INTERLEUKIN-4-INDUCED GENE 1 (IL4I1) AS A BIOMARKER AND USES THEREOF

Abstract

The present invention relates to a newly identified AHR-activating enzyme and uses thereof as marker in the diagnosis and therapy, for example for selecting patients for treatment with IL4I1-modulating interventions, and monitoring of therapy response.

Claims

1. A method for detecting a modulation of AHR in a cell or subject, comprising detecting a change of the biological state of IL4I1 in a biological sample derived from said cell or subject, wherein a change in said biological state of IL4I1 in said sample, when compared to a control sample, indicates an IL4I1-related modulation of AHR in said cell or subject, and wherein preferably said modulation is selected from an activation or repression of AHR.

2. The method according to claim 1, wherein said modulation is indicative for an AHR-related physiological or pathological condition in said cell or subject, wherein said physiological or pathological condition is selected from intoxication, cancer, autoimmune disorders, degeneration, inflammation, infection, metabolic diseases and conditions, angiogenesis, drug metabolism, hematopoiesis, lipid metabolism, cell motility, immune modulation, and stress conditions.

3. The method according to claim 1, wherein said biological state as detected is selected from mutations, nucleic acid methylation, copy numbers, expression, amount of protein, protein modifications, cellular localization, and metabolites.

4. The method according to claim 1, wherein said biological sample is selected from a suitable sample comprising biological fluids, and mammalian cells.

5. The method according to claim 1, wherein said subject is a mammalian subject.

6. The method according to claim 1, wherein said control sample is selected from a sample from a healthy subject or group of subjects.

7. A method for screening for at least one modulator of the biological state of IL4I1, comprising contacting at least one candidate modulator compound with a biological sample, and detecting the modulation of the biological state of IL4I1 or a gene encoding for IL4I1, wherein said modulation or activity identifies a modulator of said biological state.

8. The method according to claim 7, wherein said biological state as detected is selected from mutations, nucleic acid methylation, copy numbers, expression, amount of protein, protein modifications, cellular localization, and metabolites.

9. The method according to claim 7, wherein said modulator is selected from an inhibitor or an inducer of said biological state of IL4I1.

10. The method according to claim 7, wherein said method further comprises detecting a modulation of AHR.

11. The method according to claim 7, wherein said compound is selected from a proteinaceous domain, a small molecule, a peptide, antibodies, an environmental substance, probiotic, toxin, aerosol, medicine, nutrient, galenic composition, plant extract, volatile compound, homeopathic substance, incense, pharmaceutical drug, vaccine, a compounds or compound mixture derived from animals, plants, fungi, bacteria, archaea, a chemical compound, a compound used in food or cosmetic industry, and a library of said compounds.

12. A method for monitoring the modulation of the biological state of AHR in response to at least one compound, comprising performing a method according to claim 1 on a biological sample that was contacted with an amount of said at least one compound, and wherein said biological sample is compared to a control sample that was not contacted with said amount of said compound, wherein said biological samples are obtained through the course of a treatment, and/or are compared to a suitable control sample or a sample derived from a group of subjects or patients.

13. The method according to claim 1, wherein said method further comprises the step of using said comparison for unsupervised clustering or supervised classification of said samples into subgroups of IL4I1 modulation.

14. A diagnostic kit comprising materials for performing a method according to claim 1 in one or separate containers.

15. (canceled)

16. The method of claim 2, wherein said stress conditions are selected from the group consisting of biological, mechanical and environmental stresses.

17. The method of claim 3, wherein said metabolites are produced by IL4I1.

18. The method of claim 4, wherein said mammalian cells are selected from the group consisting of human, cells, tissues, whole blood, cell lines, cellular supernatants, primary cells, IPSCs, hybridomas, recombinant cells, stem cells, and cancer cells, bone cells, cartilage cells, nerve cells, glial cells, epithelial cells, skin cells, scalp cells, lung cells, mucosal cells, muscle cells, skeletal muscles cells, striated muscle cells, smooth muscle cells, heart cells, secretory cells, adipose cells, blood cells, erythrocytes, basophils, eosinophils, monocytes, lymphocytes, T-cells, B-cells, neutrophils, NK cells, regulatory T-cells, dendritic cells, Th17 cells, Th1 cells, Th2 cells, myeloid cells, macrophages, monocyte derived stromal cells, bone marrow cells, spleen cells, thymus cells, pancreatic cells, oocytes, sperm, kidney cells, fibroblasts, intestinal cells, cells of the female or male reproductive tracts, prostate cells, bladder cells, eye cells, corneal cells, retinal cells, sensory cells, keratinocytes, hepatic cells, brain cells, kidney cells, and colon cells, and the transformed counterparts of said cells or tissues.

19. The method of claim 5, wherein said mammalian subject is a human subject suffering from an AHR-related physiological or pathological condition.

20. The method of claim 7, further comprising detecting a change of a biological state of IL4I1 in a biological sample, wherein a change in the biological state of said IL4I1 in the presence of said at least one modulator compared to the absence of said at least one modulator identifies a modulator.

21. The method of claim 8, wherein said metabolites are modulated by IL4I1.

22. The method of claim 13, wherein said method further comprises unsupervised clustering or supervised classification of said samples into different subgroups of AHR modulation.

