METHOD FOR DIAGNOSING CANCER USING CFDNA
20220170108 · 2022-06-02
Assignee
Inventors
Cpc classification
C12Q2563/155
CHEMISTRY; METALLURGY
C12Q2527/125
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q2563/155
CHEMISTRY; METALLURGY
C12Q2527/125
CHEMISTRY; METALLURGY
International classification
Abstract
Provided is a diagnostic method in which small-sized cfDNA is concentrated and isolated from a liquid sample such as urine, cerebrospinal fluid, plasma, blood, pleural fluid, or body fluid, and then a biomarker overexpressed in a specific cancer is detected with ultra-high sensitivity without PCR, and the method does not require a PCR amplification reaction and thus can greatly reduce time taken to diagnose cancer, and since it can be directly analyzed in the field, it can be used as a point-of-care testing (POCT) that can simultaneously search a large number of genes within a short time.
Claims
1.-300. (canceled)
301. A method for diagnosing cancer by detecting a gene derived from cancer cells from a sample without amplification, wherein the method comprises: a) a step of mixing a biological sample isolated from an individual comprising cell-free DNA (cfDNA) and a positively charged material; b) a step of mixing a probe having a sequence complementary to the cfDNA and a marker in the mixture; and c) a step of detecting the marker bound to the cfDNA, wherein the probe having a sequence complementary to cfDNA complementarily binds to a gene known as a cancer biomarker.
302. The method for diagnosing cancer according to claim 301, wherein the cancer is prostate cancer, lung cancer, thyroid cancer, bladder cancer, breast cancer, colorectal cancer, biliary tract cancer, gastric cancer, or pancreatic cancer.
303. The method for diagnosing cancer according to claim 301, characterized in that the cfDNA i) has a lower Tm value than that of cfDNA having a double helix structure derived from normal cells, or ii) is denatured in a condition in which the cfDNA having a double helix structure derived from normal cells is not denatured.
304. The method for diagnosing cancer according to claim 301, wherein the step of b) is sequentially or simultaneously mixing the probe and the marker in the mixture.
305. The method for diagnosing cancer according to claim 301, wherein the probe having a sequence complementary to cfDNA complementarily binds to a gene selected from the group consisting of KLK3, FOLH1, PCA3, PDE4D7, SFMBT2, EFEMP1, RETN, ACADL, AGR2, COL1A1, FAM13C, GPX8, GRHL2, HNF1A, HOXB13, KLK2, MYBPC1, NROB1, PITX2, SFRP4, SLCO1B3, TMEFF2, TMPRSS2-ERG, ACPP, CPT1A, IFNG, CD274, FOLR1, EPCAM, OGT, and a combination thereof; a gene selected from the group consisting of SART3, PLAT, ALK, ROS1, PI3K, S100P, CDCA7, S100A2, ETV4, ENO2, ACPP, KRT19, EGFR, KRAS, RET ERBB2, MMP11, TOP2A, UBE2C, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; a gene selected from the group consisting of TG, CALCA, APOC1, HIG2, ENO2, ACPP, TYRO3, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; a gene selected from the group consisting of OGT FGFR3, TP53, NUMA1, COCH, CELSR3, HMOX1, KIF1A, MGC17624, MTAP, PFKFB4, S100A8, RSPH9, FOXM1, FANCB, FANCC, FANCD2, RUSC1-AS1, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLXDC2, ZNF312, SYCP2L, HOXA9, ISL1, ALDH1A3, KRT19, CCNB1, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; a gene selected from the group consisting of MEST, NR1D1, BIRC5, RACGAP1, DHCR7, STC2, AZGP1, RBBP8, IL6ST, MGP, TRBC1, MMP11, COL10A1, C10orf64, COL11A1, POTEG, FSIP1, HER2, MUC1, ACPP, TYRO3, UBE2C, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; a gene selected from the group consisting of NCKAP1, AUNIP, NOTUM, KRT5, TUBB, COL6A1, JUP, CDX2, MELTF, EFEMP2, DEFA5, CHEK1, MAD2L1, ENC1, CSE1L, RAD51AP1, ERICH3, SLC7A11, KRT23, PLAU, CDCA1, KLK6, DPEP1, CDH3, ANLN, CXCL1, CTHRC1, LCN2, HS6ST2, EGFL6, CXCL3, CA9, PROX1, SPP1, CST1, CXCL2, TSTA3, RRM2, MMP3, MMP7, MMP10, CXCL5, SERPINB5, TEAD4, BUB1, CDC2, CLDN2, HSPH1, LY6G6D, PRC1, PUS1, SQLE, TTK, ECT2, RNF183, FBXO39, TEX38, TTLL2, PRR7, CANP, KIAA0101, ACPP, FLU3, TYRO3, COTL1, CK7, CK20, MUC2, SDC2, ASB9, CCNB1, MELK, CKS2, IFITM1, CEACAM6, ATAD2, TOP2A, CPT1A, DSCC1, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; a gene selected from the group consisting of MUC16, ASH1L, DOCK7, ACPP, FLU3, CPT1A, DSCC1, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; a gene selected from the group consisting of CGB, PARP1, FOXO3A, MED30, CCNE1, MYC, TFF1, FABP1, LAMP5, MATN3, CLIP4, NOX4, ADRA2C, CSK, FZD9, GALR1, GRM6, INSR, LPHN1, LYN, MRGPRX3, ADCY3, HDAC2, CFL1, NRP2, ANXA10, TFF2, CDCA5, NUSAP1, ACPP, FLU3, KRT19, ER882, EGFR, KRAS, DSCC1, CK20, MUC2, SDC2, COTL1, ATAD2, AS89, MMP1, CEACAM6, DSCC1, CKS2, CST1, IFITM1, MELK, LGALS3BP, CPT1A, IFNG, CD279, CD274, ER882, EGFR, FOLR1, EPCAM, and a combination thereof; or a gene selected from the group consisting of SMAD4, APC, GNAS, KRAS, MUC1, MSLN, CEACAM1, CEACAM5, MUC16, and a combination thereof.
306. The method for diagnosing cancer according to claim 301, wherein the sample is selected from the group consisting of urine, cerebrospinal fluid, plasma, blood, pleural fluid, ascites, saliva, sputum, and body fluid samples.
307. The method for diagnosing cancer according to claim 301, wherein the probe is composed of a 15-mer to 30-mer nucleotide, and at least one biotin is bound to the probe.
308. The method for diagnosing cancer according to claim 301, wherein: the marker is selected from the group consisting of a quantum dot, a HRP (horse-radish peroxidase), a fluorescent protein, a phosphor, an alkaline phosphatase, and a luciferase, an avidin-based protein is bound to the marker, and the avidin-based protein is selected from the group consisting of avidin, streptavidin, and a combination thereof.
309. The method for diagnosing cancer according to claim 301, wherein the marker is a nanoparticle comprising a conductive polymer; hyaluronic acid; avidin or streptavidin; and a HRP (horse-radish peroxidase) or a fluorescent protein, and wherein the marker is detected in step (c) by a color change, a UV absorbance change, a fluorescence change, or an electrochemical change.
310. A diagnostic kit for diagnosing cancer, comprising: a probe to which biotin is bound, complementarily binding to a gene specifically expressed in cancer; a positively charged material; a marker to which an avidin-based protein is bound; and a manual, wherein the manual describes that the kit is configured to be capable of diagnosing cancer without gene amplification by the following protocol: a) isolate cfDNA from a biological sample isolated from an individual using a positively charged material contained in the kit; b) mix sequentially or simultaneously a probe to which biotin is bound contained in the kit and a marker contained in the kit in the isolated cfDNA; and c) detect the signal of the marker.
311. The diagnostic kit according to claim 310, wherein the cancer is prostate cancer, lung cancer, thyroid cancer, bladder cancer, breast cancer, colorectal cancer, biliary tract cancer, gastric cancer, or pancreatic cancer.
312. The diagnostic kit according to claim 311, wherein the gene specifically expressed in prostate cancer is selected from the group consisting of KLK3, FOLH1, PCA3, PDE4D7, SFMBT2, EFEMP1, RETN, ACADL, AGR2, COL1A1, FAM13C, GPX8, GRHL2, HNF1A, HOXB13, KLK2, MYBPC1, NROB1, PITX2, SFRP4, SLCO1B3, TMEFF2, TMPRSS2-ERG, ACPP, CPT1A, IFNG, CD274, FOLR1, EPCAM, OGT, and a combination thereof; wherein the gene specifically expressed in lung cancer is selected from the group consisting of SART3, PLAT ALK, ROS1, PI3K, S100P, CDCA7, S100A2, ETV4, ENO2, ACPP, KRT19, EGFR, KRAS, RET ERBB2, MMP11, TOP2A, UBE2C, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; wherein the gene specifically expressed in thyroid cancer is selected from the group consisting of TG, CALCA, APOC1, HIG2, ENO2, ACPP, TYRO3, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; wherein the gene specifically expressed in bladder cancer is selected from the group consisting of OGT FGFR3, TP53, NUMA1, COCH, CELSR3, HMOX1, KIF1A, MGC17624, MTAP, PFKFB4, S100A8, RSPH9, FOXM1, FANCB, FANCC, FANCD2, RUSC1-AS1, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLXDC2, ZNF312, SYCP2L, HOXA9, ISL1, ALDH1A3, KRT19, CCNB1, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; wherein the gene specifically expressed in breast cancer is selected from the group consisting of MEST, NR1D1, BIRC5, RACGAP1, DHCR7, STC2, AZGP1, RBBP8, IL6ST, MGP, TRBC1, MMP11, COL10A1, C10orf64, COL11A1, POTEG, FSIP1, HER2, MUC1, ACPP, TYRO3, UBE2C, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; wherein the gene specifically expressed in colorectal cancer is selected from the group consisting of NCKAP1, AUNIP, NOTUM, KRT5, TUBB, COL6A1, JUP, CDX2, MELTF, EFEMP2, DEFA5, CHEK1, MAD2L1, ENC1, CSE1L, RAD51AP1, ERICH3, SLC7A11, KRT23, PLAU, CDCA1, KLK6, DPEP1, CDH3, ANLN, CXCL1, CTHRC1, LCN2, HS6ST2, EGFL6, CXCL3, CA9, PROX1, SPP1, CST1, CXCL2, TSTA3, RRM2, MMP3, MMP7, MMP10, CXCL5, SERPINB5, TEAD4, BUB1, CDCl2, CLDN2, HSPH1, LY6G6D, PRC1, PUS1, SQLE, TTK, ECT2, RNF183, FBXO39, TEX38, TTLL2, PRR7, CANP, KIAA0101, ACPP, FLU3, TYRO3, COTL1, CK7, CK20, MUC2, SDC2, ASB9, CCNB1, MELK, CKS2, IFITM1, CEACAM6, ATAD2, TOP2A, CPT1A, DSCC1, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; wherein the gene specifically expressed in biliary tract cancer is selected from the group consisting of MUC16, ASH1L, DOCK7, ACPP, FLU3, CPT1A, DSCC1, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; wherein the gene specifically expressed in gastric cancer is selected from the group consisting of CGB, PARP1, FOXO3A, MED30, CCNE1, MYC, TFF1, FABP1, LAMP5, MATN3, CLIP4, NOX4, ADRA2C, CSK, FZD9, GALR1, GRM6, INSR, LPHN1, LYN, MRGPRX3, ADCY3, HDAC2, CFL1, NRP2, ANXA10, TFF2, CDCA5, NUSAP1, ACPP, FLU3, KRT19, ER882, EGFR, KRAS, DSCC1, CK20, MUC2, SDC2, COTL1, ATAD2, AS89, MMP1, CEACAM6, DSCC1, CKS2, CST1, IFITM1, MELK, LGALS3BP, CPT1A, IFNG, CD279, CD274, ER882, EGFR, FOLR1, EPCAM, and a combination thereof; or wherein the gene specifically expressed in pancreatic cancer is selected from the group consisting of SMAD4, APC, GNAS, KRAS, MUC1, MSLN, CEACAM1, CEACAM5, MUC16, and a combination thereof.
313. The diagnostic kit according to claim 310, wherein the marker is a nanoparticle comprising a conductive polymer; hyaluronic acid; avidin or streptavidin; and a HRP (horse-radish peroxidase) or a fluorescent protein.
314. A device for diagnosing cancer by detecting a gene derived from cancer cells from a sample without amplification, wherein the device comprises a) a mixing part for mixing a biological sample isolated from an individual comprising cfDNA and a positively charged material; b) a reaction part for adding sequentially or simultaneously a probe to which biotin is bound and which is capable of complementarily binding to the gene specifically expressed in cancer; and a nanoparticle comprising streptavidin and a marker to the positively charged material to which cfDNA is bound; c) a detection part for detecting the marker; and d) an information processing part for determining whether there is cfDNA having a sequence complementary to the probe and derived from cancer in the sample depending on whether the marker is detected.
315. The device for diagnosing cancer according to claim 314, wherein the cancer is prostate cancer, lung cancer, thyroid cancer, bladder cancer, breast cancer, colorectal cancer, biliary tract cancer, gastric cancer, or pancreatic cancer.
316. The device for diagnosing cancer according to claim 315, wherein the gene specifically expressed in prostate cancer is selected from the group consisting of KLK3, FOLH1, PCA3, PDE4D7, SFMBT2, EFEMP1, RETN, ACADL, AGR2, COL1A1, FAM13C, GPX8, GRHL2, HNF1A, HOXB13, KLK2, MYBPC1, NROB1, PITX2, SFRP4, SLCO1B3, TMEFF2, TMPRSS2-ERG, ACPP, CPT1A, IFNG, CD274, FOLR1, EPCAM, OGT, and a combination thereof; wherein the gene specifically expressed in lung cancer is selected from the group consisting of SART3, PLAT ALK, ROS1, PI3K, S100P, CDCA7, S100A2, ETV4, ENO2, ACPP, KRT19, EGFR, KRAS, RET ERBB2, MMP11, TOP2A, UBE2C, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; wherein the gene specifically expressed in thyroid cancer is selected from the group consisting of TG, CALCA, APOC1, HIG2, ENO2, ACPP, TYRO3, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; wherein the gene specifically expressed in bladder cancer is selected from the group consisting of OGT FGFR3, TP53, NUMA1, COCH, CELSR3, HMOX1, KIF1A, MGC17624, MTAP, PFKFB4, S100A8, RSPH9, FOXM1, FANCB, FANCC, FANCD2, RUSC1-AS1, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLXDC2, ZNF312, SYCP2L, HOXA9, ISL1, ALDH1A3, KRT19, CCNB1, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; wherein the gene specifically expressed in breast cancer is selected from the group consisting of MEST, NR1D1, BIRC5, RACGAP1, DHCR7, STC2, AZGP1, RBBP8, IL6ST, MGP, TRBC1, MMP11, COL10A1, C10orf64, COL11A1, POTEG, FSIP1, HER2, MUC1, ACPP, TYRO3, UBE2C, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; wherein the gene specifically expressed in colorectal cancer is selected from the group consisting of NCKAP1, AUNIP, NOTUM, KRT5, TUBB, COL6A1, JUP, CDX2, MELTF EFEMP2, DEFA5, CHEK1, MAD2L1, ENC1, CSE1L, RAD51AP1, ERICH3, SLC7A11, KRT23, PLAU, CDCA1, KLK6, DPEP1, CDH3, ANLN, CXCL1, CTHRC1, LCN2, HS6ST2, EGFL6, CXCL3, CA9, PROX1, SPP1, CST1, CXCL2, TSTA3, RRM2, MMP3, MMP7, MMP10, CXCL5, SERPINB5, TEAD4, BUB1, CDCl2, CLDN2, HSPH1, LY6G6D, PRC1, PUS1, SQLE, TTK, ECT2, RNF183, FBXO39, TEX38, TTLL2, PRR7, CANP, KIAA0101, ACPP, FLU3, TYRO3, COTL1, CK7, CK20, MUC2, SDC2, ASB9, CCNB1, MELK, CKS2, IFITM1, CEACAM6, ATAD2, TOP2A, CPT1A, DSCC1, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; wherein the gene specifically expressed in biliary tract cancer is selected from the group consisting of MUC16, ASH1L, DOCK7, ACPP, FLU3, CPT1A, DSCC1, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof; wherein the gene specifically expressed in gastric cancer is selected from the group consisting of CGB, PARP1, FOXO3A, MED30, CCNE1, MYC, TFF1, FABP1, LAMP5, MATN3, CLIP4, NOX4, ADRA2C, CSK, FZD9, GALR1, GRM6, INSR, LPHN1, LYN, MRGPRX3, ADCY3, HDAC2, CFL1, NRP2, ANXA10, TFF2, CDCA5, NUSAP1, ACPP, FLU3, KRT19, ER882, EGFR, KRAS, DSCC1, CK20, MUC2, SDC2, COTL1, ATAD2, AS89, MMP1, CEACAM6, DSCC1, CKS2, CST1, IFITM1, MELK, LGALS3BP, CPT1A, IFNG, CD279, CD274, ER882, EGFR, FOLR1, EPCAM, and a combination thereof; or wherein the gene specifically expressed in pancreatic cancer is selected from the group consisting of SMAD4, APC, GNAS, KRAS, MUC1, MSLN, CEACAM1, CEACAM5, MUC16, and a combination thereof.
317. A method for early diagnosing cancer or predicting the prognosis of cancer by detecting a gene derived from cancer cells from a sample without amplification, wherein the method comprises a) a step of mixing a biological sample isolated from an individual comprising cell-free DNA (hereinafter cfDNA) and a positively charged material; b) a step of mixing a probe having a sequence complementary to the cfDNA and a marker in the mixture; and c) a step of detecting the marker bound to the cfDNA, wherein the probe having a sequence complementary to cfDNA complementarily binds to a gene known as a cancer biomarker.
318. The method for early diagnosing cancer or predicting the prognosis of cancer according to claim 317, wherein the probe having a sequence complementary to cfDNA, complementarily binds to a gene selected from the group consisting of CPT1A, IFNG, IFNGR1, CD279, CD274, NSE, SCC, CEA, cyfra21-1, TPA, NMP22, OGT Thyroglobulin (TG), Calcitonin (CALCA), BRAF V600E, TERT C228T/C250T, AFP, β-HCG (CGB), CA19-9, PSA, PSMA, PAP, PCA3, TMPRSS2-ERG, CA125, HIF-1a, VEGF, CA15-3, HER2, SCC (SART3), TOP2A, MCM2, p16INK4a (CDKN2A), Ki-67 (MK1167), HE4 (WEDC2), and a combination thereof.
319. A diagnostic kit for early diagnosing cancer or predicting the prognosis of cancer, comprising a probe to which biotin is bound complementarily binding to a gene specifically expressed in cancer; a positively charged material; a marker to which an avidin-based protein is bound; and a manual, wherein the manual describes that the kit is configured to be capable of diagnosing cancer without gene amplification by the following protocol: a) isolate cfDNA from a biological sample isolated from an individual using a positively charged material contained in the kit; b) mix sequentially or simultaneously a probe to which biotin is bound contained in the kit and a marker contained in the kit in the isolated cfDNA; and c) detect the signal of the marker.
320. The diagnostic kit for early diagnosing cancer or predicting the prognosis of cancer according to claim 319, wherein the gene specifically expressed in cancer is selected from the group consisting of CPT1A, IFNG, IFNGR1, CD279, CD274, NSE, SCC, CEA, cyfra21-1, TPA, NMP22, OGT Thyroglobulin (TG), Calcitonin (CALCA), BRAF V600E, TERT C228T/C250T, AFP, β-HCG (CGB), CA19-9, PSA, PSMA, PAP, PCA3, TMPRSS2-ERG, CA125, HIF-1a, VEGF, CA15-3, HER2, SCC (SART3), TOP2A, MCM2, p16INK4a (CDKN2A), Ki-67 (MK1167), HE4 (WEDC2), and a combination thereof.
321. A device for early diagnosing cancer or predicting the prognosis of cancer by detecting a gene derived from cancer cells from a sample without amplification, wherein the device comprises: a) a mixing part for mixing a biological sample isolated from an individual comprising cfDNA and a positively charged material; b) a reaction part for adding sequentially or simultaneously a probe to which biotin is bound and which is capable of complementarily binding to the gene specifically expressed in cancer; and a nanoparticle comprising streptavidin and a marker to the positively charged material to which cfDNA is bound; c) a detection part for detecting the marker; and d) an information processing part for determining whether there is cfDNA having a sequence complementary to the probe and derived from cancer in the sample depending on whether the marker is detected.
322. The device for early diagnosing cancer or predicting the prognosis of cancer according to claim 321, wherein the gene specifically expressed in cancer is selected from the group consisting of CPT1A, IFNG, IFNGR1, CD279, CD274, NSE, SCC, CEA, cyfra21-1, TPA, NMP22, OGT Thyroglobulin (TG), Calcitonin (CALCA), BRAF V600E, TERT C228T/C250T, AFP, β-HCG (CGB), CA19-9, PSA, PSMA, PAP, PCA3, TMPRSS2-ERG, CA125, HIF-1a, VEGF, CA15-3, HER2, SCC (SART3), TOP2A, MCM2, p16INK4a (CDKN2A), Ki-67 (MK1167), HE4 (WEDC2), and a combination thereof.
Description
DESCRIPTION OF DRAWINGS
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
BEST MODE
[0146] <Definition of Term>
[0147] As used herein, the term “cell-free DNA” is also referred to as cfDNA. In addition, cfDNA may be circulating tumor DNA (ctDNA), which is a cancer cell-derived DNA that may be found in a biological sample such as urine, cerebrospinal fluid, plasma, blood, or body fluid derived from cancer patients due to tumor cells. In addition, cfDNA may be present in a biological sample such as urine, cerebrospinal fluid, pleural fluid, ascites, plasma, blood, saliva, sputum, or body fluid. In this case, cfDNA may have a size of 80 bp to 10 kbp, 100 bp to 1 kbp, 120 bp to 500 bp. In addition, cfDNA may have a size of 150 bp to 200 bp, and may usually have a size of 165 bp to 170 bp. In addition, the cfDNA may include a small sized cfDNA of about 80 bp or less.
[0148] As used herein, the term “unstable cfDNA” means cfDNA that is thermodynamically unstable compared to “stable cfDNA.” In other words, unstable cfDNA may be denatured in less severe conditions than conditions in which stable cfDNA is denatured. The reason why the unstable cfDNA is generated is that the unstable cfDNA has an unstable double helix structure. Specifically, cfDNA derived from a gene that is overexpressed in cancer cells may be an example of unstable cfDNA.
[0149] As used herein, the term “cfDNA having an unstable double helix structure” is characterized in that it has a lower Tm value than that of cfDNA having a stable double helix structure, or that it is denatured in a condition in which cfDNA having a stable double helix structure is not denatured. The Tm refers to a melting temperature and means a temperature at which 50% of double-stranded DNA is converted into single-stranded DNA. The Tm value is proportional to the length of DNA and may vary depending on the nucleotide sequence. However, since in genomic DNA a large number of nucleotides are bound by hydrogen bonds, it should be heated at 92° C. to 95° C. for 5 minutes or more, or at 98° C. for 2 minutes or more. In addition, at temperatures lower than 90° C., genomic DNA is not easily denatured. In this case, assuming that cfDNA having a stable double helix structure has an average nucleotide of about 170 bp, it may have a Tm value similar to that of genomic DNA.
[0150] However, the “cfDNA having an unstable double helix structure” has a lower Tm value than that of cfDNA having a stable double helix structure. Therefore, when the cfDNA having a stable double helix structure is denatured in any one condition selected from the group consisting of i) a condition of allowing to stand for about 1 minute to about 120 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for about 1 second to about 3 minutes; iii) a condition of heating at about 75° C. to about 90° C. for about 1 second to about 5 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 30 seconds to about 60 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 10 minutes to about 120 minutes; vi) a condition of treating with protease for about 10 seconds to about 30 minutes; vii) a condition of treating with DNase for about 10 seconds to about 30 minutes, and viii) a condition of treating with a chemical substance (for example, sodium hydroxide, DMSO, a surfactant, and the like), and then subjected to a binding reaction with a 15-mer to 30-mer probe having a sequence complementary to a portion of the sequence of cfDNA, the cfDNA having a stable double helix structure does not bind with the above probe. In this case, “ambient temperature” means room temperature and may be about 18° C. to about 25° C. Further, in addition to the above conditions, a condition of heating at about 40° C. to about 65° C. for about 5 minutes to about 80 minutes may be further included.
[0151] However, when treating the cfDNA having an unstable double helix structure in any one condition of the above described conditions i) to viii), and then performing a binding reaction with a 15-mer to 30-mer probe, it was confirmed that the cfDNA bound with the above probe. In this case, the above probe may be a about 15-mer to about 30-mer or about 20-mer to about 25-mer probe and may be a about 21-mer, about 22-mer, about 23-mer, or about 24-mer probe.
[0152] In this case, the cfDNA having an unstable double helix structure may be a circulating tumer DNA (ctDNA).
[0153] As used herein, the term “probe” means DNA or RNA for detecting a target cfDNA. The probe may have a sequence designed to be capable of complementarily binding to unstable cfDNA. As used herein, the term “probe having a sequence complementary to cfDNA” means a probe having a nucleic acid sequence capable of complementarily binding to cfDNA of the desired double helix structure that is desired to be detected and is present in fluid sample like plasma.
[0154] In this case, the probe may be constructed in two ways. One may be a first probe (hereinafter referred to as CP) designed to be capable of binding to a damaged region of a gene, and the other may be a second probe (hereinafter referred to as DP) designed to be capable of binding to a periphery of a damaged region. The DP may be designed to complementarily bind to a sequence located about 10 bp to about 100 bp, about 20 bp to about 50 bp away from a targeted DNA sequence or a region where damage occurred.
[0155] As used herein, the term “complementarily binding” means that the probe can bind to the target cfDNA and form a duplex under appropriate hybridization conditions, and the probe has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% complementary to the target sequence of cfDNA.
[0156] “Hybridization conditions” can be determined empirically by those skilled in the art based on, for example, the length of the probe, the complementarity of the probe, and the salt concentration (i.e., ionic strength) in the hybridization buffer. In general, stringent hybridization conditions are those in which a polynucleotide can preferentially bind to its complementary sequence, and also can bind with a higher affinity relative to any other region on the target. Exemplary stringent conditions for hybridization to its complement of a polynucleotide sequence having 20 bases may be about 50% G+C content, 50 mM salt (Na+), and annealing temperature of 60° C. In the case of a longer sequence, hybridization may be carried out at higher temperature. In general, stringent conditions are the conditions in which annealing is carried out at about 5° C. below the melting temperature of the polynucleotide. The “melting temperature” is a temperature at which 50% of the polynucleotide complementary to the target polynucleotide complementarily binds at a given ion strength, pH, and polynucleotide concentration.
[0157] In the present specification, it was confirmed that damaged cfDNA can be effectively detected even when the first probe and the second probe are used at the same time or the first probe or the second probe is used respectively. In addition, the probe may be in a form in which a material such as biotin is bound in order to bind with a marker. Alternatively, the probe may be directly bound to a marker or bound through a linker. In this case, the marker may be a nanoparticle, a fluorescent dye, a fluorescent protein, or an enzyme. In addition, the probe may be added simultaneously with the marker, and may be added sequentially.
[0158] In one embodiment of the present invention, a probe capable of complementarily binding to a target cfDNA may complementarily bind to a region comprising a sequence specific to the following cancer cells. For example, in the case of the sequence specific to ovarian cancer or breast cancer, it may be a SNP present in BRCA1 exon 7, BRCA1 exon 10, BRCA1 exon 11, BRCA1 exon 15. In addition, in the case of the sequence specific to gastric cancer, it may be a SNP present in TP53, and in the case of the sequence specific to colorectal cancer, it may be a SNP present in MSH2. In the case of the sequence specific to lung cancer, it may be a SNP present in EGFR. In addition, in the case of the sequence specific to liver cancer, it may be selected from a SNP present in FGFR3.
[0159] Biomarker genes derived from cancer cells and specific to cancer cells are known to those skilled in the art. For example, the following documents can be referred: Circulating Cell-Free DNA in Plasma/Serum of Lung Cancer Patients as a Potential Screening and Prognostic Tool, Pathak et al, Clinical Chemistry October 2006 vol. 52 no. 10 1833-1842; Cell-free Tumor DNA in Blood Plasma As a Marker for Circulating Tumor Cells in Prostate Cancer, Schwarzenbach et al, Clin Cancer Res Feb. 1, 2009 15; 1032; Cell-free DNA: measurement in various carcinomas and establishment of normal reference range, Wua et al, Clinica Chimica Acta, Volume 321, Issues 1-2, July 2002, Pages 77-87; Detection of Circulating Tumour DNA in the Blood (Plasma/Serum) of Cancer Patients, Anker et al, Cancer and Metastasis Reviews 1999, Volume 18, Issue 1, pp 65-73; Cell-free nucleic acids as biomarkers in cancer patients, Schwarzenbach et al, Nature Reviews Cancer 11, 426-437 (June 2011); Circulating Tumor-Specific DNA: A Marker for Monitoring Efficacy of Adjuvant Therapy in Cancer Patients, Fiegl et al, Cancer Res Feb. 15, 2005 65; 1141.
[0160] In one embodiment of the present invention, a probe capable of complementarily binding to a target cfDNA can complementarily bind to a region overexpressed in the following cancer cells. As such, the region overexpressed in cancer cells may be a biomarker of cancer cells. The biomarkers of cancer cells may be genes shown in
[0161] As used herein, the term “separated biological sample” means a sample of urine, saliva, cerebrospinal fluid, pleural fluid, ascites, plasma, blood, sputum, or body fluid separated from the human body. The separated biological sample may be a liquid sample separated from the human body. In this case, plasma may be obtained from the blood.
[0162] As used herein, the term “positively charged material” is a positively charged material, and may be used in the form of a nanoparticle, a nanowire, a network, or a filter, but is not limited thereto. One embodiment of the “positively charged material” may be a nanowire or a membrane having a positively charged surface. The nanowire or membrane may be manufactured using a conductive polymer. The conductive polymer may be any one selected from the group consisting of poly(acetylene), poly(pyrrole), poly(thiophene), poly(para-phenylene), poly(3,4-ethylenedioxythiophene), poly(phenylene sulfide), poly(para-phenylene vinylene), and polyaniline. Although the length and diameter may be appropriately adjusted depending on the manufacturing method, for nanowires, the diameter can be selected from a range of about 50 nm to about 500 nm, about 100 nm to about 500 nm, about 100 nm to about 400 nm, about 150 nm to about 350 nm, about 200 nm to about 400 nm, or about 100 nm to about 300 nm, and the length can be selected from a range of several μm to about 100 μm, about 10 μm to about 100 μm, about 15 μm to about 50 μm, about 15 μm to about 40 μm, or about 15 μm to about 30 μm.
[0163] In one embodiment, it may be a nanowire having a diameter of about 200 nm and a length of about 18 μm. In addition, the nanowire may be manufactured in a form of including biotin.
[0164] The surface of the nanowire or membrane may be modified by a cationic polymer. The kind of the cationic polymer is not limited. One embodiment of the cationic polymer may be polyethyleneimine (PEI) or polylysine (PLL). In addition, it may be cationic branched polymer polyethyleneimine. The nanowires or membranes modified by such cationic polymer may have a positive charge on their surfaces. To capture cfDNA, the surface charge of the nanowire or membrane may be from about 20 mV to about 80 mV, from about 30 mV to about 60 mV, and from about 35 mV to about 50 mV. Further, the surface charge may be about 36 mV, about 37 mV, about 38 mV, about 39 mV, about 40 mV, about 41 mV, about 42 mV, about 43 mV, or about 44 mV.
[0165] In one embodiment, the positively charged nanowires can successfully capture cfDNA efficiently even at a low concentration. In particular, due to the characteristics of the nanowires such as the large surface area for binding with target molecules such as DNA and the enhanced mobility for facilitating interaction with DNA, cfDNA can be effectively captured.
[0166] As used herein, the term “marker” is a material for effectively detecting and/or quantifying cfDNA having a double helix structure derived from cancer cells, and specifically, may be a quantum dot, a material that degrades a specific substrate to cause a color reaction, a material that emits luminescence when irradiated with a certain wavelength, and the like. Specifically, the marker may be a fluorescent protein such as GFP (Green Fluorescent Protein), YFP (Yellow Fluorescent Protein), RFP (Red Fluorescent Protein), or CFP (Cyan Fluorescent Protein). In addition, the marker may be a chromogenic enzyme or bioluminescent enzyme, such as alkaline phosphatase (AP), Horsesadish peroxidase (HRP), or beta-galactosidase (BGAL).
[0167] The chromogenic enzyme mediates a chromogenic reaction or a luminescent reaction by reacting with a substrate. For HRP, ABTS, OPD, AmplexRed, DAB, AEC, TMB, Homovanillic acid, Luminol and the like can be used as such a substrate. For AP, BCIP (5-Bromo-4-Chloro-3-Indolyl Phosphate)/NBT (nitriblue tetrazolium), pNPP (p-Nitrophenyl Phosphate), Fast Red TR/Naphthol AS-MX and CDP-Star (Disodium 2-chloro-5-(4-methoxyspiro[1,2-dioxetane-3,2′-(5-chlorotricyclo[3.3.1.1.sup.3,7]decan])-4-yl]-1-phenyl phosphate) and the like can be used. For BGAL, any substrate selected from the group consisting of X-gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) or ONPG (ortho-Nitrophenyl-β-galactoside) can be used together. The bioluminescent enzyme may be a luciferase derived from firefly (Photinus pyralis), sea pansy (Renilla sp.), copepod Metridiia longa, bacteria of the genus Vibrio, or dinoflagellate.
[0168] The marker may further include a material capable of binding to the probe. Specifically, when biotin is bound to the probe, the marker may further include an avidine-based protein. Specifically, the marker may further include any one selected from the group consisting of avidin, streptavidin, or a combination thereof.
[0169] In addition, the marker may include biotin. In this case, the probe may further include an avidin-based protein. Specifically, the marker may further include any one selected from the group consisting of avidin, streptavidin, or a combination thereof.
[0170] In one embodiment of such a marker, it may be used in the form of nanoparticles in which streptavidin and HRP are bound to nanoparticles composed of a conductive polymer and hyaluronic acid. In this case, the conductive polymer is as described above, and preferably may be poly(pyrrole). In another embodiment, it may be used in the form of nanoparticles in which streptavidin and a fluorescent protein are bound to the nanoparticles composed of a conductive polymer and hyaluronic acid. The size of the HRP nanoparticles may be about 20 nm to about 150 nm, and may be about 30 nm to about 120 nm, about 40 nm to about 100 nm. In addition, The size of the HRP nanoparticles may be about 50 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, or about 80 nm.
[0171] In addition, a substrate suitable for a marker may be used together to cause a color reaction of the marker. In this case, the substrate may be added simultaneously with the marker, but may be added before and after adding the marker. The markers and substrates can be used by known methods. In one embodiment, when HRP is used as a marker, ABTS (2,2′-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt), OPD (o-Phenylenediamine dihydrochloride), AmplexRed, DAB (3,3′-diaminobenzidine tetrahydrochloride), AEC (3-Amino-9-ethylcarbazole), TMB (3,3′,5,5′-Tetramethylbenzidine), Homovanillic acid, or Luminol may be used as a substrate. In addition, in one embodiment, when a fluorescent protein is used, a marker may be detected by the presence or absence of light having a wavelength emitted after irradiating light of a specific wavelength rather than a substrate.
[0172] According to one embodiment, the present diagnostic method can detect the target cfDNA with a high degree of precision and accuracy, and for example, it is possible to effectively detect even when the target cfDNA is contained in a very small amount in a biological sample. Therefore, it can be usefully used for the detection of cancer cell in early stage.
