Aureobasidium pullulans strains with high-yield heavy oil and construction method and application thereof

Abstract

An Aureobasidium pullulans recombinant strain with high-yield heavy oil and a construction method and application thereof are provided. The Aureobasidium pullulans recombinant strain is obtained by knocking out a pullulan synthetase PUL gene while overexpressing an ACL gene. The obtained Aureobasidium pullulans recombinant strain can significantly increase the yield of heavy oil. After 7-day fermentation with xylose as carbon source, the yield of the heavy oil of the recombinant strain reaches 19.4372 g/L, while the yield of the heavy oil of the original strain is 10.0325 g/L, i.e. the recombinant strain improves the yield by 93.74% compared with the original strain.

Claims

1. An Aureobasidium pullulans recombinant strain, wherein the Aureobasidium pullulans recombinant strain improves a yield of heavy oil, and the Aureobasidium pullulans recombinant strain is achieved by using an Aureobasidium pullulans P30 strain as an original strain, using an ATP-citrate lyase (ACL) gene as a substitute for a pullulan synthetase (PUL) gene, and overexpressing the ACL gene with a promoter, wherein the nucleotide sequence of the ACL gene comprises SEQ ID NO: 1, the nucleotide sequence of the PUL gene comprises SEQ ID NO: 2, and the preservation number of the Aureobasidium pullulans P30 strain is CGMCC No. 13988.

2. The Aureobasidium pullulans recombinant strain according to claim 1, wherein the promoter is a PGK promoter, and the nucleotide sequence of the PGK promoter is as SEQ ID NO: 5.

3. A method of making the Aureobasidium pullulans recombinant strain according to claim 1, comprising the following steps: obtaining an Aureobasidium pullulans P30 strain as the original parent strain; sequentially connecting and integrating an upstream homologous arm FA of the PUL gene of the Aureobasidium pullulans P30, a hygromycin resistance gene (hyg) fragment, a PGK promoter, the ACL gene of the Aureobasidium pullulans P30 strain, a GAP terminator and a downstream homologous arm FB of the PUL gene of the Aureobasidium pullulans P30 strain into a PUL gene integration site of the Aureobasidium pullulans P30 strain; and performing homologous recombination to obtain the Aureobasidium pullulans recombinant strain of claim 1, wherein the nucleotide sequence of the PGK promoter is SEQ ID NO: 5, and the nucleotide sequence of the GAP terminator is SEQ ID NO: 6.

4. The method of making the Aureobasidium pullulans recombinant strain according to claim 3, specifically comprising the following steps: carrying out a first PCR amplification with a genome of the Aureobasidium pullulans P30 strain as a template to obtain PCR amplification products of the upstream homologous arm FA and the downstream homologous arm FB of the PUL gene, the PGK promoter, the GAP terminator and the ACL gene; carrying out a second PCR amplification on a plasmid carrying a hyg resistance gene to obtain a PCR amplification product of the hyg resistance gene fragment; and performing an electrotransformation to sequentially connect and integrate the PCR amplification products of the upstream homologous arm FA of the PUL gene, the hyg resistance gene fragment, the PGK promoter, the ACL gene, the GAP terminator and the downstream homologous arm FB of the PUL gene into the PUL gene integration site of the Aureobasidium pullulans P30 strain, and performing the homologous recombination to obtain the Aureobasidium pullulans recombinant strain of claim 1 overexpressing the ACL gene with the PGK promoter.

5. A method to produce a heavy oil, comprising culturing the Aureobasidium pullulans recombinant strain according to claim 1 under fermentation conditions, wherein the fermentation results in production of heavy oil.

6. The method according to claim 5, comprising the following steps: selecting and inoculating a strain seed of the Aureobasidium pullulans recombinant strain according to claim 1 into a seed culture medium, and performing shake culture at 28-30° C. and 200-240 r/min for 20-24 h to obtain a seed solution; inoculating the seed solution at an inoculum size of 6%-8% into a fermentation culture medium, and performing a shake flask fermentation at 28-30° C. and 200-240 r/min for 5-7 days; wherein the seed culture medium comprises 20 g/L of xylose, 1.0 g/L of yeast extract powder, 4.0 g/L of K.sub.2HPO.sub.4, 0.8 g/L of (NH.sub.4).sub.2SO.sub.4, 0.2 g/L of MgSO.sub.4, 4.0 g/L of NaCl and water as balance, with a pH of 5.5-6.5, and the seed culture medium is subjected to sterilization at 121° C. for 20 min; and the fermentation culture medium comprises 50 g/L of xylose, 1.4-2.0 g/L of yeast extract powder, 0.8 g/L of KNOB, 2.0 g/L of NaCl, 5.0 g/L of K.sub.2HPO.sub.4, 0.3 g/L of MgSO.sub.4 and water as balance, with a pH of 4.5-5.5, and the fermentation culture medium is subjected to sterilization at 121° C. for 20 min.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows a flow diagram of construction of the pUC-HPT plasmid;