23. The method of claim 13, wherein said method further comprises a stratification of said subject into a particular group of subjects or patient groups.

Description

[0075] The invention shall now be further described in the following examples with reference to the accompanying figures, nevertheless, without being limited thereto. For the purposes of the present invention, all references as cited herein are incorporated by reference in their entireties.

[0076] FIG. 1 shows that IL4I1 is expressed in various tumor entities. a, heatmap representation of the median log 2 transcript per million (log 2 TPM) of IDO1, IDO2, TDO2 and IL4I1 expression in the Genotype-Tissue Expression dataset (GTEX) comprising 30 non-diseased tissues. Empty cells denote no expression was detected. Dot size and shading colors correspond to the expression level, light grey denoting low expression and dark grey denoting high expression levels. b, heatmap representation of the median log 2 transcript per million (log 2 TPM) of IDO1, IDO2, TDO2 and IL4I1 expression in 32 TCGA tumors.

[0077] FIG. 2 shows that IL4I1 activates the AHR. a, mRNA expression of selected AHR target genes in shCtrl and shAHR U-87MG cells expressing IL4I1, relative to shCtrl U-87MG cells without IL4I1 expression (dashed line), cultured for 120 h (n=3 for EGR1, IL1B, MMP1; n=4 for all other genes). b, Immunoblot (left) and quantification (right) of the nuclear to cytoplasmic ratio of AHR protein expression, in LN-229 cells upon 4 h treatment with supernatants of Ctrl and IL4I1-expressing U-251MG cells cultured for 120 h (n=3). c, TIPARP mRNA expression in CAS-1 cells treated with siRNA targeting IL4I1, relative to cells treated with siCtrl, cultured for 72 h (n=4). d, Concentration of Phe, Tyr and Trp in supernatants of Ctrl and IL4I1-expressing U-87MG cells, cultured for 120 h (n=3). e, IL4I1 activity in lysates of U-87MG cells expressing IL4I1 in presence of Phe, Tyr or Trp (n=3). f, K.sub.m values of IL4I1 for Phe and Trp (n=5). g, Volcano plots showing the differential regulation of AHR target genes in microarray data of U-87MG cells exposed to 40 μM of PP (left), HPP (middle) or I3P (right) for 24 h compared to vehicle (n=5). Dark grey data points represent selected regulated AHR target genes. Light grey data points represent all other genes. The vertical dotted lines denote a log 2FC of +/−0.58 and the horizontal dotted line is at a p-value cutoff of 0.01. h, TIPARP mRNA expression in U-87MG treated with PP, HPP, I3P or vehicle (dashed line) for 24 h (n=3). i, Representative images of GFP-Ahr expressing tao BpRc1c cells treated with 25 μM PP, HPP, I3P or vehicle for 4 h. n values represent independent experiments. Data are presented as mean±S.E.M and were analyzed by two-tailed paired student's t-test (c, d, e), two-tailed unpaired student's t-test (f, h), one-way ANOVA with Tukey's multiple comparisons test (g) or repeated measures ANOVA with Dunnett's multiple comparisons test (j). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. n.s., not significant. *shCtrl compared to IL4I1-shCtrl; #IL4I1-shCtrl compared to IL4I1-shAHR.

[0078] FIG. 3 shows that IL4I1 degrades aromatic amino acids and produces AHR ligands. a, Phenylpyruvate (PP), phenylacetic acid (PAA), hydroxyphenylpyruvate (HPP), hydroxybenzaldehyde (HBA) and hydroxyphenylacetic acid (HPAA) in the supernatant of U87-ctrl and U87-IL4I1 cells (120 h). b, HBA, HPAA, HPP, PAA and PP in the supernatant of U251-ctrl and U251-IL4I1 cells (120 h). c, Kynurenine (Kyn), kynurenic acid (KynA), indole-3-pyruvate (I3P), indoleacetic acid (IAA), indole-3-carboxaldehyde (I3CA) and indole-3-lactic acid (ILA) in the supernatant of U87-ctrl and U87-IL4I1 cells (120 h). d, KynA, Kyn, I3P, IAA, I3CA and ILA in the supernatant of U251-ctrl and U251-IL4I1 cells (120 h).*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. One sample t test.

[0079] FIG. 4 shows the IL4I1-derived Trp metabolites and their effect on AHR activity. a, Relative abundance of Kyn, KynA, IAA, and I3CA in supernatants of U-87MG cells treated with I3P or vehicle for 24 h (n=4). b, Representative chromatogram showing KynA measured by HPLC with overlay of a KynA standard (black, highest peak, 20 pmol on column). Black, lowest peak: 3.33 mg/mL I3P in phosphate buffered saline (PBS) incubated for 24 h. Grey peak: 3.33 mg/mL I3P incubated in PBS in the presence of 1 mM H.sub.2O.sub.2 for 24 h (n=2). c-e, TIPARP mRNA expression in U-87MG cells treated with IAA (c), ILA (d), I3CA (e) or vehicle for 24 h (n=3). f, TIPARP mRNA expression in shCtrl and shAHR U-87MG cells treated with 50 μM KynA or vehicle for 24 h (n=3). g, Representative images of GFP-Ahr expressing tao BpRc1c cells treated with either vehicle or 50 μM KynA for 1 h. n values represent independent experiments. Data are presented as mean±S.E.M and were analyzed by two-tailed paired student's t-test (a, b, h) or repeated measures ANOVA with Dunnett's multiple comparisons test (c, e-g). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. n.s., not significant.