[0173] By detecting the presence or absence of cfDNA encoding a biomarker of a specific abnormal cells/tissue, for example a specific cancer, present in a biological sample, the diagnosis, prognosis, or metastatis status of the cancer in question can be confirmed, and resistance/tolerance to conventional treatment methods can be also predicted.
[0174] <Prostate Cancer>
[0175] Method for Diagnosing Prostate Cancer
[0176] One aspect of the present invention provides a method for diagnosing prostate cancer by detecting a gene derived from prostate cancer cells from a sample without amplification, wherein the method comprises a) a step of mixing a biological sample isolated from an individual comprising cell-free DNA (hereinafter cfDNA) and a positively charged material; b) a step of isolating the positively charged material to which cfDNA is bound; c) a step of sequentially or simultaneously mixing a probe having a sequence complementary to the cfDNA and a marker in the mixture; d) a step of removing the probe that does not bind to cfDNA and the marker; and e) a step of detecting the marker, wherein the probe having a sequence complementary to cfDNA complementarily binds to a gene known as a prostate cancer biomarker. In this case, a gene known as a prostate cancer biomarker may be a gene encoding a protein overexpressed in prostate cancer.
[0177] Specifically, the probe having a sequence complementary to cfDNA may complementarily bind to at least any one gene selected from the group consisting of KLK3, FOLH1, PCA3, PDE4D7, SFMBT2, EFEMP1, RETN, ACADL, AGR2, COL1A1, FAM13C, GPX8, GRHL2, HNF1A, HOXB13, KLK2, MYBPC1, NROB1, PITX2, SFRP4, SLCO1B3, TMEFF2, TMPRSS2-ERG, and a combination thereof.
[0178] In addition, the purpose of using the isolated biological sample is to detect cfDNA present in the sample. Therefore, cfDNA in a sample may be used by being isolated and/or concentrated in various ways. In one embodiment, a nitrocellulose membrane having a strong affinity for nucleic acid may be used. In addition, in one embodiment, a positively charged material may be used to capture a negatively charged cfDNA. The positively charged material may be a nanoparticle, a nanowire, a network, or a positively charged filter, but is not limited thereto. In one embodiment of the “positively charged material”, it may be a positively charged nanostructure or a positively charged membrane.
[0179] In one example of the nanostructure, it may comprise a cationic polymer. The kind of the cationic polymer is not limited. One embodiment of the cationic polymer may be polyethyleneimine (PEI), and may be a cationic branched polymer polyethyleneimine.
[0180] In addition, by mixing nanowires labeled with avidin-based protein with a solution of PEI to which biotin is bound, cationic branched polyethyleneimine (cationic branched PEI) may be further bound to the nanowires through the interaction of biotin-avidin-based protein. As a result, the nanoparticles in the nanostructures (PEI/mPpy NWs) with polyethyleneimine, a cationic polymer, bound to the surface of the nanostructures may be incorporated with high density and irregular distribution.
[0181] These nanowires can successfully capture genomic DNA and cfDNA with high efficiency even at a low concentration. In particular, due to the characteristics of the nanowires such as the large surface area for binding with target molecules such as DNA and the enhanced mobility for promoting interaction with DNA, it is possible to efficiently and effectively capture the target cfDNA.
[0182] In this case, the target cfDNA refers to the desired cfDNA to be detected. In the present specification, cfDNA has double strands. In this case, in a portion of the cfDNA, double strands may be unwound. In addition, the cfDNA may be derived from a gene of prostate cancer cells. Specifically, cfDNA may include a nucleic acid sequence overexpressed in prostate cancer cells. The nucleic acid sequence that is overexpressed in the cancer cells refers to a nucleic acid sequence that is overexpressed in specific cancer cells, although it has an appropriate expression level in normal cells.
[0183] Specifically, the level or reference (cutoff) of the nucleic acid sequence overexpressed in cancer cells may be a case where the OD value is 0.007 or more when the absorbance (optical density) is measured using a marker. More specifically, in the level or reference of the nucleic acid sequence overexpressed in cancer cells, an OD value that is determined from a maximum value of sensitivity and specificity by measuring an absorbance using a marker and then drawing a receiver operation characteristic curve may be used as a reference. In this case, the wavelength irradiated for measuring the absorbance may be appropriately determined according to a marker. The cfDNA may be DNA in which double strands are unwound (unwinding of DNA). In addition, cfDNA may be appropriately determined according to the purpose.
[0184] In addition, the cfDNA derived from prostate cancer cells may be characterized by i) having a lower Tm value than that of cfDNA having a double helix structure derived from normal cells, or ii) being denatured in a condition in which the cfDNA having a double helix structure derived from normal cells is not denatured.
[0185] In addition, the cfDNA is capable of binding with a about 15-mer to about 30-mer probe that can complementarily bind to cfDNA in any one of the following conditions: i) a condition of allowing to stand for about 1 minute to about 120 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for about 1 second to about 3 minutes; iii) a condition of heating at about 75° C. to about 90° C. for about 1 second to about 5 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 30 seconds to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 10 minutes to about 120 minutes; vi) a condition of treating with protease for about 1 minute to about 30 minutes; vii) a condition of treating with DNase for about 1 minute to about 30 minutes; and viii) a condition of treating with a chemical substance (for example, sodium hydroxide, DMSO, a surfactant, and the like).
[0186] The gene overexpressed in prostate cancer cells may be any one selected from the group consisting of KLK3 (NCBI Gene ID: 354), FOLH1 (NCBI Gene ID: 2346), ACPP (NCBI Gene ID: 55), PCA3 (NCBI Gene ID: 50652), PDE4D7 (NCBI Gene ID: 5144), SFMBT2 (NCBI Gene ID: 57713), EFEMP1 (NCBI Gene ID: 2202), RETN (NCBI Gene ID: 56729), ACADL (NCBI Gene ID: 33), AGR2 (NCBI Gene ID: 10551), COL1A1 (NCBI Gene ID: 1277), FAM13C (NCBI Gene ID: 220965), GPX8 (NCBI Gene ID: 493869), GRHL2 (NCBI Gene ID: 79977), HNF1A (NCBI Gene ID: 6927), HOXB13 (NCBI Gene ID: 10481), KLK2 (NCBI Gene ID: 3817), MYBPC1 (NCBI Gene ID: 4604), NROB1 (NCBI Gene ID: 190), PITX2 (NCBI Gene ID: 5308), SFRP4 (NCBI Gene ID: 6424), SLCO1B3 (NCBI Gene ID: 28234), TMEFF2 (NCBI Gene ID: 23671), CPT1A (NCBI Gene ID: 1374), IFNG (NCBI Gene ID: 3458), CD274 (NCBI Gene ID: 29126), FOLR1 (NCBI Gene ID: 2348), EPCAM (NCBI Gene ID: 4072), OGT (NCBI Gene ID: 8473), TMPRSS2-ERG, and a combination thereof.
[0187] In one embodiment, the gene specifically present in prostate cancer may be KLK3, FOLH1, PCA3, PDE4D7, SFMBT2, EFEMP1, RETN, ACADL, AGR2, COL1A1, FAM13C, GPX8, GRHL2, HNF1A, HOXB13, KLK2, MYBPC1, NROB1, PITX2, SFRP4, SLCO1B3, TMEFF2, TMPRSS2-ERG genes, and additionally, one or more additional marker genes selected from the group consisting of ACPP, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, and EPCAM may be additionally detected to diagnose prostate cancer. The additional marker gene is not a marker gene specific for prostate cancer, but when used in combination with the gene specifically present in prostate cancer, the sensitivity and specificity of the method for diagnosing prostate cancer can be significantly enhanced.
[0188] As used herein, the term “KLK3” refers to a gene encoding kallikrein-3, gamma-seminoprotein or prostate specific antigen (PSA). The PSA is a proteolytic enzyme synthesized in epithelial cells of the prostate, and is rarely expressed in tissues other than the prostate, and thus is a useful tumor marker used for screening prostate cancer. In addition, the PSA is usefully used for screening prostate cancer as well as for determining recurrence after surgery.
[0189] As used herein, the term “FOLH1” refers to a gene encoding a prostate-specific membrane antigen (PSMA). It is known that the PSMA is highly expressed in the prostate, and the expression of the PSMA in prostate cancer cells is increased by about 8 times to about 12 times as compared to that of normal prostate cells. The PSMA is used as a tumor marker for the diagnosis of prostate cancer.
[0190] As used herein, the term “ACPP” refers to a gene encoding prostatic acid phosphatase (PAP). The PAP is an enzyme produced by the prostate. The PAP shows an increase in expression in men suffering from prostate cancer or prostate disease, and thus, is used as an indicator of prostate cancer or prostate disease.
[0191] As used herein, the term “PCA3” refers to a gene expressed in the form of non-coding RNA in human prostate tissue. The PCA3 is expressed only in human prostate tissue and is highly overexpressed in prostate cancer cells. The PCA3 is used as a tumor marker for prostate cancer.
[0192] As used herein, the term “probe” refers to DNA or RNA for detecting cfDNA. The probe may have a specific sequence to be capable of complementarily binding to cfDNA. The probe having a sequence complementary to cfDNA refers to a probe having a nucleic acid sequence capable of complementarily binding to a desired double-stranded cfDNA to be detected present in plasma. In this case, the probe may be one to which biotin is bound. The probe may be bound to a marker that is bound to a biotin-binding protein.
[0193] As used herein, the term “marker” refers to a material that is used for detecting a probe bound to cfDNA. The marker may be a nanoparticle, a fluorescent dye, a fluorescent protein, or an enzyme. Specifically, the marker may be any one selected from the group consisting of a quantum dot, an HRP and a fluorescent protein. In one embodiment, the marker may be GFP (green fluorescent protein), BFP (blue fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow fluorescent protein), or HRP (horse radish peroxidase), but is not limited thereto.
[0194] The marker may be one to which a biotin-binding protein is bound. The biotin-binding protein may be an avidin-based protein, avidin, streptavidin, traptavidin, or neutravidin, but may be used without limit as long as it is a protein that can specifically bind to biotin. In one embodiment, the marker may be one to which streptavidin is bound.
[0195] As used herein, the term “avidin” refers to a homotetramer protein produced in the fallopian tubes of birds, reptiles, and amphibians, and is distributed in the egg white, and binds to biotin with a high affinity. Although its function in nature has been not yet investigated, it is estimated to be used for inhibiting the growth of bacteria by binding to biotin, which is necessary for the growth of bacteria.
[0196] As used herein, the term “streptavidin” is a tetrameric biotin-binding protein with a molecular weight of about 60 kDa isolated from Streptomyces avidinii. It has very low homology to the avidin, but its structure is very similar to the avidin. Like avidin, it has an antibacterial activity and a very high binding capacity to biotin. On the other hand, unlike avidin, it does not contain carbohydrates, has an acidic isoelectric point (pI=5), and has a significantly lower solubility than avidin. A commercially available streptavidin such as Thermo Scientific Pierce Streptavidin is in a recombinant form of streptavidin having a molecular weight of about 53 kDa and has an isoelectric point which is near neutral (pI=6.8 to 7.5). The streptavidin having the lack of glycosylation and low pI has a low level of non-specific binding (in particular, lectin binding) as compared to avidin. These properties of streptavidin allow it to be selected as an ideal reagent for many detection systems.
[0197] As used herein, the term “traptavidin” refers to a mutant (variant or mutein) of streptavidin, and is a protein having a dissociation rate for biotin that is slower by about 10 times and having an increased mechanical strength and enhanced thermal stability. In addition, the traptavidin specifically binds to biotin.
[0198] The term “neutravidin” of the present invention is also referred to as “deglycosylated avidin” and is prepared to avoid the main disadvantages of naturally occurring avidin and streptavidin. As shown in the name, neutravidin is produced by deglycosylating avidin. It is a protein that has a reduced molecular weight (about 60 kDa) and maintains a high biotin binding capacity as compared to avidin. The deglycosylation of the avidin reduces the binding of lectin to an undetectable level and lowers an isoelectric point (pI=about 6.3) to effectively eliminate the main cause of non-specific binding to avidin. A lysine residue remains usable, so it can be easily derivatized or complexed like streptavidin. In addition, since it exhibits high biotin binding capacity and low non-specific binding, it can be used in various ways as an ideal biotin-binding protein.
[0199] As used herein, the term “a step of detecting the marker” refers to a step of detecting a marker that is bound to a probe through a reaction of biotin-avidin. The detection of the marker can be measured by a color change, a UV absorbance change, the presence or absence of bioluminescence, a fluorescence change, or an electrochemical change. Specifically, the method for detecting the marker may be performed differently depending on the marker used. For example, when HRP is used as a marker, the marker can be detected by observing the color reaction through the reaction between hydrogen peroxide and a substrate. In addition, when the marker is a fluorescent protein such as GFP, the presence or absence of the marker can be detected by observing the detected light after irradiating light of a specific wavelength. In addition, when the marker is luciferase, the presence of the marker can be detected by measuring the bioluminescence that is exhibited after adding a substrate such as luciferin by bioluminometer.
[0200] In addition, the diagnostic method of the present invention may further comprise a step of denaturing cfDNA. In this case, the denaturation step can be performed to selectively denature only cfDNA derived from prostate cancer, but not to denature normal double-stranded cfDNA. To this end, the conditions of the denaturation step may be performed at about 50° C. to about 100° C. for about 0.1 second to about 5 minutes. One embodiment of the denaturation temperature may be about 95° C., and the denaturation time may be usually about 0.1 second to about 8 minutes. In addition, it may be denatured for about 1 second, about 5 seconds, about 10 seconds, about 30 seconds, about 60 seconds, or about 90 seconds. In one embodiment, the step of denaturing cfDNA may be performed prior to step c) above.
[0201] Specifically, the method may further comprise a step of denaturing the sample or cfDNA bound to the positively charged material prior to step c) above in any one condition selected from the group consisting of i) a condition of allowing to stand for about 1 minute to about 10 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for 1 second to 1 minute; iii) a condition of heating at about 75° C. to about 90° C. for about 10 seconds to about 3 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 1 minute to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 5 minutes to about 60 minutes; vi) a condition of treating with protease for about 1 minute to about 10 minutes; and vii) a condition of treating with DNaseI for about 1 minute to about 10 minutes. This denaturation step does not denature the double-stranded cfDNA derived from normal cells, but selectively denatures only cfDNA derived from cancer cells, thereby making it easier to bind with the probe. The denaturation conditions of i) to vii) may be performed after obtaining a sample. In addition, the denaturation conditions of i) to vii) may be performed after obtaining cfDNA bound to the positively charged material. In addition, the temperature, protease, and DNase treatment time of the denaturation conditions of i) to vii) may be appropriately adjusted as long as they do not denature the stable cfDNA.
[0202] Prostate Cancer Diagnostic Kit
[0203] Other aspect of the present invention provides a diagnostic kit for diagnosing prostate cancer, comprising a probe to which biotin is bound complementarily binding to a gene specifically expressed in prostate cancer; a positively charged material; a marker to which an avidin-based protein is bound; and a manual.
[0204] In this case, the gene specifically expressed in prostate cancer may be any one or more selected from the group consisting of KLK3, FOLH1, PCA3, PDE4D7, SFMBT2, EFEMP1, RETN, ACADL, AGR2, COL1A1, FAM13C, GPX8, GRHL2, HNF1A, HOXB13, KLK2, MYBPC1, NROB1, PITX2, SFRP4, SLCO1B3, TMEFF2, TMPRSS2-ERG, and a combination thereof.
[0205] In addition, the manual may describe that the kit is configured to be capable of diagnosing prostate cancer by the following protocol: a) isolate cfDNA from a biological sample isolated from an individual using a positively charged material contained in the kit; b) mix sequentially or simultaneously a probe to which biotin is bound contained in the kit and a marker contained in the kit in the isolated cfDNA; c) remove the probe that does not bind to cfDNA and the marker; and d) detect the signal of the marker.
[0206] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of ACPP, CPT1A, IFNG, CD274, FOLR1, EPCAM OGT, and a combination thereof.
[0207] In addition, the probe, the positively charged material, and the marker are as described above.
[0208] Prostate Cancer Diagnostic Device
[0209] Other aspect of the present invention provides a device for diagnosing prostate cancer by detecting a gene derived from prostate cancer cells from a sample without amplification, wherein the device comprises a) a mixing part for mixing a biological sample isolated from an individual comprising cfDNA and a positively charged material; b) an obtaining part for removing the sample except for the positively charged material to which cfDNA is bound; c) a reaction part for adding sequentially or simultaneously a probe to which biotin is bound capable of complementarily binding to the gene specifically expressed in prostate cancer; and a nanoparticle comprising streptavidin and a marker to the positively charged material to which cfDNA is bound; d) a detection part for detecting the marker; and e) an information processing part for determining whether there is cfDNA having a sequence complementary to the probe and derived from prostate cancer in the sample depending on whether the marker is detected.
[0210] In this case, the gene specifically expressed in prostate cancer may be any one or more selected from the group consisting of KLK3, FOLH1, PCA3, PDE4D7, SFMBT2, EFEMP1, RETN, ACADL, AGR2, COL1A1, FAM13C, GPX8, GRHL2, HNF1A, HOXB13, KLK2, MYBPC1, NROB1, PITX2, SFRP4, SLCO1B3, TMEFF2, TMPRSS2-ERG, and a combination thereof.
[0211] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of ACPP, CPT1A, IFNG, CD274, FOLR1, EPCAM OGT, and a combination thereof
[0212] <Lung Cancer>
[0213] Method for Diagnosing Lung Cancer
[0214] One aspect of the present invention provides a method for diagnosing lung cancer by detecting a gene derived from lung cancer cells from a sample without amplification, wherein the method comprises a) a step of mixing a biological sample isolated from an individual comprising cell-free DNA (hereinafter cfDNA) and a positively charged material; b) a step of isolating the positively charged material to which cfDNA is bound; c) a step of sequentially or simultaneously mixing a probe having a sequence complementary to the cfDNA and a marker in the mixture; d) a step of removing the probe that does not bind to cfDNA and the marker; and e) a step of detecting the marker, wherein the probe having a sequence complementary to cfDNA complementarily binds to a gene known as a lung cancer biomarker. In this case, a gene known as a lung cancer biomarker may be a gene encoding a protein overexpressed in lung cancer.
[0215] Specifically, the probe having a sequence complementary to cfDNA may complementarily bind to at least any one gene selected from the group consisting of ENO2, SART3, KRT19, PLAT, EGFR, ALK, ROS1, RET, ERBB2, PI3K, SLOOP, MMP11, CDCA7, S100A2, ETV4, TOP2A, UBE2C, and a combination thereof.
[0216] In addition, the purpose of using the isolated biological sample is to detect cfDNA present in the sample. Therefore, cfDNA in a sample may be used by being isolated and/or concentrated in various ways. In one embodiment, a nitrocellulose membrane having a strong affinity for nucleic acid may be used. In addition, in one embodiment, a positively charged material may be used to capture a negatively charged cfDNA. The positively charged material may be a nanoparticle, a nanowire, a network, or a positively charged filter, but is not limited thereto. In one embodiment of the “positively charged material”, it may be a positively charged nanostructure or a positively charged membrane.
[0217] In one example of the nanostructure, it may comprise a cationic polymer. The kind of the cationic polymer is not limited. One embodiment of the cationic polymer may be polyethyleneimine (PEI), and may be a cationic branched polymer polyethyleneimine.
[0218] In addition, by mixing nanowires labeled with streptavidin with a solution of PEI to which biotin is bound, cationic branched polyethyleneimine (cationic branched PEI) may be further bound to the nanowires through the interaction of biotin-streptavidin. As a result, the nanoparticles in the nanostructures (PEI/mPpy NWs) with polyethyleneimine, a cationic polymer, bound to the surface of the nanostructures may be incorporated with high density and irregular distribution.
[0219] These nanowires can successfully capture genomic DNA and cfDNA with high efficiency even at a low concentration. In particular, due to the characteristics of the nanowires such as the large surface area for binding with target molecules such as DNA and the enhanced mobility for promoting interaction with DNA, it is possible to efficiently and effectively capture the target cfDNA.
[0220] In this case, the target cfDNA refers to the desired cfDNA to be detected. In the present specification, cfDNA has double strands. In this case, in a portion of the cfDNA, double strands may be unwound. In addition, the cfDNA may be derived from a gene of lung cancer cells. Specifically, cfDNA may include a nucleic acid sequence overexpressed in lung cancer cells. The nucleic acid sequence that is overexpressed in the cancer cells refers to a nucleic acid sequence that is overexpressed in specific cancer cells, although it has an appropriate expression level in normal cells.
[0221] Specifically, the level or reference (cutoff) of the nucleic acid sequence overexpressed in cancer cells may be a case where the OD value is 0.010 or more when the absorbance (optical density) is measured using a marker.
[0222] More specifically, in the level or reference of the nucleic acid sequence overexpressed in cancer cells, an OD value is about 0.012 or about 0.015 or more by measuring an absorbance using a marker. In this case, the wavelength irradiated for measuring the absorbance may be appropriately determined according to a marker. The cfDNA may be DNA in which double strands are unwound (unwinding of DNA). In addition, cfDNA may be appropriately determined according to the purpose.
[0223] In addition, the cfDNA derived from lung cancer cells may be characterized by i) having a lower Tm value than that of cfDNA having a double helix structure derived from normal cells, or ii) being denatured in a condition in which the cfDNA having a double helix structure derived from normal cells is not denatured.
[0224] In addition, the cfDNA is capable of binding with a about 15-mer to about 30-mer probe that can complementarily bind to cfDNA in any one of the following conditions: i) a condition of allowing to stand for about 1 minute to about 120 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for about 1 second to about 3 minutes; iii) a condition of heating at about 75° C. to about 90° C. for about 1 second to about 5 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 30 seconds to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 10 minutes to about 120 minutes; vi) a condition of treating with protease for about 1 minute to about 30 minutes; vii) a condition of treating with DNase for about 1 minute to about 30 minutes.
[0225] The gene overexpressed in lung cancer cells may be any one selected from the group consisting of ENO2 (NCBI Gene ID: 2026), SART3 (NCBI Gene ID: 9733), ACPP (NCBI Gene ID: 55), KRT19 (NCBI Gene ID: 3880), PLAT (NCBI Gene ID: 5327), EGFR(NCBI Gene ID: 1956), KRAS(NCBI Gene ID: 3845), ALK (NCBI Gene ID: 238), ROS1 (NCBI Gene ID: 6098), RET (NCBI Gene ID: 5979), ERBB2 (NCBI Gene ID: 2064), PI3K (NCBI Gene ID: 5291), S100P (NCBI Gene ID: 6286), MMP11 (NCBI Gene ID: 4320), CDCA7 (NCBI Gene ID: 83879), S100A2 (NCBI Gene ID: 6273), ETV4 (NCBI Gene ID: 2118), TOP2A (NCBI Gene ID: 7153), UBE2C(NCBI Gene ID: 11065), CPT1A (NCBI Gene ID: 1374), IFNG (NCBI Gene ID: 3458), CD274 (NCBI Gene ID: 29126), FOLR1 (NCBI Gene ID: 2348), EPCAM (NCBI Gene ID: 4072), OGT (NCBI Gene ID: 8473), and a combination thereof.
[0226] In one embodiment, the gene specifically present in lung cancer may be SART3, PLAT, ALK, ROS1, PI3K, S100P, CDCA7, S100A2, ETV4 genes, and additionally, ENO2, ACPP, KRT19, EGFR, KRAS, RET, ERBB2, MMP11, TOP2A, UBE2C, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, or EPCAM gene may be additionally detected to diagnose lung cancer.
[0227] As used herein, the term “ENO2” refers to a gene encoding an enzyme known as gamma-enolase or enolase 2 or NSE (neuron specific enolase). The NSE is used as a tumor marker of small cell lung cancer, neuroblastoma, and medullary thyroid cancer.
[0228] As used herein, the term “SART3” refers to a gene encoding squamous cell carcinoma antigen (SCCA). The SCCA is used as a tumor marker because it exhibits positive in the blood of patients with many squamous cell cancers such as vulvar cancer, vaginal cancer, esophageal cancer, tongue cancer, and pharynx cancer as well as squamous cell cancer of the cervix.
[0229] As used herein, the term “KRT19” refers to a gene encoding a protein known as Cyfra 21-1, CK-19 (cytokeratin-19), or K19 (keratin-19). It is known that the Cyfra 21-1 is associated with cancers originated from epithelial cells such as lung cancer and head and neck cancer. In addition, it has been reported that the blood level of the Cyfra 21-1 in patients suffering from pneumonia or lung disease is increased as compared to normal persons, and the Cyfra 21-1 is used as a tumor indicator.
[0230] As used herein, the term “PLAT” refers to a gene encoding TPA (tissue plasminogen activator), which is a protein involved in blood clot disruption.
[0231] As used herein, the term “probe” refers to DNA or RNA for detecting cfDNA. The probe may have a specific sequence to be capable of complementarily binding to cfDNA. The probe having a sequence complementary to cfDNA refers to a probe having a nucleic acid sequence capable of complementarily binding to a desired double-stranded cfDNA to be detected present in plasma. In this case, the probe may be one to which biotin is bound. The probe may be bound to a marker that is bound to a biotin-binding protein.
[0232] As used herein, the term “marker” refers to a material that is used for detecting a probe bound to cfDNA. The marker may be a nanoparticle, a fluorescent dye, a fluorescent protein, or an enzyme. Specifically, the marker may be any one selected from the group consisting of a quantum dot, an HRP and a fluorescent protein. In one embodiment, the marker may be GFP (green fluorescent protein), BFP (blue fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow fluorescent protein), or HRP (horse radish peroxidase), but is not limited thereto.
[0233] The marker may be one to which a biotin-binding protein is bound. The biotin-binding protein may be an avidin-based protein, avidin, streptavidin, traptavidin, or neutravidin, but may be used without limit as long as it is a protein that can specifically bind to biotin. In one embodiment, the marker may be one to which streptavidin is bound.
[0234] As used herein, the term “streptavidin” is a tetrameric biotin-binding protein with a molecular weight of about 60 kDa isolated from Streptomyces avidinii. It has very low homology to the avidin, but its structure is very similar to the avidin. Like avidin, it has an antibacterial activity and a very high binding capacity to biotin. On the other hand, unlike avidin, it does not contain carbohydrates, has an acidic isoelectric point (pI=5), and has a significantly lower solubility than avidin. A commercially available streptavidin such as Thermo Scientific Pierce Streptavidin is in a recombinant form of streptavidin having a molecular weight of about 53 kDa and has an isoelectric point which is near neutral (pI=6.8 to 7.5). The streptavidin having the lack of glycosylation and low pI has a low level of non-specific binding (in particular, lectin binding) as compared to avidin. These properties of streptavidin allow it to be selected as an ideal reagent for many detection systems.
[0235] As used herein, the term “traptavidin” refers to a mutant (variant or mutein) of streptavidin, and is a protein having a dissociation rate for biotin that is slower by about 10 times and having an increased mechanical strength and enhanced thermal stability. In addition, the traptavidin specifically binds to biotin.
[0236] The term “neutravidin” of the present invention is also referred to as “deglycosylated avidin” and is prepared to avoid the main disadvantages of naturally occurring avidin and streptavidin. As shown in the name, neutravidin is produced by deglycosylating avidin. It is a protein that has a reduced molecular weight (about 60 kDa) and maintains a high biotin binding capacity as compared to avidin. The deglycosylation of the avidin reduces the binding of lectin to an undetectable level and lowers an isoelectric point (pI=about 6.3) to effectively eliminate the main cause of non-specific binding to avidin. A lysine residue remains usable, so it can be easily derivatized or complexed like streptavidin. In addition, since it exhibits high biotin binding capacity and low non-specific binding, it can be used in various ways as an ideal biotin-binding protein.
[0237] As used herein, the term “a step of detecting the marker” refers to a step of detecting a marker that is bound to a probe through a reaction of biotin-avidin. The detection of the marker can be measured by a color change, a UV absorbance change, the presence or absence of bioluminescence, a fluorescence change, or an electrochemical change. Specifically, the method for detecting the marker may be performed differently depending on the marker used. For example, when HRP is used as a marker, the marker can be detected by observing the color reaction through the reaction between hydrogen peroxide and a substrate. In addition, when the marker is a fluorescent protein such as GFP, the presence or absence of the marker can be detected by observing the detected light after irradiating light of a specific wavelength. In addition, when the marker is luciferase, the presence of the marker can be detected by measuring the bioluminescence that is exhibited after adding a substrate such as luciferin by bioluminometer.
[0238] In addition, the diagnostic method of the present invention may further comprise a step of denaturing cfDNA. In this case, the denaturation step can be performed to selectively denature only cfDNA derived from lung cancer, but not to denature normal double-stranded cfDNA. To this end, the conditions of the denaturation step may be performed at about 50° C. to about 100° C. for about 0.1 second to about 5 minutes. One embodiment of the denaturation temperature may be about 95° C., and the denaturation time may be usually about 0.1 second to about 8 minutes. In addition, it may be denatured for about 1 second, about 5 seconds, about 10 seconds, about 30 seconds, about 60 seconds, or about 90 seconds. In one embodiment, the step of denaturing cfDNA may be performed prior to step c) above.
[0239] Specifically, the method may further comprise a step of denaturing the sample or cfDNA bound to the positively charged material prior to step c) above in any one condition selected from the group consisting of i) a condition of allowing to stand for about 1 minute to about 10 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for 1 second to 1 minute; iii) a condition of heating at about 75° C. to about 90° C. for about 10 seconds to about 3 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 1 minute to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 5 minutes to about 60 minutes; vi) a condition of treating with protease for about 1 minute to about 10 minutes; and vii) a condition of treating with DNaseI for about 1 minute to about 10 minutes. This denaturation step does not denature the double-stranded cfDNA derived from normal cells, but selectively denatures only cfDNA derived from cancer cells, thereby making it easier to bind with the probe. The denaturation conditions of i) to vii) may be performed after obtaining a sample. In addition, the denaturation conditions of i) to vii) may be performed after obtaining cfDNA bound to the positively charged material. In addition, the temperature, protease, and DNase treatment time of the denaturation conditions of i) to vii) may be appropriately adjusted as long as they do not denature the stable cfDNA.
[0240] Lung Cancer Diagnostic Kit
[0241] Other aspect of the present invention provides a diagnostic kit for diagnosing lung cancer, comprising a probe to which biotin is bound complementarily binding to a gene specifically expressed in lung cancer; a positively charged material; a marker to which an avidin-based protein is bound; and a manual.
[0242] In this case, the gene specifically expressed in lung cancer may be any one or more selected from the group consisting of SART3, PLAT, ALK, ROS1, PI3K, SLOOP, CDCA7, S100A2, ETV4, and a combination thereof.
[0243] In addition, the manual may describe that the kit is configured to be capable of diagnosing lung cancer by the following protocol: a) isolate cfDNA from a biological sample isolated from an individual using a positively charged material contained in the kit; b) mix sequentially or simultaneously a probe to which biotin is bound contained in the kit and a marker contained in the kit in the isolated cfDNA; c) remove the probe that does not bind to cfDNA and the marker; and d) detect the signal of the marker.
[0244] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of ENO2, ACPP, KRT19, EGFR, KRAS, RET, ERBB2, MMP11, TOP2A, UBE2C, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof.
[0245] In addition, the probe, the positively charged material, and the marker are as described above.
[0246] Lung Cancer Diagnostic Device
[0247] Other aspect of the present invention provides a device for diagnosing lung cancer by detecting a gene derived from lung cancer cells from a sample without amplification, wherein the device comprises a) a mixing part for mixing a biological sample isolated from an individual comprising cfDNA and a positively charged material; b) an obtaining part for removing the sample except for the positively charged material to which cfDNA is bound; c) a reaction part for adding sequentially or simultaneously a probe to which biotin is bound capable of complementarily binding to the gene specifically expressed in lung cancer; and a nanoparticle comprising streptavidin and a marker to the positively charged material to which cfDNA is bound; d) a detection part for detecting the marker; and e) an information processing part for determining whether there is cfDNA having a sequence complementary to the probe and derived from lung cancer in the sample depending on whether the marker is detected.
[0248] In this case, the gene specifically expressed in lung cancer may be any one or more selected from the group consisting of SART3, PLAT, ALK, ROS1, PI3K, SLOOP, CDCA7, S100A2, ETV4, and a combination thereof.
[0249] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of ENO2, ACPP, KRT19, EGFR, KRAS, RET, ERBB2, MMP11, TOP2A, UBE2C, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof
[0250] <Thyroid Cancer>
[0251] Method for Diagnosing Thyroid Cancer
[0252] One aspect of the present invention provides a method for diagnosing thyroid cancer by detecting a gene derived from thyroid cancer cells from a sample without amplification, wherein the method comprises a) a step of mixing a biological sample isolated from an individual comprising cell-free DNA (hereinafter cfDNA) and a positively charged material; b) a step of isolating the positively charged material to which cfDNA is bound; c) a step of sequentially or simultaneously mixing a probe having a sequence complementary to the cfDNA and a marker in the mixture; d) a step of removing the probe that does not bind to cfDNA and the marker; and e) a step of detecting the marker, wherein the probe having a sequence complementary to cfDNA complementarily binds to a gene known as a thyroid cancer biomarker. In this case, a gene known as a thyroid cancer biomarker may be a gene encoding a protein overexpressed in thyroid cancer.
[0253] Specifically, the probe having a sequence complementary to cfDNA may complementarily bind to at least any one gene selected from the group consisting of TG, CALCA, APOC1, HIG2, and a combination thereof.
[0254] In addition, the purpose of using the isolated biological sample is to detect cfDNA present in the sample. Therefore, cfDNA in a sample may be used by being isolated and/or concentrated in various ways. In one embodiment, a nitrocellulose membrane having a strong affinity for nucleic acid may be used. In addition, in one embodiment, a positively charged material may be used to capture a negatively charged cfDNA. The positively charged material may be a nanoparticle, a nanowire, a network, or a positively charged filter, but is not limited thereto. In one embodiment of the “positively charged material”, it may be a positively charged nanostructure or a positively charged membrane.
[0255] In one example of the nanostructure, it may comprise a cationic polymer. The kind of the cationic polymer is not limited. One embodiment of the cationic polymer may be polyethyleneimine (PEI), and may be a cationic branched polymer polyethyleneimine.
[0256] In addition, by mixing nanowires labeled with streptavidin protein with a solution of PEI to which biotin is bound, cationic branched polyethyleneimine (cationic branched PEI) may be further bound to the nanowires through the interaction of biotin-streptavidin protein. As a result, the nanoparticles in the nanostructures (PEI/mPpy NWs) with polyethyleneimine, a cationic polymer, bound to the surface of the nanostructures may be incorporated with high density and irregular distribution.
[0257] These nanowires can successfully capture genomic DNA and cfDNA with high efficiency even at a low concentration. In particular, due to the characteristics of the nanowires such as the large surface area for binding with target molecules such as DNA and the enhanced mobility for promoting interaction with DNA, it is possible to efficiently and effectively capture the target cfDNA.
[0258] In this case, the target cfDNA refers to the desired cfDNA to be detected. In the present specification, cfDNA has double strands. In this case, in a portion of the cfDNA, double strands may be unwound. In addition, the cfDNA may be derived from a gene of thyroid cancer cells. Specifically, cfDNA may include a nucleic acid sequence overexpressed in thyroid cancer cells. The nucleic acid sequence that is overexpressed in the cancer cells refers to a nucleic acid sequence that is overexpressed in specific cancer cells, although it has an appropriate expression level in normal cells.
[0259] Specifically, the level or reference (cutoff) of the nucleic acid sequence overexpressed in cancer cells may be a case where the OD value is 0.010 or more when the absorbance (optical density) is measured using a marker. More specifically, in the level or reference of the nucleic acid sequence overexpressed in cancer cells, an OD value is about 0.012 or about 0.015 or more by measuring a absorbance using a marker. In this case, the wavelength irradiated for measuring the absorbance may be appropriately determined according to a marker. The cfDNA may be DNA in which double strands are unwound (unwinding of DNA). In addition, cfDNA may be appropriately determined according to the purpose.