(2) FIG. 2 is an electrophoretogram showing the verification of construction of the pUC-HPT plasmid;

(3) wherein the lane M: 5000 bp DNA maker; lane 1: fragment obtained by PCR using PUC19 as template, and PUC-U and PUC-D as primers; lane 2: fragment obtained by PCR using pUC-HPT as template, and PUC-U and PUC-D as primers;

(4) FIG. 3 is a diagram showing the process of homologous recombination of the Aureobasidium pullulans recombinant strain overexpressing the ACL gene;

(5) FIG. 4 shows verification result of the recombinant strains of Aureobasidium pullulans overexpressing the ACL gene:

(6) wherein the lane M: 5000 bp DNA maker; lane 1: fragment obtained by PCR using the original strain as template, and PUL-U and PGK-D as primers; lane 2: fragment obtained by PCR using the recombinant strain as template, and PUL-U and PGK-D as primers; lane 3: fragment obtained by PCR using the original strain as template, and PGK-U and PUL-D as primers (cross validation fragment); lane 4: fragment obtained by PCR using the recombinant strain as template, and PGK-U and PUL-D as primers;

(7) FIGS. 5A-5B shows a comparison of xylose utilization and biomass between the recombinant strain (PACLΔP) and the original strain (P30), wherein FIG. 5A shows xylose consumption curves and FIG. 5B shows biomass change curves.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(8) The present invention is described below with reference to specific embodiments. Unless otherwise specified, the technical means used in the present invention are all well known to those skilled in the art. In addition, the embodiments should be considered illustrative and not restrictive to the scope of the present invention. The essence and scope of the present invention is defined solely by the claims. For those skilled in the art, various changes or modifications in the components and amounts of the materials used in the embodiments should be made without departing from the spirit and scope of the invention and shall fall in the scope of protection of the present invention.

Embodiment 1: Construction of the Aureobasidium pullulans Recombinant Strain Capable of Improving Heavy Oil Production Capacity

(9) The original strain used in the embodiment was Aureobasidium pullulans P30, the E. coli DH5a was purchased from Takara, the YPD culture medium was a general complete culture medium, and the solid culture medium contained 2% agar powder.

(10) The following primers were designed based on the Aureobasidium pullulans genome data and the integration plasmid sequence. KpnI restriction sites were underlined.

(11) TABLE-US-00001 TABLE 1 The primers used in the Embodiment 1. SEQ ID NO Primer 5′.fwdarw.3′ 7 PTEFP-U CTAGAGGATCCCCGGGTACCGTCAAGACAGCAAGAACGGG 8 TEFpH-D CGGTGAGTTCAGGCTTTTTCATGTTGACGGTTGTGTATGGAA 9 TEFpH-U TTCCATACACAACCGTCAACATGAAAAAGCCTGAACTCACCG 10 HTEFt-D AGACAAAAGTGTCAAATCGTCTATTCCTTTGCCCTCGGAC 11 HTEFt-U GTCCGAGGGCAAAGGAATAGACGATTTGACACTTTTGTC 12 TEFtP-D GTGAATTCGAGCTCGGTACCTCTTCCCTTTCACTAGGTCG 13 PUC-U TGATTACGCCAAGCTTGCATGC 14 PUC-D GTAAAACGACGGCCAGTGAATTC 15 FA-U TCGGCATCTATTTTGAGATGCTG 16 FA-D GTGTTCCCGTTCTTGCTGTCTTGACGGTTGTTAGGAGATAGAATGGTTG 17 H-U GCAACCATTCTATCTCCTAACAACCGTCAAGACAGCAAGAACGGGAACAC 18 H-D GAGAGGTTACCTAAGTGAGGCAATGTCTTCCCTTTCACTAGGTCG 19 PKG-U CTGTCCGACCTAGTGAAAGGGAAGACATTGCCTCACTTAGGTAACC 20 PKG-D GAGGATCGACTTTGCGGACATTGTGACTGAATCGAGTGTGTC 21 ACL-U GTCTGACACACTCGATTCAGTCACAATGTCCGCAAAGTCGATCCTC 22 ACL-D GCTTGGTCATACGCACATCAGAGATATGCACCGAACTCCTTGATGTC 23 GAP-U GACATCAAGGAGTTCGGTGCATATCTCTGATGTGCGTATGACCAAGC 24 GAP-D GTTGGTAGTAGGGATCGAAGAGGGTCTAAGGTCATGGTTTCTCTG 25 FB-U CTGCCCAGAGAAACCATGACCTTAGACCCTCTTCGATCCCTACTACC 26 FB-D TAGTAAGGCACAGTCAAAGC 27 PUL-U AGAAGGCTGTGTAGCTGTACGACC 28 PUL-D TTAGTAAGGCACAGTCAAAGCAG