[0080] FIG. 5 shows that IL4I1 expression is regulated by AHR IL4I1 mRNA expression in CAS-1 cells treated with siRNA targeting AHR, relative to cells treated with siCtrl.

[0081] FIG. 6 shows a block diagram of the system in accordance with the aspects of the disclosure. CPU: Central Processing Unit (“processor”).

[0082] FIG. 7 shows the flowchart of an exemplary embodiment.

[0083] SEQ ID Nos: 1 to 26 show sequences of oligomers as used in the present invention.

EXAMPLES

Material and Methods

Microarray and RNA-Seq Data Analysis

[0084] Array datasets—The affymetrix microarray chips “human gene 2.0 ST” were analyzed using the oligo package and annotated using NetAffx (14). Raw CEL files were RMA normalized and summarized. Differential gene expression was performed using the limma pipeline for microarrays (15).

[0085] RNA-seq datasets—The harmonized FPKM data of The Cancer Genome Atlas (TCGA) tumor datasets were downloaded using TCGAbiolinks (16) from GDC (https://gdc.cancer.gov), and only patients with the identifier “primary solid tumor” were retained. The FPKM values were converted to Transcripts per Million (TPMs) (17), TPM data of normal tissues were downloaded from the Genotype-Tissue Expression dataset (GTEX—https://gtexportal.org/home/). All TPM values were log 2 transformed.

Cell Culture

[0086] HEK293T, LN-229, Tao BpRc1 and U-87MG were obtained from ATCC. CAS-1 and U-251MG were from ICLC and ECACC, respectively. CAS-1, HEK293T, LN-229, U-87MG and U-251MG were cultured in phenol-red free high glucose DMEM medium (Gibco, 31053028) supplemented with 10% FBS (Gibco, 10270106), 2 mM L-glutamine (Gibco, 25030-024), 1 mM sodium pyruvate (Gibco, 11360-039), 100 U/mL penicillin and 100 μg/mL streptomycin (Gibco, 15140-122) (henceforth, referred to as complete DMEM). Tao BpRc1 cells were cultured as above, but with complete phenol-red free DMEM and 5 μg/mL tetracycline (Sigma-Aldrich, T3383). For translocation assays medium with 10% Tet System Approved FBS (Clontech, 631107) was used. Cells were cultured at 37° C. and 5% CO.sub.2.

Generation of Transgenic Cell Lines

[0087] Human IL4I1 cDNA clone flanked by Gateway compatible recombination sites was purchased from MyBiosource (MBS1270935). The cDNA clone was recombined into Lentivirus compatible Gateway expression vector pLX301 (a gift from D. Root, Addgene plasmid 25895).sup.18. Production of Lentiviruses was achieved by transfecting HEK293T with pMD2.G (a gift from D. Trono, Addgene plasmid 12259), psPAX2 (a gift from D. Trono, Addgene plasmid 12260), and lentiviral plasmid, using FuGENE HD (Promega, E2311), according to the manufacturer's protocol. Viral supernatants were harvested at 48 h and 72 h, pooled and filtered through a 0.45 μm pore filter. Stable IL4I1 overexpressing (pLX301-IL4I1) and control (pLX301) cell lines were generated by infecting U-87MG and U-251MG cells for 24 hours with respective viral supernatants in presence of 8 μg/mL polybrene (Merck Millipore, TR-1003-G), followed by selection with medium containing 1 μg/mL puromycin (AppliChem, A2856). Stable overexpression of IL4I1 was confirmed by qRT-PCR, western blot and IL4I1 enzymatic activity.

[0088] Stable knockdown of AHR in U-87MG cells was achieved using shERWOOD UltramiR Lentiviral shRNA targeting AHR (transOMIC Technologies, TLHSU1400-196-GVO-TRI). Glioma cells were infected with viral supernatants containing either shAHR or shControl (shC) sequences to generate stable cell lines. shERWOOD UltramiR shRNA sequences are:

TABLE-US-00002 shAHR (ULTRA-3234821): (SEQ ID NO: 1) 5′-TGCTGTTGACAGTGAGCGCAGGAAGAATTGTTTTAGGATATAGTGAA GCCACAGATGTATATCCTAAAACAATTCTTCCTTTGCCTACTGCCTCGG A-3′; shC (ULTRA-NT#4): (SEQ ID NO: 2) 5′-TGCTGTTGACAGTGAGCGAAGGCAGAAGTATGCAAAGCATTAGTGAA GCCACAGATGTAATGCTTTGCATACTTCTGCCTGTGCCTACTGCCTCGG A-3′.

[0089] siRNA mediated gene knockdown of IL4I1 was carried out using ON-TARGETplus Human SMARTpool siRNA reagent (Dharmacon, L-008109-00-0005). siRNA mediated gene knockdown of AHR was carried out using ON-TARGETplus Human SMARTpool siRNA reagent (Dharmacon, L-004990-00-0005). siRNA transfections were done with Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778100), following the manufacturer's protocol. ON-TARGETplus Non-targeting Pool siRNA (Dharmacon, D-001810-10-05) was used as control.