[0260] In addition, the cfDNA derived from thyroid cancer cells may be characterized by i) having a lower Tm value than that of cfDNA having a double helix structure derived from normal cells, or ii) being denatured in a condition in which the cfDNA having a double helix structure derived from normal cells is not denatured.
[0261] In addition, the cfDNA is capable of binding with a about 15-mer to about 30-mer probe that can complementarily bind to cfDNA in any one of the following conditions: i) a condition of allowing to stand for about 1 minute to about 120 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for about 1 second to about 3 minutes; iii) a condition of heating at about 75° C. to about 90° C. for about 1 second to about 5 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 30 seconds to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 10 minutes to about 120 minutes; vi) a condition of treating with protease for about 1 minute to about 30 minutes; vii) a condition of treating with DNase for about 1 minute to about 30 minutes; and viii) a condition of treating with a chemical substance (for example, sodium hydroxide, DMSO, a surfactant, and the like).
[0262] The gene overexpressed in thyroid cancer cells may be any one selected from the group consisting of ACPP (NCBI Gene ID: 55), ENO2 (NCBI Gene ID: 2026), TG (NCBI Gene ID: 7038), CALCA (NCBI Gene ID: 796), APOC1 (NCBI Gene ID: 341), HIG2 (NCBI Gene ID: 29923), TYRO3 (NCBI Gene ID: 7301), CPT1A (NCBI Gene ID: 1374), IFNG (NCBI Gene ID: 3458), CD274 (NCBI Gene ID: 29126), FOLR1 (NCBI Gene ID: 2348), EPCAM (NCBI Gene ID: 4072), and a combination thereof.
[0263] In one embodiment, the gene specifically present in thyroid cancer may be TG, CALCA, APOC1, HIG2 genes, and additionally, ENO2, ACPP, TYRO3, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, or EPCAM gene may be additionally detected to diagnose thyroid cancer.
[0264] As used herein, the term “TG” refers to a gene encoding thyroglobulin (Tg). The thyroglobulin is produced only in the thyroid gland in the human body, and when thyroid cancer develops or metastasizes, the level of thyroglobulin in the blood is increased. The level of thyroglobulin in the blood is used as a thyroid cancer marker.
[0265] As used herein, the term “CALCA” refers to a gene encoding a calcitonin gene-related peptide.
[0266] As used herein, the term “probe” refers to DNA or RNA for detecting cfDNA. The probe may have a specific sequence to be capable of complementarily binding to cfDNA. The probe having a sequence complementary to cfDNA refers to a probe having a nucleic acid sequence capable of complementarily binding to a desired double-stranded cfDNA to be detected present in plasma. In this case, the probe may be one to which biotin is bound. The probe may be bound to a marker that is bound to a biotin-binding protein.
[0267] As used herein, the term “marker” refers to a material that is used for detecting a probe bound to cfDNA. The marker may be a nanoparticle, a fluorescent dye, a fluorescent protein, or an enzyme. Specifically, the marker may be any one selected from the group consisting of a quantum dot, an HRP and a fluorescent protein. In one embodiment, the marker may be GFP (green fluorescent protein), BFP (blue fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow fluorescent protein), or HRP (horse radish peroxidase), but is not limited thereto.
[0268] The marker may be one to which a biotin-binding protein is bound. The biotin-binding protein may be an avidin-based protein, avidin, streptavidin, traptavidin, or neutravidin, but may be used without limit as long as it is a protein that can specifically bind to biotin. In one embodiment, the marker may be one to which streptavidin is bound.
[0269] As used herein, the term “streptavidin” is a tetrameric biotin-binding protein with a molecular weight of about 60 kDa isolated from Streptomyces avidinii. It has very low homology to the avidin, but its structure is very similar to the avidin. Like avidin, it has an antibacterial activity and a very high binding capacity to biotin. On the other hand, unlike avidin, it does not contain carbohydrates, has an acidic isoelectric point (pI=5), and has a significantly lower solubility than avidin. A commercially available streptavidin such as Thermo Scientific Pierce Streptavidin is in a recombinant form of streptavidin having a molecular weight of about 53 kDa and has an isoelectric point which is near neutral (pI=6.8 to 7.5). The streptavidin having the lack of glycosylation and low pI has a low level of non-specific binding (in particular, lectin binding) as compared to avidin. These properties of streptavidin allow it to be selected as an ideal reagent for many detection systems.
[0270] As used herein, the term “traptavidin” refers to a mutant (variant or mutein) of streptavidin, and is a protein having a dissociation rate for biotin that is slower by about 10 times and having an increased mechanical strength and enhanced thermal stability. In addition, the traptavidin specifically binds to biotin.
[0271] The term “neutravidin” of the present invention is also referred to as “deglycosylated avidin” and is prepared to avoid the main disadvantages of naturally occurring avidin and streptavidin. As shown in the name, neutravidin is produced by deglycosylating avidin. It is a protein that has a reduced molecular weight (about 60 kDa) and maintains a high biotin binding capacity as compared to avidin. The deglycosylation of the avidin reduces the binding of lectin to an undetectable level and lowers an isoelectric point (pI=about 6.3) to effectively eliminate the main cause of non-specific binding to avidin. A lysine residue remains usable, so it can be easily derivatized or complexed like streptavidin. In addition, since it exhibits high biotin binding capacity and low non-specific binding, it can be used in various ways as an ideal biotin-binding protein.
[0272] As used herein, the term “a step of detecting the marker” refers to a step of detecting a marker that is bound to a probe through a reaction of biotin-avidin. The detection of the marker can be measured by a color change, a UV absorbance change, the presence or absence of bioluminescence, a fluorescence change, or an electrochemical change. Specifically, the method for detecting the marker may be performed differently depending on the marker used. For example, when HRP is used as a marker, the marker can be detected by observing the color reaction through the reaction between hydrogen peroxide and a substrate. In addition, when the marker is a fluorescent protein such as GFP, the presence or absence of the marker can be detected by observing the detected light after irradiating light of a specific wavelength. In addition, when the marker is luciferase, the presence of the marker can be detected by measuring the bioluminescence that is exhibited after adding a substrate such as luciferin by bioluminometer.
[0273] In addition, the diagnostic method of the present invention may further comprise a step of denaturing cfDNA. In this case, the denaturation step can be performed to selectively denature only cfDNA derived from thyroid cancer, but not to denature normal double-stranded cfDNA. To this end, the conditions of the denaturation step may be performed at about 50° C. to about 100° C. for about 0.1 second to about 5 minutes. One embodiment of the denaturation temperature may be about 95° C., and the denaturation time may be usually about 0.1 second to about 8 minutes. In addition, it may be denatured for about 1 second, about 5 seconds, about 10 seconds, about 30 seconds, about 60 seconds, or about 90 seconds. In one embodiment, the step of denaturing cfDNA may be performed prior to step c) above.
[0274] Specifically, the method may further comprise a step of denaturing the sample or cfDNA bound to the positively charged material prior to step c) above in any one condition selected from the group consisting of i) a condition of allowing to stand for about 1 minute to about 10 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for 1 second to 1 minute; iii) a condition of heating at about 75° C. to about 90° C. for about 10 seconds to about 3 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 1 minute to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 5 minutes to about 60 minutes; vi) a condition of treating with protease for about 1 minute to about 10 minutes; and vii) a condition of treating with DNaseI for about 1 minute to about 10 minutes. This denaturation step does not denature the double-stranded cfDNA derived from normal cells, but selectively denatures only cfDNA derived from cancer cells, thereby making it easier to bind with the probe. The denaturation conditions of i) to vii) may be performed after obtaining a sample. In addition, the denaturation conditions of i) to vii) may be performed after obtaining cfDNA bound to the positively charged material. In addition, the temperature, protease, and DNase treatment time of the denaturation conditions of i) to vii) may be appropriately adjusted as long as they do not denature the stable cfDNA.
[0275] Thyroid Cancer Diagnostic Kit
[0276] Other aspect of the present invention provides a diagnostic kit for diagnosing thyroid cancer, comprising a probe to which biotin is bound complementarily binding to a gene specifically expressed in thyroid cancer; a positively charged material; a marker to which an avidin-based protein is bound; and a manual.
[0277] In this case, the gene specifically expressed in thyroid cancer may be any one or more selected from the group consisting of TG, CALCA, APOC1, HIG2, and a combination thereof.
[0278] In addition, the manual may describe that the kit is configured to be capable of diagnosing thyroid cancer by the following protocol: a) isolate cfDNA from a biological sample isolated from an individual using a positively charged material contained in the kit; b) mix sequentially or simultaneously a probe to which biotin is bound contained in the kit and a marker contained in the kit in the isolated cfDNA; c) remove the probe that does not bind to cfDNA and the marker; and d) detect the signal of the marker.
[0279] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of ENO2, ACPP, TYRO3, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof.
[0280] In addition, the probe, the positively charged material, and the marker are as described above.
[0281] Thyroid Cancer Diagnostic Device
[0282] Other aspect of the present invention provides a device for diagnosing thyroid cancer by detecting a gene derived from thyroid cancer cells from a sample without amplification, wherein the device comprises a) a mixing part for mixing a biological sample isolated from an individual comprising cfDNA and a positively charged material; b) an obtaining part for removing the sample except for the positively charged material to which cfDNA is bound; c) a reaction part for adding sequentially or simultaneously a probe to which biotin is bound capable of complementarily binding to the gene specifically expressed in thyroid cancer; and a nanoparticle comprising streptavidin and a marker to the positively charged material to which cfDNA is bound; d) a detection part for detecting the marker; and e) an information processing part for determining whether there is cfDNA having a sequence complementary to the probe and derived from thyroid cancer in the sample depending on whether the marker is detected.
[0283] In this case, the gene specifically expressed in thyroid cancer may be any one or more selected from the group consisting of TG, CALCA, APOC1, HIG2, and a combination thereof.
[0284] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of ENO2, ACPP, TYRO3, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof
[0285] <Bladder Cancer>
[0286] Method for Diagnosing Bladder cancer
[0287] One aspect of the present invention provides a method for diagnosing bladder cancer by detecting a gene derived from bladder cancer cells from a sample without amplification, wherein the method comprises a) a step of mixing a biological sample isolated from an individual comprising cell-free DNA (hereinafter cfDNA) and a positively charged material; b) a step of isolating the positively charged material to which cfDNA is bound; c) a step of sequentially or simultaneously mixing a probe having a sequence complementary to the cfDNA and a marker in the mixture; d) a step of removing the probe that does not bind to cfDNA and the marker; and e) a step of detecting the marker, wherein the probe having a sequence complementary to cfDNA complementarily binds to a gene known as a bladder cancer biomarker. In this case, a gene known as a bladder cancer biomarker may be a gene encoding a protein overexpressed in bladder cancer.
[0288] Specifically, the probe having a sequence complementary to cfDNA may complementarily bind to at least any one gene selected from the group consisting of OGT, FGFR3, TP53, NUMA1, COCH, CELSR3, HMOX1, KIF1A, MGC17624, MTAP, PFKFB4, S100A8, RSPH9, FOXM1, FANCB, FANCC, FANCD2, RUSC1-AS1, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLXDC2, ZNF312, SYCP2L, HOXA9, ISL1, ALDH1A3, and a combination thereof.
[0289] In addition, the purpose of using the isolated biological sample is to detect cfDNA present in the sample. Therefore, cfDNA in a sample may be used by being isolated and/or concentrated in various ways. In one embodiment, a nitrocellulose membrane having a strong affinity for nucleic acid may be used. In addition, in one embodiment, a positively charged material may be used to capture a negatively charged cfDNA. The positively charged material may be a nanoparticle, a nanowire, a network, or a positively charged filter, but is not limited thereto. In one embodiment of the “positively charged material”, it may be a positively charged nanostructure or a positively charged membrane.
[0290] In one example of the nanostructure, it may comprise a cationic polymer. The kind of the cationic polymer is not limited. One embodiment of the cationic polymer may be polyethyleneimine (PEI), and may be a cationic branched polymer polyethyleneimine.
[0291] In addition, by mixing nanowires labeled with streptavidin with a solution of PEI to which biotin is bound, cationic branched polyethyleneimine (cationic branched PEI) may be further bound to the nanowires through the interaction of biotin-streptavidin. As a result, the nanoparticles in the nanostructures (PEI/mPpy NWs) with polyethyleneimine, a cationic polymer, bound to the surface of the nanostructures may be incorporated with high density and irregular distribution.
[0292] These nanowires can successfully capture genomic DNA and cfDNA with high efficiency even at a low concentration. In particular, due to the characteristics of the nanowires such as the large surface area for binding with target molecules such as DNA and the enhanced mobility for promoting interaction with DNA, it is possible to efficiently and effectively capture the target cfDNA.
[0293] In this case, the target cfDNA refers to the desired cfDNA to be detected. In the present specification, cfDNA has double strands. In this case, in a portion of the cfDNA, double strands may be unwound. In addition, the cfDNA may be derived from a gene of bladder cancer cells. Specifically, cfDNA may include a nucleic acid sequence overexpressed in bladder cancer cells. The nucleic acid sequence that is overexpressed in the cancer cells refers to a nucleic acid sequence that is overexpressed in specific cancer cells, although it has an appropriate expression level in normal cells.
[0294] Specifically, the level or reference (cutoff) of the nucleic acid sequence overexpressed in cancer cells may be a case where the OD value is 0.010 or more when the absorbance (optical density) is measured using a marker. More specifically, in the level or reference of the nucleic acid sequence overexpressed in cancer cells, an OD value is about 0.012 or about 0.015 or more by measuring an absorbance using a marker. In this case, the wavelength irradiated for measuring the absorbance may be appropriately determined according to a marker. The cfDNA may be DNA in which double strands are unwound (unwinding of DNA). In addition, cfDNA may be appropriately determined according to the purpose.
[0295] In addition, the cfDNA derived from bladder cancer cells may be characterized by i) having a lower Tm value than that of cfDNA having a double helix structure derived from normal cells, or ii) being denatured in a condition in which the cfDNA having a double helix structure derived from normal cells is not denatured.
[0296] In addition, the cfDNA is capable of binding with a about 15-mer to about 30-mer probe that can complementarily bind to cfDNA in any one of the following conditions: i) a condition of allowing to stand for about 1 minute to about 120 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for about 1 second to about 3 minutes; iii) a condition of heating at about 75° C. to about 90° C. for about 1 second to about 5 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 30 seconds to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 10 minutes to about 120 minutes; vi) a condition of treating with protease for about 1 minute to about 30 minutes; vii) a condition of treating with DNase for about 1 minute to about 30 minutes; and viii) a condition of treating with a chemical substance (for example, sodium hydroxide, DMSO, a surfactant, and the like).
[0297] The gene overexpressed in bladder cancer cells may be any one selected from the group consisting of OGT (NCBI Gene ID: 8473), FGFR3 (NCBI Gene ID: 2261), TP53 (NCBI Gene ID: 7157), NUMA1 (NCBI Gene ID: 4926), KRT19 (NCBI Gene ID: 3880), COCH(NCBI Gene ID: 1690), CELSR3 (NCBI Gene ID: 1951), HMOX1 (NCBI Gene ID: 3162), KIF1A (NCBI Gene ID: 547), MGC17624 (NCBI Gene ID: 404550), MTAP (NCBI Gene ID: 4507), PFKFB4 (NCBI Gene ID: 5210), S100A8 (NCBI Gene ID: 6279), RSPH9 (NCBI Gene ID: 221421), CCNB1 (NCBI Gene ID: 891), FOXM1 (NCBI Gene ID: 2305), FANCB (NCBI Gene ID: 2187), FANCC(NCBI Gene ID: 2176), FANCD2 (NCBI Gene ID: 2177), RUSC1-AS1 (NCBI Gene ID: 284618), CACNA1B (NCBI Gene ID: 774), IMP-1 (NCBI Gene ID: 10642), PDE3A (NCBI Gene ID: 5139), POU3F4 (NCBI Gene ID: 5456), SOX3 (NCBI Gene ID: 6658), DMC1 (NCBI Gene ID: 11144), PLXDC2 (NCBI Gene ID: 84898), ZNF312 (NCBI Gene ID: 55079), SYCP2L (NCBI Gene ID: 221711), HOXA9 (NCBI Gene ID: 3205), ISL1 (NCBI Gene ID: 3670), ALDH1A3 (NCBI Gene ID: 220), CPT1A (NCBI Gene ID: 1374), IFNG (NCBI Gene ID: 3458), CD274 (NCBI Gene ID: 29126), FOLR1 (NCBI Gene ID: 2348), EPCAM (NCBI Gene ID: 4072), and a combination thereof.
[0298] In one embodiment, the gene specifically present in bladder cancer may be OGT, FGFR3, TP53, NUMA1, COCH, CELSR3, HMOX1, KIF1A, MGC17624, MTAP, PFKFB4, S100A8, RSPH9, FOXM1, FANCB, FANCC, FANCD2, RUSC1-AS1, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLXDC2, ZNF312, SYCP2L, HOXA9, ISL1, ALDH1A3 genes, and additionally, KRT19, CCNB1, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, or EPCAM gene may be additionally detected to diagnose bladder cancer.
[0299] As used herein, the term “OGT” refers to a gene encoding O-GlcNAc transferase.
[0300] As used herein, the term “FGFR1” refers to a gene encoding fibroblast growth factor receptor 1.
[0301] As used herein, the term “NUMA1” refers to a gene encoding NMP22 (nuclear matrix protein-22). It was found that the level of the NMP22 in urine of patients with some types of cancer, including bladder cancer, is higher than a normal level, and thus the NMP22 is widely used as a bladder cancer marker.
[0302] As used herein, the term “probe” refers to DNA or RNA for detecting cfDNA. The probe may have a specific sequence to be capable of complementarily binding to cfDNA. The probe having a sequence complementary to cfDNA refers to a probe having a nucleic acid sequence capable of complementarily binding to a desired double-stranded cfDNA to be detected present in plasma. In this case, the probe may be one to which biotin is bound. The probe may be bound to a marker that is bound to a biotin-binding protein.
[0303] As used herein, the term “marker” refers to a material that is used for detecting a probe bound to cfDNA. The marker may be a nanoparticle, a fluorescent dye, a fluorescent protein, or an enzyme. Specifically, the marker may be any one selected from the group consisting of a quantum dot, an HRP and a fluorescent protein. In one embodiment, the marker may be GFP (green fluorescent protein), BFP (blue fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow fluorescent protein), or HRP (horse radish peroxidase), but is not limited thereto.
[0304] The marker may be one to which a biotin-binding protein is bound. The biotin-binding protein may be an avidin-based protein, avidin, streptavidin, traptavidin, or neutravidin, but may be used without limit as long as it is a protein that can specifically bind to biotin. In one embodiment, the marker may be one to which streptavidin is bound.
[0305] As used herein, the term “streptavidin” is a tetrameric biotin-binding protein with a molecular weight of about 60 kDa isolated from Streptomyces avidinii. It has very low homology to the avidin, but its structure is very similar to the avidin. Like avidin, it has an antibacterial activity and a very high binding capacity to biotin. On the other hand, unlike avidin, it does not contain carbohydrates, has an acidic isoelectric point (pI=5), and has a significantly lower solubility than avidin. A commercially available streptavidin such as Thermo Scientific Pierce Streptavidin is in a recombinant form of streptavidin having a molecular weight of about 53 kDa and has an isoelectric point which is near neutral (pI=6.8 to 7.5). The streptavidin having the lack of glycosylation and low pI has a low level of non-specific binding (in particular, lectin binding) as compared to avidin. These properties of streptavidin allow it to be selected as an ideal reagent for many detection systems.
[0306] As used herein, the term “traptavidin” refers to a mutant (variant or mutein) of streptavidin, and is a protein having a dissociation rate for biotin that is slower by about 10 times and having an increased mechanical strength and enhanced thermal stability. In addition, the traptavidin specifically binds to biotin.
[0307] The term “neutravidin” of the present invention is also referred to as “deglycosylated avidin” and is prepared to avoid the main disadvantages of naturally occurring avidin and streptavidin. As shown in the name, neutravidin is produced by deglycosylating avidin. It is a protein that has a reduced molecular weight (about 60 kDa) and maintains a high biotin binding capacity as compared to avidin. The deglycosylation of the avidin reduces the binding of lectin to an undetectable level and lowers an isoelectric point (pI=about 6.3) to effectively eliminate the main cause of non-specific binding to avidin. A lysine residue remains usable, so it can be easily derivatized or complexed like streptavidin. In addition, since it exhibits high biotin binding capacity and low non-specific binding, it can be used in various ways as an ideal biotin-binding protein.
[0308] As used herein, the term “a step of detecting the marker” refers to a step of detecting a marker that is bound to a probe through a reaction of biotin-avidin. The detection of the marker can be measured by a color change, a UV absorbance change, the presence or absence of bioluminescence, a fluorescence change, or an electrochemical change. Specifically, the method for detecting the marker may be performed differently depending on the marker used. For example, when HRP is used as a marker, the marker can be detected by observing the color reaction through the reaction between hydrogen peroxide and a substrate. In addition, when the marker is a fluorescent protein such as GFP, the presence or absence of the marker can be detected by observing the detected light after irradiating light of a specific wavelength. In addition, when the marker is luciferase, the presence of the marker can be detected by measuring the bioluminescence that is exhibited after adding a substrate such as luciferin by bioluminometer.
[0309] In addition, the diagnostic method of the present invention may further comprise a step of denaturing cfDNA. In this case, the denaturation step can be performed to selectively denature only cfDNA derived from bladder cancer, but not to denature normal double-stranded cfDNA. To this end, the conditions of the denaturation step may be performed at about 50° C. to about 100° C. for about 0.1 second to about 5 minutes. One embodiment of the denaturation temperature may be about 95° C., and the denaturation time may be usually about 0.1 second to about 8 minutes. In addition, it may be denatured for about 1 second, about 5 seconds, about 10 seconds, about 30 seconds, about 60 seconds, or about 90 seconds. In one embodiment, the step of denaturing cfDNA may be performed prior to step c) above.
[0310] Specifically, the method may further comprise a step of denaturing the sample or cfDNA bound to the positively charged material prior to step c) above in any one condition selected from the group consisting of i) a condition of allowing to stand for about 1 minute to about 10 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for 1 second to 1 minute; iii) a condition of heating at about 75° C. to about 90° C. for about 10 seconds to about 3 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 1 minute to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 5 minutes to about 60 minutes; vi) a condition of treating with protease for about 1 minute to about 10 minutes; and vii) a condition of treating with DNaseI for about 1 minute to about 10 minutes. This denaturation step does not denature the double-stranded cfDNA derived from normal cells, but selectively denatures only cfDNA derived from cancer cells, thereby making it easier to bind with the probe. The denaturation conditions of i) to vii) may be performed after obtaining a sample. In addition, the denaturation conditions of i) to vii) may be performed after obtaining cfDNA bound to the positively charged material. In addition, the temperature, protease, and DNase treatment time of the denaturation conditions of i) to vii) may be appropriately adjusted as long as they do not denature the stable cfDNA.
[0311] Bladder Cancer Diagnostic Kit
[0312] Other aspect of the present invention provides a diagnostic kit for diagnosing bladder cancer, comprising a probe to which biotin is bound complementarily binding to a gene specifically expressed in bladder cancer; a positively charged material; a marker to which an avidin-based protein is bound; and a manual.
[0313] In this case, the gene specifically expressed in bladder cancer may be any one or more selected from the group consisting of OGT, FGFR3, TP53, NUMA1, COCH, CELSR3, HMOX1, KIF1A, MGC17624, MTAP, PFKFB4, S100A8, RSPH9, FOXM1, FANCB, FANCC, FANCD2, RUSC1-AS1, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLXDC2, ZNF312, SYCP2L, HOXA9, ISL1, ALDH1A3, and a combination thereof.
[0314] In addition, the manual may describe that the kit is configured to be capable of diagnosing bladder cancer by the following protocol: a) isolate cfDNA from a biological sample isolated from an individual using a positively charged material contained in the kit; b) mix sequentially or simultaneously a probe to which biotin is bound contained in the kit and a marker contained in the kit in the isolated cfDNA; c) remove the probe that does not bind to cfDNA and the marker; and d) detect the signal of the marker.
[0315] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of KRT19, CCNB1, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof.
[0316] In addition, the probe, the positively charged material, and the marker are as described above.
[0317] Bladder Cancer Diagnostic Device
[0318] Other aspect of the present invention provides a device for diagnosing bladder cancer by detecting a gene derived from bladder cancer cells from a sample without amplification, wherein the device comprises a) a mixing part for mixing a biological sample isolated from an individual comprising cfDNA and a positively charged material; b) an obtaining part for removing the sample except for the positively charged material to which cfDNA is bound; c) a reaction part for adding sequentially or simultaneously a probe to which biotin is bound capable of complementarily binding to the gene specifically expressed in bladder cancer; and a nanoparticle comprising streptavidin and a marker to the positively charged material to which cfDNA is bound; d) a detection part for detecting the marker; and e) an information processing part for determining whether there is cfDNA having a sequence complementary to the probe and derived from bladder cancer in the sample depending on whether the marker is detected.
[0319] In this case, the gene specifically expressed in bladder cancer may be any one or more selected from the group consisting of OGT, FGFR3, TP53, NUMA1, COCH, CELSR3, HMOX1, KIF1A, MGC17624, MTAP, PFKFB4, S100A8, RSPH9, FOXM1, FANCB, FANCC, FANCD2, RUSC1-AS1, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLXDC2, ZNF312, SYCP2L, HOXA9, ISL1, ALDH1A3, and a combination thereof.
[0320] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of KRT19, CCNB1, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof
[0321] <Breast Cancer>
[0322] Method for Diagnosing Breast cancer
[0323] One aspect of the present invention provides a method for diagnosing breast cancer by detecting a gene derived from breast cancer cells from a sample without amplification, wherein the method comprises a) a step of mixing a biological sample isolated from an individual comprising cell-free DNA (hereinafter cfDNA) and a positively charged material; b) a step of isolating the positively charged material to which cfDNA is bound; c) a step of sequentially or simultaneously mixing a probe having a sequence complementary to the cfDNA and a marker in the mixture; d) a step of removing the probe that does not bind to cfDNA and the marker; and e) a step of detecting the marker, wherein the probe having a sequence complementary to cfDNA complementarily binds to a gene known as a breast cancer biomarker. In this case, a gene known as a breast cancer biomarker may be a gene encoding a protein overexpressed in breast cancer.
[0324] Specifically, the probe having a sequence complementary to cfDNA may complementarily bind to at least any one gene selected from the group consisting of MEST, NR1D1, BIRC5, RACGAP1, DHCR7, STC2, AZGP1, RBBP8, IL6ST, MGP, TRBC1, MMP11, COL10A1, C10orf64, COL11A1, POTEG, FSIP1, HER2, and a combination thereof.
[0325] In addition, the purpose of using the isolated biological sample is to detect cfDNA present in the sample. Therefore, cfDNA in a sample may be used by being isolated and/or concentrated in various ways. In one embodiment, a nitrocellulose membrane having a strong affinity for nucleic acid may be used. In addition, in one embodiment, a positively charged material may be used to capture a negatively charged cfDNA. The positively charged material may be a nanoparticle, a nanowire, a network, or a positively charged filter, but is not limited thereto. In one embodiment of the “positively charged material”, it may be a positively charged nanostructure or a positively charged membrane.
[0326] In one example of the nanostructure, it may comprise a cationic polymer. The kind of the cationic polymer is not limited. One embodiment of the cationic polymer may be polyethyleneimine (PEI), and may be a cationic branched polymer polyethyleneimine.
[0327] In addition, by mixing nanowires labeled with streptavidin with a solution of PEI to which biotin is bound, cationic branched polyethyleneimine (cationic branched PEI) may be further bound to the nanowires through the interaction of biotin-streptavidin. As a result, the nanoparticles in the nanostructures (PEI/mPpy NWs) with polyethyleneimine, a cationic polymer, bound to the surface of the nanostructures may be incorporated with high density and irregular distribution.
[0328] These nanowires can successfully capture genomic DNA and cfDNA with high efficiency even at a low concentration. In particular, due to the characteristics of the nanowires such as the large surface area for binding with target molecules such as DNA and the enhanced mobility for promoting interaction with DNA, it is possible to efficiently and effectively capture the target cfDNA.
[0329] In this case, the target cfDNA refers to the desired cfDNA to be detected. In the present specification, cfDNA has double strands. In this case, in a portion of the cfDNA, double strands may be unwound. In addition, the cfDNA may be derived from a gene of breast cancer cells. Specifically, cfDNA may include a nucleic acid sequence overexpressed in breast cancer cells. The nucleic acid sequence that is overexpressed in the cancer cells refers to a nucleic acid sequence that is overexpressed in specific cancer cells, although it has an appropriate expression level in normal cells.
[0330] Specifically, the level or reference (cutoff) of the nucleic acid sequence overexpressed in cancer cells may be a case where the OD value is 0.010 or more when the absorbance (optical density) is measured using a marker. More specifically, in the level or reference of the nucleic acid sequence overexpressed in cancer cells, an OD value is about 0.012 or about 0.015 or more by measuring an absorbance using a marker. In this case, the wavelength irradiated for measuring the absorbance may be appropriately determined according to a marker. The cfDNA may be DNA in which double strands are unwound (unwinding of DNA). In addition, cfDNA may be appropriately determined according to the purpose.
[0331] In addition, the cfDNA derived from breast cancer cells may be characterized by i) having a lower Tm value than that of cfDNA having a double helix structure derived from normal cells, or ii) being denatured in a condition in which the cfDNA having a double helix structure derived from normal cells is not denatured.
[0332] In addition, the cfDNA is capable of binding with a about 15-mer to about 30-mer probe that can complementarily bind to cfDNA in any one of the following conditions: i) a condition of allowing to stand for about 1 minute to about 120 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for about 1 second to about 3 minutes; iii) a condition of heating at about 75° C. to about 90° C. for about 1 second to about 5 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 30 seconds to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 10 minutes to about 120 minutes; vi) a condition of treating with protease for about 1 minute to about 30 minutes; vii) a condition of treating with DNase for about 1 minute to about 30 minutes; and viii) a condition of treating with a chemical substance (for example, sodium hydroxide, DMSO, a surfactant, and the like).
[0333] The gene overexpressed in breast cancer cells may be any one selected from the group consisting of MUC1 (NCBI Gene ID: 4582), ACPP (NCBI Gene ID: 55), MEST (NCBI Gene ID: 4232), TYRO3 (NCBI Gene ID: 7301), NR1D1 (NCBI Gene ID: 9572), UBE2C(NCBI Gene ID: 11065), BIRC5 (NCBI Gene ID: 332), RACGAP1 (NCBI Gene ID: 29127), DHCR7 (NCBI Gene ID: 1717), STC2 (NCBI Gene ID: 8614), AZGP1 (NCBI Gene ID: 563), RBBP8 (NCBI Gene ID: 5932), IL6ST (NCBI Gene ID: 3572), MGP (NCBI Gene ID: 4256), TRBC1 (NCBI Gene ID: 28639), MMP11 (NCBI Gene ID: 4320), COL10A1 (NCBI Gene ID: 1300), C10orf64 (NCBI Gene ID: 57705), COL11A1 (NCBI Gene ID: 1301), POTEG (NCBI Gene ID: 404785), FSIP1 (NCBI Gene ID: 161835), HER2 (NCBI Gene ID: 2064), CPT1A (NCBI Gene ID: 1374), IFNG (NCBI Gene ID: 3458), CD274 (NCBI Gene ID: 29126), FOLR1 (NCBI Gene ID: 2348), EPCAM (NCBI Gene ID: 4072), and a combination thereof.
[0334] In one embodiment, the gene specifically present in breast cancer may be MEST, NR1D1, BIRC5, RACGAP1, DHCR7, STC2, AZGP1, RBBP8, IL6ST, MGP, TRBC1, MMP11, COL10A1, C10orf64, COL11A1, POTEG, FSIP1, HER2 genes, and additionally, MUC1, ACPP, TYRO3, UBE2C, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, or EPCAM gene may be additionally detected to diagnose breast cancer.
[0335] As used herein, the term “MUC1” refers to a breast cancer-related gene encoding a protein including CA 15-3 (carcinoma antigen 15-3) and CA 27-29. The CA15-3 has been shown to increase the possibility of early recurrence in breast cancer and is used as a breast cancer marker.
[0336] As used herein, the term “probe” refers to DNA or RNA for detecting cfDNA. The probe may have a specific sequence to be capable of complementarily binding to cfDNA. The probe having a sequence complementary to cfDNA refers to a probe having a nucleic acid sequence capable of complementarily binding to a desired double-stranded cfDNA to be detected present in plasma. In this case, the probe may be one to which biotin is bound. The probe may be bound to a marker that is bound to a biotin-binding protein.
[0337] As used herein, the term “marker” refers to a material that is used for detecting a probe bound to cfDNA. The marker may be a nanoparticle, a fluorescent dye, a fluorescent protein, or an enzyme. Specifically, the marker may be any one selected from the group consisting of a quantum dot, an HRP and a fluorescent protein. In one embodiment, the marker may be GFP (green fluorescent protein), BFP (blue fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow fluorescent protein), or HRP (horse radish peroxidase), but is not limited thereto.
[0338] The marker may be one to which a biotin-binding protein is bound. The biotin-binding protein may be an avidin-based protein, avidin, streptavidin, traptavidin, or neutravidin, but may be used without limit as long as it is a protein that can specifically bind to biotin. In one embodiment, the marker may be one to which streptavidin is bound.
[0339] As used herein, the term “streptavidin” is a tetrameric biotin-binding protein with a molecular weight of about 60 kDa isolated from Streptomyces avidinii. It has very low homology to the avidin, but its structure is very similar to the avidin. Like avidin, it has an antibacterial activity and a very high binding capacity to biotin. On the other hand, unlike avidin, it does not contain carbohydrates, has an acidic isoelectric point (pI=5), and has a significantly lower solubility than avidin. A commercially available streptavidin such as Thermo Scientific Pierce Streptavidin is in a recombinant form of streptavidin having a molecular weight of about 53 kDa and has an isoelectric point which is near neutral (pI=6.8 to 7.5). The streptavidin having the lack of glycosylation and low pI has a low level of non-specific binding (in particular, lectin binding) as compared to avidin. These properties of streptavidin allow it to be selected as an ideal reagent for many detection systems.
[0340] As used herein, the term “traptavidin” refers to a mutant (variant or mutein) of streptavidin, and is a protein having a dissociation rate for biotin that is slower by about 10 times and having an increased mechanical strength and enhanced thermal stability. In addition, the traptavidin specifically binds to biotin.
[0341] The term “neutravidin” of the present invention is also referred to as “deglycosylated avidin” and is prepared to avoid the main disadvantages of naturally occurring avidin and streptavidin. As shown in the name, neutravidin is produced by deglycosylating avidin. It is a protein that has a reduced molecular weight (about 60 kDa) and maintains a high biotin binding capacity as compared to avidin. The deglycosylation of the avidin reduces the binding of lectin to an undetectable level and lowers an isoelectric point (pI=about 6.3) to effectively eliminate the main cause of non-specific binding to avidin. A lysine residue remains usable, so it can be easily derivatized or complexed like streptavidin. In addition, since it exhibits high biotin binding capacity and low non-specific binding, it can be used in various ways as an ideal biotin-binding protein.