(12) TABLE-US-00002 TABLE 2 PCR amplification system used in the Embodiment 1. 20 μL system (μL) 50 μL system (μL) 10 × PCR Buffer 2.0 5.0 dNTP (2.5 mmol/L) 1.5 4.0 Upstream primer (10 μmol/L) 1.0 1.0 Downstream primer (10 μmol/L) 1.0 1.0 Template 1.0 1.5 rTaq enzyme 0.5 1.0 ddH.sub.2O Add to 20 Add to 50

(13) TABLE-US-00003 TABLE 3 PCR amplification system used in the Embodiment 1. 50 μL system (μL) 5 × primeSTAR Buffer (Mg.sup.2− Plus) 10 dNTP Mixture 4 Upstream primer 1 Downstream primer 1 Template DNA 1 PrimeSTAR HS 0.5 ddH.sub.2O 32.5

(14) (1) Construction of Recombinant Plasmid pUC-HPT

(15) The construction process of the recombinant pUC-HPT plasmid is shown in FIG. 1. Firstly, the genome of the Aureobasidium pullulans P30 strain was taken as a template, the primers PTEFP-U and TEFpH-D were applied to amplification to obtain a TEF promoter fragment of 1500 bp (SEQ ID NO: 3), the primers HTEFt-U and TEFtP-D were applied to amplification to obtain a TEF terminator of 500 bp (SEQ ID NO: 4). Yep-HPT plasmid was taken as a template and TEFpH-U and HTEFt-D as primers to perform amplification to obtain an hyg fragment of 1026 bp in length; the TEF promoter, the hygromycin (hyg) resistance gene and the TEF terminator were connected together through fusion PCR to obtain TEFp-hyg-TEFt (KpnI restriction sites were added during design of the upstream primers of the promoter and the downstream primers of the terminator to obtain the TEFp-hyg-TEFt fragment with the KpnI restriction sites at both ends), and the TEFp-hyg-TEFt fragment was subjected to KpnI enzyme digestion and then connected to a pUC19 plasmid also subjected to KpnI enzyme digestion to obtain a pUC-HPT plasmid. The electrophoretogram of verification of construction of the pUC-HPT plasmid is shown in FIG. 2.

(16) (2) Construction of the Aureobasidium pullulans Recombinant Strain

(17) The genome of the Aureobasidium pullulans P30 strain was taken as a template to carry out PCR amplification to obtain the upper and lower homologous arms FA and FB of the pullulan synthetase PUL gene (nucleotides 85-511 and nucleotides 571-989 of SEQ ID NO: 2, respectively), a PGK promoter (SEQ ID NO: 5), a GAP terminator (SEQ ID NO: 6) and an ACL gene (SEQ ID NO: 1) which are respectively 430 bp, 430 bp, 1454 bp, 620 bp and 1462 bp in length. Meanwhile, the pUC-HPT plasmid was taken as a template to perform PCR to obtain the hygromycin resistance gene TEFp-hyg-TEFt. Electrotransformation was performed to sequentially connect and integrate the PCR amplification products of the upper homologous arm FA, the hyg resistance gene fragment, the PGK promoter, the ACL gene, the GAP terminator and the downstream homologous arm FB into the sites of the pullulan synthetase PUL gene of the original strain of the Aureobasidium pullulans P30 strain. Plates containing 150 mg/L hygromycin B were used for screening to obtain a homologous recombinant strain. The process of homologous recombination of the Aureobasidium pullulans recombinant strain overexpressing the ACL gene is shown in FIG. 3, and the verification of the recombinant strain is shown in FIG. 4.