[0090] Stably transfected tao BpRc1c cells, expressing a GFP-tagged Ahr under tetracycline control, were used to visualize nuclear translocation of Ahr. The murine Ahr was cloned into the pEGFP-C1 vector (CLONTECH, Palo Alto, Calif.) including a tet-off expression system (pRevTRE, CLONTECH). The Phoenix packaging line was used for retroviral transfection into murine hepatoma tao BpRc1 cells deficient of endogenous Ahr expression.

Cell Culture Treatment Conditions

[0091] For treatment of adherent cells with established and hypothetical AHR ligands, 4×10.sup.5 cells per well were seeded in six well plates and incubated for 24 h prior to treatment. Non-adherent cells were seeded in 24 well plates at 5×10.sup.5 cells in 1 mL and treated immediately. For verification of the generated AHR signature, cells were treated with the established AHR agonist Kyn (50 μM, SigmaAldrich, K8625) for 24 h. In order to investigate the potential of direct and downstream IL4I1 metabolites to activate the AHR, cells were treated with I3P (3.125 μM to 100 μM, Sigma-Aldrich, 17017), HPP (8 μM to 1000 μM, Sigma-Aldrich, 114286), PP (8 μM to 1000 μM, Alfa Aesar, L11934), kynurenic acid (50 μM, Sigma-Aldrich, K3375), indole-3-lactic acid (25 μM to 100 μM, Sigma-Aldrich, 15508), 3-indoleacetic acid (25 μM to 100 μM, Sigma-Aldrich, 12886), indole-3-carboxaldehyde (6.25 μM to 100 μM, Sigma-Aldrich, 129445) and supernatants of U-87MG or U-251MG control and IL4I1 expressing cells for 24 h. When using the AHR antagonist SR1 (1 μM, Merck Millipore, 182706), cells were treated for 24 h alone or in combination with AHR ligands. DMSO was used for dissolving all compounds such that its final concentration in culture medium did not exceed 0.2%.

[0092] For gene and protein expression experiments involving U-87MG and U-251MG control and IL4I1 expressing cells, 4×10.sup.5 cells per well were seeded in 2 mL in six well plates, and incubated for 72 or 120 h. For metabolomics experiments, cells were seeded at a density of 4×10.sup.5 cells per well in 2 mL of complete DMEM in six well plates and incubated for 24 h. In cases where more cells and supernatant were needed, 2.6×10.sup.6 cells per well were seeded in 13.3 mL of complete DMEM in 10 cm dishes and incubated for 24 h. After 24 h, cells were washed once with PBS, 2 or 13.3 mL of fresh FBS-free DMEM were added (depending on the well size and cell density used) and cells were incubated for 120 h. Sample preparation was adapted from previous studies.sup.19,20. Briefly, supernatants were snap frozen in liquid nitrogen and stored at −80° C. until metabolite measurement. Plates containing cells were quickly washed once with 37° C. pre-heated cell culture grade water, quenched with liquid nitrogen and stored at −80° C. until metabolite measurement.

[0093] For experiments where IL4I1 was knocked down in CAS-1 cells, 4×10.sup.5 cells per well in six well plates were seeded and incubated for 24 h. Cells were transfected with respective control or targeting siRNA. Complete DMEM was replaced with 1.5 mL of FBS-free DMEM 24 h post-transfection and cells were incubated for 72 h.

RNA Isolation and Real Time PCR

[0094] Total RNA was harvested from cultured cells using the RNeasy Mini Kit (Qiagen, 80204) followed by cDNA synthesis using the High Capacity cDNA reverse transcriptase kit (Applied Biosystems, 4368813). A StepOne Plus real-time PCR system (Applied Biosystems) was used to perform real-time PCR of cDNA samples using SYBR Select Master mix (Thermo Scientific, 4309155). Data was processed and analysed using the StepOne Software v 2.3. Relative quantification of target genes was done against RNA18S as reference gene using the 2.sup.ΔΔCt method. Human primer sequences are listed in table 2 as follows.