[0342] As used herein, the term “a step of detecting the marker” refers to a step of detecting a marker that is bound to a probe through a reaction of biotin-avidin. The detection of the marker can be measured by a color change, a UV absorbance change, the presence or absence of bioluminescence, a fluorescence change, or an electrochemical change. Specifically, the method for detecting the marker may be performed differently depending on the marker used. For example, when HRP is used as a marker, the marker can be detected by observing the color reaction through the reaction between hydrogen peroxide and a substrate. In addition, when the marker is a fluorescent protein such as GFP, the presence or absence of the marker can be detected by observing the detected light after irradiating light of a specific wavelength. In addition, when the marker is luciferase, the presence of the marker can be detected by measuring the bioluminescence that is exhibited after adding a substrate such as luciferin by bioluminometer.
[0343] In addition, the diagnostic method of the present invention may further comprise a step of denaturing cfDNA. In this case, the denaturation step can be performed to selectively denature only cfDNA derived from breast cancer, but not to denature normal double-stranded cfDNA. To this end, the conditions of the denaturation step may be performed at about 50° C. to about 100° C. for about 0.1 second to about 5 minutes. One embodiment of the denaturation temperature may be about 95° C., and the denaturation time may be usually about 0.1 second to about 8 minutes. In addition, it may be denatured for about 1 second, about 5 seconds, about 10 seconds, about 30 seconds, about 60 seconds, or about 90 seconds. In one embodiment, the step of denaturing cfDNA may be performed prior to step c) above.
[0344] Specifically, the method may further comprise a step of denaturing the sample or cfDNA bound to the positively charged material prior to step c) above in any one condition selected from the group consisting of i) a condition of allowing to stand for about 1 minute to about 10 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for 1 second to 1 minute; iii) a condition of heating at about 75° C. to about 90° C. for about 10 seconds to about 3 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 1 minute to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 5 minutes to about 60 minutes; vi) a condition of treating with protease for about 1 minute to about 10 minutes; and vii) a condition of treating with DNaseI for about 1 minute to about 10 minutes. This denaturation step does not denature the double-stranded cfDNA derived from normal cells, but selectively denatures only cfDNA derived from cancer cells, thereby making it easier to bind with the probe. The denaturation conditions of i) to vii) may be performed after obtaining a sample. In addition, the denaturation conditions of i) to vii) may be performed after obtaining cfDNA bound to the positively charged material. In addition, the temperature, protease, and DNase treatment time of the denaturation conditions of i) to vii) may be appropriately adjusted as long as they do not denature the stable cfDNA.
[0345] Breast Cancer Diagnostic Kit Other aspect of the present invention provides a diagnostic kit for diagnosing breast cancer, comprising a probe to which biotin is bound complementarily binding to a gene specifically expressed in breast cancer; a positively charged material; a marker to which an avidin-based protein is bound; and a manual.
[0346] In this case, the gene specifically expressed in breast cancer may be any one or more selected from the group consisting of MEST, NR1D1, BIRC5, RACGAP1, DHCR7, STC2, AZGP1, RBBP8, IL6ST, MGP, TRBC1, MMP11, COL10A1, C10orf64, COL11A1, POTEG, FSIP1, HER2, and a combination thereof.
[0347] In addition, the manual may describe that the kit is configured to be capable of diagnosing breast cancer by the following protocol: a) isolate cfDNA from a biological sample isolated from an individual using a positively charged material contained in the kit; b) mix sequentially or simultaneously a probe to which biotin is bound contained in the kit and a marker contained in the kit in the isolated cfDNA; c) remove the probe that does not bind to cfDNA and the marker; and d) detect the signal of the marker.
[0348] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of MUC1, ACPP, TYRO3, UBE2C, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof.
[0349] In addition, the probe, the positively charged material, and the marker are as described above.
[0350] Breast Cancer Diagnostic Device
[0351] Other aspect of the present invention provides a device for diagnosing breast cancer by detecting a gene derived from breast cancer cells from a sample without amplification, wherein the device comprises a) a mixing part for mixing a biological sample isolated from an individual comprising cfDNA and a positively charged material; b) an obtaining part for removing the sample except for the positively charged material to which cfDNA is bound; c) a reaction part for adding sequentially or simultaneously a probe to which biotin is bound capable of complementarily binding to the gene specifically expressed in breast cancer; and a nanoparticle comprising streptavidin and a marker to the positively charged material to which cfDNA is bound; d) a detection part for detecting the marker; and e) an information processing part for determining whether there is cfDNA having a sequence complementary to the probe and derived from breast cancer in the sample depending on whether the marker is detected.
[0352] In this case, the gene specifically expressed in breast cancer may be any one or more selected from the group consisting of MEST, NR1D1, BIRC5, RACGAP1, DHCR7, STC2, AZGP1, RBBP8, IL6ST, MGP, TRBC1, MMP11, COL10A1, C10orf64, COL11A1, POTEG, FSIP1, HER2, and a combination thereof.
[0353] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of MUC1, ACPP, TYRO3, UBE2C, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof
[0354] <Colorectal Cancer>
[0355] Method for Diagnosing Colorectal Cancer
[0356] One aspect of the present invention provides a method for diagnosing colorectal cancer by detecting a gene derived from colorectal cancer cells from a sample without amplification, wherein the method comprises a) a step of mixing a biological sample isolated from an individual comprising cell-free DNA (hereinafter cfDNA) and a positively charged material; b) a step of isolating the positively charged material to which cfDNA is bound; c) a step of sequentially or simultaneously mixing a probe having a sequence complementary to the cfDNA and a marker in the mixture; d) a step of removing the probe that does not bind to cfDNA and the marker; and e) a step of detecting the marker, wherein the probe having a sequence complementary to cfDNA complementarily binds to a gene known as a colorectal cancer biomarker. In this case, a gene known as a colorectal cancer biomarker may be a gene encoding a protein overexpressed in colorectal cancer.
[0357] Specifically, the probe having a sequence complementary to cfDNA may complementarily bind to at least any one gene selected from the group consisting of NCKAP1, AUNIP, NOTUM, KRT5, TUBB, COL6A1, JUP, CDX2, MELTF, EFEMP2, DEFA5, CHEK1, MAD2L1, ENC1, CSE1L, RAD51AP1, ERICH3, SLC7A11, KRT23, PLAU, CDCA1, KLK6, DPEP1, CDH3, ANLN, CXCL1, CTHRC1, LCN2, HS6ST2, EGFL6, CXCL3, CA9, PROX1, SPP1, CST1, CXCL2, TSTA3, RRM2, MMP3, MMP7, MMP10, CXCL5, SERPINB5, TEAD4, BUB1, CDCl2, CLDN2, HSPH1, LY6G6D, PRC1, PUS1, SQLE, TTK, ECT2, RNF183, FBXO39, TEX38, TTLL2, PRR7, CANP, KIAA010, and a combination thereof.
[0358] In addition, the purpose of using the isolated biological sample is to detect cfDNA present in the sample. Therefore, cfDNA in a sample may be used by being isolated and/or concentrated in various ways. In one embodiment, a nitrocellulose membrane having a strong affinity for nucleic acid may be used. In addition, in one embodiment, a positively charged material may be used to capture a negatively charged cfDNA. The positively charged material may be a nanoparticle, a nanowire, a network, or a positively charged filter, but is not limited thereto. In one embodiment of the “positively charged material”, it may be a positively charged nanostructure or a positively charged membrane.
[0359] In one example of the nanostructure, it may comprise a cationic polymer. The kind of the cationic polymer is not limited. One embodiment of the cationic polymer may be polyethyleneimine (PEI), and may be a cationic branched polymer polyethyleneimine.
[0360] In addition, by mixing nanowires labeled with streptavidin protein with a solution of PEI to which biotin is bound, cationic branched polyethyleneimine (cationic branched PEI) may be further bound to the nanowires through the interaction of biotin-streptavidin protein. As a result, the nanoparticles in the nanostructures (PEI/mPpy NWs) with polyethyleneimine, a cationic polymer, bound to the surface of the nanostructures may be incorporated with high density and irregular distribution.
[0361] These nanowires can successfully capture genomic DNA and cfDNA with high efficiency even at a low concentration. In particular, due to the characteristics of the nanowires such as the large surface area for binding with target molecules such as DNA and the enhanced mobility for promoting interaction with DNA, it is possible to efficiently and effectively capture the target cfDNA.
[0362] In this case, the target cfDNA refers to the desired cfDNA to be detected. In the present specification, cfDNA has double strands. In this case, in a portion of the cfDNA, double strands may be unwound. In addition, the cfDNA may be derived from a gene of colorectal cancer cells. Specifically, cfDNA may include a nucleic acid sequence overexpressed in colorectal cancer cells. The nucleic acid sequence that is overexpressed in the cancer cells refers to a nucleic acid sequence that is overexpressed in specific cancer cells, although it has an appropriate expression level in normal cells.
[0363] Specifically, the level or reference (cutoff) of the nucleic acid sequence overexpressed in cancer cells may be a case where the OD value is 0.010 or more when the absorbance (optical density) is measured using a marker. More specifically, in the level or reference of the nucleic acid sequence overexpressed in cancer cells, an OD value is about 0.012 or about 0.015 or more by measuring an absorbance using a marker. In this case, the wavelength irradiated for measuring the absorbance may be appropriately determined according to a marker. The cfDNA may be DNA in which double strands are unwound (unwinding of DNA). In addition, cfDNA may be appropriately determined according to the purpose.
[0364] In addition, the cfDNA derived from colorectal cancer cells may be characterized by i) having a lower Tm value than that of cfDNA having a double helix structure derived from normal cells, or ii) being denatured in a condition in which the cfDNA having a double helix structure derived from normal cells is not denatured.
[0365] In addition, the cfDNA is capable of binding with a about 15-mer to about 30-mer probe that can complementarily bind to cfDNA in any one of the following conditions: i) a condition of allowing to stand for about 1 minute to about 120 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for about 1 second to about 3 minutes; iii) a condition of heating at about 75° C. to about 90° C. for about 1 second to about 5 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 30 seconds to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 10 minutes to about 120 minutes; vi) a condition of treating with protease for about 1 minute to about 30 minutes; vii) a condition of treating with DNase for about 1 minute to about 30 minutes; and viii) a condition of treating with a chemical substance (for example, sodium hydroxide, DMSO, a surfactant, and the like).
[0366] The gene overexpressed in colorectal cancer cells may be any one selected from the group consisting of ACPP (NCBI Gene ID: 55), FLU3 (NCBI Gene ID: 837968), TYRO3 (NCBI Gene ID: 7301), NCKAP1 (NCBI Gene ID: 10787), AUNIP (NCBI Gene ID: 79000), NOTUM (NCBI Gene ID: 147111), KRT5 (NCBI Gene ID: 3852), TUBB (NCBI Gene ID: 203068), COL6A1 (NCBI Gene ID: 1291), JUP (NCBI Gene ID: 3728), COTL1 (NCBI Gene ID: 23406), CK7 (NCBI Gene ID: 3855), CK20 (NCBI Gene ID: 54474), CDX2 (NCBI Gene ID: 1045), MUC2 (NCBI Gene ID: 4583), MELTF (NCBI Gene ID: 4241), SDC2 (NCBI Gene ID: 6383), EFEMP2 (NCBI Gene ID: 30008), DEFA5 (NCBI Gene ID: 1670), ASB9 (NCBI Gene ID: 140462), CHEK1 (NCBI Gene ID: 1111), MAD2L1 (NCBI Gene ID: 4085), ENC1 (NCBI Gene ID: 8507), CSE1L (NCBI Gene ID: 1434), RAD51AP1 (NCBI Gene ID: 10635), ERICH3 (NCBI Gene ID: 127524), SLC7A11 (NCBI Gene ID: 23657), KRT23 (NCBI Gene ID: 25984), PLAU (NCBI Gene ID: 5328), CCNB1 (NCBI Gene ID: 891), MELK (NCBI Gene ID: 9833), CDCA1 (NCBI Gene ID: 83540), KLK6 (NCBI Gene ID: 5653), CKS2 (NCBI Gene ID: 1164), IFITM1 (NCBI Gene ID: 8519), DPEP1 (NCBI Gene ID: 1800), CDH3 (NCBI Gene ID: 1001), ANLN(NCBI Gene ID: 54443), CXCL1 (NCBI Gene ID: 2919), CTHRC1 (NCBI Gene ID: 115908), CEACAM6 (NCBI Gene ID: 4680), LCN2 (NCBI Gene ID: 3934), HS6ST2 (NCBI Gene ID: 90161), EGFL6 (NCBI Gene ID: 25975), CXCL3 (NCBI Gene ID: 2921), CA9 (NCBI Gene ID: 768), ATAD2 (NCBI Gene ID: 29028), PROX1 (NCBI Gene ID: 5629), SPP1 (NCBI Gene ID: 6696), CST1 (NCBI Gene ID: 1469), CXCL2 (NCBI Gene ID: 2920), TSTA3 (NCBI Gene ID: 7264), RRM2 (NCBI Gene ID: 6241), MMP3 (NCBI Gene ID: 4314), MMP7 (NCBI Gene ID: 4316), MMP10 (NCBI Gene ID: 4319), CXCL2 (NCBI Gene ID: 6374), SERPINB5 (NCBI Gene ID: 5268), TEAD4 (NCBI Gene ID: 7004), BUB1 (NCBI Gene ID: 699), CDCl2 (NCBI Gene ID: 983), CLDN2 (NCBI Gene ID: 9075), HSPH1 (NCBI Gene ID: 10808), LY6G6D (NCBI Gene ID: 58530), PRC1 (NCBI Gene ID: 9055), PUS1 (NCBI Gene ID: 80324), SQLE (NCBI Gene ID: 6713), TOP2A (NCBI Gene ID: 7153), TTK (NCBI Gene ID: 7272), DSCC1 (NCBI Gene ID: 79075), ECT2 (NCBI Gene ID: 1894), RNF183 (NCBI Gene ID: 138065), FBXO39 (NCBI Gene ID: 162517), TEX38 (NCBI Gene ID: 374973), TTLL2 (NCBI Gene ID: 83887), PRR7 (NCBI Gene ID: 80758), CANP (NCBI Gene ID: 823), KIAA0101 (NCBI Gene ID: 9768), CPT1A (NCBI Gene ID: 1374), IFNG (NCBI Gene ID: 3458), CD274 (NCBI Gene ID: 29126), FOLR1 (NCBI Gene ID: 2348), EPCAM (NCBI Gene ID: 4072), KRAS(NCBI Gene ID: 3845), and a combination thereof.
[0367] In one embodiment, the gene specifically present in colorectal cancer may be NCKAP1, AUNIP, NOTUM, KRT5, TUBB, COL6A1, JUP, CDX2, MELTF, EFEMP2, DEFA5, CHEK1, MAD2L1, ENC1, CSE1L, RAD51AP1, ERICH3, SLC7A11, KRT23, PLAU, CDCA1, KLK6, DPEP1, CDH3, ANLN, CXCL1, CTHRC1, LCN2, HS6ST2, EGFL6, CXCL3, CA9, PROX1, SPP1, CST1, CXCL2, TSTA3, RRM2, MMP3, MMP7, MMP10, CXCL5, SERPINB5, TEAD4, BUB1, CDCl2, CLDN2, HSPH1, LY6G6D, PRC1, PUS1, SQLE, TTK, ECT2, RNF183, FBXO39, TEX38, TTLL2, PRR7, CANP, KIAA010 genes, and additionally, ACPP, FLU3, TYRO3, COTL1, CK7, CK20, MUC2, SDC2, ASB9, CCNB1, MELK, CKS2, IFITM1, CEACAM6, ATAD2, TOP2A, CPT1A, DSCC1, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, or EPCAM gene may be additionally detected to diagnose colorectal cancer.
[0368] As used herein, the term “FLU3” refers to a gene encoding a protein including CA19-9 (Carcinoma Antigen 19-9).
[0369] As used herein, the term “probe” refers to DNA or RNA for detecting cfDNA. The probe may have a specific sequence to be capable of complementarily binding to cfDNA. The probe having a sequence complementary to cfDNA refers to a probe having a nucleic acid sequence capable of complementarily binding to a desired double-stranded cfDNA to be detected present in plasma. In this case, the probe may be one to which biotin is bound. The probe may be bound to a marker that is bound to a biotin-binding protein.
[0370] As used herein, the term “marker” refers to a material that is used for detecting a probe bound to cfDNA. The marker may be a nanoparticle, a fluorescent dye, a fluorescent protein, or an enzyme. Specifically, the marker may be any one selected from the group consisting of a quantum dot, an HRP and a fluorescent protein. In one embodiment, the marker may be GFP (green fluorescent protein), BFP (blue fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow fluorescent protein), or HRP (horse radish peroxidase), but is not limited thereto.
[0371] The marker may be one to which a biotin-binding protein is bound. The biotin-binding protein may be an avidin-based protein, avidin, streptavidin, traptavidin, or neutravidin, but may be used without limit as long as it is a protein that can specifically bind to biotin. In one embodiment, the marker may be one to which streptavidin is bound.
[0372] As used herein, the term “streptavidin” is a tetrameric biotin-binding protein with a molecular weight of about 60 kDa isolated from Streptomyces avidinii. It has very low homology to the avidin, but its structure is very similar to the avidin. Like avidin, it has an antibacterial activity and a very high binding capacity to biotin. On the other hand, unlike avidin, it does not contain carbohydrates, has an acidic isoelectric point (pI=5), and has a significantly lower solubility than avidin. A commercially available streptavidin such as Thermo Scientific Pierce Streptavidin is in a recombinant form of streptavidin having a molecular weight of about 53 kDa and has an isoelectric point which is near neutral (pI=6.8 to 7.5). The streptavidin having the lack of glycosylation and low pI has a low level of non-specific binding (in particular, lectin binding) as compared to avidin. These properties of streptavidin allow it to be selected as an ideal reagent for many detection systems.
[0373] As used herein, the term “traptavidin” refers to a mutant (variant or mutein) of streptavidin, and is a protein having a dissociation rate for biotin that is slower by about 10 times and having an increased mechanical strength and enhanced thermal stability. In addition, the traptavidin specifically binds to biotin.
[0374] The term “neutravidin” of the present invention is also referred to as “deglycosylated avidin” and is prepared to avoid the main disadvantages of naturally occurring avidin and streptavidin. As shown in the name, neutravidin is produced by deglycosylating avidin. It is a protein that has a reduced molecular weight (about 60 kDa) and maintains a high biotin binding capacity as compared to avidin. The deglycosylation of the avidin reduces the binding of lectin to an undetectable level and lowers an isoelectric point (pI=about 6.3) to effectively eliminate the main cause of non-specific binding to avidin. A lysine residue remains usable, so it can be easily derivatized or complexed like streptavidin. In addition, since it exhibits high biotin binding capacity and low non-specific binding, it can be used in various ways as an ideal biotin-binding protein.
[0375] As used herein, the term “a step of detecting the marker” refers to a step of detecting a marker that is bound to a probe through a reaction of biotin-avidin. The detection of the marker can be measured by a color change, a UV absorbance change, the presence or absence of bioluminescence, a fluorescence change, or an electrochemical change. Specifically, the method for detecting the marker may be performed differently depending on the marker used. For example, when HRP is used as a marker, the marker can be detected by observing the color reaction through the reaction between hydrogen peroxide and a substrate. In addition, when the marker is a fluorescent protein such as GFP, the presence or absence of the marker can be detected by observing the detected light after irradiating light of a specific wavelength. In addition, when the marker is luciferase, the presence of the marker can be detected by measuring the bioluminescence that is exhibited after adding a substrate such as luciferin by bioluminometer.
[0376] In addition, the diagnostic method of the present invention may further comprise a step of denaturing cfDNA. In this case, the denaturation step can be performed to selectively denature only cfDNA derived from colorectal cancer, but not to denature normal double-stranded cfDNA. To this end, the conditions of the denaturation step may be performed at about 50° C. to about 100° C. for about 0.1 second to about 5 minutes. One embodiment of the denaturation temperature may be about 95° C., and the denaturation time may be usually about 0.1 second to about 8 minutes. In addition, it may be denatured for about 1 second, about 5 seconds, about 10 seconds, about 30 seconds, about 60 seconds, or about 90 seconds. In one embodiment, the step of denaturing cfDNA may be performed prior to step c) above.
[0377] Specifically, the method may further comprise a step of denaturing the sample or cfDNA bound to the positively charged material prior to step c) above in any one condition selected from the group consisting of i) a condition of allowing to stand for about 1 minute to about 10 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for 1 second to 1 minute; iii) a condition of heating at about 75° C. to about 90° C. for about 10 seconds to about 3 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 1 minute to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 5 minutes to about 60 minutes; vi) a condition of treating with protease for about 1 minute to about 10 minutes; and vii) a condition of treating with DNaseI for about 1 minute to about 10 minutes. This denaturation step does not denature the double-stranded cfDNA derived from normal cells, but selectively denatures only cfDNA derived from cancer cells, thereby making it easier to bind with the probe. The denaturation conditions of i) to vii) may be performed after obtaining a sample. In addition, the denaturation conditions of i) to vii) may be performed after obtaining cfDNA bound to the positively charged material. In addition, the temperature, protease, and DNase treatment time of the denaturation conditions of i) to vii) may be appropriately adjusted as long as they do not denature the stable cfDNA.
[0378] Colorectal Cancer Diagnostic Kit
[0379] Other aspect of the present invention provides a diagnostic kit for diagnosing colorectal cancer, comprising a probe to which biotin is bound complementarily binding to a gene specifically expressed in colorectal cancer; a positively charged material; a marker to which an avidin-based protein is bound; and a manual.
[0380] In this case, the gene specifically expressed in colorectal cancer may be any one or more selected from the group consisting of NCKAP1, AUNIP, NOTUM, KRT5, TUBB, COL6A1, JUP, CDX2, MELTF, EFEMP2, DEFA5, CHEK1, MAD2L1, ENC1, CSE1L, RAD51AP1, ERICH3, SLC7A11, KRT23, PLAU, CDCA1, KLK6, DPEP1, CDH3, ANLN, CXCL1, CTHRC1, LCN2, HS6ST2, EGFL6, CXCL3, CA9, PROX1, SPP1, CST1, CXCL2, TSTA3, RRM2, MMP3, MMP7, MMP10, CXCL5, SERPINB5, TEAD4, BUB1, CDCl2, CLDN2, HSPH1, LY6G6D, PRC1, PUS1, SQLE, TTK, ECT2, RNF183, FBXO39, TEX38, TTLL2, PRR7, CANP, KIAA0101, and a combination thereof.
[0381] In addition, the manual may describe that the kit is configured to be capable of diagnosing colorectal cancer by the following protocol: a) isolate cfDNA from a biological sample isolated from an individual using a positively charged material contained in the kit; b) mix sequentially or simultaneously a probe to which biotin is bound contained in the kit and a marker contained in the kit in the isolated cfDNA; c) remove the probe that does not bind to cfDNA and the marker; and d) detect the signal of the marker.
[0382] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of ACPP, FLU3, TYRO3, COTL1, CK7, CK20, MUC2, SDC2, ASB9, CCNB1, MELK, CKS2, IFITM1, CEACAM6, ATAD2, TOP2A, CPT1A, DSCC1, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof.
[0383] In addition, the probe, the positively charged material, and the marker are as described above.
[0384] Colorectal Cancer Diagnostic Device
[0385] Other aspect of the present invention provides a device for diagnosing colorectal cancer by detecting a gene derived from colorectal cancer cells from a sample without amplification, wherein the device comprises a) a mixing part for mixing a biological sample isolated from an individual comprising cfDNA and a positively charged material; b) an obtaining part for removing the sample except for the positively charged material to which cfDNA is bound; c) a reaction part for adding sequentially or simultaneously a probe to which biotin is bound capable of complementarily binding to the gene specifically expressed in colorectal cancer; and a nanoparticle comprising streptavidin and a marker to the positively charged material to which cfDNA is bound; d) a detection part for detecting the marker; and e) an information processing part for determining whether there is cfDNA having a sequence complementary to the probe and derived from colorectal cancer in the sample depending on whether the marker is detected.
[0386] In this case, the gene specifically expressed in colorectal cancer may be any one or more selected from the group consisting of NCKAP1, AUNIP, NOTUM, KRT5, TUBB, COL6A1, JUP, CDX2, MELTF, EFEMP2, DEFA5, CHEK1, MAD2L1, ENC1, CSE1L, RAD51AP1, ERICH3, SLC7A11, KRT23, PLAU, CDCA1, KLK6, DPEP1, CDH3, ANLN, CXCL1, CTHRC1, LCN2, HS6ST2, EGFL6, CXCL3, CA9, PROX1, SPP1, CST1, CXCL2, TSTA3, RRM2, MMP3, MMP7, MMP10, CXCL5, SERPINB5, TEAD4, BUB1, CDCl2, CLDN2, HSPH1, LY6G6D, PRC1, PUS1, SQLE, TTK, ECT2, RNF183, FBXO39, TEX38, TTLL2, PRR7, CANP, KIAA0101, and a combination thereof.
[0387] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of ACPP, FLU3, TYRO3, COTL1, CK7, CK20, MUC2, SDC2, ASB9, CCNB1, MELK, CKS2, IFITM1, CEACAM6, ATAD2, TOP2A, CPT1A, DSCC1, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof
[0388] <Biliary Tract Cancer>
[0389] Method for Diagnosing Biliary Tract Cancer
[0390] One aspect of the present invention provides a method for diagnosing biliary tract cancer by detecting a gene derived from biliary tract cancer cells from a sample without amplification, wherein the method comprises a) a step of mixing a biological sample isolated from an individual comprising cell-free DNA (hereinafter cfDNA) and a positively charged material; b) a step of isolating the positively charged material to which cfDNA is bound; c) a step of sequentially or simultaneously mixing a probe having a sequence complementary to the cfDNA and a marker in the mixture; d) a step of removing the probe that does not bind to cfDNA and the marker; and e) a step of detecting the marker, wherein the probe having a sequence complementary to cfDNA complementarily binds to a gene known as a biliary tract cancer biomarker. In this case, a gene known as a biliary tract cancer biomarker may be a gene encoding a protein overexpressed in biliary tract cancer.
[0391] Specifically, the probe having a sequence complementary to cfDNA may complementarily bind to at least any one gene selected from the group consisting of MUC16, ASH1L, DOCK70, and a combination thereof.
[0392] In addition, the purpose of using the isolated biological sample is to detect cfDNA present in the sample. Therefore, cfDNA in a sample may be used by being isolated and/or concentrated in various ways. In one embodiment, a nitrocellulose membrane having a strong affinity for nucleic acid may be used. In addition, in one embodiment, a positively charged material may be used to capture a negatively charged cfDNA. The positively charged material may be a nanoparticle, a nanowire, a network, or a positively charged filter, but is not limited thereto. In one embodiment of the “positively charged material”, it may be a positively charged nanostructure or a positively charged membrane.
[0393] In one example of the nanostructure, it may comprise a cationic polymer. The kind of the cationic polymer is not limited. One embodiment of the cationic polymer may be polyethyleneimine (PEI), and may be a cationic branched polymer polyethyleneimine.
[0394] In addition, by mixing nanowires labeled with streptavidin with a solution of PEI to which biotin is bound, cationic branched polyethyleneimine (cationic branched PEI) may be further bound to the nanowires through the interaction of biotin-streptavidin. As a result, the nanoparticles in the nanostructures (PEI/mPpy NWs) with polyethyleneimine, a cationic polymer, bound to the surface of the nanostructures may be incorporated with high density and irregular distribution.
[0395] These nanowires can successfully capture genomic DNA and cfDNA with high efficiency even at a low concentration. In particular, due to the characteristics of the nanowires such as the large surface area for binding with target molecules such as DNA and the enhanced mobility for promoting interaction with DNA, it is possible to efficiently and effectively capture the target cfDNA.
[0396] In this case, the target cfDNA refers to the desired cfDNA to be detected. In the present specification, cfDNA has double strands. In this case, in a portion of the cfDNA, double strands may be unwound. In addition, the cfDNA may be derived from a gene of biliary tract cancer cells. Specifically, cfDNA may include a nucleic acid sequence overexpressed in biliary tract cancer cells. The nucleic acid sequence that is overexpressed in the cancer cells refers to a nucleic acid sequence that is overexpressed in specific cancer cells, although it has an appropriate expression level in normal cells.
[0397] Specifically, the level or reference (cutoff) of the nucleic acid sequence overexpressed in cancer cells may be a case where the OD value is 0.010 or more when the absorbance (optical density) is measured using a marker. More specifically, in the level or reference of the nucleic acid sequence overexpressed in cancer cells, an OD value is about 0.012 or about 0.015 or more by measuring a absorbance using a marker. In this case, the wavelength irradiated for measuring the absorbance may be appropriately determined according to a marker. The cfDNA may be DNA in which double strands are unwound (unwinding of DNA). In addition, cfDNA may be appropriately determined according to the purpose.
[0398] In addition, the cfDNA derived from biliary tract cancer cells may be characterized by i) having a lower Tm value than that of cfDNA having a double helix structure derived from normal cells, or ii) being denatured in a condition in which the cfDNA having a double helix structure derived from normal cells is not denatured.
[0399] In addition, the cfDNA is capable of binding with a about 15-mer to about 30-mer probe that can complementarily bind to cfDNA in any one of the following conditions: i) a condition of allowing to stand for about 1 minute to about 120 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for about 1 second to about 3 minutes; iii) a condition of heating at about 75° C. to about 90° C. for about 1 second to about 5 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 30 seconds to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 10 minutes to about 120 minutes; vi) a condition of treating with protease for about 1 minute to about 30 minutes; vii) a condition of treating with DNase for about 1 minute to about 30 minutes; and viii) a condition of treating with a chemical substance (for example, sodium hydroxide, DMSO, a surfactant, and the like).
[0400] The gene overexpressed in biliary tract cancer cells may be any one selected from the group consisting of ACPP (NCBI Gene ID: 55), FLU3 (NCBI Gene ID: 837968), MUC16 (NCBI Gene ID: 94025), ASH1L (NCBI Gene ID: 55870), DOCK7 (NCBI Gene ID: 85440), CPT1A (NCBI Gene ID: 1374), IFNG (NCBI Gene ID: 3458), CD274 (NCBI Gene ID: 29126), FOLR1 (NCBI Gene ID: 2348), EPCAM (NCBI Gene ID: 4072), CA125 (NCBI Gene ID: 94025), CEACAM5 (NCBI Gene ID: 1048), and a combination thereof.
[0401] In one embodiment, the gene specifically present in biliary tract cancer may be MUC16, ASH1L, DOCK70 genes, and additionally, ACPP, FLUS, CPT1A, DSCC1, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, or EPCAM gene may be additionally detected to diagnose biliary tract cancer.
[0402] As used herein, the term “MUC16” refers to a gene encoding CA-125 (carcinoma antigen 125). The CA-125 is used as a tumor marker or a biomarker that is positive in the blood of some patients with certain types of cancer.
[0403] As used herein, the term “probe” refers to DNA or RNA for detecting cfDNA. The probe may have a specific sequence to be capable of complementarily binding to cfDNA. The probe having a sequence complementary to cfDNA refers to a probe having a nucleic acid sequence capable of complementarily binding to a desired double-stranded cfDNA to be detected present in plasma. In this case, the probe may be one to which biotin is bound. The probe may be bound to a marker that is bound to a biotin-binding protein.
[0404] As used herein, the term “marker” refers to a material that is used for detecting a probe bound to cfDNA. The marker may be a nanoparticle, a fluorescent dye, a fluorescent protein, or an enzyme. Specifically, the marker may be any one selected from the group consisting of a quantum dot, an HRP and a fluorescent protein. In one embodiment, the marker may be GFP (green fluorescent protein), BFP (blue fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow fluorescent protein), or HRP (horse radish peroxidase), but is not limited thereto.
[0405] The marker may be one to which a biotin-binding protein is bound. The biotin-binding protein may be an avidin-based protein, avidin, streptavidin, traptavidin, or neutravidin, but may be used without limit as long as it is a protein that can specifically bind to biotin. In one embodiment, the marker may be one to which streptavidin is bound.
[0406] As used herein, the term “streptavidin” is a tetrameric biotin-binding protein with a molecular weight of about 60 kDa isolated from Streptomyces avidinii. It has very low homology to the avidin, but its structure is very similar to the avidin. Like avidin, it has an antibacterial activity and a very high binding capacity to biotin. On the other hand, unlike avidin, it does not contain carbohydrates, has an acidic isoelectric point (pI=5), and has a significantly lower solubility than avidin. A commercially available streptavidin such as Thermo Scientific Pierce Streptavidin is in a recombinant form of streptavidin having a molecular weight of about 53 kDa and has an isoelectric point which is near neutral (pI=6.8 to 7.5). The streptavidin having the lack of glycosylation and low pI has a low level of non-specific binding (in particular, lectin binding) as compared to avidin. These properties of streptavidin allow it to be selected as an ideal reagent for many detection systems.
[0407] As used herein, the term “traptavidin” refers to a mutant (variant or mutein) of streptavidin, and is a protein having a dissociation rate for biotin that is slower by about 10 times and having an increased mechanical strength and enhanced thermal stability. In addition, the traptavidin specifically binds to biotin.
[0408] The term “neutravidin” of the present invention is also referred to as “deglycosylated avidin” and is prepared to avoid the main disadvantages of naturally occurring avidin and streptavidin. As shown in the name, neutravidin is produced by deglycosylating avidin. It is a protein that has a reduced molecular weight (about 60 kDa) and maintains a high biotin binding capacity as compared to avidin. The deglycosylation of the avidin reduces the binding of lectin to an undetectable level and lowers an isoelectric point (pI=about 6.3) to effectively eliminate the main cause of non-specific binding to avidin. A lysine residue remains usable, so it can be easily derivatized or complexed like streptavidin. In addition, since it exhibits high biotin binding capacity and low non-specific binding, it can be used in various ways as an ideal biotin-binding protein.
[0409] As used herein, the term “a step of detecting the marker” refers to a step of detecting a marker that is bound to a probe through a reaction of biotin-avidin. The detection of the marker can be measured by a color change, a UV absorbance change, the presence or absence of bioluminescence, a fluorescence change, or an electrochemical change. Specifically, the method for detecting the marker may be performed differently depending on the marker used. For example, when HRP is used as a marker, the marker can be detected by observing the color reaction through the reaction between hydrogen peroxide and a substrate. In addition, when the marker is a fluorescent protein such as GFP, the presence or absence of the marker can be detected by observing the detected light after irradiating light of a specific wavelength. In addition, when the marker is luciferase, the presence of the marker can be detected by measuring the bioluminescence that is exhibited after adding a substrate such as luciferin by bioluminometer.
[0410] In addition, the diagnostic method of the present invention may further comprise a step of denaturing cfDNA. In this case, the denaturation step can be performed to selectively denature only cfDNA derived from biliary tract cancer, but not to denature normal double-stranded cfDNA. To this end, the conditions of the denaturation step may be performed at about 50° C. to about 100° C. for about 0.1 second to about 5 minutes. One embodiment of the denaturation temperature may be about 95° C., and the denaturation time may be usually about 0.1 second to about 8 minutes. In addition, it may be denatured for about 1 second, about 5 seconds, about 10 seconds, about 30 seconds, about 60 seconds, or about 90 seconds. In one embodiment, the step of denaturing cfDNA may be performed prior to step c) above.
[0411] Specifically, the method may further comprise a step of denaturing the sample or cfDNA bound to the positively charged material prior to step c) above in any one condition selected from the group consisting of i) a condition of allowing to stand for about 1 minute to about 10 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for 1 second to 1 minute; iii) a condition of heating at about 75° C. to about 90° C. for about 10 seconds to about 3 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 1 minute to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 5 minutes to about 60 minutes; vi) a condition of treating with protease for about 1 minute to about 10 minutes; and vii) a condition of treating with DNaseI for about 1 minute to about 10 minutes. This denaturation step does not denature the double-stranded cfDNA derived from normal cells, but selectively denatures only cfDNA derived from cancer cells, thereby making it easier to bind with the probe. The denaturation conditions of i) to vii) may be performed after obtaining a sample. In addition, the denaturation conditions of i) to vii) may be performed after obtaining cfDNA bound to the positively charged material. In addition, the temperature, protease, and DNase treatment time of the denaturation conditions of i) to vii) may be appropriately adjusted as long as they do not denature the stable cfDNA.
