Transgenic microalgae and use thereof for oral delivery of proteins
11344590 · 2022-05-31
Assignee
Inventors
- Shiri Moshitzky (Tel Aviv, IL)
- Doron Eisenstadt (Kfar Saba, IL)
- Guy Levi (Jerusalem, IL)
- Ofra Chen (Rehovot, IL)
Cpc classification
A23K50/80
HUMAN NECESSITIES
A23K10/16
HUMAN NECESSITIES
C07K2319/06
CHEMISTRY; METALLURGY
C07K2319/04
CHEMISTRY; METALLURGY
International classification
A23K50/80
HUMAN NECESSITIES
A23K10/16
HUMAN NECESSITIES
Abstract
Transgenic microalgae expressing at least one exogenous biologically active protein. The protein-expressing microalgae are used for the oral delivery of the biologically active protein to the target organism in its intact and functional form. The exogenous protein, expressed in algae, is characterized by being biologically active, exerting at least one specific activity having a beneficial effect on the subject consuming the algae. The transgenic microalgae are used as animal food for aquatic or land animals welfare or as food supplement for human healthcare.
Claims
1. A method for oral delivery of a biologically active exogenous protein to a subject, the method comprising orally administering to the subject an effective amount of an edible transgenic Phaeodactylum tricornutum microalga or a composition comprising same, wherein the subject is selected from an aquatic animal and a land farm animal, and wherein the transgenic P. tricornutum microalga comprises: an expression cassette comprising at least one transcribable polynucleotide encoding the biologically active exogenous protein operatively linked to a vacuole targeting peptide having the amino acid sequence of SEQ ID NO:4, wherein the polynucleotide is operably linked to an expression control sequences; and wherein the expressed biologically active exogenous protein is targeted to the microalga cell vacuole.
2. The method of claim 1, wherein the vacuole targeting peptide is encoded by a polynucleotide comprising the nucleic acid sequence set forth in SEQ ID NO:18.
3. The method of claim 2, wherein the exogenous protein affects at least one of growth, development, and survival of the subject.
4. The method of claim 1, wherein the expression cassette further comprises a polynucleotide encoding a cell penetrating peptide (CPP) that mediates the uptake of the expressed exogenous protein by a cell or a tissue of the subject, operably linked to the polynucleotide encoding said exogenous protein.
5. The method of claim 1, wherein the biologically active exogenous protein has a molecular weight of up to 150 kDa.
6. The method of claim 1, wherein the exogenous biologically active protein has a therapeutic effect on the subject.
7. The method of claim 1, wherein the exogenous biologically active protein enhances at least one of: the growth, the survival, and the reproduction rate of the subject.
8. The method of claim 1, wherein the exogenous biologically active protein is a hormone.
9. The method of claim 8, wherein the hormone is selected from the group consisting of a growth hormone, an appetite inducing hormone and a spawning hormone.
10. The method of claim 9, wherein the hormone is Salmon growth hormone having the amino acid sequence set forth in SEQ ID NO:12.
11. The method of claim 9, wherein the hormone is a spawning hormone having the amino acid sequence set forth in SEQ ID NO:24.
12. The method of claim 9, wherein the hormone is appetite inducing hormone having the amino acid sequence set forth in SEQ ID NO:20.
13. The method of claim 1, wherein the aquatic animal is selected from the group consisting of fish, crustaceans, mollusks and corals.
14. The method of claim 13, wherein the aquatic animal is a fish.
15. The method of claim 1, wherein the land farm animal is selected from the group consisting of poultry, pig, cow and rabbit.
16. The method of claim 15, wherein the land farm animal is poultry.
17. The method of claim 15, wherein the land farm animal is a pig.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
DETAILED DESCRIPTION OF THE INVENTION
(20) The present invention provides compositions and methods for oral delivery of biologically active proteins to an organism in need of such proteins. Particularly, the present invention provides microalgae expressing the biologically active protein and edible compositions comprising same. The present invention demonstrates that the biological activity of the protein is maintained within the consumed algae and furthermore, that the protein exerts its biological activity in cells or tissues of the organism consuming the transgenic microalgae.
Definitions
(21) The terms “microalga” or “microalgae” is used herein in its broadest scope and refer to unicellular microscopic eukaryotic algae, typically found in freshwater and marine systems. Depending on the species, the microalgae size can range from a few micrometers (μm) to a few hundreds of micrometers. According to certain currently specific embodiments, the term refers to marine eukaryotic microalga or microalgae.