TABLE-US-00003 TABLE 2 Human primer sequences Gene Forward Primer (5′->3′) Reverse Primer (5′->3′) ABCG2 TTCCACGATATGGATTTACGG GTTTCCTGTTGCATTGAGTCC (SEQ ID NO: 3) (SEQ ID NO: 4) AHRR CCCTCCTCAGGTGGTGTTTG CGACAAATGAAGCAGCGTGT (SEQ ID NO: 5) (SEQ ID NO: 6) CYP1B1 GACGCCTTTATCCTCTCTGCG ACGACCTGATCCAATTCTGCC (SEQ ID NO: 7) (SEQ ID NO: 8) EGR1 CTGACCGCAGAGTCTTTTCCT GAGTGGTTTGGCTGGGGTAA (SEQ ID NO: 9) (SEQ ID NO: 10) EREG CTGCCTGGGTTTCCATCTTCT GCCATTCATGTCAGAGCTACACT (SEQ ID NO: 11) (SEQ ID NO: 12) IL1B CTCGCCAGTGAAATGATGGCT GTCGGAGATTCGTAGCTGGAT (SEQ ID NO: 13) (SEQ ID NO: 14) IL4I1 CGCCCGAAGACATCTACCAG GATATTCCAAGAGCGTGTGCC (SEQ ID NO: 15) (SEQ ID NO: 16) MMP1 GCTAACCTTTGATGCTATAACTACGA TTTGTGCGCATGTAGAATCTG (SEQ ID NO: 17) (SEQ ID NO: 18) NPTX1 CATCAATGACAAGGTGGCCAAG GGGCTTGATGGGGTGATAGG (SEQ ID NO: 19) (SEQ ID NO: 20) RNA18S GATGGGCGGCGGAAAATAG GCGTGGATTCTGCATAATGGT (SEQ ID NO: 21) (SEQ ID NO: 22) SERPINB2 ACCCCCATGACTCCAGAGAA CTTGTGCCTGCAAAATCGCAT (SEQ ID NO: 23) (SEQ ID NO: 24) TIPARP CACCCTCTAGCAATGTCAACTC CAGACTCGGGATACTCTCTCC (SEQ ID NO: 25) (SEQ ID NO: 26)

Protein Isolation and Western Blots

[0095] For AHR translocation assays, protein content in the nuclear and the cytoplasmic fractions of LN-229 glioma cells was compared by immunoblotting. LN-229 cells were treated with supernatants of U-251MG control or IL4I1 expressing cells (120 h) for 4h. Lysates were snap frozen in liquid nitrogen and thawed three times following 10 cycles of ultrasonication after each freeze-thaw cycle. To isolate protein from the two different cellular fractions NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific Inc.) were used. Extraction was performed following the manufacturer's instructions. Nuclear specific Lamin A served as control for appropriate fractionation and was detected using polyclonal rabbit anti-Lamin A (1:500, BioLegend), respectively. AHR was detected using the primary mouse monoclonal anti-AHR antibody clone RPT1 (Abcam, Berlin, Germany).

AHR Nuclear Translocation Assay

[0096] For induction of GFP-Ahr expression in the transgenic tao BpRc1c cells, cells were taken off tetracycline 24 h before translocation assays. Assays were performed in black clear bottom 96-well plates (BD, #353219) with 7500 cells/well in 150 μl/well. Metabolites were added in 50 μL/well induction medium. Cells were exposed for 4h to 25 μM PP, HPP, and I3P respectively. Medium was discarded and cells fixed with pre-warmed 3.7% formaldehyde in PBS (10 min at RT). After fixation cells were washed with detergent buffer (DB, 0.01% Tween20 in PBS, Sigma Aldrich), followed by permeabilization with 0.1% Triton X-100 in PBS (Sigma Aldrich) for 15 min at RT. Cells were washed twice with DB and incubated with 0.4 ng/ml Hoechst 33342 (Sigma Aldrich) for 30 min at RT protected from light. After washing with DB and PBS cells were stored in PBS at 4° C. until translocation analysis. Translocation by KynA was monitored by live cell imaging after 3 h of exposure including the appropriate negative medium control. Translocation of Ahr by the different metabolites was monitored on a BD Pathway Imager 855.

Metabolomic Analyses

[0097] Consumption of phenylalanine, tyrosine and Trp by IL4I1-expressing and non-expressing U-87MG and U-251MG cells was assessed by quantification of the amino acids in the cell culture supernatants after 120 h incubation. For phenylalanine and tyrosine detection, amino acids were labeled with the fluorescent dye AccQ-Tag™ (Waters) according to the manufacturer's protocol. The derivatization product was separated at 42° C. on an Acquity BEH C18 column (Waters) using an Acquity H-class UPLC system (Waters) coupled to an Acquity fluorescence detector (FLR) (Waters). Samples were analyzed on the UPLC as described before by Yang et. al., 2015.sup.21. For analyses of Trp consumption, supernatants were mixed with an equal volume of 12% perchloric acid and incubated on ice for 10 min. Prior to analysis, samples were centrifuged for 10 min at 4° C. and 16,400 g to precipitate proteins and remove remaining cell debris. Metabolites were then separated by reversed phase chromatography on an Acquity HSS T3 column (100 mm×2.1 mm, 1.7 μm, Waters) connected to an Acquity H-class UPLC system (Waters). The column was heated to 37° C. and equilibrated with 5 column volumes of 100% solvent A (20 mM sodium acetate, 3 mM zinc acetate, pH 6) at a flow rate of 0.55 mL/min. Clear separation of Trp was achieved by increasing the concentration of solvent B (acetonitrile) in solvent A as follows: 4 min 0% B, 10 min 5% B, 13 min 15% B, 15 min 25% B, and return to 0% B in 3 min. Trp was detected by fluorescence (Acquity FLR detector, Waters, excitation: 254 nm, emission: 401 nm). Standards were used for quantification (Sigma). Data acquisition and processing was performed with the Empower3 software suite (Waters). We took an untargeted metabolomics approach to identify metabolites that were differentially abundant in supernatants of IL4I1-expressing versus non-expressing U-87MG and U-251MG cells cultured for 120 h. To this end, 50 μl of cell culture supernatants were mixed with 200 μl ice-cold acetonitrile by vortexing followed by incubation at −20° C. for 1 h. Samples were centrifuged for 15 min at 4° C. and transferred into TruView UPLC-MS vials (Waters). A pool sample was prepared by mixing equal volumes of all samples. Samples were measured using an I-class UPLC system coupled to a Vion IMS QTof MS (Waters). Metabolites were separated using either a Cogent Diamond Hydride 2.0 column (150×2.1 mm, 2.2 μm; MicroSolv USA) or a HSS T3 column (100×2.1 mm, 1.8 μm; Waters). For instrument control and acquisition of MS data UNIFI 1.8.2 (Waters) was used. Follow-up data analyses were performed using Progenesis QI (Waters). ILA was detected at 204.0662 Da (neg. mode; expected monoisotopic mass: 205.0739 Da; deviation −2 ppm) and identified by the expected fragment ions at 116.0495, 128.0495, 130.0652 and 204.0655 Da. Selected differentially abundant Trp-, phenylalanine- and tyrosine-derived metabolites (IAA, I3CA, KynA, PP, HPP, HBA) and further downstream transformation products (Kyn, PAA, HPAA) were identified by comparing their fragmentation patterns resulting from suspect LC-MS measurements using an HPLC (Agilent 1290) coupled to a triple quad MS (Agilent 6460) with external standards.