[0412] Biliary Tract Cancer Diagnostic Kit
[0413] Other aspect of the present invention provides a diagnostic kit for diagnosing biliary tract cancer, comprising a probe to which biotin is bound complementarily binding to a gene specifically expressed in biliary tract cancer; a positively charged material; a marker to which an avidin-based protein is bound; and a manual.
[0414] In this case, the gene specifically expressed in biliary tract cancer may be any one or more selected from the group consisting of MUC16, ASH1L, DOCK7, and a combination thereof.
[0415] In addition, the manual may describe that the kit is configured to be capable of diagnosing biliary tract cancer by the following protocol: a) isolate cfDNA from a biological sample isolated from an individual using a positively charged material contained in the kit; b) mix sequentially or simultaneously a probe to which biotin is bound contained in the kit and a marker contained in the kit in the isolated cfDNA; c) remove the probe that does not bind to cfDNA and the marker; and d) detect the signal of the marker.
[0416] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of ACPP, FLU3, CPT1A, DSCC1, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof.
[0417] In addition, the probe, the positively charged material, and the marker are as described above.
[0418] Biliary Tract Cancer Diagnostic Device
[0419] Other aspect of the present invention provides a device for diagnosing biliary tract cancer by detecting a gene derived from biliary tract cancer cells from a sample without amplification, wherein the device comprises a) a mixing part for mixing a biological sample isolated from an individual comprising cfDNA and a positively charged material; b) an obtaining part for removing the sample except for the positively charged material to which cfDNA is bound; c) a reaction part for adding sequentially or simultaneously a probe to which biotin is bound capable of complementarily binding to the gene specifically expressed in biliary tract cancer; and a nanoparticle comprising streptavidin and a marker to the positively charged material to which cfDNA is bound; d) a detection part for detecting the marker; and e) an information processing part for determining whether there is cfDNA having a sequence complementary to the probe and derived from biliary tract cancer in the sample depending on whether the marker is detected.
[0420] In this case, the gene specifically expressed in biliary tract cancer may be any one or more selected from the group consisting of ACPP, FLU3, CPT1A, DSCC1, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof.
[0421] In addition, it may further comprise a probe to which biotin is bound specifically binding to at least any one gene selected from the group consisting of ACPP, FLU3, CPT1A, DSCC1, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof
[0422] <Gastric Cancer>
[0423] Method for Diagnosing Gastric cancer
[0424] One aspect of the present invention provides a method for diagnosing gastric cancer by detecting a gene derived from gastric cancer cells from a sample without amplification, wherein the method comprises a) a step of mixing a biological sample isolated from an individual comprising cell-free DNA (hereinafter cfDNA) and a positively charged material; b) a step of isolating the positively charged material to which cfDNA is bound; c) a step of sequentially or simultaneously mixing a probe having a sequence complementary to the cfDNA and a marker in the mixture; d) a step of removing the probe that does not bind to cfDNA and the marker; and e) a step of detecting the marker, wherein the probe having a sequence complementary to cfDNA complementarily binds to a gene known as a gastric cancer biomarker. In this case, a gene known as a gastric cancer biomarker may be a gene encoding a protein overexpressed in gastric cancer.
[0425] Specifically, the probe having a sequence complementary to cfDNA may complementarily bind to at least any one gene selected from the group consisting of CGB, PARP1, FOXO3A, MED30, CCNE1, MYC, TFF1, FABP1, LAMP5, MATN3, CLIP4, NOX4, ADRA2C, CSK, FZD9, GALR1, GRM6, INSR, LPHN1, LYN, MRGPRX3, ADCY3, HDAC2, CFL1, NRP2, ANXA10, TFF2, CDCA5, NUSAP1, and a combination thereof.
[0426] In addition, the purpose of using the isolated biological sample is to detect cfDNA present in the sample. Therefore, cfDNA in a sample may be used by being isolated and/or concentrated in various ways. In one embodiment, a nitrocellulose membrane having a strong affinity for nucleic acid may be used. In addition, in one embodiment, a positively charged material may be used to capture a negatively charged cfDNA. The positively charged material may be a nanoparticle, a nanowire, a network, or a positively charged filter, but is not limited thereto. In one embodiment of the “positively charged material”, it may be a positively charged nanostructure or a positively charged membrane.
[0427] In one example of the nanostructure, it may comprise a cationic polymer. The kind of the cationic polymer is not limited. One embodiment of the cationic polymer may be polyethyleneimine (PEI), and may be a cationic branched polymer polyethyleneimine.
[0428] In addition, by mixing nanowires labeled with streptavidin with a solution of PEI to which biotin is bound, cationic branched polyethyleneimine (cationic branched PEI) may be further bound to the nanowires through the interaction of biotin-streptavidin. As a result, the nanoparticles in the nanostructures (PEI/mPpy NWs) with polyethyleneimine, a cationic polymer, bound to the surface of the nanostructures may be incorporated with high density and irregular distribution.
[0429] These nanowires can successfully capture genomic DNA and cfDNA with high efficiency even at a low concentration. In particular, due to the characteristics of the nanowires such as the large surface area for binding with target molecules such as DNA and the enhanced mobility for promoting interaction with DNA, it is possible to efficiently and effectively capture the target cfDNA.
[0430] In this case, the target cfDNA refers to the desired cfDNA to be detected. In the present specification, cfDNA has double strands. In this case, in a portion of the cfDNA, double strands may be unwound. In addition, the cfDNA may be derived from a gene of gastric cancer cells. Specifically, cfDNA may include a nucleic acid sequence overexpressed in gastric cancer cells. The nucleic acid sequence that is overexpressed in the cancer cells refers to a nucleic acid sequence that is overexpressed in specific cancer cells, although it has an appropriate expression level in normal cells.
[0431] Specifically, the level or reference (cutoff) of the nucleic acid sequence overexpressed in cancer cells may be a case where the OD value is 0.010 or more when the absorbance (optical density) is measured using a marker. More specifically, in the level or reference of the nucleic acid sequence overexpressed in cancer cells, an OD value is about 0.012 or about 0.015 or more by measuring an absorbance using a marker. In this case, the wavelength irradiated for measuring the absorbance may be appropriately determined according to a marker. The cfDNA may be DNA in which double strands are unwound (unwinding of DNA). In addition, cfDNA may be appropriately determined according to the purpose.
[0432] In addition, the cfDNA derived from gastric cancer cells may be characterized by i) having a lower Tm value than that of cfDNA having a double helix structure derived from normal cells, or ii) being denatured in a condition in which the cfDNA having a double helix structure derived from normal cells is not denatured.
[0433] In addition, the cfDNA is capable of binding with a about 15-mer to about 30-mer probe that can complementarily bind to cfDNA in any one of the following conditions: i) a condition of allowing to stand for about 1 minute to about 120 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for about 1 second to about 3 minutes; iii) a condition of heating at about 75° C. to about 90° C. for about 1 second to about 5 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 30 seconds to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 10 minutes to about 120 minutes; vi) a condition of treating with protease for about 1 minute to about 30 minutes; vii) a condition of treating with DNase for about 1 minute to about 30 minutes; and viii) a condition of treating with a chemical substance (for example, sodium hydroxide, DMSO, a surfactant, and the like).
[0434] The gene overexpressed in gastric cancer cells may be any one selected from the group consisting of ACPP (NCBI Gene ID: 55), FLU3 (Gene ID: 837968), CGB (NCBI Gene ID: 1082), KRT19 (NCBI Gene ID: 3880), PARP1 (NCBI Gene ID: 142), FOXO3A (NCBI Gene ID: 2309), MED30 (NCBI Gene ID: 90390), ERBB2 (NCBI Gene ID: 2064), CCNE1 (NCBI Gene ID: 898), MYC(NCBI Gene ID: 4609), EGFR(NCBI Gene ID: 1956), KRAS(NCBI Gene ID: 3845), TFF1 (NCBI Gene ID: 7031), FABP1 (NCBI Gene ID: 2168), CK20 (NCBI Gene ID: 54474), MUC2 (NCBI Gene ID: 4583), SDC2 (NCBI Gene ID: 6383), LAMP5 (NCBI Gene ID: 24141), MATN3 (NCBI Gene ID: 4148), CLIP4 (NCBI Gene ID: 79745), NOX4 (NCBI Gene ID: 50507), ADRA2C(NCBI Gene ID: 152), CSK (NCBI Gene ID: 1445), FZD9 (NCBI Gene ID: 8326), GALR1 (NCBI Gene ID: 2587), GRM6 (NCBI Gene ID: 2916), INSR(NCBI Gene ID: 3643), LPHN1 (NCBI Gene ID: 22859), LYN(NCBI Gene ID: 4067), MRGPRX3 (NCBI Gene ID: 117195), ADCY3 (NCBI Gene ID: 109), HDAC2 (NCBI Gene ID: 3066), CFL1 (NCBI Gene ID: 1072), COTL1 (NCBI Gene ID: 23406), NRP2 (NCBI Gene ID: 8828), ANXA10 (NCBI Gene ID: 11199), TFF2 (NCBI Gene ID: 7032), CDCA5 (NCBI Gene ID: 113130), ATAD2 (NCBI Gene ID: 29028), ASB9 (NCBI Gene ID: 140462), MMP1 (NCBI Gene ID: 4312), CEACAM6 (NCBI Gene ID: 4680), DSCC1 (NCBI Gene ID: 79075), CKS2 (NCBI Gene ID: 1164), CST1 (NCBI Gene ID: 1469), IFITM1 (NCBI Gene ID: 8519), NUSAP1 (NCBI Gene ID: 51203), MELK (NCBI Gene ID: 9833), LGALS3BP (NCBI Gene ID: 3959), CPT1A (NCBI Gene ID: 1374), IFNG (NCBI Gene ID: 3458), CD274 (NCBI Gene ID: 29126), FOLR1 (NCBI Gene ID: 2348), EPCAM (NCBI Gene ID: 4072), CEACAM5 (NCBI Gene ID: 1048), and a combination thereof.
[0435] In one embodiment, the gene specifically present in gastric cancer may be CGB, PARP1, FOXO3A, MED30, CCNE1, MYC, TFF1, FABP1, LAMP5, MATN3, CLIP4, NOX4, ADRA2C, CSK, FZD9, GALR1, GRM6, INSR, LPHN1, LYN, MRGPRX3, ADCY3, HDAC2, CFL1, NRP2, ANXA10, TFF2, CDCA5, NUSAP1 genes, and additionally, ACPP, FLUS, KRT19, ERBB2, EGFR, KRAS, DSCC1, CK20, MUC2, SDC2, COTL1, ATAD2, ASB9, 111114P1, CEACAM6, DSCC1, CKS2, CST1, IFITM1, MELK, LGALS3BP, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, or EPCAM gene may be additionally detected to diagnose gastric cancer.
[0436] As used herein, the term “CGB” refers to a gene encoding a hCG (human chorionic gonadotropin) hormone. Some cancers also produce a hCG hormone. Therefore, if the hCG hormone level measured when the patient is not pregnant is high, it can be diagnosed with cancer.
[0437] As used herein, the term “probe” refers to DNA or RNA for detecting cfDNA. The probe may have a specific sequence to be capable of complementarily binding to cfDNA. The probe having a sequence complementary to cfDNA refers to a probe having a nucleic acid sequence capable of complementarily binding to a desired double-stranded cfDNA to be detected present in plasma. In this case, the probe may be one to which biotin is bound. The probe may be bound to a marker that is bound to a biotin-binding protein.
[0438] As used herein, the term “marker” refers to a material that is used for detecting a probe bound to cfDNA. The marker may be a nanoparticle, a fluorescent dye, a fluorescent protein, or an enzyme. Specifically, the marker may be any one selected from the group consisting of a quantum dot, an HRP and a fluorescent protein. In one embodiment, the marker may be GFP (green fluorescent protein), BFP (blue fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow fluorescent protein), or HRP (horse radish peroxidase), but is not limited thereto.
[0439] The marker may be one to which a biotin-binding protein is bound. The biotin-binding protein may be an avidin-based protein, avidin, streptavidin, traptavidin, or neutravidin, but may be used without limit as long as it is a protein that can specifically bind to biotin. In one embodiment, the marker may be one to which streptavidin is bound.
[0440] As used herein, the term “streptavidin” is a tetrameric biotin-binding protein with a molecular weight of about 60 kDa isolated from Streptomyces avidinii. It has very low homology to the avidin, but its structure is very similar to the avidin. Like avidin, it has an antibacterial activity and a very high binding capacity to biotin. On the other hand, unlike avidin, it does not contain carbohydrates, has an acidic isoelectric point (pI=5), and has a significantly lower solubility than avidin. A commercially available streptavidin such as Thermo Scientific Pierce Streptavidin is in a recombinant form of streptavidin having a molecular weight of about 53 kDa and has an isoelectric point which is near neutral (pI=6.8 to 7.5). The streptavidin having the lack of glycosylation and low pI has a low level of non-specific binding (in particular, lectin binding) as compared to avidin. These properties of streptavidin allow it to be selected as an ideal reagent for many detection systems.
[0441] As used herein, the term “traptavidin” refers to a mutant (variant or mutein) of streptavidin, and is a protein having a dissociation rate for biotin that is slower by about 10 times and having an increased mechanical strength and enhanced thermal stability. In addition, the traptavidin specifically binds to biotin.
[0442] The term “neutravidin” of the present invention is also referred to as “deglycosylated avidin” and is prepared to avoid the main disadvantages of naturally occurring avidin and streptavidin. As shown in the name, neutravidin is produced by deglycosylating avidin. It is a protein that has a reduced molecular weight (about 60 kDa) and maintains a high biotin binding capacity as compared to avidin. The deglycosylation of the avidin reduces the binding of lectin to an undetectable level and lowers an isoelectric point (pI=about 6.3) to effectively eliminate the main cause of non-specific binding to avidin. A lysine residue remains usable, so it can be easily derivatized or complexed like streptavidin. In addition, since it exhibits high biotin binding capacity and low non-specific binding, it can be used in various ways as an ideal biotin-binding protein.
[0443] As used herein, the term “a step of detecting the marker” refers to a step of detecting a marker that is bound to a probe through a reaction of biotin-avidin. The detection of the marker can be measured by a color change, a UV absorbance change, the presence or absence of bioluminescence, a fluorescence change, or an electrochemical change. Specifically, the method for detecting the marker may be performed differently depending on the marker used. For example, when HRP is used as a marker, the marker can be detected by observing the color reaction through the reaction between hydrogen peroxide and a substrate. In addition, when the marker is a fluorescent protein such as GFP, the presence or absence of the marker can be detected by observing the detected light after irradiating light of a specific wavelength. In addition, when the marker is luciferase, the presence of the marker can be detected by measuring the bioluminescence that is exhibited after adding a substrate such as luciferin by bioluminometer.
[0444] In addition, the diagnostic method of the present invention may further comprise a step of denaturing cfDNA. In this case, the denaturation step can be performed to selectively denature only cfDNA derived from gastric cancer, but not to denature normal double-stranded cfDNA. To this end, the conditions of the denaturation step may be performed at about 50° C. to about 100° C. for about 0.1 second to about 5 minutes. One embodiment of the denaturation temperature may be about 95° C., and the denaturation time may be usually about 0.1 second to about 8 minutes. In addition, it may be denatured for about 1 second, about 5 seconds, about 10 seconds, about 30 seconds, about 60 seconds, or about 90 seconds. In one embodiment, the step of denaturing cfDNA may be performed prior to step c) above.
[0445] Specifically, the method may further comprise a step of denaturing the sample or cfDNA bound to the positively charged material prior to step c) above in any one condition selected from the group consisting of i) a condition of allowing to stand for about 1 minute to about 10 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for 1 second to 1 minute; iii) a condition of heating at about 75° C. to about 90° C. for about 10 seconds to about 3 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 1 minute to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 5 minutes to about 60 minutes; vi) a condition of treating with protease for about 1 minute to about 10 minutes; and vii) a condition of treating with DNaseI for about 1 minute to about 10 minutes. This denaturation step does not denature the double-stranded cfDNA derived from normal cells, but selectively denatures only cfDNA derived from cancer cells, thereby making it easier to bind with the probe. The denaturation conditions of i) to vii) may be performed after obtaining a sample. In addition, the denaturation conditions of i) to vii) may be performed after obtaining cfDNA bound to the positively charged material. In addition, the temperature, protease, and DNase treatment time of the denaturation conditions of i) to vii) may be appropriately adjusted as long as they do not denature the stable cfDNA.
[0446] Gastric Cancer Diagnostic Kit
[0447] Other aspect of the present invention provides a diagnostic kit for diagnosing gastric cancer, comprising a probe to which biotin is bound complementarily binding to a gene specifically expressed in gastric cancer; a positively charged material; a marker to which an avidin-based protein is bound; and a manual.
[0448] In this case, the gene specifically expressed in gastric cancer may be any one or more selected from the group consisting of CGB, PARP1, FOXO3A, MED30, CCNE1, MYC, TFF1, FABP1, LAMP5, MATN3, CLIP4, NOX4, ADRA2C, CSK, FZD9, GALR1, GRM6, INSR, LPHN1, LYN, MRGPRX3, ADCY3, HDAC2, CFL1, NRP2, ANXA10, TFF2, CDCA5, NUSAP1, and a combination thereof.
[0449] In addition, the manual may describe that the kit is configured to be capable of diagnosing gastric cancer by the following protocol: a) isolate cfDNA from a biological sample isolated from an individual using a positively charged material contained in the kit; b) mix sequentially or simultaneously a probe to which biotin is bound contained in the kit and a marker contained in the kit in the isolated cfDNA; c) remove the probe that does not bind to cfDNA and the marker; and d) detect the signal of the marker.
[0450] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of ACPP, FLU3, KRT19, ERBB2, EGFR, KRAS, DSCC1, CK20, MUC2, SDC2, COTL1, ATAD2, ASB9, MMP1, CEACAM6, DSCC1, CKS2, CST1, IFITM1, MELK, LGALS3BP, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof.
[0451] In addition, the probe, the positively charged material, and the marker are as described above.
[0452] Gastric Cancer Diagnostic Device
[0453] Other aspect of the present invention provides a device for diagnosing gastric cancer by detecting a gene derived from gastric cancer cells from a sample without amplification, wherein the device comprises a) a mixing part for mixing a biological sample isolated from an individual comprising cfDNA and a positively charged material; b) an obtaining part for removing the sample except for the positively charged material to which cfDNA is bound; c) a reaction part for adding sequentially or simultaneously a probe to which biotin is bound capable of complementarily binding to the gene specifically expressed in gastric cancer; and a nanoparticle comprising streptavidin and a marker to the positively charged material to which cfDNA is bound; d) a detection part for detecting the marker; and e) an information processing part for determining whether there is cfDNA having a sequence complementary to the probe and derived from gastric cancer in the sample depending on whether the marker is detected.
[0454] In this case, the gene specifically expressed in gastric cancer may be any one or more selected from the group consisting of CGB, PARP1, FOXO3A, MED30, CCNE1, MYC, TFF1, FABP1, LAMP5, MATN3, CLIP4, NOX4, ADRA2C, CSK, FZD9, GALR1, GRM6, INSR, LPHN1, LYN, MRGPRX3, ADCY3, HDAC2, CFL1, NRP2, ANXA10, TFF2, CDCA5, NUSAP1, and a combination thereof.
[0455] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of ACPP, FLU3, KRT19, ERBB2, EGFR, KRAS, DSCC1, CK20, MUC2, SDC2, COTL1, ATAD2, ASB9, MMP1, CEACAM6, DSCC1, CKS2, CST1, IFITM1, MELK, LGALS3BP, CPT1A, IFNG, CD279, CD274, ERBB2, EGFR, FOLR1, EPCAM, and a combination thereof
[0456] <Pancreatic Cancer>
[0457] Method for Diagnosing Pancreatic Cancer
[0458] One aspect of the present invention provides a method for diagnosing pancreatic cancer by detecting a gene derived from pancreatic cancer cells from a sample without amplification, wherein the method comprises a) a step of mixing a biological sample isolated from an individual comprising cell-free DNA (hereinafter cfDNA) and a positively charged material; b) a step of isolating the positively charged material to which cfDNA is bound; c) a step of sequentially or simultaneously mixing a probe having a sequence complementary to the cfDNA and a marker in the mixture; d) a step of removing the probe that does not bind to cfDNA and the marker; and e) a step of detecting the marker, wherein the probe having a sequence complementary to cfDNA complementarily binds to a gene known as a pancreatic cancer biomarker. In this case, a gene known as a pancreatic cancer biomarker may be a gene encoding a protein overexpressed in pancreatic cancer.
[0459] Specifically, the probe having a sequence complementary to cfDNA may complementarily bind to at least any one gene selected from the group consisting of SMAD4, APC, GNAS, and a combination thereof.
[0460] In addition, the purpose of using the isolated biological sample is to detect cfDNA present in the sample. Therefore, cfDNA in a sample may be used by being isolated and/or concentrated in various ways. In one embodiment, a nitrocellulose membrane having a strong affinity for nucleic acid may be used. In addition, in one embodiment, a positively charged material may be used to capture a negatively charged cfDNA. The positively charged material may be a nanoparticle, a nanowire, a network, or a positively charged filter, but is not limited thereto. In one embodiment of the “positively charged material”, it may be a positively charged nanostructure or a positively charged membrane.
[0461] In one example of the nanostructure, it may comprise a cationic polymer. The kind of the cationic polymer is not limited. One embodiment of the cationic polymer may be polyethyleneimine (PEI), and may be a cationic branched polymer polyethyleneimine.
[0462] In addition, by mixing nanowires labeled with streptavidin with a solution of PEI to which biotin is bound, cationic branched polyethyleneimine (cationic branched PEI) may be further bound to the nanowires through the interaction of biotin-streptavidin. As a result, the nanoparticles in the nanostructures (PEI/mPpy NWs) with polyethyleneimine, a cationic polymer, bound to the surface of the nanostructures may be incorporated with high density and irregular distribution.
[0463] These nanowires can successfully capture genomic DNA and cfDNA with high efficiency even at a low concentration. In particular, due to the characteristics of the nanowires such as the large surface area for binding with target molecules such as DNA and the enhanced mobility for promoting interaction with DNA, it is possible to efficiently and effectively capture the target cfDNA.
[0464] In this case, the target cfDNA refers to the desired cfDNA to be detected. In the present specification, cfDNA has double strands. In this case, in a portion of the cfDNA, double strands may be unwound. In addition, the cfDNA may be derived from a gene of pancreatic cancer cells. Specifically, cfDNA may include a nucleic acid sequence overexpressed in pancreatic cancer cells. The nucleic acid sequence that is overexpressed in the cancer cells refers to a nucleic acid sequence that is overexpressed in specific cancer cells, although it has an appropriate expression level in normal cells.
[0465] Specifically, the level or reference (cutoff) of the nucleic acid sequence overexpressed in cancer cells may be a case where the OD value is 0.010 or more when the absorbance (optical density) is measured using a marker. More specifically, in the level or reference of the nucleic acid sequence overexpressed in cancer cells, an OD value is about 0.012 or about 0.015 or more by measuring an absorbance using a marker. In this case, the wavelength irradiated for measuring the absorbance may be appropriately determined according to a marker. The cfDNA may be DNA in which double strands are unwound (unwinding of DNA). In addition, cfDNA may be appropriately determined according to the purpose.
[0466] In addition, the cfDNA derived from pancreatic cancer cells may be characterized by i) having a lower Tm value than that of cfDNA having a double helix structure derived from normal cells, or ii) being denatured in a condition in which the cfDNA having a double helix structure derived from normal cells is not denatured.
[0467] In addition, the cfDNA is capable of binding with a about 15-mer to about 30-mer probe that can complementarily bind to cfDNA in any one of the following conditions: i) a condition of allowing to stand for about 1 minute to about 120 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for about 1 second to about 3 minutes; iii) a condition of heating at about 75° C. to about 90° C. for about 1 second to about 5 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 30 seconds to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 10 minutes to about 120 minutes; vi) a condition of treating with protease for about 1 minute to about 30 minutes; vii) a condition of treating with DNase for about 1 minute to about 30 minutes; and viii) a condition of treating with a chemical substance (for example, sodium hydroxide, DMSO, a surfactant, and the like).
[0468] The gene overexpressed in pancreatic cancer cells may be any one selected from the group consisting of KRAS(NCBI Gene ID: 3845), SMADA4 (NCBI Gene ID: 4089), APC(NCBI Gene ID: 324), GNAS(NCBI Gene ID: 2788), MUC1 (NCBI Gene ID: 4582), CEACAM5 (NCBI Gene ID: 1048), CEACAM1 (NCBI Gene ID: 634), MUC16 (NCBI Gene ID: 94025), and a combination thereof.
[0469] In one embodiment, the gene specifically present in pancreatic cancer may be SMAD4, APC, GNAS genes, and additionally, KRAS, MUC1, MSLN, CEACAM1, CEACAM5 or MUC16 gene may be additionally detected to diagnose pancreatic cancer.
[0470] As used herein, the term “probe” refers to DNA or RNA for detecting cfDNA. The probe may have a specific sequence to be capable of complementarily binding to cfDNA. The probe having a sequence complementary to cfDNA refers to a probe having a nucleic acid sequence capable of complementarily binding to a desired double-stranded cfDNA to be detected present in plasma. In this case, the probe may be one to which biotin is bound. The probe may be bound to a marker that is bound to a biotin-binding protein.
[0471] As used herein, the term “marker” refers to a material that is used for detecting a probe bound to cfDNA. The marker may be a nanoparticle, a fluorescent dye, a fluorescent protein, or an enzyme. Specifically, the marker may be any one selected from the group consisting of a quantum dot, an HRP and a fluorescent protein. In one embodiment, the marker may be GFP (green fluorescent protein), BFP (blue fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow fluorescent protein), or HRP (horse radish peroxidase), but is not limited thereto.
[0472] The marker may be one to which a biotin-binding protein is bound. The biotin-binding protein may be an avidin-based protein, avidin, streptavidin, traptavidin, or neutravidin, but may be used without limit as long as it is a protein that can specifically bind to biotin. In one embodiment, the marker may be one to which streptavidin is bound.
[0473] As used herein, the term “streptavidin” is a tetrameric biotin-binding protein with a molecular weight of about 60 kDa isolated from Streptomyces avidinii. It has very low homology to the avidin, but its structure is very similar to the avidin. Like avidin, it has an antibacterial activity and a very high binding capacity to biotin. On the other hand, unlike avidin, it does not contain carbohydrates, has an acidic isoelectric point (pI=5), and has a significantly lower solubility than avidin. A commercially available streptavidin such as Thermo Scientific Pierce Streptavidin is in a recombinant form of streptavidin having a molecular weight of about 53 kDa and has an isoelectric point which is near neutral (pI=6.8 to 7.5). The streptavidin having the lack of glycosylation and low pI has a low level of non-specific binding (in particular, lectin binding) as compared to avidin. These properties of streptavidin allow it to be selected as an ideal reagent for many detection systems.
[0474] As used herein, the term “traptavidin” refers to a mutant (variant or mutein) of streptavidin, and is a protein having a dissociation rate for biotin that is slower by about 10 times and having an increased mechanical strength and enhanced thermal stability. In addition, the traptavidin specifically binds to biotin.
[0475] The term “neutravidin” of the present invention is also referred to as “deglycosylated avidin” and is prepared to avoid the main disadvantages of naturally occurring avidin and streptavidin. As shown in the name, neutravidin is produced by deglycosylating avidin. It is a protein that has a reduced molecular weight (about 60 kDa) and maintains a high biotin binding capacity as compared to avidin. The deglycosylation of the avidin reduces the binding of lectin to an undetectable level and lowers an isoelectric point (pI=about 6.3) to effectively eliminate the main cause of non-specific binding to avidin. A lysine residue remains usable, so it can be easily derivatized or complexed like streptavidin. In addition, since it exhibits high biotin binding capacity and low non-specific binding, it can be used in various ways as an ideal biotin-binding protein.
[0476] As used herein, the term “a step of detecting the marker” refers to a step of detecting a marker that is bound to a probe through a reaction of biotin-avidin. The detection of the marker can be measured by a color change, a UV absorbance change, the presence or absence of bioluminescence, a fluorescence change, or an electrochemical change. Specifically, the method for detecting the marker may be performed differently depending on the marker used. For example, when HRP is used as a marker, the marker can be detected by observing the color reaction through the reaction between hydrogen peroxide and a substrate. In addition, when the marker is a fluorescent protein such as GFP, the presence or absence of the marker can be detected by observing the detected light after irradiating light of a specific wavelength. In addition, when the marker is luciferase, the presence of the marker can be detected by measuring the bioluminescence that is exhibited after adding a substrate such as luciferin by bioluminometer.
[0477] In addition, the diagnostic method of the present invention may further comprise a step of denaturing cfDNA. In this case, the denaturation step can be performed to selectively denature only cfDNA derived from pancreatic cancer, but not to denature normal double-stranded cfDNA. To this end, the conditions of the denaturation step may be performed at about 50° C. to about 100° C. for about 0.1 second to about 5 minutes. One embodiment of the denaturation temperature may be about 95° C., and the denaturation time may be usually about 0.1 second to about 8 minutes. In addition, it may be denatured for about 1 second, about 5 seconds, about 10 seconds, about 30 seconds, about 60 seconds, or about 90 seconds. In one embodiment, the step of denaturing cfDNA may be performed prior to step c) above.
[0478] Specifically, the method may further comprise a step of denaturing the sample or cfDNA bound to the positively charged material prior to step c) above in any one condition selected from the group consisting of i) a condition of allowing to stand for about 1 minute to about 10 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for 1 second to 1 minute; iii) a condition of heating at about 75° C. to about 90° C. for about 10 seconds to about 3 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 1 minute to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 5 minutes to about 60 minutes; vi) a condition of treating with protease for about 1 minute to about 10 minutes; and vii) a condition of treating with DNaseI for about 1 minute to about 10 minutes. This denaturation step does not denature the double-stranded cfDNA derived from normal cells, but selectively denatures only cfDNA derived from cancer cells, thereby making it easier to bind with the probe. The denaturation conditions of i) to vii) may be performed after obtaining a sample. In addition, the denaturation conditions of i) to vii) may be performed after obtaining cfDNA bound to the positively charged material. In addition, the temperature, protease, and DNase treatment time of the denaturation conditions of i) to vii) may be appropriately adjusted as long as they do not denature the stable cfDNA.
[0479] Pancreatic Cancer Diagnostic Kit Other aspect of the present invention provides a diagnostic kit for diagnosing pancreatic cancer, comprising a probe to which biotin is bound complementarily binding to a gene specifically expressed in pancreatic cancer; a positively charged material; a marker to which an avidin-based protein is bound; and a manual.
[0480] In this case, the gene specifically expressed in pancreatic cancer may be any one or more selected from the group consisting of SMAD4, APC, GNAS, and a combination thereof.
[0481] In addition, the manual may describe that the kit is configured to be capable of diagnosing pancreatic cancer by the following protocol: a) isolate cfDNA from a biological sample isolated from an individual using a positively charged material contained in the kit; b) mix sequentially or simultaneously a probe to which biotin is bound contained in the kit and a marker contained in the kit in the isolated cfDNA; c) remove the probe that does not bind to cfDNA and the marker; and d) detect the signal of the marker.
[0482] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of KRAS, MUC1, MSLN, CEACAM1, CEACAM5 and MUC16, and a combination thereof.
[0483] In addition, the probe, the positively charged material, and the marker are as described above.
[0484] Pancreatic Cancer Diagnostic Device
[0485] Other aspect of the present invention provides a device for diagnosing pancreatic cancer by detecting a gene derived from pancreatic cancer cells from a sample without amplification, wherein the device comprises a) a mixing part for mixing a biological sample isolated from an individual comprising cfDNA and a positively charged material; b) an obtaining part for removing the sample except for the positively charged material to which cfDNA is bound; c) a reaction part for adding sequentially or simultaneously a probe to which biotin is bound capable of complementarily binding to the gene specifically expressed in pancreatic cancer; and a nanoparticle comprising streptavidin and a marker to the positively charged material to which cfDNA is bound; d) a detection part for detecting the marker; and e) an information processing part for determining whether there is cfDNA having a sequence complementary to the probe and derived from pancreatic cancer in the sample depending on whether the marker is detected.
[0486] In this case, the gene specifically expressed in pancreatic cancer may be any one or more selected from the group consisting of SMAD4, APC, GNAS, and a combination thereof.
[0487] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of KRAS, MUC1, MSLN, CEACAM1, CEACAM5 and MUC16, and a combination thereof
[0488] <Early Diagnosis and Prognosis Prediction>
[0489] Method for Diagnosing Cancer
[0490] One aspect of the present invention provides a method for early diagnosing cancer or predicting the prognosis of cancer by detecting a gene derived from cancer cells from a sample without amplification, wherein the method comprises a) a step of mixing a biological sample isolated from an individual comprising cell-free DNA (hereinafter cfDNA) and a positively charged material; b) a step of isolating the positively charged material to which cfDNA is bound; c) a step of sequentially or simultaneously mixing a probe having a sequence complementary to the cfDNA and a marker in the mixture; d) a step of removing the probe that does not bind to cfDNA and the marker; and e) a step of detecting the marker, wherein the probe having a sequence complementary to cfDNA complementarily binds to a gene known as a cancer biomarker.
[0491] Specifically, the probe having a sequence complementary to cfDNA may complementary bind to at least any one gene selected from the group consisting of CPT1A, IFNG, IFNGR1, CD279, CD274, and a combination thereof. In this case, preferably, two or more genes selected from the above group may be combined.
[0492] The cancer may be any one selected from the group consisting of lung cancer, colorectal cancer, prostate cancer, thyroid cancer, breast cancer, brain cancer, head and neck cancer, esophageal cancer, skin cancer, thymic cancer, gastric cancer, colon cancer, liver cancer, ovarian cancer, uterine cancer, bladder cancer, rectal cancer, gallbladder cancer, biliary tract cancer, pancreatic cancer, lymphoma, acute leukemia, multiple myeloma, and a combination thereof.
[0493] In addition, the purpose of using the isolated biological sample is to detect cfDNA present in the sample. Therefore, cfDNA in a sample may be used by being isolated and/or concentrated in various ways. In one embodiment, a nitrocellulose membrane having a strong affinity for nucleic acid may be used. In addition, in one embodiment, a positively charged material may be used to capture a negatively charged cfDNA. The positively charged material may be a nanoparticle, a nanowire, a network, or a positively charged filter, but is not limited thereto. In one embodiment of the “positively charged material”, it may be a positively charged nanostructure or a positively charged membrane.
[0494] In one example of the nanostructure, it may comprise a cationic polymer. The kind of the cationic polymer is not limited. One embodiment of the cationic polymer may be polyethyleneimine (PEI), and may be a cationic branched polymer polyethyleneimine.
[0495] In addition, by mixing nanowires labeled with streptavidin with a solution of PEI to which biotin is bound, cationic branched polyethyleneimine (cationic branched PEI) may be further bound to the nanowires through the interaction of biotin-streptavidin. As a result, the nanoparticles in the nanostructures (PEI/mPpy NWs) with polyethyleneimine, a cationic polymer, bound to the surface of the nanostructures may be incorporated with high density and irregular distribution.
[0496] These nanowires can successfully capture genomic DNA and cfDNA with high efficiency even at a low concentration. In particular, due to the characteristics of the nanowires such as the large surface area for binding with target molecules such as DNA and the enhanced mobility for promoting interaction with DNA, it is possible to efficiently and effectively capture the target cfDNA.