(22) The term “gene” refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises coding sequences necessary for the production of RNA or a polypeptide. A polypeptide can be encoded by a full-length coding sequence or by any part thereof. The term “parts thereof” when used in reference to a gene refers to fragments of that gene. The fragments may range in size from a few nucleotides to the entire gene sequence minus one nucleotide. Thus, “a nucleic acid sequence comprising at least a part of a gene” may comprise fragments of the gene or the entire gene.
(23) The term “gene” optionally also encompasses the coding regions of a structural gene and includes sequences located adjacent to the coding region on both the 5′ and 3′ ends for a distance of about 1 kb on either end such that the gene corresponds to the length of the full-length mRNA. The sequences which are located 5′ of the coding region and which are present on the mRNA are referred to as 5′ non-translated sequences. The sequences which are located 3′ or downstream of the coding region and which are present on the mRNA are referred to as 3′ non-translated sequences.
(24) The terms “protein”, “protein sequence” and amino acid sequence” are used interchangeably throughout the specification to designate a linear series of amino acid residues connected one to the other by peptide bonds. The term also encompasses peptides.
(25) The terms “polynucleotide”, “polynucleotide sequence” and “nucleic acid sequence” are used interchangeably herein. These terms encompass nucleotide sequences and the like. A polynucleotide may be a polymer of RNA or DNA or hybrid thereof, that is single- or double-stranded, linear or branched, and that optionally contains synthetic, non-natural or altered nucleotide bases. The terms also encompass RNA/DNA hybrids. According to certain currently exemplary embodiments, the polynucleotides of the present invention are designed based on the amino acid sequence of the protein of interest employing a codon usage of the particular microalga species to be transformed.
(26) The terms “expression cassette” and “construct” or “DNA construct” are used herein interchangeably and refer to an artificially assembled or isolated nucleic acid molecule which includes the polynucleotide encoding the protein of interest. The construct may further include a marker gene which in some cases can also encode a protein of interest. The expression cassette further comprising appropriate regulatory sequences operably linked to the polynucleotide encoding the protein of interest. It should be appreciated that the inclusion of regulatory sequences in a construct is optional, for example, such sequences may not be required in situations where the regulatory sequences of a host cell are to be used.
(27) According to certain embodiments, the organism comprises an expression cassette comprising operably linked a promoter sequence, a polynucleotide encoding the protein of interest and a termination sequence.
(28) The term “operably linked” refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is regulated by the other. For example, a promoter is operably linked with a coding sequence when it is capable of regulating the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in a sense or antisense orientation.
(29) The terms “promoter element,” “promoter,” or “promoter sequence” as used herein, refer to a DNA sequence that is located upstream to the 5′ end (i.e. proceeds) the protein coding region of a DNA polymer. The location of most promoters known in nature precedes the transcribed region. The promoter functions as a switch, activating the expression of a gene or part thereof. If the gene is activated, it is said to be transcribed, or participating in transcription. Transcription involves the synthesis of mRNA from the gene. The promoter, therefore, serves as a transcriptional regulatory element and also provides a site for initiation of transcription of the gene into mRNA. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene or part thereof in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of some variation may have identical promoter activity. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”.
(30) According to the teachings of the present invention, the promoter can be the organism's native promoter or a heterologous promoter, which may be a constitutive promoter, an induced promoter or a tissue specific promoter.
(31) Any promoter known in the art to be active in microalgae can be used according to the teachings of the present invention. Non-limiting examples are fucoxanthin chlorophyll protein A (fcpA); B (fcpB); C (fcpC) and E (fcpE) promoters as well as any light harvesting complex (Lhc) promoter. Non-light harvesting related promoters can also be used, including, but not limited to, the nopaline synthase promoter; poly-adenylation sequences from the Ti plasmid of Agrobacterium tumefaciens; the promoter region of the tubB2; the PL promoter from bacteriophage λ; the CaMV 35S promoter; the bacterial tφ promoter; the heat shock protein 70A promoter (HSP70A); and a promoter of Rubisco small subunit 2 (RBCS2).
(32) As used herein, the term “food” refers to food for human or animal consumption, including land and aquatic animal.
(33) The term “aquaculture” as used herein refers to aquatic organism cultivated under controlled conditions. An “aquatic organism” is an organism grown in water, either fresh- or saltwater. Aquatic organisms, include, but are not limited to, fish, e.g., bass, striped bass, tilapia, catfish, sea bream, rainbow trout, zebra fish, red drum, goldfish, Koi fish, Angel fish and carp; crustaceans, e.g., penaeid shrimp, brine shrimp, freshwater and saltwater shrimp, and Artemia; and rotifers.