[0098] For targeted quantification of the metabolites, MRM mode was used. For all test compounds 10 mM stock solutions were prepared by gravimetrically adding the required amount into 1.5 mL Eppendorf safe-lock tubes and dissolving the test compound in 1 mL DMSO. For each compound, stock solutions covered a concentration range from 10 mM to 0.039 mM. For quantification of the metabolites, 300 μL of each bioassay supernatant was added into Eppendorf safe-lock tubes. Associated calibration samples were prepared by adding 300 μL cell culture media and 1 μL of test compound stock solution into Eppendorf safe-lock tubes. Subsequently, 300 acetonitrile was added to trigger precipitation of media components. All samples were centrifuged at 8000 rpm for 4 min and 150 μL of the supernatants was transferred into 1.5 mL glass vials equipped with 200 μL glass inserts for HPLC analysis. 5 μl of the sample was injected for the analysis. Water and acetonitrile with 0.1% formic acid were used as eluent A and B, respectively for HPLC separation for 5 min with a flowrate of 0.5 mL/min. Separation was achieved using a 50 mm long Poroshell 120 EC-C18 2.7 micron column (Agilent). The Agilent Jetstream ESI source was set to gas and gas sheath temperature of 300° C., with a gas flow of 10 L/min and sheath gas flow of 11 L/min. The nebulizer pressure was set to 55 psi and capillary voltage at 2000 V throughout the run. For instrument control and data acquisition MassHunter software suite (Agilent) was used.

IL4I1 Activity Assay

[0099] U-87MG and U-251MG cells stably expressing IL4I1 and control transduced counterparts were lysed in 0.1% Triton X-100/PBS. Human tissue obtained from resection of metastatic melanoma was lysed in 1% Triton X-100/PBS by shaking with stainless steel beads in a Mixer Mill MINI 301 for two cycles of 1 min at 40 Hz. IL4I1 activity was determined by measuring H.sub.2O.sub.2 production via Amplex® Red fluorescence (excitation at 530 nm and emission at 590 nm) every minute for 60 minutes in black 96-well plates using a CLARIOstar® (BMG LABTECH) plate reader. Reactions were prepared in PBS and contained 50 μM Amplex® Red (Cayman Chemicals, #Cayl0010469), 0.1 U/mL HRP (Merck Millipore, #516531) and amino acids as IL4I1 substrates as indicated in figure legends. IL4I1 independent H.sub.2O.sub.2 production was assessed in absence of amino acids and subtracted from activity obtained in presence of substrate. IL4I1 mediated H.sub.2O.sub.2 production was calculated using an H.sub.2O.sub.2 calibration curve (0-10 μM final) and normalized to sample protein content as quantified by Bradford assay.

Software and Statistics

[0100] Graphical and statistical analysis of gene (real time-PCR) and protein expression data, as well as metabolite data were done using GraphPad Prism software versions 6.0 and 8.0. Unless otherwise indicated, data represents the mean±S.E.M of at least 3 independent experiments. In cases where data was expressed as fold of change, these values were Log 10 transformed and the resulting values were used for statistical analysis. Depending on the data, the following statistical analyses were applied: two-tailed student's t-test (paired or unpaired), one-way ANOVA with Tukey's multiple comparisons test and repeated measures ANOVA with Dunnett's multiple comparisons test. Significant differences were reported as *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. n. s. indicates no significant difference.