[0497] In this case, the target cfDNA refers to the desired cfDNA to be detected. In the present specification, cfDNA has double strands. In this case, in a portion of the cfDNA, double strands may be unwound. In addition, the cfDNA may be derived from a gene of cancer cells. Specifically, cfDNA may include a nucleic acid sequence overexpressed in cancer cells. The nucleic acid sequence that is overexpressed in the cancer cells refers to a nucleic acid sequence that is overexpressed in specific cancer cells, although it has an appropriate expression level in normal cells.
[0498] Specifically, the level or reference (cutoff) of the nucleic acid sequence overexpressed in cancer cells may be a case where the OD value is 0.010 or more when the absorbance (optical density) is measured using a marker. More specifically, in the level or reference of the nucleic acid sequence overexpressed in cancer cells, an OD value may be about 0.012 or about 0.015 or more by measuring an absorbance using a marker. In this case, the wavelength irradiated for measuring the absorbance may be appropriately determined according to a marker. The cfDNA may be DNA in which double strands are unwound (unwinding of DNA). In addition, cfDNA may be appropriately determined according to the purpose.
[0499] In addition, the cfDNA derived from cancer cells may be characterized by i) having a lower Tm value than that of cfDNA having a double helix structure derived from normal cells, or ii) being denatured in a condition in which the cfDNA having a double helix structure derived from normal cells is not denatured.
[0500] In addition, the cfDNA is capable of binding with a about 15-mer to about 30-mer probe that can complementarily bind to cfDNA in any one of the following conditions: i) a condition of allowing to stand for about 1 minute to about 120 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for about 1 second to about 3 minutes; iii) a condition of heating at about 75° C. to about 90° C. for about 1 second to about 5 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 30 seconds to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 10 minutes to about 120 minutes; vi) a condition of treating with protease for about 1 minute to about 30 minutes; vii) a condition of treating with DNase for about 1 minute to about 30 minutes; and viii) a condition of treating with a chemical substance (for example, sodium hydroxide, DMSO, a surfactant, and the like).
[0501] The gene overexpressed in cancer cells may be any one selected from the group consisting of FNG (NCBI Gene ID: 3458), IFNGR1 (NCBI Gene ID: 3459), CD279 (NCBI Gene ID: 5133) and CD274 (NCBI Gene ID: 29126), and a combination thereof. In one embodiment, when two genes overexpressed in cancer cells are combined, the combination may be IFNG/IFNGR1, IFNG/CD274, or IFNG/CD279. When three genes overexpressed in cancer cells are combined, the combination may be IFNG/IFNGR1/CD274, IFNG/CD274/CD279, or IFNGR1/CD274/CD279. When four genes overexpressed in cancer cells are combined, the combination may be INFG/IFNGR1/CD274/CD279. When two or more genes overexpressed in cancer cells are analyzed, the reliability of the analysis results may be enhanced.
[0502] As used herein, the term “IFNG” refers to a gene encoding interferon gamma.
[0503] As used herein, the term “IFNGR1” refers to a gene encoding interferon gamma receptor 1.
[0504] As used herein, the term “CD274” refers to a gene encoding PD-L1 (programmed death-ligand 1).
[0505] As used herein, the term “probe” refers to DNA or RNA for detecting cfDNA. The probe may have a specific sequence to be capable of complementarily binding to cfDNA. The probe having a sequence complementary to cfDNA refers to a probe having a nucleic acid sequence capable of complementarily binding to a desired double-stranded cfDNA to be detected present in plasma. In this case, the probe may be one to which biotin is bound. The probe may be bound to a marker that is bound to a biotin-binding protein.
[0506] As used herein, the term “marker” refers to a material that is used for detecting a probe bound to cfDNA. The marker may be a nanoparticle, a fluorescent dye, a fluorescent protein, or an enzyme. Specifically, the marker may be any one selected from the group consisting of a quantum dot, an HRP and a fluorescent protein. In one embodiment, the marker may be GFP (green fluorescent protein), BFP (blue fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow fluorescent protein), or HRP (horse radish peroxidase), but is not limited thereto.
[0507] The marker may be one to which a biotin-binding protein is bound. The biotin-binding protein may be an avidin-based protein, avidin, streptavidin, traptavidin, or neutravidin, but may be used without limit as long as it is a protein that can specifically bind to biotin. In one embodiment, the marker may be one to which streptavidin is bound.
[0508] As used herein, the term “streptavidin” is a tetrameric biotin-binding protein with a molecular weight of about 60 kDa isolated from Streptomyces avidinii. It has very low homology to the avidin, but its structure is very similar to the avidin. Like avidin, it has an antibacterial activity and a very high binding capacity to biotin. On the other hand, unlike avidin, it does not contain carbohydrates, has an acidic isoelectric point (pI=5), and has a significantly lower solubility than avidin. A commercially available streptavidin such as Thermo Scientific Pierce Streptavidin is in a recombinant form of streptavidin having a molecular weight of about 53 kDa and has an isoelectric point which is near neutral (pI=6.8 to 7.5). The streptavidin having the lack of glycosylation and low pI has a low level of non-specific binding (in particular, lectin binding) as compared to avidin. These properties of streptavidin allow it to be selected as an ideal reagent for many detection systems.
[0509] As used herein, the term “traptavidin” refers to a mutant (variant or mutein) of streptavidin, and is a protein having a dissociation rate for biotin that is slower by about 10 times and having an increased mechanical strength and enhanced thermal stability. In addition, the traptavidin specifically binds to biotin.
[0510] The term “neutravidin” of the present invention is also referred to as “deglycosylated avidin” and is prepared to avoid the main disadvantages of naturally occurring avidin and streptavidin. As shown in the name, neutravidin is produced by deglycosylating avidin. It is a protein that has a reduced molecular weight (about 60 kDa) and maintains a high biotin binding capacity as compared to avidin. The deglycosylation of the avidin reduces the binding of lectin to an undetectable level and lowers an isoelectric point (pI=about 6.3) to effectively eliminate the main cause of non-specific binding to avidin. A lysine residue remains usable, so it can be easily derivatized or complexed like streptavidin. In addition, since it exhibits high biotin binding capacity and low non-specific binding, it can be used in various ways as an ideal biotin-binding protein.
[0511] As used herein, the term “a step of detecting the marker” refers to a step of detecting a marker that is bound to a probe through a reaction of biotin-avidin. The detection of the marker can be measured by a color change, a UV absorbance change, the presence or absence of bioluminescence, a fluorescence change, or an electrochemical change. Specifically, the method for detecting the marker may be performed differently depending on the marker used. For example, when HRP is used as a marker, the marker can be detected by observing the color reaction through the reaction between hydrogen peroxide and a substrate. In addition, when the marker is a fluorescent protein such as GFP, the presence or absence of the marker can be detected by observing the detected light after irradiating light of a specific wavelength. In addition, when the marker is luciferase, the presence of the marker can be detected by measuring the bioluminescence that is exhibited after adding a substrate such as luciferin by bioluminometer.
[0512] In addition, the diagnostic method of the present invention may further comprise a step of denaturing cfDNA. In this case, the denaturation step can be performed to selectively denature only cfDNA derived from cancer, but not to denature normal double-stranded cfDNA. To this end, the conditions of the denaturation step may be performed at about 50° C. to about 100° C. for about 0.1 second to about 5 minutes. One embodiment of the denaturation temperature may be about 95° C., and the denaturation time may be usually about 0.1 second to about 8 minutes. In addition, it may be denatured for about 1 second, about 5 seconds, about 10 seconds, about 30 seconds, about 60 seconds, or about 90 seconds. In one embodiment, the step of denaturing cfDNA may be performed prior to step c) above.
[0513] Specifically, the method may further comprise a step of denaturing the sample or cfDNA bound to the positively charged material prior to step c) above in any one condition selected from the group consisting of i) a condition of allowing to stand for about 1 minute to about 10 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for 1 second to 1 minute; iii) a condition of heating at about 75° C. to about 90° C. for about 10 seconds to about 3 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 1 minute to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 5 minutes to about 60 minutes; vi) a condition of treating with protease for about 1 minute to about 10 minutes; and vii) a condition of treating with DNaseI for about 1 minute to about 10 minutes. This denaturation step does not denature the double-stranded cfDNA derived from normal cells, but selectively denatures only cfDNA derived from cancer cells, thereby making it easier to bind with the probe. The denaturation conditions of i) to vii) may be performed after obtaining a sample. In addition, the denaturation conditions of i) to vii) may be performed after obtaining cfDNA bound to the positively charged material. In addition, the temperature, protease, and DNase treatment time of the denaturation conditions of i) to vii) may be appropriately adjusted as long as they do not denature the stable cfDNA.
[0514] Cancer Diagnostic Kit
[0515] Other aspect of the present invention provides a diagnostic kit for early diagnosing cancer or predicting the prognosis of cancer, comprising a probe to which biotin is bound complementarily binding to a gene specifically expressed in cancer; a positively charged material; a marker to which an avidin-based protein is bound; and a manual.
[0516] In this case, the gene specifically expressed in cancer may be any one or more selected from the group consisting of CPT1A, IFNG, IFNGR1, CD279, CD274, and a combination thereof.
[0517] In addition, the manual may describe that the kit is configured to be capable of early diagnosing cancer or predicting the prognosis of cancer by the following protocol: a) isolate cfDNA from a biological sample isolated from an individual using a positively charged material contained in the kit; b) mix sequentially or simultaneously a probe to which biotin is bound contained in the kit and a marker contained in the kit in the isolated cfDNA; c) remove the probe that does not bind to cfDNA and the marker; and d) detect the signal of the marker.
[0518] In addition, the probe, the positively charged material, and the marker are as described above.
[0519] Cancer Diagnostic Device
[0520] Other aspect of the present invention provides a device for early diagnosing cancer or predicting the prognosis of cancer by detecting a gene derived from cancer cells from a sample without amplification, wherein the device comprises a) a mixing part for mixing a biological sample isolated from an individual comprising cfDNA and a positively charged material; b) an obtaining part for removing the sample except for the positively charged material to which cfDNA is bound; c) a reaction part for adding sequentially or simultaneously a probe to which biotin is bound capable of complementarily binding to the gene specifically expressed in cancer; and a nanoparticle comprising streptavidin and a marker to the positively charged material to which cfDNA is bound; d) a detection part for detecting the marker; and e) an information processing part for determining whether there is cfDNA having a sequence complementary to the probe and derived from cancer in the sample depending on whether the marker is detected.
[0521] In this case, the gene specifically expressed in cancer may be any one or more selected from the group consisting of CPT1A, IFNG, IFNGR1, CD279, CD274, and a combination thereof
[0522] <Cancer>
[0523] Method for Confirming Cancer, Metastasis of Cancer, and Resistance of Cancer to Drugs
[0524] One aspect of the present invention is a method for determining the presence or absence of cancer, metastasis state of cancer, and/or resistance by detecting a gene derived from cancer cells from the sample without amplification, wherein the method comprises a) a step of mixing a biological sample isolated from an individual comprising cell-free DNA (hereinafter cfDNA) and a positively charged material; b) a step of isolating the positively charged material to which cfDNA is bound; c) a step of sequentially or simultaneously mixing a probe having a sequence complementary to the cfDNA and a marker in the mixture; d) a step of removing the probe that does not bind to cfDNA and the marker; and e) a step of detecting the marker, wherein the cfDNA is derived from cancer cells, and the probe having a sequence complementary to cfDNA complementarily binds to a gene known as an indicator of the presence or absence of cancer and metastasis of cancer or a resistance biomarker, and the method determines the presence or absence of metastasis state or resistance of cancer. In this case, the gene known as an indicator of the presence or absence of cancer and metastasis of cancer or a resistance biomarker may be a gene including single nucleotide polymorphism (snp) in cancer (see Example 6 and Example 7).
[0525] Specifically, the probe having a sequence complementary to cfDNA may complementarily bind to at least any one gene selected from the group consisting of CPT1A, IFNG, IFNGR1, CD279, CD274, and a combination thereof.
[0526] The probe having a sequence complementary to cfDNA may complementarily bind to a gene overexpressed in cancer cells, a gene specifically present in cancer, a gene related to metastasis, or a gene related to drug resistance.
[0527] In one embodiment, the gene overexpressed in cancer cells may be any one selected from the group consisting of CPT1A, IFNG, IFNGR1, CD279, CD274, NSE, SCC, CEA, cyfra21-1, TPA, NMP22, OGT, Thyroglobulin (TG), Calcitonin (CALCA), BRAF V600E, TERT C228T/C250T, AFP, β-HCG (CGB). CA19-9, PSA, PSMA, PAP, PCA3, TMPRSS2-ERG, CA125, HIF-1a, VEGF, CA15-3, HER2, SCC (SART3), TOP2A, MCM2, p16INK4a (CDKN2A), Ki-67 (MK1167), HE4 (WEDC2), and a combination thereof.
[0528] In one embodiment, the gene specifically present in cancer may be CPT1A, IFNG, IFNGR1, CD279, CD274 genes, and additionally, NSE, SCC, CEA, cyfra21-1, TPA, NMP22, OGT Thyroglobulin (TG), Calcitonin (CALCA), BRAF V600E, TERT C228T/C250T, AFP, β-HCG (CGB). CA19-9, PSA, PSMA, PAP, PCA3, TMPRSS2-ERG, CA125, HIF-1a, VEGF, CA15-3, HER2, SCC (SART3), TOP2A, MCM2, p16INK4a (CDKN2A), Ki-67 (MK1167), or HE4 (WEDC2) gene may be additionally detected to diagnose cancer.
[0529] In one embodiment, the gene related to the metastasis of cancer may be genes related to “proliferation” and “invasion”, and may be, for example, Ki67, STK15, Survivin, Cyclin B1, MYBL2, Stromelysin3, or Cathepsin L2.
[0530] In one embodiment, the gene related to the drug resistance may be determined depending on the drug and the type of cancer. In one embodiment, the gene related to acquired resistance to EGFR-TKI may be any one selected from the group consisting of EGFR T790M, PI3K, BRAF, MAPK1, HER2, KRAS, NRAS, RB deletion, p53 deletion, PTEN, and NFkB.
[0531] In addition, the purpose of using the isolated biological sample is to detect cfDNA present in the sample. Therefore, cfDNA in a sample may be used by being isolated and/or concentrated in various ways. In one embodiment, a nitrocellulose membrane having a strong affinity for nucleic acid may be used. In addition, in one embodiment, a positively charged material may be used to capture a negatively charged cfDNA. The positively charged material may be a nanoparticle, a nanowire, a network, or a positively charged filter, but is not limited thereto. In one embodiment of the “positively charged material”, it may be a positively charged nanostructure or a positively charged membrane.
[0532] In one example of the nanostructure, it may comprise a cationic polymer. The kind of the cationic polymer is not limited. One embodiment of the cationic polymer may be polyethyleneimine (PEI), and may be a cationic branched polymer polyethyleneimine.
[0533] In addition, by mixing nanowires labeled with streptavidin with a solution of PEI to which biotin is bound, cationic branched polyethyleneimine (cationic branched PEI) may be further bound to the nanowires through the interaction of biotin-streptavidin. As a result, the nanoparticles in the nanostructures (PEI/mPpy NWs) with polyethyleneimine, a cationic polymer, bound to the surface of the nanostructures may be incorporated with high density and irregular distribution.
[0534] These nanowires can successfully capture genomic DNA and cfDNA with high efficiency even at a low concentration. In particular, due to the characteristics of the nanowires such as the large surface area for binding with target molecules such as DNA and the enhanced mobility for promoting interaction with DNA, it is possible to efficiently and effectively capture the target cfDNA.
[0535] In this case, the target cfDNA refers to the desired cfDNA to be detected. In the present specification, cfDNA has double strands. In this case, in a portion of the cfDNA, double strands may be unwound. In addition, the cfDNA may be derived from a gene of cancer cells. Specifically, cfDNA may include a nucleic acid sequence overexpressed in cancer cells. The nucleic acid sequence that is overexpressed in the cancer cells refers to a nucleic acid sequence that is overexpressed in specific cancer cells, although it has an appropriate expression level in normal cells.
[0536] Specifically, the level or reference (cutoff) of the nucleic acid sequence overexpressed in cancer cells may be a case where the OD value is 0.010 or more when the absorbance (optical density) is measured using a marker. More specifically, in the level or reference of the nucleic acid sequence overexpressed in cancer cells, an OD value is about 0.012 or about 0.015 or more by measuring an absorbance using a marker. In this case, the wavelength irradiated for measuring the absorbance may be appropriately determined according to a marker. The cfDNA may be DNA in which double strands are unwound (unwinding of DNA). In addition, cfDNA may be appropriately determined according to the purpose.
[0537] In addition, the cfDNA derived from cancer cells may be characterized by i) having a lower Tm value than that of cfDNA having a double helix structure derived from normal cells, or ii) being denatured in a condition in which the cfDNA having a double helix structure derived from normal cells is not denatured.
[0538] In addition, the cfDNA is capable of binding with a about 15-mer to about 30-mer probe that can complementarily bind to cfDNA in any one of the following conditions: i) a condition of allowing to stand for about 1 minute to about 120 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for about 1 second to about 3 minutes; iii) a condition of heating at about 75° C. to about 90° C. for about 1 second to about 5 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 30 seconds to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 10 minutes to about 120 minutes; vi) a condition of treating with protease for about 1 minute to about 30 minutes; vii) a condition of treating with DNase for about 1 minute to about 30 minutes; and viii) a condition of treating with a chemical substance (for example, sodium hydroxide, DMSO, a surfactant, and the like).
[0539] As used herein, the term “probe” refers to DNA or RNA for detecting cfDNA. The probe may have a specific sequence to be capable of complementarily binding to cfDNA. The probe having a sequence complementary to cfDNA refers to a probe having a nucleic acid sequence capable of complementarily binding to a desired double-stranded cfDNA to be detected present in plasma. In this case, the probe may be one to which biotin is bound. The probe may be bound to a marker that is bound to a biotin-binding protein.
[0540] As used herein, the term “marker” refers to a material that is used for detecting a probe bound to cfDNA. The marker may be a nanoparticle, a fluorescent dye, a fluorescent protein, or an enzyme. Specifically, the marker may be any one selected from the group consisting of a quantum dot, an HRP and a fluorescent protein. In one embodiment, the marker may be GFP (green fluorescent protein), BFP (blue fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow fluorescent protein), or HRP (horse radish peroxidase), but is not limited thereto.
[0541] The marker may be one to which a biotin-binding protein is bound. The biotin-binding protein may be an avidin-based protein, avidin, streptavidin, traptavidin, or neutravidin, but may be used without limit as long as it is a protein that can specifically bind to biotin. In one embodiment, the marker may be one to which streptavidin is bound.
[0542] As used herein, the term “streptavidin” is a tetrameric biotin-binding protein with a molecular weight of about 60 kDa isolated from Streptomyces avidinii. It has very low homology to the avidin, but its structure is very similar to the avidin. Like avidin, it has an antibacterial activity and a very high binding capacity to biotin. On the other hand, unlike avidin, it does not contain carbohydrates, has an acidic isoelectric point (pI=5), and has a significantly lower solubility than avidin. A commercially available streptavidin such as Thermo Scientific Pierce Streptavidin is in a recombinant form of streptavidin having a molecular weight of about 53 kDa and has an isoelectric point which is near neutral (pI=6.8 to 7.5). The streptavidin having the lack of glycosylation and low pI has a low level of non-specific binding (in particular, lectin binding) as compared to avidin. These properties of streptavidin allow it to be selected as an ideal reagent for many detection systems.
[0543] As used herein, the term “traptavidin” refers to a mutant (variant or mutein) of streptavidin, and is a protein having a dissociation rate for biotin that is slower by about 10 times and having an increased mechanical strength and enhanced thermal stability. In addition, the traptavidin specifically binds to biotin.
[0544] The term “neutravidin” of the present invention is also referred to as “deglycosylated avidin” and is prepared to avoid the main disadvantages of naturally occurring avidin and streptavidin. As shown in the name, neutravidin is produced by deglycosylating avidin. It is a protein that has a reduced molecular weight (about 60 kDa) and maintains a high biotin binding capacity as compared to avidin. The deglycosylation of the avidin reduces the binding of lectin to an undetectable level and lowers an isoelectric point (pI=about 6.3) to effectively eliminate the main cause of non-specific binding to avidin. A lysine residue remains usable, so it can be easily derivatized or complexed like streptavidin. In addition, since it exhibits high biotin binding capacity and low non-specific binding, it can be used in various ways as an ideal biotin-binding protein.
[0545] As used herein, the term “a step of detecting the marker” refers to a step of detecting a marker that is bound to a probe through a reaction of biotin-avidin. The detection of the marker can be measured by a color change, a UV absorbance change, the presence or absence of bioluminescence, a fluorescence change, or an electrochemical change. Specifically, the method for detecting the marker may be performed differently depending on the marker used. For example, when HRP is used as a marker, the marker can be detected by observing the color reaction through the reaction between hydrogen peroxide and a substrate. In addition, when the marker is a fluorescent protein such as GFP, the presence or absence of the marker can be detected by observing the detected light after irradiating light of a specific wavelength. In addition, when the marker is luciferase, the presence of the marker can be detected by measuring the bioluminescence that is exhibited after adding a substrate such as luciferin by bioluminometer.
[0546] In addition, the diagnostic method of the present invention may further comprise a step of denaturing cfDNA. In this case, the denaturation step can be performed to selectively denature only cfDNA derived from cancer, but not to denature normal double-stranded cfDNA. To this end, the conditions of the denaturation step may be performed at about 50° C. to about 100° C. for about 0.1 second to about 5 minutes. One embodiment of the denaturation temperature may be about 95° C., and the denaturation time may be usually about 0.1 second to about 8 minutes. In addition, it may be denatured for about 1 second, about 5 seconds, about 10 seconds, about 30 seconds, about 60 seconds, or about 90 seconds. In one embodiment, the step of denaturing cfDNA may be performed prior to step c) above.
[0547] Specifically, the method may further comprise a step of denaturing the sample or cfDNA bound to the positively charged material prior to step c) above in any one condition selected from the group consisting of i) a condition of allowing to stand for about 1 minute to about 10 minutes at ambient temperature; ii) a condition of heating at about 90° C. to about 95° C. for 1 second to 1 minute; iii) a condition of heating at about 75° C. to about 90° C. for about 10 seconds to about 3 minutes; iv) a condition of heating at about 60° C. to about 75° C. for about 1 minute to about 30 minutes; v) a condition of heating at about 25° C. to about 40° C. for about 5 minutes to about 60 minutes; vi) a condition of treating with protease for about 1 minute to about 10 minutes; and vii) a condition of treating with DNaseI for about 1 minute to about 10 minutes. This denaturation step does not denature the double-stranded cfDNA derived from normal cells, but selectively denatures only cfDNA derived from cancer cells, thereby making it easier to bind with the probe. The denaturation conditions of i) to vii) may be performed after obtaining a sample. In addition, the denaturation conditions of i) to vii) may be performed after obtaining cfDNA bound to the positively charged material. In addition, the temperature, protease, and DNase treatment time of the denaturation conditions of i) to vii) may be appropriately adjusted as long as they do not denature the stable cfDNA.
[0548] Cancer Diagnostic Kit Other aspect of the present invention provides a diagnostic kit for diagnosing cancer, comprising a probe to which biotin is bound complementarily binding to a gene specifically expressed in cancer; a positively charged material; a marker to which an avidin-based protein is bound; and a manual.
[0549] In this case, the gene specifically expressed in cancer may be any one or more selected from the group consisting of CPT1A, IFNG, IFNGR1, CD279, CD274G, and a combination thereof.
[0550] In addition, the manual may describe that the kit is configured to be capable of diagnosing cancer by the following protocol: a) isolate cfDNA from a biological sample isolated from an individual using a positively charged material contained in the kit; b) mix sequentially or simultaneously a probe to which biotin is bound contained in the kit and a marker contained in the kit in the isolated cfDNA; c) remove the probe that does not bind to cfDNA and the marker; and d) detect the signal of the marker.
[0551] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of NSE, SCC, CEA, cyfra21-1, TPA, NMP22, OGT, Thyroglobulin (TG), Calcitonin (CALCA), BRAF V600E, TERT C228T/C250T, AFP, β-HCG (CGB). CA19-9, PSA, PSMA, PAP, PCA3, TMPRSS2-ERG, CA125, HIF-1a, VEGF, CA15-3, HER2, SCC (SART3), TOP2A, MCM2, p16INK4a (CDKN2A), Ki-67 (MK1167), HE4 (WEDC2), and a combination thereof.
[0552] In addition, the probe, the positively charged material, and the marker are as described above.
[0553] Cancer Diagnostic Device
[0554] Other aspect of the present invention provides a device for diagnosing cancer by detecting a gene derived from cancer cells from a sample without amplification, wherein the device comprises a) a mixing part for mixing a biological sample isolated from an individual comprising cfDNA and a positively charged material; b) an obtaining part for removing the sample except for the positively charged material to which cfDNA is bound; c) a reaction part for adding sequentially or simultaneously a probe to which biotin is bound capable of complementarily binding to the gene specifically expressed in cancer; and a nanoparticle comprising streptavidin and a marker to the positively charged material to which cfDNA is bound; d) a detection part for detecting the marker; and e) an information processing part for determining whether there is cfDNA having a sequence complementary to the probe and derived from cancer in the sample depending on whether the marker is detected.
[0555] In this case, the gene specifically expressed in cancer may be any one or more selected from the group consisting of CPT1A, IFNG, IFNGR1, CD279, CD274, and a combination thereof.
[0556] In addition, it may further comprise a probe to which biotin is bound complementarily binding to at least any one gene selected from the group consisting of NSE, SCC, CEA, cyfra21-1, TPA, NMP22, OGT, Thyroglobulin (TG), Calcitonin (CALCA), BRAF V600E, TERT C228T/C250T, AFP, β-HCG (CGB). CA19-9, PSA, PSMA, PAP, PCA3, TMPRSS2-ERG, CA125, HIF-1a, VEGF, CA15-3, HER2, SCC (SART3), TOP2A, MCM2, p16INK4a (CDKN2A), Ki-67 (MK1167), HE4 (WEDC2), and a combination thereof.
MODE FOR CARRYING OUT THE INVENTION
[0557] Hereinafter, the present invention will be described in more detail through the working examples below. However, the following examples are provided only for the purpose of illustration of the present invention, but the scope of the present invention is not limited to the following examples.
Experimental Method
[0558] 1. Method for Detecting cfDNA Derived from Tumor Specific Gene
[0559] Step 1: Sample Preparation and Nanowire Addition
[0560] Immediately after obtaining plasma, urine, saliva, sputum, or the like of patients, it was centrifuged at 4° C., 3000×g, for 10 minutes. The plasma, urine, saliva, sputum, or the like of patients was diluted in DPBS at a given ratio. In the case of plasma, 1 μL or 30 μL of plasma was mixed in 150 μL of DW and put in a spin column (Type G or Type Q), and PEI/Ppy nanowire (150 μL) was added and mixed for 20 minutes at a speed of 1,200 rpm at room temperature using a thermomixer.
[0561] Step 2: Vacuum/Washing/Temperature Denaturation
[0562] The spin column was mounted on a vacuum suction device, and then suction was performed at 550 mBar. 400 μL of 1×DPBS was added and suction was performed again. The same process was repeated once more. Only the nanowire-DNA complex obtained through the 2-step was captured in the spin column. When temperature denaturation was required, the spin column in which suction was completed was put in a heating block preheated to 95° C., and incubation was performed at 95° C. for 1 minute, and then it was taken out immediately. Samples that do not require a temperature denaturation step were not subjected to this process.
[0563]
[0564] Step 3: Addition of Probe and HRP/STR NPs
[0565] A probe (200 μL) which was compatible to the experiment and HRP/STR NPs solution (200 μL) were added to a spin column, respectively. It was mixed for 30 minutes at a speed of 850 rpm to 1,000 rpm at room temperature using a thermomixer. The spin column was mounted on a vacuum device, and then suction was performed. 400 μL of 1×DPBS was added and suction was performed again. The same process was repeated once more.
[0566] Step 4: TMB Reaction for Detecting Gene Mutation After replacing the collection tube with a new one, 200 μL of sodium acetate buffer (0.2 M, pH 7.0), 50 μL of H2O2 (0.1 M) were sequentially added to a spin column using a syringe pump, and then incubation was performed for 3 minutes. At the end of the incubation, the spin column was centrifuged at a speed of 3,500 rpm to 5,000 rpm for 30 seconds. 200 μL of the solution collected in the collection tube was transferred to each of 96 wells, and then the absorbance was measured in a wavelength range of 500 nm to 850 nm using a UV/VIS spectrophotometer.
[0567] Overview of Detection Method
[0568] The detection step of the present invention is illustrated in
Preparation Example 1. Preparation of Nanowires Surface-Treated with Cationic Polymers
[0569] As shown in
[0570] In order to prepare nanowires (PEI/Ppy NWs) surface-treated with cationic polymers, along with 0.01 M poly(4-styrene sulfonic acid) and a 0.01 M pyrrole solution containing 1 mg/ml biotin, chronoamperometry at 1.0 V (vs. Ag/AgCl) was applied into the pores of the AAO template for 7 minutes to perform an electrochemical deposition.
[0571] The resulting AAO template was washed several times with distilled water, dipped in a 2 M sodium hydroxide (NaOH) solution for 3 hours, and then put in Bioruptor UCD-200 (Diagenode) for sonication to obtain free-standing poly(pyrrole) nanowire (free-standing Ppy NWs) doped with biotin molecules. Then, 30 mM N-(3-dimethylaminopropyl)-N-ethylcarbodiimide hydrochloride (EDC) and 6 mM N-hydroxysuccinimide (NHS) were added to the resulting nanowire to activate a carboxylic acid group (—COOH). Thereafter, a PEI solution was added, then reacted for 1 hour at ambient temperature, and washed with water to obtain nanostructures (PEI/Ppy NW) on the surface of which polyethyleneimine was conjugated. The obtained nanostructures (PEI/Ppy NW) were dispersed in deionized water and stored at room temperature until use.
[0572] Through such preparation method, each of poly(pyrrole) (Ppy) nanowires was released from the AAO template after the AAO template was selectively dissolved, and cationic branched polyethyleneimine (cationic branched PEI, 25 kDa) was additionally conjugated to the nanowire through a biotin-streptavidin interaction.
Preparation Example 2. Preparation of Nanowires Surface-Treated with Cationic Polymer
[0573] According to the method substantially the same as Preparation Example 1 above, the nanostructures (PL/Ppy NW) with polylysine conjugated to the surface of the nanostructures instead of polyethyleneimine were obtained.
Preparation Example 3. Preparation of Poly(Pyrrole) Nanoparticle Labeled with HRP and Streptavidin
[0574] In order to prepare nanoparticles to which HRP and streptavidin are bound, 0.5 g of polyvinylpyrrolidone (PVP) was added to 12.5 mL of tertiary distilled water, stirred for 30 minutes, and then 65 μL of pyrrole was added and further stirred for 10 minutes. Thereafter, 0.5 mL of a FeCl.sub.3 solution at a concentration of 0.75 g/mL was added and reacted for 3 hours. Thereafter, 20 mL of an aqueous hyaluronic acid solution (400 mg/20 mL) was added and stirred for 3 hours to prepare poly(pyrrole)-hyaluronic acid nanoparticles (Ppy-HA-NPs).
[0575] MWCO: Dialysis in tertiary distilled water for 2 days using a 50,000 pore-sized membrane was performed. The large-sized particles aggregates were removed by centrifugation at 1,200 rpm for 3 minutes and then lyophilized. 200 μg of Ppy-HA-NPs prepared above were added to 1 mL of tertiary distilled water, and then a 100 mM EDC/50 mM NHS solution was added and reacted for 45 minutes to activate a carboxy group of hyaluronic acid. While the supernatant was removed by centrifugation at 15,000 rpm for 10 minutes, the washing was performed twice. 1 mg of HRP and 1 mg of streptavidin were added to Ppy-HA-NPs and mixed at 4° C. temperature. Thereafter, the supernatant was removed by centrifugation at 15,000 rpm for 10 minutes and then stored in tertiary distilled water. The morphology of the nanoparticle (HRP/st-tagged NP) with HRP and streptavidin conjugated to the surface of the nanoparticles was observed using a scanning electron microscope (
Preparation Example 4. Probe Construction
[0576] The probes were constructed to detect cfDNA having an unstable double helix structure. The probe constructs were differently constructed depending on cfDNA of the desired cancer type to be detected. In this case, biotin was bound to the probes. The specific nucleic acid sequence information of the probes is as shown in Tables 1, 5, 9 and 11 to 28 depending on the type of cancer to be diagnosed.
[0577] I. Confirmation of Accuracy for Detection of Gene Derived from Cancer Cell Line
Example 1. Detection of Gene Expressed in Cancer Cell Line
Example 1.1. Confirmation of Accuracy for Detection of PD-L1
[0578] The accuracy for detection of PD-L1 was confirmed using MDA-MB-231, HCC827, H1975, PC9, and H460 cancer cell lines known as PD-L1 positive cancer cell lines and A549, MDA-MB-468, HeLa, and MCF7 cancer cell lines known as PD-L1 negative cancer cell lines obtained from ATCC and Korean Cell Line Bank. In this case, the PD-L1 positive cancer cell lines and PD-L1 negative cancer cell lines were classified based on the mRNA level of PD-L1 of each cancer cell line provided by CCLE (Cancer Cell Line Encyclopedia).
[0579] Specifically, genomic DNA was extracted from each of the PD-L1 positive cancer cell line and PD-L1 negative cancer cell line, followed by sonication to produce fDNA (fragmented DNA). 50 ng/μL fDNA was added to PBS, and then the nanowires prepared in Preparation Example 1 were added and reacted for 20 minutes to isolate them. Thereafter, a temperature denaturation process was undergone at a temperature of 95° C. for 1 minute, and then a biotinylated PD-L1 probe was added and reacted further for 20 minutes. In this case, the probes used are shown in Table 1 below.
TABLE-US-00001 TABLE 1 Sequence Sequence(5′->3′) ID NO. biotinylated PD-L1 TGGGAGCCATCTTATTATGCC 1 probe 1(Exon5) biotinylated PD-L1 CGGAAGATGAATGTCAGTGC 2 probe 2(Exon5) biotinylated PD-L1 CCTACTGGCATTTGCTGAACG 3 probe 3(Exon2) biotinylated PD-L1 ACCATAGCTGATCATGCAGCG 4 probe 4(Exon3)
[0580] For colorimetric detection, it was treated with the solution in which TMB (3,3′,5,5′-tetramethylbenzidine) and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm detection results. As a result of analyzing DNA-based PD-L1 expression (ΔOD) of each cancer cell line, in two repeated experiments, clear PD-L1 DNA expression (ΔOD; cutoff OD>0.012) was observed only in fDNA of MDA-MB-231, HCC827, H1975, PC9, and H460 cancer cell lines. On the other hand, in two repeated experiments, PD-L1 DNA expression was not observed in A549, MDA-MB-461, HeLa, and MCF7 cancer cell lines (
TABLE-US-00002 TABLE 2 Cancer cell line CD274 MDAMB231_BREAST 3.474506 HCC827_LUNG 3.426417 NCIH1975_LUNG 2.513606 PC9_LUNG 1.098854 NCIH460_LUNG 0.903786 A549_LUNG 0.735843 MDAMB468_BREAST −0.38864 MCF7_BREAST −4.06132
[0581] As a result, high mRNA expression was shown in MDA-MB-231, HCC827, H1975, PC9, and H460 cancer cell lines. On the other hand, mRNA expression was hardly shown in A549, MDA-MB-461, HeLa, and MCF7 cancer cell lines.