Specific Embodiments for Carrying Out the Invention
(34) The teachings of the present invention are illustrated below with regard to animals, particularly animals grown in aquaculture and model land animals as non-limiting examples for implementation of at least some aspects of the present invention.
(35) Currently available aquaculture systems are generally classified as open or closed. Open systems are typically created by building a net-pen in a body of water, such as a lake or stream. Closed systems generally recirculate the water in a closed tank, the water being pumped from the tank through a treatment cycle and back into the tank.
(36) Aquaculture systems are used to grow aquatic animals such as fish, crustaceans and mollusks, to a size where they are marketable for different uses, primarily as food products but also as ornamentals. According to at least some embodiments the present invention provides improved food for fish or other aquatic animal. Suitable food forms an important aspect of aquaculture systems; the teachings of the present invention provide means and methods for producing food with enhanced outcome including improved growth (including enhancing the length and/or weight gain), improved growth pattern (particularly reducing or eliminating body deformation), shortening the time to sexual maturation or another life cycle stage, improved overall health (including increasing the survival rate) or combinations thereof.
(37) Oral administration of an edible composition comprising a biologically active protein is of significant economical value in aquaculture as well as in agriculture, eliminating the need to administer the composition to each animal individually.
(38) Therapeutic edible compositions are also highly desired for humans, as their administration does not require professional manpower (required for administration of a therapeutic compound e.g. intravenously) and are easy to consume thus enhancing the compliance of the patients in taking the prescribed dose.
(39) According to one aspect, the present invention provides a transgenic eukaryotic microalga comprising an expression cassette comprising at least one transcribable polynucleotide encoding a biologically active exogenous protein, wherein the biologically active exogenous protein is expressed within a subcellular compartment of the microalga cell.
(40) Various algae species can be used according to the teachings of the present invention. According to certain embodiments, the alga is marine microalga. An exemplary list of marine microalga that can be used according to the teachings of the present invention includes, but is not limited to, Phaeodactylum tricornutum; Dunaliella spp.; Nannochloropsis spp. including Nannochloropsis oculata, Nannochloropsis salina, Nannochloropsis gaditana; Nannochloris spp., Tetraselmis spp. including Tetraselmis suecica, Tetraselmis chuii; Isochrysis galbana; Pavlova spp.; Amphiprora hyaline; Chaetoceros muelleri; and Neochloris oleoabundans. The algae come from and represent a large taxonomical cross section of species (Table 1).
(41) TABLE-US-00001 TABLE 1 Phylogeny of some of the eukaryotic algae Genus Family Order Phylum Kingdom Phaeodactylum Phaeodactylaceae Naviculales Bacillariophyta Chromalveolata Dunaliella Dunaliellaceae Chlamydomonadales Chlorophyta Viridaeplantae Nannochloris Coccomyxaceae Chlorococcales Chlorophyta Viridaeplantae Tetraselmis Chlorodendraceae Chlorodendrales Chlorophyta Viridaeplantae Nannochloropsis Monodopsidaceae Eustigmatales Heterokontophyta Chromobiota Pavlova Pavlovaceae Pavlovales Haptophyta Chromobiota Isochrysis Isochrysidaceae Isochrysidales Haptophyta Chromobiota
(42) Phylogeny according to Guiry, M D and Guiry G M. 2013. AlgaeBase. World-wide electronic publication, National University of Ireland, Galway.
(43) According to certain specific embodiments, the transgenic microalga used according to the teachings of the present invention is Phaeodactylum tricornutum. The alga Phaeodactylum tricornutum is a diatomaceous unicellular alga that forms part of phytoplankton and originates from temperate climes. This alga is readily amenable to transformation and the transformed alga growth well in aquaculture. In addition, this alga is nontoxic and nonpathogenic, and can be used as a food source for animals, especially fish and marine invertebrates but also for land animals.
(44) The primary use of the transgenic microalgae of the present invention is as an edible composition. The exogenous protein expressed in the algal cell should reach the target cell or tissue of the subject consuming the composition in its active form, wherein the subject is aquatic or land animal, including humans. One of the principal obstacles in oral delivery of a biologically active protein is the susceptibility of the protein to the environmental conditions throughout the process of preparing the oral delivery product and its storage and thereafter within the body of the target subject in the gastrointestinal tract.