[0101] When comparing the expression levels of Trp degrading enzymes in normal (GTEX) and tumor tissue, the inventors found that IL4I1 expression was enhanced in cancer tissues compared to normal tissues, similar to IDO1 and TDO2, other tryptophan degrading enzymes that are implicated in activating AHR, (FIG. 1a,b). The inventors show that qRT-PCR of AHR target genes confirmed AHR activation mediated by IL4I1 (FIG. 2a). Further confirming IL4I1-mediated AHR activation, increased nuclear/cytoplasmic localization of the AHR was detected in glioblastoma cells treated with supernatants of the IL4I1-expressing cells (FIG. 2b). Conversely, knockdown of IL4I1 in glioblastoma cells, which constitutively express IL4I1, decreased the expression of the AHR target gene TIPARP (FIG. 2c). Taken together, the inventors' results reveal that IL4I1 indeed activates the AHR.

[0102] Next, the inventors set out to investigate how IL4I1 activates the AHR. In keeping with previous reports, IL4I1 expression reduced the levels of phenylalanine, tyrosine and tryptophan (FIG. 2d) with phenylalanine being catabolized most efficiently (FIG. 2e,f). IL4I1 converts phenylalanine, tyrosine and tryptophan to phenylpyruvic acid (PP), hydroxyphenylpyruvic acid (HPP), and indole-3-pyruvic acid (I3P), respectively (1). The inventors therefore exposed AHR-proficient glioblastoma cells to these metabolites to investigate if they activate the AHR. While PP and HPP did not elicit relevant modulation of AHR target genes, gene expression analyses revealed significant regulation of AHR activation signature genes in response to I3P (FIGS. 2g,h), which was AHR-dependent. In line, nuclear translocation of the AHR was observed only in response to I3P (FIG. 2i). In summary, the inventors' results indicate that IL4I1 activates the AHR mainly through generation of I3P, which is in agreement with findings from microbiota-derived I3P and I3P generated by D-amino acid oxidase and aspartate aminotransferase (22-25).

[0103] The IL4I1-expressing cells showed high levels of PP and HPP as well as their downstream metabolites phenyl acetic acid (PAA), 4-hydroxybenzaldehyde (HBA) and hydroxyphenyl acetic acid (HPAA) (FIG. 3a,b). To the inventors' surprise the inventors were unable to detect I3P (FIG. 3c,d). However, the inventors detected increased levels of compounds derived from I3P including indole acetic acid (IAA), indole-3-carboxaldehyde (I3CA) and indole-3-lactic acid (ILA) (FIG. 3c,d), suggesting that the metabolic flux through I3P is very rapid. Moreover, the levels of kynurenic acid were elevated in the supernatants of the IL4I1 expressing cells (FIG. 3c,d). Treatment of glioblastoma cells with increasing concentrations of I3P resulted in a dose-dependent increase in IAA, I3CA and kynurenic acid in the cell supernatants (FIG. 4a). One reaction through which IL4I1 could enhance kynurenic acid levels is by transamination of kynurenine (produced by IDO1 and/or TDO2) as kynurenine aminotransferase can use I3P, PP or HPP as amino group acceptors (26). However, kynurenine concentrations were not reduced in IL4I1 expressing cells rendering this hypothesis unlikely (FIG. 3c,d). Kynurenic acid formed spontaneously from I3P, which was enhanced in the presence of H.sub.2O.sub.2 (FIG. 4b), suggesting that the H.sub.2O.sub.2 produced by IL4I1 concomitantly with I3P promotes its conversion to kynurenic acid. Indeed, generation of kynurenic acid from I3P that was produced via tryptophan transamination in rat tissues was described previously (27). While the inventors did not observe relevant induction of the AHR target gene TIPARP in response to IAA or I3L (FIG. 4c, d), I3CA (FIG. 4e) and kynurenic acid (FIG. 4f) induced TIPARP transcripts. AHR activation mediated by kynurenic acid was confirmed by nuclear translocation of the AHR (FIG. 4g). In summary, the inventors' data suggest that IL4I1 activates the AHR through downstream products of I3P including kynurenic acid and I3CA, yielding a mixture of AHR activating compounds.