Example 1.2. Confirmation of Accuracy for Detection of EpCAM
[0582] The accuracy for detection of EpCAM was confirmed using MDA-MB468, HCC827, MCF7, H1975, and MDA-MB-231 cancer cell lines known as EpCAM positive cancer cell lines and A549, H460, and HeLa cancer cell lines known as EpCAM negative cancer cell lines obtained from ATCC and Korean Cell Line Bank. In this case, the EpCAM positive cancer cell lines and EpCAM negative cancer cell lines were classified based on the mRNA level of EpCAM of each cancer cell line provided by CCLE (Cancer Cell Line Encyclopedia).
[0583] Specifically, genomic DNA was extracted from each of the EpCAM positive cancer cell line and EpCAM negative cancer cell line, followed by sonication to produce fDNA. 50 ng/μL fDNA was added to PBS, and then the nanowires prepared in Preparation Example 1 were added and reacted for 20 minutes to isolate them. Thereafter, a temperature denaturation process was undergone at a temperature of 95° C. for 1 minute, and then a biotinylated EpCAM probe was added and reacted further for 20 minutes. In this case, the probes used are shown in Table 3 below.
TABLE-US-00003 TABLE 3 Sequence Sequence(5′->3′) ID NO. biotinylated EpCAM ACAGAGCGCTAGTCCTTCGGC 5 probe 1(Exon1) biotinylated EpCAM AACCTTATGATAGTAAAAGTT 6 probe 2(Exon4) biotinylated EpCAM GGTCTAAAAGCTGGTGTTATT 7 probe 3(Exon7) biotinylated EpCAM GAAACTGGCTTTACCAATCTT 8 probe 4(Exon9)
[0584] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm detection results. As a result of analyzing DNA-based EpCAM expression (ΔOD) of each cancer cell line, in two repeated experiments, clear EpCAM DNA expression (ΔOD; cutoff OD>0.012) was observed only in fDNA of PC9, MDA-MB468, HCC827, MCF7, H1975, and MDA-MB-231 cancer cell lines. On the other hand, in two repeated experiments, EpCAM DNA expression was not observed in H460 and HeLa cancer cell lines (
TABLE-US-00004 TABLE 4 Gene EpCAM MDAMB468_BREAST 7.391754 HCC827_LUNG 7.394143 MCF7_BREAST 7.506349 NCIH1975_LUNG 6.241641 MDAMB231_BREAST 3.334 A549_LUNG 1.727828 NCIH460_LUNG −0.448733 HRLA_CERVIX −0.00781
[0585] As a result, high mRNA expression was shown in PC9, MDA-MB468, HCC827, MCF7, H1975, and MDA-MB-231 cancer cell lines. On the other hand, mRNA expression was hardly shown in H460 and HeLa cancer cell lines.
Example 1.3. Confirmation of Accuracy for Detection of FOLR1
[0586] The accuracy for detection of FOLR1 was confirmed using HeLa, MDA-MB-468, HCC827, MCF7, and MDA-MB-231 cancer cell lines known as FOLR1 positive cancer cell lines and H460, PC9, H1975 and A549 cancer cell lines known as FOLR1 negative cancer cell lines obtained from ATCC and Korean Cell Line Bank. In this case, the FOLR1 positive cancer cell lines and FOLR1 negative cancer cell lines were classified based on the mRNA level of FOLR1 of each cancer cell line provided by CCLE (Cancer Cell Line Encyclopedia).
[0587] Specifically, genomic DNA was extracted from each of the FOLR1 positive cancer cell line and FOLR1 negative cancer cell line, followed by sonication to produce fDNA. 50 ng/μL fDNA was added to PBS, and then the nanowires prepared in Preparation Example 1 were added and reacted for 20 minutes to isolate them. Thereafter, a temperature denaturation process was undergone at a temperature of 95° C. for 1 minute, and then a biotinylated FOLR1 probe was added and reacted further for 20 minutes. In this case, the probes used are shown in Table 5 below.
TABLE-US-00005 TABLE 5 Sequence Sequence(5′->3′) ID NO. biotinylated FOLR1 TGTTCTACCAACACCAGCCAG 9 probe 1(Exon4) biotinylated FOLR1 ACTGAACCCAAAGGATCACCT 10 probe 2(Exon2) biotinylated FOLR1 CCTAGGCCACTAAACCACAGC 11 probe 3(Exon1) biotinylated FOLR1 GGCTGGGCCCTGGGCAGCCTG 12 probe 4(Exon5)
[0588] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm detection results. As a result of analyzing DNA-based FOLR1 expression (ΔOD) of each cancer cell line, in two repeated experiments, clear FOLR1 DNA expression (ΔOD; cutoff OD>0.012) was observed only in fDNA of HeLa, MDA-MB468, HCC827, MCF7, and MDA-MB-231 cancer cell lines. On the other hand, in two repeated experiments, FOLR1 DNA expression was not observed in H460, PC9, H1975 and A549 cancer cells (
TABLE-US-00006 TABLE 6 Cancer cell line FOLR1 NCIH460_LUNG −4.67303 A549_LUNG −2.67569 NCIH1975_LUNG −2.1258 PC9_LUNG −1.3628 MDAMB231_BREAST 0.92787 MDAMB468_BREAST 1.029144 MCF7_BREAST 1.137905 HCC827_LUNG 2.13759 HRLA_CERVIX 6.756305
[0589] As a result, high mRNA expression was shown in HeLa, MDA-MB-468, HCC827, MCF7, and MDA-MB-231 cancer cell lines. On the other hand, mRNA expression was hardly shown in H460, PC9, H1975, and A549 cancer cell lines.
Example 1.4. Confirmation of Accuracy for Detection of EGFR
[0590] The accuracy for detection of EGFR was confirmed using HeLa, PC9, A549, H1975, H460, MDA-MB-468, MCF7, and MDA-MB-231 cancer cell lines known as EGFR positive cancer cell lines and MCF7 cancer cell lines known as EGFR negative cancer cell lines obtained from ATCC and Korean Cell Line Bank. In this case, the EGFR positive cancer cell lines and EGFR negative cancer cell lines were classified based on the mRNA level of EGFR of each cancer cell line provided by CCLE (Cancer Cell Line Encyclopedia).
[0591] Specifically, genomic DNA was extracted from each of the EGFR positive cancer cell line and EGFR negative cancer cell line, followed by sonication to produce fDNA. 50 ng/μL fDNA was added to PBS, and then the nanowires prepared in Preparation Example 1 were added and reacted for 20 minutes to isolate them. Thereafter, a temperature denaturation process was undergone at a temperature of 95° C. for 1 minute, and then a biotinylated EGFR probe was added and reacted further for 20 minutes. In this case, the probes used are shown in Table 7 below.
TABLE-US-00007 TABLE 7 Sequence Sequence(5′->3′) ID NO. biotinylated EGFR AACGCCACAACCACCGCGCAC 13 probe 1(Exon1) biotinylated EGFR GGACCGTCGCTTGGTGCACCG 14 probe 2(Exon21) biotinylated EGFR TCTGGACCCAGAAGGTGAGAA 15 probe 3(Exon19) biotinylated EGFR TGCTGGGCATCTGCCTCACCT 16 probe 4(Exon20)
[0592] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm detection results. As a result of analyzing DNA-based EGFR expression (ΔOD) of each cancer cell line, in two repeated experiments, clear EGFR DNA expression (ΔOD; cutoff OD>0.012) was observed only in fDNA of HCC827, PC9, MDA-MB468, MCF7, and MDA-MB-231 cancer cell lines. On the other hand, in two repeated experiments, EGFR DNA expression was not observed in MCF7 cancer cell line (
TABLE-US-00008 TABLE 8 Gene EGFR MCF7_BREAST −2.6082 NCIH460_LUNG 2.290725 HRLA_CERVIX 3.548315 NCIH1975_LUNG 4.722316 A549_LUNG 4.772873 MDAMB231_BREAST 5.060244 PC9_LUNG 6.4006 MDAMB468_BREAST 8.505156 HCC827_LUNG 8.98461
[0593] As a result, high mRNA expression was shown in HeLa, H460, PC9, H1975, MDA-MB-468, MCF7, and MDA-MB-231 cancer cell lines. On the other hand, mRNA expression was hardly shown in MCF7 cancer cell lines.
Example 1.5. Confirmation of Accuracy for Detection of ERBB2 (HER2)
[0594] The accuracy for detection of ERBB2 was confirmed using MCF7, PC9, A549, H1975, H460, MDA-MB468, MCF7, and MDA-MB-231 cancer cell lines known as ERBB2 positive cancer cell lines and H460 cancer cell lines known as ERBB2 negative cancer cell lines obtained from ATCC and Korean Cell Line Bank. In this case, the ERBB2 positive cancer cell lines and ERBB2 negative cancer cell lines were classified based on the mRNA level of ERBB2 of each cancer cell line provided by CCLE (Cancer Cell Line Encyclopedia).
[0595] Specifically, genomic DNA was extracted from each of the ERBB2 positive cancer cell line and ERBB2 negative cancer cell line, followed by sonication to produce fDNA. 50 ng/μL fDNA was added to PBS, and then the nanowires prepared in Preparation Example 1 were added and reacted for 20 minutes to isolate them. Thereafter, a temperature denaturation process was undergone at a temperature of 95° C. for 1 minute, and then a biotinylated ERBB2 probe was added and reacted further for 20 minutes. In this case, the probes used are shown in Table 9 below.
TABLE-US-00009 TABLE 9 Sequence Sequence(5′->3′) ID NO. biotinylated ERBB2 TCGCAGCACCCCGCGCCCCGC 17 probe 1(Exon1) biotinylated ERBB2 CCTGTTCTCCGATGTGTAAGG 18 probe 2(Exon5) biotinylated ERBB2 CCGCTCCAGCCAGAGCAGCTC 19 probe 3(Exon10) biotinylated ERBB2 AAGATCCGGAAGTACACGATG 20 probe 4(Exon17)
[0596] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm detection results. As a result of analyzing DNA-based ERBB2 expression (ΔOD) of each cancer cell line, in two repeated experiments, clear ERBB2 DNA expression (ΔOD; cutoff OD>0.010) was observed only in fDNA of MCF7, PC9, A549, H1975, MDA-MB468, MCF7, and MDA-MB-231 cancer cell lines. On the other hand, in two repeated experiments, ERBB2 DNA expression was not observed in H460 cancer cell line (
TABLE-US-00010 TABLE 10 Gene ERBB2 MCF7_BREAST 4.64588 NCIH1975_LUNG 4.314726 HRLA_CERVIX 4.056006 HCC827_LUNG 4.077482 MDAMB231_BREAST 3.681573 MDAMB468_BREAST 3.576987 A549_LUNG 3.298639 NCIH460_LUNG 2.948514
[0597] As a result, high mRNA expression was shown in MCF7, PC9, A549, H1975, MDA-MB468, MCF7, H460, and MDA-MB-231 cancer cell lines.
Example 1.6. Confirmation of Accuracy for Detection of OGT (O-linked β-N-acetylglucosamine Transferase)
[0598] The accuracy for detection of OGT was confirmed using UMUC3, KU19-19, 253J, J82, T24, MBT2 cancer cell lines known as OGT positive cancer cell lines and RT4, MDCK, HBL EpC, Jurkat cancer cell lines known as OGT negative cancer cell lines obtained from ATCC and Korean Cell Line Bank. In this case, the OGT positive cancer cell lines and OGT negative cancer cell lines were classified based on the mRNA level of OGT of each cancer cell line provided by CCLE (Cancer Cell Line Encyclopedia).
[0599] Specifically, genomic DNA was extracted from each of the OGT positive cancer cell line and OGT negative cancer cell line, followed by sonication to produce fDNA. 50 ng/μL fDNA was added to PBS, and then the nanowires prepared in Preparation Example 1 were added and reacted for 20 minutes to isolate them. Thereafter, a temperature denaturation process was undergone at a temperature of 95° C. for 1 minute, and then a biotinylated OGT probe was added and reacted further for 20 minutes. In this case, the probes used are shown in Table 11 below.
TABLE-US-00011 TABLE 11 Sequence Sequence(5′->3′) ID NO. biotinylated OGT ATGGCGTCTTCCGTGGGC 21 (O-GlcNAc transferase) probe 1 OGT_R biotinylated OGT TGCCCTGTGGCCATGGAC 22 (O-GlcNAc transferase) probe 2
[0600] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm detection results. As a result of analyzing DNA-based OGT expression (ΔOD) after detecting fDNA extracted from OGT positive cancer cell lines and OGT negative cancer cell lines with nanowires prepared in Preparation Example 1, in two repeated experiments, clear OGT DNA expression (ΔOD; cutoff OD>0.010) was observed only in fDNA of UMUC3, KU19-19, 253J, J82, T24, MBT2 cancer cell lines. On the other hand, in two repeated experiments both, OGT DNA expression was not observed in RT4, a positive bladder cancer cell line, and MDCK and HBL EpC, normal bladder cell lines, or Jurkat T-lymphocyte cells (
[0601] II. Tumor Marker Detection of Gene Derived from Cancer Cell Line
Example 2. Detection of Biomarker Derived from Cancer Cell Line
Example 2.1. Detection of CEA
[0602] CEA was detected using LoVo, MKN45, and SW1116 cancer cell lines known as CEA positive cancer cell lines and HCT8, HCT15, HeLa, and MDA-MB-231 cancer cell lines known as CEA negative cancer cell lines obtained from ATCC and Korean Cell Line Bank. In this case, the CEA positive cancer cell lines and CEA negative cancer cell lines were classified based on the mRNA level of CEA of each cancer cell line provided by CCLE (Cancer Cell Line Encyclopedia).
[0603] Specifically, genomic DNA was extracted from each of the CEA positive cancer cell line and CEA negative cancer cell line, followed by sonication to produce fDNA. 50 ng/μL fDNA was added to PBS, and then the nanowires prepared in Preparation Example 1 were added and reacted for 20 minutes to isolate them. Thereafter, a temperature denaturation process was undergone at a temperature of 95° C. for 1 minute, and then a biotinylated CEA probe was added and reacted further for 20 minutes. In this case, the probes used are shown in Table 12 below.
TABLE-US-00012 TABLE 12 Sequence Sequence(5′->3′) ID NO. biotinylated CEA(Prostatic Acid AATCTGAACCTCTCCTGCCAC 23 Phosphatase; ACPP gene) probe 1 biotinylated CEA(Prostatic Acid ACCCTTCATCACCAGCAACAA 24 Phosphatase; ACPP gene) probe 2 biotinylated CEA(Prostatic Acid TATTCTTGGCTGATTGATGGG 25 Phosphatase; ACPP gene) probe 3 biotinylated CEA(Prostatic Acid CAGCAACAACTCCAAACCCGT 26 Phosphatase; ACPP gene) probe 4
[0604] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm detection results. As a result of analyzing DNA-based CEA expression (ΔOD) of each cancer cell line, in three repeated experiments, clear CEA DNA expression (ΔOD; cutoff OD>0.010) was observed only in fDNA of LoVo, MKN45, and SW1116 cancer cell lines. On the other hand, in three repeated experiments, CEA DNA expression was not observed in HCT8, HCT15, HeLa, and MDA-MB-231 cancer cell lines (
Example 2.2. Detection of PSA
[0605] PSA was detected using LNE and LNCaP cancer cell lines known as PSA positive cancer cell lines and PC3, DU145, and MCF7 cancer cell lines known as PSA negative cancer cell lines obtained from ATCC and Korean Cell Line Bank. In this case, the PSA positive cancer cell lines and PSA negative cancer cell lines were classified based on the mRNA level of PSA of each cancer cell line provided by CCLE (Cancer Cell Line Encyclopedia).
[0606] Specifically, genomic DNA was extracted from each of the PSA positive cancer cell line and PSA negative cancer cell line, followed by sonication to produce fDNA. 50 ng/μL fDNA was added to PBS, and then the nanowires prepared in Preparation Example 1 were added and reacted for 20 minutes to isolate them. Thereafter, a temperature denaturation process was undergone at a temperature of 95° C. for 1 minute, and then a biotinylated PSA probe was added and reacted further for 20 minutes. In this case, the probes used are shown in Table 13 below.
TABLE-US-00013 TABLE 13 Sequence Sequence(5′->3′) ID NO. biotinylated PSA CAGTCTGCGGCGGTGTTCTGG 27 (KLK3) probe 1 biotinylated PSA GCAAGTTCACCCTCAGAAGGT 28 (KLK3) probe 2 biotinylated PSA GAGGTCCAGGGTTGCTAGGAA 29 (KLK3) probe 3
[0607] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm detection results. As a result of analyzing DNA-based PSA expression (ΔOD) of each cancer cell line, in two repeated experiments, clear PSA DNA expression (ΔOD; cutoff OD>0.010) was observed only in fDNA of LNE and LNCaP cancer cell lines. On the other hand, in two repeated experiments, PSA DNA expression was not observed in PC3, DU145, and MCF7 cancer cell lines (
Example 2.3. Detection of CA19-9
[0608] CA19-9 was detected using Capan1, Capn2, and AsPC1 cancer cell lines known as CA19-9 positive cancer cell lines and MIA-PaCa2 and Panc1 cancer cell lines known as CA19-9 negative cancer cell lines obtained from ATCC and Korean Cell Line Bank. In this case, the CA19-9 positive cancer cell lines and CA19-9 negative cancer cell lines were classified based on the mRNA level of CA19-9 of each cancer cell line provided by CCLE (Cancer Cell Line Encyclopedia).
[0609] Specifically, genomic DNA was extracted from each of the CA19-9 positive cancer cell line and CA19-9 negative cancer cell line, followed by sonication to produce fDNA. 50 fDNA was added to PBS, and then the nanowires were added and reacted for 20 minutes to isolate them. Thereafter, a temperature denaturation process was undergone at a temperature of 95° C. for 1 minute, and then a biotinylated CA19-9 probe was added and reacted further for 20 minutes. In this case, the probes used are shown in Table 14 below.
TABLE-US-00014 TABLE 14 Sequence Sequence (5′->3′) ID NO. biotinylated CA19-9 GATCATCACGGCACGGTC 30 (FLU3 gene) probe 1 biotinylated CA19-9 GTGCAGAGAGATCATCAC 31 (FLU3 gene) probe 2 GGC biotinylated CA19-9 TCTCTCTTACCTGGGACC 32 (FLU3 gene) probe 3 TCA
[0610] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm detection results. As a result of analyzing DNA-based CA19-9 expression (ΔOD) of each cancer cell line, in two repeated experiments, clear CA19-9 DNA expression (ΔOD; cutoff OD>0.010) was observed only in fDNA of Capan1, Capn2, and AsPC1 cancer cell lines. On the other hand, in two repeated experiments, CA19-9 DNA expression was not observed in MIA-PaCa2 and Panc1 cancer cell lines (
Example 2.4. Detection of CA125
[0611] CA125 was detected using A549 cancer cell line known as a CA125 positive cancer cell line and A431 cancer cell line known as a CA125 negative cancer cell line obtained from ATCC and Korean Cell Line Bank. In this case, the CA125 positive cancer cell line and CA125 negative cancer cell line were classified based on the mRNA level of CA125 of each cancer cell line provided by CCLE (Cancer Cell Line Encyclopedia).
[0612] Specifically, genomic DNA was extracted from each of the CA125 positive cancer cell line and CA125 negative cancer cell line, followed by sonication to produce fDNA. 50 ng/4 fDNA was added to PBS, and then the nanowires were added and reacted for 20 minutes to isolate them. Thereafter, a temperature denaturation process was undergone at a temperature of 95° C. for 1 minute, and then a biotinylated CA125 probe was added and reacted further for 20 minutes. In this case, the probes used are shown in Table 15 below.
TABLE-US-00015 TABLE 15 Sequence Sequence (5′->3′) ID NO. biotinylated CA125 CTGGAACTGAT 33 (MUC16 gene) probe 1 TCTATCAACC biotinylated CA125 TGTGGCAGAAA 34 (MUC16 gene) probe 2 CCAGCTATCC biotinylated CA125 GAGGTCCTGAG 35 (MUC16 gene) probe 3 GATGTGTCAT
[0613] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm detection results. As a result of analyzing DNA-based CA125 expression (ΔOD) of each cancer cell line, in two repeated experiments, clear CA125 DNA expression (ΔOD; cutoff OD>0.010) was observed only in fDNA of A549 cancer cell line. On the other hand, in two repeated experiments, CA125 DNA expression was not observed in A431 cancer cell lines (
Example 2.5. Detection of AFP
[0614] AFP was detected using Huh7, HepG2, Hep3B, and PLC cancer cell lines known as AFP positive cancer cell lines and SNU475, SNU387, SNU423, SNU449, SK Hep1, and HeLa cancer cell lines known as AFP negative cancer cell lines obtained from ATCC and Korean Cell Line Bank. In this case, the AFP positive cancer cell lines and AFP negative cancer cell lines were classified based on the mRNA level of AFP of each cancer cell line provided by CCLE (Cancer Cell Line Encyclopedia).
[0615] Specifically, genomic DNA was extracted from each of the AFP positive cancer cell line and AFP negative cancer cell line, followed by sonication to produce fDNA. 50 ng/μL fDNA was added to PBS, and then the nanowires were added and reacted for 20 minutes to isolate them. Thereafter, a temperature denaturation process was undergone at a temperature of 95° C. for 1 minute, and then a biotinylated AFP probe was added and reacted further for 20 minutes. In this case, the probes used are shown in Table 16 below.
TABLE-US-00016 TABLE 16 Sequence Sequence (5′->3′) ID NO. biotinylated AFP probe 1 TGAGTCAGAAG 36 TTTACCAAAG biotinylated AFP probe 2 TGCAAACTGAC 37 CACGCTGGAA biotinylated AFP probe 3 CTTGAATGCCA 38 AGATAAAGGA
[0616] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm detection results. As a result of analyzing DNA-based AFP expression (ΔOD) of each cancer cell line, in two repeated experiments, clear AFP DNA expression (ΔOD; cutoff OD>0.010) was observed only in fDNA of Huh7, HepG2, Hep3B, and PLC cancer cell lines. On the other hand, in two repeated experiments, AFP DNA expression was not observed in SNU475, SNU387, SNU423, SNU449, SK Hep1, and HeLa cancer cell lines (
[0617] III. Confirmation of Detection of Biomarker Using Plasma or Urine of Cancer Patients
Example 3. Detection of Biomarker Derived from Cancer Patients
Example 3.1. Confirmation of Detection of Tumor Marker Using Plasma of Prostate Cancer Patients
[0618] PSA, PSMA, PAP, and PCA3 prostate cancer tumor markers were detected from the plasma obtained from normal persons or prostate cancer patients. As a prostate cancer marker, PSA, PSMA, PAP, and PAC3 are highly expressed in prostate cancer patients, and are currently used for determining prostate cancer by confirming the level of prostate cancer antigen (PSA, PSMA, PAP, and PAC3) through cancer tissue and blood tests.
[0619] Specifically, plasma was obtained from normal persons or prostate cancer patients, and then the nanowire was added and reacted for 20 minutes to isolate ctDNA (circulating tumor DNA). In this case, ctDNA was attached to the nanowire to form a complex. The experiments were performed i) when the complex of ctDNA and nanowire was used at a temperature of 27° C. without temperature denaturation, and ii) when the complex of ctDNA and nanowire was used after being subjected to a temperature denaturation process at a temperature of 95° C. for 1 minute, respectively. Thereafter, each biotinylated probe and HRP and streptavidin-labeled poly(pyrrole) nanoparticles (HRP/st-tagged NPs) were added and reacted further for 20 minutes. In this case, the probes used are shown in Table 17 below.
TABLE-US-00017 TABLE 17 Sequence Sequence(5′-> 3′) ID NO. biotinylated CAGTCTGCGGCGGTGTTCTGG 26 PSA(KLK3) probe 1 biotinylated GCAAGTTCACCCTCAGAAGGT 27 PSA(KLK3) probe 2 biotinylated GAGGTCCAGGGTTGCTAGGAA 28 PSA(KLK3) probe 3 biotinylated CATAGTGCTCCCTTTTGATTG 39 PSMA(FOLH1) probe 1 biotinylated AGTGGAAAGAATTTGGCCTGG 40 PSMA(FOLH1) probe 2 biotinylated ACCTAGAAGAACAATTTTGTT 41 PSMA(FOLH1) probe 3 biotinylated GCAGCATTATGAACTTGGAGA 42 PAP(Prostatic Acid Phosphatase; ACPP gene) probe 1 biotinylated TCGGAATGAGACGCAGCACGA 43 PAP(Prostatic Acid Phosphatase; ACPP gene) probe 2 biotinylated CTTAGTGTTTCAATGAACACC 44 PCA3(Prostate cancer antigen 3; PCA3 gene) probe 1 biotinylated GCTTAGCCTTGTACTGAGGCT 45 PCA3(Prostate cancer antigen 3; PCA3 gene) probe 2
[0620] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm expression of PSA, PSMA, PAP, and PAC3. As a result of analyzing PSA, PSMA, PAP, and PAC3 ctDNA expression (ΔOD), clear PSA, PSMA, PAP, and PAC3 ctDNA expression (ΔOD; cutoff OD>0.015) was observed in prostate cancer patients when temperature denaturation was not undergone or when temperature denaturation process was undergone. On the other hand, PSA, PSMA, PAP, and PAC3 ctDNA expression (ΔOD; cutoff OD>0.015) was not observed in normal persons both when temperature denaturation was not undergone and when temperature denaturation process was undergone (
Example 3.2. Confirmation of Detection of Tumor Marker Using Plasma of Lung Cancer Patients
[0621] NSE, SCC, CEA, Cyfra21-1, TPA lung cancer tumor markers were detected from the plasma obtained from normal persons or lung cancer patients. As a lung cancer marker, NSE, SCC, CEA, Cyfra21-1, TPA are highly expressed in lung cancer patients, and are currently used for determining lung cancer by confirming the level of lung cancer antigen (NSE, SCC, CEA, Cyfra21-1, TPA) through cancer tissue and blood tests.
[0622] Specifically, plasma was obtained from normal persons or lung cancer patients, and then the nanowire was added and reacted for 20 minutes to isolate ctDNA (circulating tumor DNA). In this case, ctDNA was attached to the nanowire to form a complex. The experiments were performed i) when the complex of ctDNA and nanowire was used at a temperature of 27° C. without temperature denaturation, and ii) when the complex of ctDNA and nanowire was used after being subjected to a temperature denaturation process at a temperature of 95° C. for 1 minute, respectively. Thereafter, each biotinylated probe and HRP and streptavidin-labeled poly(pyrrole) nanoparticles (HRP/st-tagged NPs) were added and reacted further for 20 minutes. In this case, the probes used are shown in Table 18 below.
TABLE-US-00018 TABLE 18 Sequence Sequence (5′->3′) ID NO. biotinylated CCATAGAGAAGATCTGGGCCC 46 NSE(Neuron- Specific Enolase; ENO2 gene) probe 1 biotinylated GATCCTCCCAGTGGGAGCTGA 47 NSE(Neuron- Specific Enolase; ENO2 gene) probe 2 biotinylated GGTCATGGTGAGTCATCGCTC 48 NSE(Neuron- Specific Enolase; ENO2 gene) probe 3 biotinylated GCTGGAGTGGCTGCATGACGA 49 SCC(Squamous Cell Carcinoma Antigen; SART3 gene) probe 1 biotinylated GCGCCCTGGTCGAGAACTGCC 50 SCC(Squamous Cell Carcinoma Antigen; SART3 gene) probe 2 biotinylated GTGGCTAGAGTATTACAACCT 51 SCC(Squamous Cell Carcinoma Antigen; SART3 gene) probe 3 biotinylated TCGAGAACAGCATCCCTGCAG 52 SCC(Squamous Cell Carcinoma Antigen; SART3 gene) probe 4 biotinylated AATCTGAACCTCTCCTGCCAC 23 CEA(Prostatic Acid Phosphatase; ACPP gene) probe 1 biotinylated ACCCTTCATCACCAGCAACAA 24 CEA(Prostatic Acid Phosphatase; ACPP gene) probe 2 biotinylated TATTCTTGGCTGATTGATGGG 25 CEA(Prostatic Acid Phosphatase; ACPP gene) probe 3 biotinylated CAGCAACAACTCCAAACCCGT 26 CEA(Prostatic Acid Phosphatase; ACPP gene) probe 4 biotinylated CTGGCCTCCTACCTGGACAA 53 Cyfra21-1 (cytokeratin 19-fragments; KRT19 gene) probe 1 biotinylated GACCTGGAGATGCAGATCGAA 54 Cyfra21-1 (cytokeratin 19-fragments; KRT19 gene) probe 2 biotinylated GTCGCTGGCCACACGGAGCAG 55 Cyfra21-1 (cytokeratin 19-fragments; KRT19 gene) probe 3 biotinylated GCTGTGAAGCAATCATGGATG 56 TPA(Tissue plasminogen activator; PLAT
[0623] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm expression of NSE, SCC, CEA, Cyfra21-1, TPA. As a result of analyzing ctDNA-based NSE, SCC, CEA, Cyfra21-1, TPA ctDNA expression (ΔOD), clear NSE, SCC, CEA, Cyfra21-1, TPA ctDNA expression (ΔOD; cutoff OD>0.010) was observed in two lung cancer patients when temperature denaturation was not undergone or when temperature denaturation process was undergone. On the other hand, NSE, SCC, CEA, Cyfra21-1, TPA ctDNA expression (ΔOD; cutoff OD>0.010) was not observed in normal persons both when temperature denaturation was not undergone and when temperature denaturation process was undergone (
Example 3.3. Confirmation of Detection of Tumor Marker Using Plasma of Thyroid Cancer Patients
[0624] CEA, NSE, TG, CALCA thyroid cancer tumor markers were detected from the plasma obtained from normal persons or thyroid cancer patients. As a thyroid cancer marker, CEA, NSE, TG, CALCA are highly expressed in thyroid cancer patients, and are currently used for determining thyroid cancer by confirming the level of thyroid cancer antigen (CEA, NSE, TG, CALCA) through cancer tissue and blood tests.
[0625] Specifically, plasma was obtained from normal persons or thyroid cancer patients, and then the nanowire was added and reacted for 20 minutes to isolate ctDNA (circulating tumor DNA). In this case, ctDNA was attached to the nanowire to form a complex. The experiments were performed i) when the complex of ctDNA and nanowire was used at a temperature of 27° C. without temperature denaturation, and ii) when the complex of ctDNA and nanowire was used after being subjected to a temperature denaturation process at a temperature of 95° C. for 1 minute, respectively. Thereafter, each biotinylated probe and HRP and streptavidin-labeled poly(pyrrole) nanoparticles (HRP/st-tagged NPs) were added and reacted further for 20 minutes. In this case, the probes used are shown in Table 19 below.
TABLE-US-00019 TABLE 19 Sequence Sequence (5′->3′) ID NO. biotinylated AATCTGAACCTCTCCTGCCAC 23 CEA(Prostatic Acid Phosphatase; ACPP gene) probe 1 biotinylated ACCCTTCATCACCAGCAACAA 24 CEA(Prostatic Acid Phosphatase; ACPP gene) probe 2 biotinylated TATTCTTGGCTGATTGATGGG 25 CEA(Prostatic Acid Phosphatase; ACPP gene) probe 3 biotinylated CAGCAACAACTCCAAACCCGT 26 CEA(Prostatic Acid Phosphatase; ACPP gene) probe 4 biotinylated CCATAGAGAAGATCTGGGCCC 46 NSE(Nenron- Specific Enolase; ENO2 gene) probe 1 biotinylated GATCCTCCCAGTGGGAGCTGA 47 NSE(Neuron- Specific Enolase; ENO2 gene) probe 2 biotinylated GGTCATGGTGAGTCATCGCTC 48 NSE(Neuron- Specific Enolase; ENO2 gene) probe 3 biotinylated CAACACCACAGACATGATGAT 59 Thyroglobulin (TG gene) probe 1 biotinylated TGCGGCCTGGCTCGAGCAGCA 60 Thyroglobulin (TG gene) probe 2 biotinylated AATCAATCACTATCCAGCCAG 61 Thyroglobulin (TG gene) probe 3 biotinylated ACTCTCTGGAGCACTCCACGG 62 Thyroglobulin (TG gene) probe 4 biotinylated GAGGTGTCATGGGCTTCCAAA 63 Calcitonin (Calcitonin Gene-Related
[0626] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm expression of CEA, NSE, TG, CALCA. As a result of analyzing ctDNA-based CEA, NSE, TG, CALCA ctDNA expression (ΔOD), clear CEA, NSE, TG, CALCA ctDNA expression (ΔOD; cutoff OD>0.010) was observed in thyroid cancer patients when temperature denaturation was not undergone or when temperature denaturation process was undergone. On the other hand, CEA, NSE, TG, CALCA ctDNA expression (ΔOD; cutoff OD>0.010) was not observed in normal persons both when temperature denaturation was not undergone and when temperature denaturation process was undergone (
Example 3.4. Confirmation of Detection of Tumor Marker Using Plasma of Bladder Cancer Patients
[0627] OGT, FGFR3, TP53, NMP22, Cyfra21-1 bladder cancer tumor markers were detected from the plasma obtained from normal persons or bladder cancer patients. As a bladder cancer marker, OGT, FGFR3, TP53, NMP22, Cyfra21-1 are highly expressed in the urine of bladder cancer patients, and can be used for determining bladder cancer.
[0628] Specifically, urine was obtained from normal persons or bladder cancer patients, and then the nanowire was added and reacted for 20 minutes to isolate ctDNA (circulating tumor DNA). In this case, ctDNA was attached to the nanowire to form a complex. The experiments were performed i) when the complex of ctDNA and nanowire was used at a temperature of 27° C. without temperature denaturation, and ii) when the complex of ctDNA and nanowire was used after being subjected to a temperature denaturation process at a temperature of 95° C. for 1 minute, respectively. Thereafter, each biotinylated probe and HRP and streptavidin-labeled poly(pyrrole) nanoparticles (HRP/st-tagged NPs) were added and reacted further for 20 minutes. In this case, the probes used are shown in Table 20 below.