(45) The present invention now shows that the exogenous protein expressed within a subcellular compartment of the microalga preserves its activity when consumed by aquatic as well as by terrestrial animals. Without wishing to be bound by any specific theory or mechanism of action, the protein activity may be preserved by the intact alga cell, particularly by the cell walls, which may act as a form of encapsulation that protect the protein from the outside harsh environment throughout the growth and processing of the algal biomass and furthermore from the environment of the gastrointestinal tract of the subject animal consuming the algae.
(46) According to certain embodiments, the subcellular compartment is selected from the group consisting of vacuole, endoplasmic reticulum, Golgi system, lysosome and peroxisome. Each possibility represents a separate embodiment of the present invention. According to certain currently specific embodiments, the exogenous protein is expressed within the microalga cell vacuole. Expressing the exogenous protein within the alga chloroplast is explicitly excluded from the present invention.
(47) Another problem to be solved in oral delivery of proteins is the penetration of proteins and peptides through the gastrointestinal epithelial cell membranes of the target animal subject that strictly limits their penetration. A minimum level of lipophilicity is needed for the proteins to partition into epithelial cell membranes for transcellular absorption. Unexpectedly, the present invention now shows that targeting the polynucleotides to be expressed within the plant vacuole lead to efficient transfer of the expressed, biologically active protein into the blood stream of the animal consuming the transgenic microalgae. Targeting the protein into the vacuole was advantageous over targeting to other cell compartments, including chloroplasts. Vacuoles are part of the endomembrane system of a cell; therefore, without wishing to be limited by a single hypothesis or mechanism of action, targeting peptides or proteins to the microalga cell vacuole, which is part of the endomembrane system, may increase absorption through the gastrointestinal tract of the animal once the alga is consumed and its walls are degraded by the animal subject. Such an increase in absorption may be due to increasing the “perceived” lipophilicity of peptide and protein molecules by the epithelial cell membranes, resulting in efficient absorption through the intestine. In addition, it is also possible that providing the protein through the vacuole increases storage stability of the protein. Various combinations of the above may also play a role. In any case, targeting the protein to the vacuole clearly increases the functional efficacy of orally administered proteins, as described an exemplified below in greater detail.
(48) Additionally, exogenous protein expressed by the microalgae can be so designed to enhance its uptake by the epithelial cell membranes of the animal subject consuming the transgenic algae. According to some embodiments, the expression cassette of the present invention further comprises a polynucleotide encoding a protein domain that enhances the uptake of the expressed exogenous protein by a xenogeneic cell or tissue.
(49) The particular uptake enhancing domain is selected according to the type of the xenogeneic cell, which depends on the species of the subject animal consuming the transgenic microalgae. According to certain embodiments, the expression cassette further comprises a polynucleotide encoding a cell penetrating peptide (CPP). According to some embodiments, the CPP is selected from the group consisting of, but not limited to, the trans-activating transcriptional activator (TAT) from Human Immunodeficiency virus 1 synthesized according to the Phaeodactylum tricornutum codon usage (SEQ ID NO:9) or part thereof; and the membrane translocating sequence (MTS) of a fibroblast growth factor synthesized according to the Phaeodactylum tricornutum codon usage (SEQ ID NO:7) or part thereof. Each possibility represents a separate embodiment of the present invention.
(50) Proteins having various biological activities can be expressed in the microalga cell according to the teachings of the present invention. According to certain embodiments, the protein has a therapeutic effect on the subject consuming the transgenic microalga. According to other embodiments, the protein enhances the growth of the subject consuming the transgenic microalga. According to yet additional embodiments, the protein enhances the survival of the subject consuming the transgenic microalgae. According to yet additional embodiments, the protein enhances the reproduction rate of the subject consuming the transgenic microalgae.
(51) According to certain exemplary embodiments, the transgenic microalga expresses a hormone. According to some embodiments, the hormone is selected from the group consisting of appetite inducing hormone, gonadotropin releasing hormone (spawning hormone) and a growth hormone. According to certain currently specific embodiments the growth hormone is fish growth hormone.
(52) It is to be understood that the present invention excludes use of the transgenic microalgae of the present invention as a source of exogenous proteins for vaccines.