REFERENCES AS CITED

[0104] 1 Mason, J. M. et al. IL-4-induced gene-1 is a leukocyte L-amino acid oxidase with an unusual acidic pH preference and lysosomal localization. J Immunol 173, 4561-4567 (2004). [0105] 2 Chavan, S. S. et al. Characterization of the human homolog of the IL-4 induced gene-1 (FIG. 1). Biochim Biophys Acta 1576, 70-80 (2002). [0106] 3 Chu, C. C. & Paul, W. E. FIG. 1, an interleukin 4-induced mouse B cell gene isolated by cDNA representational difference analysis. Proc Natl Acad Sci USA 94, 2507-2512 (1997). [0107] 4 Boulland, M. L. et al. Human IL4I1 is a secreted L-phenylalanine oxidase expressed by mature dendritic cells that inhibits T-lymphocyte proliferation. Blood 110, 220-227, doi:10.1182/blood-2006-07-036210 (2007). [0108] 5 Carbonnelle-Puscian, A. et al. The novel immunosuppressive enzyme IL4I1 is expressed by neoplastic cells of several B-cell lymphomas and by tumor-associated macrophages. Leukemia 23, 952-960, doi:10.1038/leu.2008.380 (2009). [0109] 6 Lasoudris, F. et al. IL4I1: an inhibitor of the CD8(+) antitumor T-cell response in vivo. Eur J Immunol 41, 1629-1638, doi:10.1002/eji.201041119 (2011). [0110] 7 Santarlasci, V. et al. Rarity of human T helper 17 cells is due to retinoic acid orphan receptor-dependent mechanisms that limit their expansion. Immunity 36, 201-214, doi:10.1016/j.immuni.2011.12.013 (2012). [0111] 8 Cousin, C. et al. The immunosuppressive enzyme IL4I1 promotes FoxP3(+) regulatory T lymphocyte differentiation. Eur J Immunol 45, 1772-1782, doi:10.1002/eji.201445000 (2015). [0112] 9 Esser, C., Rannug, A. & Stockinger, B. The aryl hydrocarbon receptor in immunity. Trends Immunol 30, 447-454, doi:S1471-4906(09)00131-8 [pii]10.1016/j.it.2009.06.005 (2009). [0113] 10 Marshall, N. B. & Kerkvliet, N. I. Dioxin and immune regulation: emerging role of aryl hydrocarbon receptor in the generation of regulatory T cells. Annals of the New York Academy of Sciences 1183, 25-37, doi:10.1111/j.1749-6632.2009.05125.x (2010). [0114] 11 Veldhoen, M. et al. The aryl hydrocarbon receptor links TH17-cell-mediated autoimmunity to environmental toxins. Nature 453, 106-109, doi:nature06881 [pii] 10.1038/nature06881 (2008). [0115] 12 Platten, M., Nollen, E. A. A., Rohrig, U. F., Fallarino, F. & Opitz, C. A. Tryptophan metabolism as a common therapeutic target in cancer, neurodegeneration and beyond. Nature reviews. Drug discovery, doi:10.1038/s41573-019-0016-5 (2019). [0116] 13 Rothhammer, V. & Quintana, F. J. The aryl hydrocarbon receptor: an environmental sensor integrating immune responses in health and disease. Nat Rev Immunol, doi:10.1038/s41577-019-0125-8 (2019). [0117] 14 Carvalho, B., Bengtsson, H., Speed, T. P. & Irizarry, R. A. Exploration, normalization, and genotype calls of high-density oligonucleotide SNP array data. Biostatistics 8, 485-499, doi:10.1093/biostatistics/kx1042 (2007). [0118] 15 Ritchie, M. E. et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res 43, e47, doi:10.1093/nar/gkv007 (2015). [0119] 16 Colaprico, A. et al. TCGAbiolinks: an R/Bioconductor package for integrative analysis of TCGA data. Nucleic Acids Res 44, e71, doi:10.1093/nar/gkv1507 (2016). [0120] 17 Li, B. & Dewey, C. N. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC bioinformatics 12, 323, doi:10.1186/1471-2105-12-323 (2011). [0121] 18 Yang, X. et al. A public genome-scale lentiviral expression library of human ORFs. Nat Methods 8, 659-661, doi:10.1038/nmeth.1638 (2011). [0122] 19 Lorenz, M. A., Burant, C. F. & Kennedy, R. T. Reducing time and increasing sensitivity in sample preparation for adherent mammalian cell metabolomics. Anal Chem 83, 3406-3414, doi:10.1021/ac103313x (2011). [0123] 20 Ivanisevic, J. et al. Toward ‘omic scale metabolite profiling: a dual separation-mass spectrometry approach for coverage of lipid and central carbon metabolism. Anal Chem 85, 6876-6884, doi:10.1021/ac401140h (2013). [0124] 21 Yang, Y. et al. Relation between chemotaxis and consumption of amino acids in bacteria. Mol Microbiol 96, 1272-1282, doi:10.1111/mmi.13006 (2015). [0125] 22 Aoki, R., Aoki-Yoshida, A., Suzuki, C. & Takayama, Y. Indole-3-Pyruvic Acid, an Aryl Hydrocarbon Receptor Activator, Suppresses Experimental Colitis in Mice. J Immunol 201, 3683-3693, doi:10.4049/jimmunol.1701734 (2018). [0126] 23 Bittinger, M. A., Nguyen, L. P. & Bradfield, C. A. Aspartate aminotransferase generates proagonists of the aryl hydrocarbon receptor. Mol Pharmacol 64, 550-556, doi:10.1124/mol.64.3.550 (2003). [0127] 24 Chowdhury, G. et al. Structural identification of Diindole agonists of the aryl hydrocarbon receptor derived from degradation of indole-3-pyruvic acid. Chem Res Toxicol 22, 1905-1912, doi:10.1021/tx9000418 (2009). [0128] 25 Nguyen, L. P. et al. D-amino acid oxidase generates agonists of the aryl hydrocarbon receptor from D-tryptophan. Chem Res Toxicol 22, 1897-1904, doi:10.1021/tx900043s (2009). [0129] 26 Han, Q., Li, J. & Li, J. pH dependence, substrate specificity and inhibition of human kynurenine aminotransferase I. Eur J Biochem 271, 4804-4814, doi: 10.1111/j.1432-1033.2004.04446.x (2004). [0130] 27 Russi, P., Carla, V. & Moroni, F. Indolpyruvic acid administration increases the brain content of kynurenic acid. Is this a new avenue to modulate excitatory amino acid receptors in vivo? Biochem Pharmacol 38, 2405-2409 (1989).