TABLE-US-00020 TABLE 20 Sequence Sequence (5′-> 3′) ID NO. biotinylated ATGGCGTCTTCCGTGGGC 21 OGT(O-G1cNAc transferase) probe 1 biotinylated TGCCCTGTGGCCATGGAC 22 OGT(O-G1cNAc transferase) probe 2 biotinylated AGTGGCGGTGGTGGTGAGG 65 FGFR3 GAG probe 1 biotinylated CCCACAGCTTCTGCCCCCGA 66 FGFR3 probe 2 biotinylated GGGCATCCATGGGAGCC 67 FGFR3 probe 3 biotinylated CAGCGTGGGCCGAGGT 68 FGFR3 probe 4 biotinylated CCCTGAGATGCTGGGAGCAG 69 FGFR3 probe 5 biotinylated GTGTGGGAAGGCGGTGTTG 70 FGFR3 probe 6 biotinylated GCCCTGACTTTCAACTCTG 71 TP53 probe 1 biotinylated ACGACAGGGCTGGTTGCC 72 TP53 probe 2 biotinylated TCCCCAGGCCTCTGATTCC 73 TP53 probe 3 biotinylated CCTCCAGGTGAGCAGTAG 74 TP53 probe 4 biotinylated CTTGGGCCTGTGTTATCTC 75 TP53 probe 5 biotinylated CCCACCTCTTACCGATTT 76 TP53 probe 6 biotinylated ACAAGGGTGGTTGGGAGTAG 77 TP53 probe 7 biotinylated GGACAAGAAGCGGTGGAGG 78 TP53 probe 8 biotinylated CTGGCCTCCTACCTGGACAA 53 Cyfra21-1 (cytokeratin 19-fragments; KRT19 gene) probe 1 biotinylated GACCTGGAGATGCAGATCGAA 54 Cyfra21-1 (cytokeratin 19-fragments; KRT19 gene) probe 2 biotinylated GTCGCTGGCCACACGGAGCAG 55 Cyfra21-1 (cytokeratin 19-fragments; KRT19 gene) probe 3 biotinylated ATGGCACTGAAGAGGGACAGC 79 NMP22(nuclear matrix protein-22; NUMA1 gene) probe 1 biotinylated GCCAAGGAAGAGCTGGAGCAG 80 NMP22(nuclear matrix prolein-22; NUMA1 gene) probe 2 biotinylated GAGCAGCTAGAGGTATTTCAG 81 NMP22(nuclear matrix protein-22; NUMA1 gene) probe 3 biotinylated AGGTAGAATCCCTGGAGAGTC 82 NMP22(nuclear matrix protein-22; NUMA1 gene) probe 4
[0629] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm expression of OGT, FGFR3, TP53, NMP22, Cyfra21-1. As a result of analyzing ctDNA-based OGT, FGFR3, TP53, NMP22, Cyfra21-1 ctDNA expression (ΔOD), clear OGT, FGFR3, TP53, NMP22, Cyfra21-1 ctDNA expression (ΔOD; cutoff OD>0.010) was observed in bladder cancer patients when temperature denaturation was not undergone or when temperature denaturation process was undergone. On the other hand, OGT, FGFR3, TP53, NMP22, Cyfra21-1 ctDNA expression (ΔOD; cutoff OD>0.010) was not observed in normal persons and cystitis patients both when temperature denaturation was not undergone and when temperature denaturation process was undergone (
Example 3.5. Confirmation of Detection of Tumor Marker Using Plasma of Breast Cancer Patients
[0630] CA27-29, CA15-3, CEA breast cancer tumor markers were detected from the plasma obtained from normal persons or breast cancer patients. As a breast cancer marker, CA27-29, CA15-3, CEA are highly expressed in breast cancer patients, and are currently used for determining breast cancer by confirming the level of breast cancer antigen (CA27-29, CA15-3, CEA) through cancer tissue and blood tests.
[0631] Specifically, plasma was obtained from normal persons or breast cancer patients, and then the nanowire was added and reacted for 20 minutes to isolate ctDNA (circulating tumor DNA). In this case, ctDNA was attached to the nanowire to form a complex. The experiments were performed i) when the complex of ctDNA and nanowire was used at a temperature of 27° C. without temperature denaturation, and ii) when the complex of ctDNA and nanowire was used after being subjected to a temperature denaturation process at a temperature of 95° C. for 1 minute, respectively. Thereafter, each biotinylated probe and HRP and streptavidin-labeled poly(pyrrole) nanoparticles (HRP/st-tagged NPs) were added and reacted further for 20 minutes. In this case, the probes used are shown in Table 21 below.
TABLE-US-00021 TABLE 21 Sequence Sequence (5′-> 3′) ID NO. biotinylated GCGCCTGCCTGAATCTGTTCT 83 CA27.29/CA15-3 (Carcinonia Antigen 15-3; MUC1 gene) probe 1 biotinylated TTCTGGGCCTCTCCAATATTA 84 CA27.29/CA l5-3 (Carcinoma Antigen 15-3; MUC1 gene) probe 2 biotinylated GGATACCTACCATCCTATGAG 85 CA27.29/CA15-3 (Carcinoina Antigen 15-3; MUC1 gene) probe 3 biotinylated AATCTGAACCTCTCCTGCCAC 23 CEA (Prostatic Acid Phosphatase: ACPP gene) probe 1 biotinylated ACCCTTCATCACCAGCAACAA 24 CEA (Prostatic Acid Phosphatase; ACPP gene) probe 2 biotinylated TATTCTTGGCTGATTGATGGG 25 CEA (Prostatic Acid Phosphatase: ACPP gene) probe 3 biotinylated CAGCAACAACTCCAAACCCGT 26 CEA (Prostatic Acid Phosphatase: ACPP gene) probe 4
[0632] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm expression of CA27-29, CA15-3, CEA. As a result of analyzing ctDNA-based CA27-29, CA15-3, CEA ctDNA expression (ΔOD), clear CA27-29, CA15-3, CEA ctDNA expression (ΔOD; cutoff OD>0.010) was observed in breast cancer patients when temperature denaturation was not undergone or when temperature denaturation process was undergone. On the other hand, CA27-29, CA15-3, CEA ctDNA expression (ΔOD; cutoff OD>0.010) was not observed in normal persons both when temperature denaturation was not undergone and when temperature denaturation process was undergone (
Example 3.6. Confirmation of Detection of Tumor Marker Using Plasma of Colorectal Cancer Patients
[0633] CEA, CA19-9 colorectal cancer tumor markers were detected from the plasma obtained from normal persons or colorectal cancer patients. As a colorectal cancer marker, CEA, CA19-9 are highly expressed in colorectal cancer patients, and are currently used for determining colorectal cancer by confirming the level of colorectal cancer antigen (CEA, CA19-9) through cancer tissue and blood tests.
[0634] Specifically, plasma was obtained from normal persons or colorectal cancer patients, and then the nanowire was added and reacted for 20 minutes to isolate ctDNA (circulating tumor DNA). In this case, ctDNA was attached to the nanowire to form a complex. The experiments were performed i) when the complex of ctDNA and nanowire was used at a temperature of 27° C. without temperature denaturation, and ii) when the complex of ctDNA and nanowire was used after being subjected to a temperature denaturation process at a temperature of 95° C. for 1 minute, respectively. Thereafter, each biotinylated probe and HRP and streptavidin-labeled poly(pyrrole) nanoparticles (HRP/st-tagged NPs) were added and reacted further for 20 minutes. In this case, the probes used are shown in Table 22 below.
TABLE-US-00022 TABLE 22 Sequence Sequence (5′->3′) ID NO. biotinylated AATCTGAACCTCTCCTGCCAC 23 CEA (Prostatic Acid Phosphatase; ACPP gene) probe 1 biotinylated ACCCTTCATCACCAGCAACAA 24 CEA(Prostatic Acid Phosphatase; ACPP gene) probe 2 biotinylated TATTCTTGGCTGATTGATGGG 25 CEA (Prostatic Acid Phosphatase; ACPP gene) probe 3 biotinylated CAGCAACAACTCCAAACCCGT 26 CEA (Prostatic Acid Phosphatase; ACPP gene) probe 4 biotinylated GATCATCACGGCACGGTC 30 CA19-9(FLU3 gene) probe 1 biotinylated GTGCAGAGAGATCATCACGGC 31 CA19-9 (FLU3 gene) probe 2 biotinylated TCTCTCTTACCTGGGACCTCA 32 CA19-9 (FLU3 gene) probe 3
[0635] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm expression of CEA, CA19-9. As a result of analyzing ctDNA-based CEA, CA19-9 ctDNA expression (ΔOD), clear CEA, CA19-9 ctDNA expression (ΔOD; cutoff OD>0.010) was observed in colorectal cancer patients when temperature denaturation was not undergone or when temperature denaturation process was undergone. On the other hand, CEA, CA19-9 ctDNA expression (ΔOD; cutoff OD>0.010) was not observed in normal persons both when temperature denaturation was not undergone and when temperature denaturation process was undergone (
Example 3.7. Confirmation of Detection of Tumor Marker Using Plasma of Biliary Tract Cancer Patients
[0636] CEA, CA19-9, CA125 biliary tract cancer tumor markers were detected from the plasma obtained from normal persons or biliary tract cancer patients. As a biliary tract cancer marker, CEA, CA19-9, CA125 are highly expressed in biliary tract cancer patients, and are currently used for determining biliary tract cancer by confirming the level of biliary tract cancer antigen (CEA, CA19-9, CA125) through blood tests.
[0637] Specifically, plasma was obtained from normal persons or biliary tract cancer patients, and then the nanowire was added and reacted for 20 minutes to isolate ctDNA (circulating tumor DNA). In this case, ctDNA was attached to the nanowire to form a complex. The experiments were performed i) when the complex of ctDNA and nanowire was used at a temperature of 27° C. without temperature denaturation, and ii) when the complex of ctDNA and nanowire was used after being subjected to a temperature denaturation process at a temperature of 95° C. for 1 minute, respectively. Thereafter, each biotinylated probe and HRP and streptavidin-labeled poly(pyrrole) nanoparticles (HRP/st-tagged NPs) were added and reacted further for 20 minutes. In this case, the probes used are shown in Table 23 below.
TABLE-US-00023 TABLE 23 Sequence Sequence (5′->3′) ID NO. biotinylated AATCTGAACCTCTCCTGCCAC 23 CEA (Prostatic Acid Phosphatase; ACPP gene) probe 1 biotinylated ACCCTTCATCACCAGCAACAA 24 CEA (Prostatic Acid Phosphatase; ACPP gene) probe 2 biotinylated TATTCTTGGCTGATTGATGGG 25 CEA(Prostatic Acid Phosphatase; ACPP gene) probe 3 biotinylated CAGCAACAACTCCAAACCCGT 26 CEA(Prostatic Acid Phosphatase; ACPP gene) probe 4 biotinylated GATCATCACGGCACGGTC 30 CA19-9(FLU3 gene) probe 1 biotinylated GTGCAGAGAGATCATCACGGC 31 CA19-9(FLU3 gene) probe 2 biotinylated TCTCTCTTACCTGGGACCTCA 32 CA19-9(FLU3 gene) probe 3 biotinylated CTGGAACTGATTCTATCAACC 33 CA125(MUC16 gene) probe 1 biotinylated TGTGGCAGAAACCAGCTATCC 34 CA125(MUC16 gene) probe 2 biotinylated GAGGTCCTGAGGATGTGTCAT 35 CA125(MUC16 gene) probe 3
[0638] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm expression of CEA, CA19-9, CA125. As a result of analyzing ctDNA-based CEA, CA19-9, CA125 ctDNA expression (ΔOD), clear CEA, CA19-9, CA125 ctDNA expression (ΔOD; cutoff OD>0.010) was observed in biliary tract cancer patients when temperature denaturation was not undergone or when temperature denaturation process was undergone. On the other hand, CEA, CA19-9, CA125 ctDNA expression (ΔOD; cutoff OD>0.010) was not observed in normal persons both when temperature denaturation was not undergone and when temperature denaturation process was undergone (
Example 3.8. Confirmation of Detection of Tumor Marker Using Plasma of Gastric Cancer Patients
[0639] CEA, CA19-9, CGB, Cyfra21-1 gastric cancer tumor markers were detected from the plasma obtained from normal persons or gastric cancer patients. As a gastric cancer marker, CEA, CA19-9, CGB, Cyfra21-1 are highly expressed in gastric cancer patients, and are currently used for determining gastric cancer by confirming the level of gastric cancer antigen (CEA, CA19-9, CGB, Cyfra21-1) through blood tests.
[0640] Specifically, plasma was obtained from normal persons or gastric cancer patients, and then the nanowire was added and reacted for 20 minutes to isolate ctDNA (circulating tumor DNA). In this case, ctDNA was attached to the nanowire to form a complex. The experiments were performed i) when the complex of ctDNA and nanowire was used at a temperature of 27° C. without temperature denaturation, and ii) when the complex of ctDNA and nanowire was used after being subjected to a temperature denaturation process at a temperature of 95° C. for 1 minute, respectively. Thereafter, each biotinylated probe and HRP and streptavidin-labeled poly(pyrrole) nanoparticles (HRP/st-tagged NPs) were added and reacted further for 20 minutes. In this case, the probes used are shown in Table 24 below.
TABLE-US-00024 TABLE 24 Sequence Sequence (5′->3′) ID NO. biotinylated AATCTGAACCTCTCCTGCCAC 23 CEA (Prostatic Acid Phosphatase; ACPP gene) probe 1 biotinylated ACCCTTCATCACCAGCAACAA 24 CEA(Prostatic Acid Phosphatase; ACPP gene) robe 2 biotinylated TATTCTTGGCTGATTGATGGG 25 CEA (Prostatic Acid Phosphatase; ACPP gene) probe 3 biotinylated CAGCAACAACTCCAAACCCGT 26 CEA (Prostatic Acid Phosphatase; ACPP gene) robe 4 biotinylated GATCATCACGGCACGGTC 30 CA19-9 (FLU3 gene) probe 1 biotinylated GTGCAGAGAGATCATCACGGC 31 CA19-9 (FLU3 gene) probe 2 biotinylated TCTCTCTTACCTGGGACCTCA 32 CA19-9 (FLU3 gene) probe 3 biotinylated TGCTGAGCATGGGCGGGACAT 86 Beta-HCG (human chorionic gonadotropin; CGB gene) probe 1 biotinylated TGGCTCTCAGCTGTCAATGTG 87 Beta-HCG (human chorionic gonadotropin; CGB gene) probe 2 biotinylated CTGGCCTCCTACCTGGACAA 53 Cyfra21-1 (cytokeratin 19-fragments; KRT19 gene) probe 1 biotinylated GACCTGGAGATGCAGATCGAA 54 Cyfra21-1 (cytokeratin 19-fragments; KRT19 gene) probe 2 biotinylated GTCGCTGGCCACACGGAGCAG 55 Cyfra21-1 (cytokeratin 19-fragments; KRT19 gene) probe 3
[0641] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm expression of CEA, CA19-9, CGB, Cyfra21-1. As a result of analyzing ctDNA-based CEA, CA19-9, CGB, Cyfra21-1 ctDNA expression (ΔOD), clear CEA, CA19-9, CGB, Cyfra21-1 ctDNA expression (ΔOD; cutoff OD>0.010) was observed in gastric cancer patients when temperature denaturation was not undergone or when temperature denaturation process was undergone. On the other hand, CEA, CA19-9, CGB, Cyfra21-1 ctDNA expression (ΔOD; cutoff OD>0.010) was not observed in normal persons both when temperature denaturation was not undergone and when temperature denaturation process was undergone (
Example 3.9. Confirmation of Detection of Tumor Marker Using Plasma of Pancreatic Cancer Patients
[0642] CA19-9, CA125, CEA pancreatic cancer tumor markers were detected from the plasma obtained from normal persons or pancreatic cancer patients.
[0643] Specifically, plasma was obtained from normal persons or pancreatic cancer patients, and then the nanowire was added and reacted for 20 minutes to isolate ctDNA (circulating tumor DNA). In this case, ctDNA was attached to the nanowire to form a complex. The experiments were performed i) when the complex of ctDNA and nanowire was used at a temperature of 27° C. without temperature denaturation, and ii) when the complex of ctDNA and nanowire was used after being subjected to a temperature denaturation process at a temperature of 95° C. for 1 minute, respectively. Thereafter, each biotinylated probe and HRP and streptavidin-labeled poly(pyrrole) nanoparticles (HRP/st-tagged NPs) were added and reacted further for 20 minutes. In this case, the probes used are shown in Table 25 below.
TABLE-US-00025 TABLE 25 Sequence Sequence (5′->3′) ID NO. biotinylated AATCTGAACCTCTCCTGCCAC 23 CEA (Prostatic Acid Phosphatase; ACPP gene) probe 1 biotinylated ACCCTTCATCACCAGCAACAA 24 CEA (Prostatic Acid Phosphatase; ACPP gene) probe 2 biotinylated TATTCTTGGCTGATTGATGGG 25 CEA (Prostatic Acid Phosphatase; ACPP gene) probe 3 biotinylated CAGCAACAACTCCAAACCCGT 26 CEA (Prostatic Acid Phosphatase; ACPP gene) probe 4 biotinylated GATCATCACGGCACGGTC 30 CA19-9 (FLU3 gene) probe 1 biotinylated GTGCAGAGAGATCATCACGGC 31 CA19-9 (FLU3 gene) probe 2 biotinylated TCTCTCTTACCTGGGACCTCA 32 CA19-9 (FLU3 gene) probe 3
[0644] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm expression of CA19-9, CA125, CEA. As a result of analyzing ctDNA-based CA19-9, CA125, CEA ctDNA expression (ΔOD), clear CA19-9, CA125, CEA ctDNA expression (ΔOD; cutoff OD>0.010) was observed in pancreatic cancer patients when temperature denaturation was not undergone. On the other hand, CA19-9, CA125, CEA ctDNA expression (ΔOD; cutoff OD>0.010) was not observed in normal persons when temperature denaturation was not undergone (
[0645] IV. Evaluation of Tumor Marker Detection for Early Diagnosis and Prognosis Prediction of Cancer
Example 4. Detection of Biomarker Derived from Cancer Patients
Example 4.1. Detection of CPT1A Using Plasma or Urine of Cancer Patients
[0646] CPT1A (Carnitine palmitoyltransferase 1A) was detected from the plasma or urine obtained from normal persons or lung cancer patients. Also, CPT1A was detected from the urine obtained from bladder cancer patients. CPT1A can be used as a diagnostic target for cancer, since it is known that the expression of CPT1A in cancer tissue is significantly increased than in normal tissue.
[0647] Specifically, the plasma or urine was obtained, and then the nanowire was added and reacted for 20 minutes to isolate ctDNA (circulating tumor DNA). In this case, ctDNA was attached to the nanowire to form a complex. The experiments were performed i) when the complex of ctDNA and nanowire was used at a temperature of 27° C. without temperature denaturation, and ii) when the complex of ctDNA and nanowire was used after being subjected to a temperature denaturation process at a temperature of 95° C. for 1 minute, respectively. Thereafter, each biotinylated probe and HRP and streptavidin-labeled poly(pyrrole) nanoparticles (HRP/st-tagged NPs) were added and reacted further for 20 minutes. In this case, the probes used are shown in Table 26 below.
TABLE-US-00026 TABLE 26 Sequence Sequence (5′->3′) ID NO. biotinylated GAGCCATGAAGCTCTTAGACA 88 CPT1A probe 1 biotinylated CTTCCAGACATCGCTGCCTCG 89 CPT1A probe 2 biotinylated TGGACAATACCTCGGAGCCTC 90 CPT1A probe 3 biotinylated CATGACCCGGCTCTTCCGAGA 91 CPT1A probe 4
[0648] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm expression of CPT1A. As a result of analyzing ctDNA-based CPT1A ctDNA expression (ΔOD), clear CPT1A ctDNA expression (ΔOD; cutoff OD>0.010) was observed in lung or bladder cancer patients when temperature denaturation was not undergone or when temperature denaturation process was undergone. On the other hand, CPT1A ctDNA expression (ΔOD; cutoff OD>0.010) was not observed in normal persons both when temperature denaturation was not undergone and when temperature denaturation process was undergone (
Example 4.2. Confirmation of IFN-γ, IFN-γ Receptor, and PD-L1 Expression Using Cancer Cell Line
[0649] The accuracy for detection of IFN-γ, IFN-γ receptor, and PD-L1 was evaluated using MDA-MB-231, HCC827, H1975, PC9, and H460 cancer cell lines known as PD-L1 positive cancer cell lines and A549, MDA-MB-461, HeLa, and MCF7 cancer cell lines known as PD-L1 negative cancer cell lines obtained from ATCC and Korean Cell Line Bank. In this case, PD-L1 positive cancer cell lines and PD-L1 negative cancer cell lines were classified based on the mRNA level of PD-L1 of each cancer cell line provided by CCLE (Cancer Cell Line Encyclopedia). 1×10.sup.6 cells of the same cells were cultured in 100 mm dishes, and then 10 nmol INF-γ was added in one dish, and IFN-γ was not treated in the other dish, and they were cultured for one day, and then genomic DNA was extracted from the PD-L1 positive cancer cell line and the PD-L1 negative cancer cell line.
[0650] Thereafter, it was sonicated to produce fDNA of 200 bp or less. 50 ng/μL fDNA was added to PBS, and then the nanowires were added and reacted for 20 minutes to isolate them. Thereafter, a temperature denaturation process was undergone at a temperature of 95° C. for 1 minute, and then a biotinylated probe and streptavidin labeled poly(pyrrole) nanoparticles (HRP/st-tagged NPs) were added and reacted further for 20 minutes. In this case, the probes used are shown in Table 27 below.
TABLE-US-00027 TABLE 27 Sequence Sequence (5′->3′) ID NO. Biotinylated TGGGAGCCATCTTATTATGCC 1 PD-L1 probe 1 Biotinylated CGGAAGATGAATGTCAGTGC 2 PD-L1 probe 2 Biotinylated CCTACTGGCATTTGCTGAACG 3 PD-L1 probe 3 Biotinylated ACCATAGCTGATCATGCAGCG 4 PD-L1 probe 4 Biotinylated ATCGTATATTGGGAGTACCAG 92 IFN-γ probe 1 Biotinylated TAAATGGAGACGAGCAGGAAG 93 IFN-γ probe 2 Biotinylated TAGTGCTTAGCCTGGTATTCA 94 IFN-γ probe 3 Biotinylated GTACCGCATGAGCCCCAGCAA 95 PD1 probe 1 Biotinylated GTTCCAAACCCTGGTGGTTGG 96 PD1 probe 2 Biotinylated GAGCAGACGGAGTATGCCAC 97 PD1 probe 3 Biotinylated ATCGTATATTGGGAGTACCAG 98 IFN-γ receptor probe 1 Biotinylated TAAATGGAGACGAGCAGGAAG 99 IFN-γ receptor probe 2 Biotinylated TAGTGCTTAGCCTGGTATTCA 100 IFN-γ receptor probe 3
[0651] For colorimetric detection, it was treated with the solution in which TMB and H.sub.2O.sub.2 were added to a sodium acetate buffer to confirm the results of IFN-γ, IFN-γ receptor, and PD-L1 detection. First, when IFN-γ was not added, as a result of analyzing the DNA-based PD-L1 expression (ΔOD) of cancer cell lines, clear PD-L1 DNA expression (cutoff: OD>0.6) in fDNA was observed only in MDA-MB-231, HCC827, H1975, PC9, and H460 cancer cell lines in all three experiments. On the other hand, the PD L1 DNA expression was not observed in A549, MDA-MB-461, HeLa, and MCF7 cancer cell lines in all three experiments (
[0652] Furthermore, when IFN-γ was not added and when IFN-γ was added, in a graph of analyzing PD-L1, IFN-γ, and IFN-γ receptor through fDNA of PD-L1 positive cancer cell lines of MDA-MB-231, HCC827, H1975, PC9, and H460 and PD-L1 negative cancer cell lines of A549, MDA-MB-461, HeLa, and MCF7 in three repeated experiments, high PD-L1 expression was confirmed in PD-L1 negative cancer cell lines when IFN-γ was added, whereas IFN-γ was not confirmed regardless of whether IFN-γ was added or not, and IFN-γ receptor was confirmed in all cell lines (
[0653]
[0654] V. Confirmation of Possibility of Detecting Cancer-Related cfDNA According to Obtaining Method
Example 5. Confirmation of Biomarker Detection According to Method for Collecting Sample
[0655] The cfDNA was detected in lung cancer patients and normal persons in the same manner as described above. However, in the collection method, it was collected from venous blood using an injection needle and it was collected from capillary blood using a lancet. The nanowires and probes used were those prepared according to Preparation Example 1 and Preparation Example 3. A level of DNA expression of a cancer-related biomarker such as AKL Fusion and PIK3CA from the blood obtained from lung cancer patients using an injection needle was shown (
[0656] VI. Confirmation of Possibility of Detecting Lung Cancer-Related cfDNA
Example 6. Confirmation of Detection of Mutation Biomarker in Lung Cancer Cell Line
[0657] The presence or absence of a mutation (snp) occurring in a cancer-specific gene provides useful information to confirm whether there is resistance to a specific treatment method or whether it has resistance to a specific treatment method, and thus to find an appropriate treatment method.
[0658] In order to confirm that a mutation of the lung cancer cell line was also detectable, the EML4-ALK gene was analyzed. First, in order to confirm the expression level, the expression level of the EML4-ALK gene was confirmed by RT-PCR. A level of EML4-ALK expression from cfDNA of EML4-ALK variant 3a/b positive cell (H2228) and EML4-ALK negative cell (A549, H1993, PC9, RT4) cancer cell lines was confirmed through RT-PCR (
[0659] Thereafter, EML4-ALK was detected by a method using fDNA described herein. The detection method was performed in the same manner as described above. As a result, it was confirmed that EML4-ALK can be also detected using the fDNA detection method. A measured level of DNA expression of EML4-ALK fusion var.1 or EML4-ALK fusion var.3 from cfDNA of EML4-ALK variant 3a/b positive cell (H2228) and EML4-ALK negative cell (A549, H1993, PC9, RT4) cancer cell lines was shown (
TABLE-US-00028 TABLE 28 EGFR Probe sequences KRAS exon2- CP1: AAATGACTGAATATAAACTTG probe (Sequence ID NO. 127) DP: GAGTGCCTTGACGATACAGCT (Sequence ID NO. 128) ALK-EML4 CP2: TAGAGCCCACACCTGGGAAA variant 1- (Sequence ID NO. 129) probe DP: CGGAGCTTGCTCAGCTTGTA (Sequence ID NO. 130) ALK-EML4 CP3: GCATAAAGATGTCATCATCAACCAAG variant 3- (Sequence ID NO. 131) probe DP: CGGAGCTTGCTCAGCTTGTA (Sequence ID NO. 132)
Example 7. Confirmation of Detection of Mutation Biomarker in Lung Cancer Patients: Drug Resistance
[0660] Various mutations were detected in lung cancer patients in the same manner as described above. In this case, as a probe for detecting cfDNA of lung cancer patients, a nucleic acid sequence complementarily binding to the lung cancer biomarker gene described above was used. Patient information and analysis genes are as described in the figures.
[0661] Specifically, a level of DNA expression of a cancer-related biomarker such as EML4-ALK fusion var.3, KRAS, SYP, NCAM1, and NKX2-1 from the blood obtained from small cell lung cancer patients was measured (
[0662] In addition, a level of DNA expression of a cancer-related biomarker such as EML4-ALK fusion var.1 from the blood obtained from cancer patients was measured (
[0663] In addition, a level of DNA expression of a cancer-related biomarker such as EML4-ALK fusion var.3 from the blood obtained from cancer patients was measured (
[0664] In addition, a level of DNA expression of a cancer-related biomarker such as EML4-ALK fusion var.3, BRAFV800E, and TP53 from the blood obtained from cancer patients was measured (
[0665] In addition, a level of DNA expression of a cancer-related biomarker such as EML4-ALK fusion var.1 from the blood obtained from cancer patients was measured (
[0666] In addition, a level of DNA expression of a cancer-related biomarker such as EML4-ALK fusion var.1 from the blood obtained from cancer patients was measured (
[0667] VII. Confirmation of Possibility of Diagnosing Bladder Cancer through OGT Detection
Example 8. Confirmation of Expression Level of OGT Derived from Cancer Cell Line and fDNA Detection Possibility
[0668] In order to confirm the expression level of OGT in the cancer cell line and the possibility of detection in patient's plasma, experiment was conducted using an in vitro experiment and a patient's blood sample in the same manner as described above.
Example 9. Confirmation of Detection of OGT-Derived cfDNA
[0669] The possibility of diagnosis of bladder cancer patients was confirmed using the detection method of the present invention in the same manner as described above. The results are shown in
[0670] VIII. Confirmation of Possibility of Diagnosis of Various Cancer
Example 10. Confirmation of Possibility of Diagnosis of Thyroid Cancer
[0671] Using the same method as described above, the patient's cfDNA was detected to confirm whether it is possible to diagnose thyroid cancer.
Example 11. Confirmation of Possibility of Diagnosis of Small Cell Lung Cancer (SCLC)
[0672] Using the same method as described above, cancer-related biomarkers such as SYP, CgA, NCAM1, and NKX2-1 were analyzed using blood obtained from small cell lung cancer patients (
Example 12. Confirmation of Possibility of Diagnosis of Non Small Cell Lung Cancer (NSCLC)
[0673] Using the same method as described above, biomarkers such as SYP, CgA, NCAM1, and NKX2-1 were analyzed using blood obtained from non-small cell lung cancer patients (
Example 13. Comparison of Biomarker Detection Before and After Anti-cancer Treatment
[0674] Using the same method as described above, it is a result showing a level of DNA expression of CEA using the blood obtained from lung cancer patients before and after anti-cancer treatment, and the prognosis of patients (
Example 14. Confirmation of Possibility of Diagnosis of Lung Cancer
[0675] Using the same method as described above, cancer-related biomarkers such as NSE and CEA were analyzed using blood obtained from lung cancer patients (
Example 15. Confirmation of Possibility of Diagnosis of Prostate Cancer
[0676] Using the same method as described above, a cancer-related biomarker such as PSA, PSMA, PAP, and PCA3 was analyzed using the blood obtained from prostate cancer patients (
Example 16. Confirmation of Possibility of Diagnosis of Thyroid Cancer
[0677] Using the same method as described above, a cancer-related biomarker such as CEA, NSE, TG (Thyroglobulin), and CALCA was analyzed using the blood obtained from thyroid cancer patients (
Example 17. Confirmation of Possibility of Diagnosis of Bladder Cancer
[0678] Using the same method as described above, the DNA expression level of OGT, FGFR3, TP53, NMP22, and Cyfra21-1 was analyzed using the urine obtained from bladder cancer patients, hematuria patients, and normal persons (
Example 18. Confirmation of Possibility of Diagnosis of Breast Cancer
[0679] Using the same method as described above, the DNA expression level of CA27-29 and CEA was analyzed using the blood obtained from breast cancer patients and normal persons (
Example 19. Confirmation of Possibility of Diagnosis of Colorectal Cancer
[0680] Using the same method as described above, the DNA expression level of CEA and CA19-9 was analyzed using the blood obtained from colorectal cancer patients and normal persons (
Example 20. Confirmation of Possibility of Diagnosis of Biliary Tract Cancer
[0681] Using the same method as described above, the DNA expression level of CA19-9, CEA, and CA123 was analyzed using the blood obtained from biliary tract cancer patients and normal persons (
Example 21. Confirmation of Possibility of Diagnosis of Gastric Cancer
[0682] Using the same method as described above, the DNA expression level of CEA, CA19-9, CGB, and Cyfra21-1 was analyzed using the blood obtained from gastric cancer patients and normal persons (
Example 22. Confirmation of Possibility of Diagnosis of Ovarian Cancer
[0683] Using the same method as described above, the DNA expression level of CA125 and CEA was analyzed using the blood obtained from ovarian cancer patients and normal persons (
Example 23. Confirmation of Possibility of Diagnosis of Pancreatic Cancer
[0684] Using the same method as described above, the DNA expression level of CEA, CA19-9, and CA125 was analyzed using the blood obtained from pancreatic cancer patients (
Example 24. Confirmation of Accuracy for Detection Method Using cfDNA Through Detection of Various Cancer Biomarkers in Sample of Normal Persons
[0685] Using the same method as described above, by measuring a level of DNA expression of a cancer-related biomarker using the blood obtained from normal persons, it was confirmed that a cancer-related biomarker was not detected in normal persons (
Example 25. Confirmation of Possibility of Diagnosis of Cervical Cancer
[0686] Using the same method as described above, the presence or absence of the binding of cfDNA present in the urine of HPV positive cervical cancer patients (HPV16 (+) and HPV18 (+)) and a HPV negative healthy control (HPV−) with a probe specific to HPV 18 or HPV 16 was confirmed through the absorbance (
Example 26. Confirmation of Possibility of Diagnosis of Lung Cancer
[0687] Using the same method as described above, a lung cancer biomarker was detected using the blood obtained from lung cancer patients.
[0688] In addition, cfDNA was obtained from the plasma of lung cancer patients with EGFR exon19 deletion, and then it was mixed with a probe specific to EGFR exon19 Del, and then the specificity and sensitivity of gene mutations were analyzed (
[0689] In addition, the sequences of CP and DP of EGFR exon 19 deletion are shown (
[0690] In addition, the sequences of CP and DP of EGFR exon 20 T790M are shown. In this study, CP2 and DP were used to analyze the cfDNA gene mutation of lung cancer patients (
[0691] In addition, the sequences of CP and DP of EGFR exon 21 L858R are shown. In this study, CP2 and DP were used to analyze the cfDNA gene mutation of lung cancer patients (
[0692] In addition, whether cfDNA was detected by the color change and UV absorbance was confirmed by reacting cfDNA obtained from the plasma of lung cancer patients with EGFR exon 19 deletion and EGFR exon 20 T790M gene mutations and a probe specific to EGFR exon 19 deletion (Del19), EGFR exon 20 T790M, and EGFR exon 21 L858R, and then adding HRP/streptavidin nanoparticles (including a large amount of HRP) (
[0693] In addition,
[0694] In addition,
[0695] In addition,
[0696] In addition,
[0697] In addition,
[0698] IX. Detection of cfDNA Derived from Cancer According to Sample Denaturation Condition
Example 27. Detection of cfDNA After Denaturation of Sample Obtained from Cancer Patients According to Temperature Condition
[0699] The Experiment was performed to confirm whether the cfDNA derived from cancer and the cfDNA derived from normal persons could be distinguished according to the sample denaturation conditions. Specifically, using a probe capable of detecting EGFR 19 deletion, it was confirmed that whether the unstable cfDNA and the stable cfDNA could be distinguished after applying various denaturation conditions to the plasma collected from normal persons and lung cancer patients (0208-343, 20190311_LC #1, Tissue result: E19del).
[0700] As a probe, ggaattaaga gaagcaacat ctcc (SEQ ID NO 105), a probe capable of detecting EGFR exon 19, deletion, was used. In this case, the probe to which biotin is bound was used. The PEI/Ppy nanowires were used, and the HRP/streptavidin-aggregated nanoparticles were used as markers.
[0701] Specifically, before cfDNA was isolated with the nanowires, the sample was treated under various conditions as follows. The sample was heated at 30° C. for 15 minutes and 0 minute. In addition, it was heated at 60° C. for 5 minutes and 0 minute. In addition, it was heated at 95° C. for 1 minute and 0 minute. The other steps were performed by the method described above.
[0702] As a result, the unstable cfDNA was not detected under any denaturation condition in normal person without EGFR 19 deletion mutation (
Example 28. Detection of cfDNA Derived From Cancer Cell Line According to Temperature Condition
[0703] In addition to the samples obtained from the human body, the experiment was performed to confirm the locations of mutations present in the cell line. Specifically, fDNA having a size similar to cfDNA was obtained from HCC2279 (Exon19Del), HCC827 (Exon19Del), H1975 (T790M, L858R), and A549 (EGFR wildtype).
[0704] As a result, it was confirmed that in a denaturation condition of heating at 95° C. for 1 minute and 0 minute, only unstable cfDNA was detected by complementarily binding to the probe and binding to the marker (
Example 29. Detection of cfDNA Derived from Cancer According to DNase Treatment
[0705] In order to confirm whether the unstable cfDNA derived from cancer cells and the stable cfDNA have a difference not only by the temperature conditions but also by DNase, the reactivity with the probe was confirmed after the unstable cfDNA and the stable cfDNA were treated with DNase. In this case, the sample was not subjected to the denaturation using high temperature.
[0706] Specifically, fDNA obtained from HCC2279 (Exon19Del), HCC827 (Exon19Del), H1975 (T790M, L858R), and A549 (EGFR wildtype) using PEI/Ppy nanowires was suspended in PBS and then treated with 1 μL of DNase. As a result of treating at 37° C. for 60 minutes, it was confirmed that there was the difference between the unstable cfDNA and the stable cfDNA in terms of the reactivity with the probe (
[0707] However, as a result of treating with 1 μL or 2 μL of DNase at 37° C. for 120 minutes, it was confirmed that the stable cfDNA also reacted with the probe when the treatment time was increased or the amount of DNase was increased (
[0708] In addition, in order to confirm the difference between the unstable cfDNA and the stable cfDNA according to the activity of DNase, the results of treating with 1 μL or 2 μL of DNase at 24° C. for 120 minutes are shown in
[0709] In addition, in order to confirm the difference between the unstable cfDNA and the stable cfDNA according to the activity of DNase, the results of treating with 1 μL or 2 μL of DNase at 3° C. for 120 minutes are shown in