(53) Any method for transforming microalgae as is known in the art can be used according to the teachings of the present invention. Transformation methods include particle bombardment, electroporation, microporation, vortexing cells in the presence of exogenous DNA, acid washed beads and polyethylene glycol-mediated transformation. Methods and tools for transformation of eukaryotic algae can be found, for example, in International (PCT) Application Publication No. WO 1997/039106.
(54) Typically, to prepare vectors for making the transgenic algae, the polynucleotide encoding the exogenous protein is first cloned into an expression vector, a plasmid that can integrate into the algal genome. In such an expression vector, the DNA sequence which encodes the exogenous protein is operatively linked to an expression control sequence, i.e., a promoter, which directs mRNA synthesis. As described hereinabove, the promoter can be an endogenous promoter, i.e., a promoter that directs transcription of genes that are normally present in the algae. According to certain embodiments, the vector further comprises a polynucleotide encoding a resistance gene to enable selection of transformed algae. According to certain currently exemplary embodiments, the vector comprises a polynucleotide encoding a protein conferring resistance to zeocine and phleomycin.
(55) Culturing conditions of the transformed algae depend on the alga species used, as is known to the skilled Artisan and as exemplified hereinbelow. Typically, the algae are grown under conditions that enable photosynthesis. Since photosynthesis requires sunlight and CO.sub.2 and the microalgae further require either fresh, brackish or marine water mixed with the appropriate fertilizers to grow, microalgae can be cultivated in, for example, open ponds and lakes. However, the open systems are more vulnerable to contamination than a closed system, and furthermore, genetically modified microalgae grown in open aqueous reservoirs may be taken as hazardous to the environments. In addition, in open systems there is less control over water temperature, CO.sub.2 concentration, and lighting conditions. The growing season is largely dependent on location and, aside from tropical areas, is limited to the warmer months of the year. An open system, however, is cheaper to set up and/or maintain than a closed system.
(56) Another approach to growing the microalgae is thus to use a semi-closed system, such as covering the pond or pool with a structure, for example, a “greenhouse-type” structure. While this can result in a smaller system, it addresses many of the problems associated with an open system. The advantages of a semi-closed system are that it can allow for the desired microalgae to be dominant over an invading organism by allowing the microalgae of interest to out-compete the invading organism for nutrients required for its growth, and it can extend the growing season. For example, if the system is heated or cooled, the microalgae can grow year round.
(57) Alternatively, the microalgae can be grown in closed structures such asphotobioreactors, where the environment is under stricter control than in open systems or semiclosed systems. A photobioreactor is a bioreactor which incorporates some type of light source to provide photonic energy input into the reactor. The term photobioreactor can refer to a system closed to the environment and having no direct exchange of gases and contaminants with the environment. A photobioreactor can be described as an enclosed, illuminated culture vessel designed for controlled biomass production of phototrophic liquid cell suspension cultures. Examples of photobioreactors include, for example, glass containers, plastic/glass tubes, tanks, plastic sleeves, and bags. Examples of light sources that can be used to provide the energy required to sustain photosynthesis include, for example, fluorescent bulbs, LEDs, and natural sunlight. Because these systems are closed everything that the organism needs to grow (for example, carbon dioxide, nutrients, water, and light) must be introduced into the bioreactor. Photobioreactors, despite the costs to set up and maintain them, have several advantages over open systems, they can, for example, prevent or minimize contamination, offer better control over the culture conditions (for example, pH, light, carbondioxide, and temperature), prevent water evaporation, lower carbon dioxide losses due to degassing, and permit higher cell concentrations. On the other hand, certain requirements of photobioreactors, such as cooling, mixing, control of oxygen accumulation and bio-fouling, make these systems more expensive to build and operate than open systems or semi-closed systems. Photobioreactors can be set up to be continually harvested (as is with the majority of the larger volume cultivation systems), or harvested one batch at a time (for example, as with polyethlyene bag cultivation). A batch photobioreactor is set up with, for example, nutrients, microalgae, and water, and the microalgae is allowed to grow until the batch is harvested. A continuous photobioreactor can be harvested, for example, either continually, daily, or at fixed time intervals.
(58) CO.sub.2 can be delivered to any of the systems described herein, for example, by bubbling in CO.sub.2 from under the surface of the liquid containing the microalgae. Also, sparges can be used to inject CO.sub.2 into the liquid. Spargers are, for example, porous disc or tube assemblies that are also referred to as Bubblers, Carbonators, Aerators, Porous Stones and Diffusers.