(18) (3) Verification of the Aureobasidium pullulans Recombinant Strain:

(19) According to the gene sequences at both ends of the Aureobasidium pullulans recombination sites and the inserted homologous recombination sequences, two groups of upstream and downstream primers, namely PUL-U, PGK-D, PGK-U and PUL-D, were designed respectively. The genome of a transformant with better growth was taken as a template to perform PCR amplification to verify the recombinant; the PCR products were subjected to 0.8% agarose gel electrophoresis, respectively; an 4900 bp band was obtained by upstream verification, and a 3972 bp band was obtained by downstream verification, which show that an ACL gene expression cassette was successfully integrated into the Aureobasidium pullulans P30 strain.

Embodiment 2: Fermentation Experiment of the Recombinant Strain by Taking Xylose as a Carbon Source

(20) The recombinant strain seed was inoculated into a seed culture medium and subjected to shaking culture at 28° C. and 240 r/min for 24 hours to obtain a seed solution; the seed solution was inoculated at an inoculum size of 6% into a fermentation culture medium and subjected to shake flask fermentation at 28° C. and 240 r/min for 7 days.

(21) The seed culture medium was composed of 20 g/L of xylose, 1.0 g/L of yeast extract powder 4.0 g/L of K.sub.2HPO.sub.4, 0.8 g/L of (NH.sub.4).sub.2SO.sub.4, 0.2 g/L of MgSO.sub.4, 4.0 g/L of NaCl and water as balance; the pH was 6.0, and sterilization was performed at 121° C. for 20 min.

(22) The fermentation medium was composed of 50 g/L of xylose, 2.0 g/L of yeast extract powder, 0.8 g/L of KNO.sub.3, 2.0 g/L of NaCl, 5.0 g/L of K.sub.2HPO.sub.4, 0.3 g/L of MgSO.sub.4 and water as balance; the pH was 5.0, and sterilization was performed at 121° C. for 20 min.

(23) The fermentation experiment was performed on the original Aureobasidium pullulans P30 strain and the selected strain PACLΔP by taking the xylose as the carbon source under the fermentation conditions above. Sampling was performed every 24 hours during fermentation to determine residual sugar and biomass, and the results are shown in FIG. 5. The content of pullulan and heavy oil after the fermentation were determined, and the results are shown in TABLE 4.

(24) As shown FIG. 5A, the xylose consumption curve of the recombinant strain is basically consistent with that of the original P30 strain, and the fermentation liquid had no xylose residue 7d (d=days) after fermentation, which indicates that the xylose utilization capability of the recombinant strain is not affected. The overall growth trend of the recombinant strain in FIG. 5B is relatively consistent to that of the original P30 strain, the growth conditions and other growth functions of the recombinant strain are overall not greatly affected, and the biomass of the recombinant strain is 19.83% lower than that of the original strain after fermentation.

(25) TABLE-US-00004 TABLE 4 Yields of pullulan and heavy oil produced by fermentation with the xylose as the carbon source. Strain Pullulan (g/L) Heavy Oil (g/L) P30 8.5417 10.0325 PACLΔP 7.5250 19.4372 Note: data shown are the average of the results of three parallel experiments.

(26) TABLE 4 shows that: in the fermentation experiment with the xylose as the carbon source, the yields of pullulan and heavy oil produced by the Aureobasidium pullulans strain obtained in the present invention change. The yield of the pullulan of the original P30 strain was 8.5417 g/L, while the yield of the pullulan of the recombinant strain obtained by the present invention was 7.5250 g/L, which is 11.9% lower compared with the original strain. The result indicates that the recombinant strain reduces the production of the byproduct of the pullulan to some extent. The yield of the heavy oil of the recombinant strain reached 19.4372 g/L, while the yield of the heavy oil of a parent strain was 10.0325 g/L, namely the recombinant strain improves the yield by 93.74% compared with the parent strain. The result indicates that the heavy oil productivity of the strain obtained in the invention is greatly improved, and thereby a theoretical basis is provided for selecting high-yield heavy oil producing Aureobasidium pullulans strains.