. for 6 hours. Thereafter, the supernatant was removed by precipitating the cells at 4000 rpm for 10 minutes, and cell washing was repeated three times using 20 mM Tris-HCl (25 mL, pH 7.5). After washing, the supernatant was removed, and the cells were resuspended using 15% glycerol buffer (2 mL) in 20 mM Tris (pH 7.5) for cell extraction. The resuspended cells (1 mL) were placed in a bead tube and homogenized six times under a condition of 46/30 seconds using a homogenizer. Thereafter, the resultants were centrifuged at 13000 rpm at 4° C. for 20 minutes.

(38) Medium #3:

(39) Glucose 2%, polypeptone 1%, (NH.sub.4).sub.2SO.sub.4 1%, KH.sub.2PO.sub.4 0.52%, K.sub.2HPO.sub.4 1.07%, yeast extract 1%, urea 0.15%, MgSO.sub.4.7H.sub.2O 0.05%, d-biotin (1.8 mg/L), thiamin-HCl (9 mg/L), calcium-pantothenic acid (9 mg/L), niacinamide (60 mg/L)

(40) Thereafter, the Bradford assay was carried out to confirm and standardize the concentration of protein contained in the supernatant (sample) obtained from the bead tube. The Bradford assay obtained a standard curve with reference to Tables 5 and 6 below and confirmed the concentration of the sample. In particular, the 1× Biorad protein assay reagent (980 μL) was added to the sample having a total volume of 20 μL and then vortexed to measure the absorbance at 595 nm for about 3 minutes.

(41) TABLE-US-00005 TABLE 5 STD and Extract Sampling mg/mL 0 0.025 0.05 0.1 0.2 BSA (1 mg/mL) (μL) 0 0.5 1 2 4 Extraction buffer (μL) 20 19.5 19 18 16 Total volume (μL) 20 20 20 20 20

(42) TABLE-US-00006 TABLE 6 Cell extract 1:10 dilution 1:5 dilution 1:20 dilution 1:50 dilution Cell extract (μL) 2 4 (1/10)10 (1/10)4 Extraction buffer (μL) 18 16 10 16 Total volume (μL) 20 20 20 20

(43) Thereafter, the experiment on the activities of lactate dehydrogenases in the strains KFCC11074 and KFCC11074::ldh-pro-1mt was carried out using the reaction solution, the composition ratio of which is shown in Table 7 below. Further, 30 mM sodium pyruvate was used as a starter. Furthermore, the activities of lactate dehydrogenase in the two strains, which were measured under the conditions shown in Table 8, are shown in Table 9 below.

(44) TABLE-US-00007 TABLE 7 Reaction solution Per 1 reaction 0.2M Tris-HCl pH 7.5 (μL) 500 30 mM Sodium pyruvate (μL) 100 6.6 mM NADH (μL) 50 Cell extract (mg/mL) 178 μg DDW Up to 1 mL

(45) TABLE-US-00008 TABLE 8 Cuvette 10 mm Wavelength 340  nm Unit U Factor −1 Decimal places  3 Temperature on on Temperature 25 ° C. Measuring Procedure lin. regr. Delay 00:01 min:sec Measuring time  1:30 min:sec Interval 00:8  min:sec Autoprint off

(46) TABLE-US-00009 TABLE 9 Strain LDH activity (U) KFCC11074 0.398 KFCC11074::ldh-pro-1mt 0.150

(47) As shown in Table 9, it was confirmed that the activity of lactate dehydrogenase was reduced in the strains into which the mutation is introduced.

(48) That is, it was confirmed that the mutation reduced the activity of lactate dehydrogenase in the microorganisms, thereby reducing the lactic acid productivity.

(49) In summary, the polynucleotide of the present disclosure is a promoter of lactate dehydrogenase including the mutation in which a single nucleotide is substituted, and thus the polynucleotide can attenuate the activity of lactate dehydrogenase in the wild-type strains or the glutamic acid-producing strains via the activity of the mutated promoter; as a result, the productivity of glutamic acid, which is a target product of fermentation, is increased, and further, the productivity of lactic acid, which lowers the palatability of the fermented product, is reduced. Accordingly, the polynucleotide of the present disclosure can be effectively used in various industrial fields for producing glutamic acid at a high yield.

(50) From the foregoing, one of ordinary skill in the art to which the present disclosure pertains will be able to understand that the present disclosure may be embodied in other specific forms without modifying the technical concepts or essential characteristics of the present disclosure. In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present disclosure. On the contrary, the present disclosure is intended to cover not only the exemplary embodiments but also various alternatives, modifications, equivalents, and other embodiments that may be included within the spirit and scope of the present disclosure as defined by the appended claims.

Accession Number

(51) Depository Institution: Korean Culture Center of Microorganisms (International Depositary Authority)

(52) Accession Number: KCCM12227P

(53) Date of Deposit: Feb. 28, 2018