(59) Nutrients that can be used in the systems described herein include, for example, nitrogen (in the form of NO.sub.3.sup.− or NH.sub.4, phosphorus, and trace metals (Fe, Mg, K, Ca, Co, Cu, Mn, Mo, Zn, V, and B). The nutrients can come, for example, in a solid form or in a liquid form. If the nutrients are in a solid form they can be mixed with, for example, fresh or salt water prior to being delivered to the liquid containing the microalgae, or prior to being delivered to a photobioreactor.
(60) The microalgae can be grown in large scale cultures, where large scale cultures refers to growth of cultures in volumes of greater than about 6 liters, or greater than about 10 liters, or greater than about 20 liters. Large scale growth can also be growth of cultures in volumes of 50 liters or more, 100 liters or more, or 200 liters and up.
(61) Optimal growth temperature is typically about 20° C. to about 25° C., however it is species dependent. According to certain embodiments microalgae cell reach a density of 10.sup.5 to 10.sup.5/ml before harvesting.
(62) Post-harvest processing of some sort may be used to prepare the material for oral consumption or as a food composition. Conventional processes typically include at least partial separation of the algal biomass from the liquid culture in which the algae were grown. Optionally, the algal biomass can be homogenized and/or dried to form pellets of various sizes, depending on the target subject and mode of application. Other modes of preparation include spray drying, fluid bed drying, or even providing the material as a liquid suspension.
(63) The harvested transgenic microalgae of the present invention can be administered per se, can be formulated into an edible composition further comprising edible diluents, excipients or carriers. The microalgae or the composition comprising same can be further used as food additive. According to some embodiments, the edible composition is an animal food composition. According to certain currently specific embodiments, the animal food composition if for feeding aquatic and land animals. According to yet other embodiments, the edible composition is for human consumption.
(64) According to a further aspect the present invention provides a method for improving at least one of an animal growth rate, growth pattern, reproductive health status, survival or any combination thereof, comprising administering to the animal transgenic microalgae of the present invention or a composition comprising same, thereby improving the growth rate and/or the growth pattern and/or the survival and/or the reproductive health status of said animal.
(65) The following examples are presented in order to more fully illustrate some embodiments of the invention. They should, in no way be construed, however, as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.
EXAMPLES
(66) These Examples relate to specific implementations of at least some aspects of embodiments of the present invention. The Examples are illustrative only and are not intended to be limiting in any way.
(67) Materials & Methods
(68) Synthesis of Salmon Growth Hormone Gene
(69) The amino acid sequence of the Salmon growth hormone (accession No. AAT02409) was used as the basis for the synthesis of a polynucleotide encoding a mature Salmon growth hormone (SEQ ID NO:12, designated herein “fish growth hormone” or “fGH”). The polynucleotide synthesis was performed using the Phaeodactylum tricornutum codon usage of “Entelechon GmbH”, thereby forming a novel polynucleotide sequence shown in SEQ ID NO:1. This novel sequence was not previously disclosed, as this codon usage has not yet been used for this protein. Furthermore, this specific sequence was designed to be more efficiently expressed by Phaeodactylum tricornutum, as discussed in greater detail below.
(70) Construction of the Salmon Growth Hormone Gene Targeted to ER
(71) The fGH growth hormone gene was fused at its 5′ end to a polynucleotide encoding Bip endoplasmic reticulum leader sequence (Kilian O and Kroth P. 2005. The Plant Journal: 41:175-183) (nucleic acids: SEQ ID NO:16; amino acids: SEQ ID NO:2) to produce the Bip-fGH (nucleic acids: SEQ ID NO: 17; amino acids: SEQ ID NO:3), according to the following:
(72) The Bip leader sequence was amplified from Phaeodactylum tricornutum genomic DNA using the following primers:
(73) TABLE-US-00002 (SEQ ID NO: 36) Forward BiP: GGAATTCATGATGTTCATGAGAATTGC (SEQ ID NO: 37) Reverse Bip-fGH-V2 ACGCTGGTTTTCAATCACGGTACCCATCTT.
(74) The Bip leader sequence product was amplified using the following primers:
(75) TABLE-US-00003 (SEQ ID NO: 38) Forward BiP GGAATTCATGATGTTCATGAGAATTGC. (SEQ ID NO: 39) Reverse Bip-fGH-V2 ACGCTGGTTTTCAATCACGGTACCCATCTT.
(76) The fGH was amplified using the following primers:
(77) TABLE-US-00004 (SEQ ID NO: 40) Forward Bip-fGH-V2 AAGATGGGTACCGTGATTGAAAACCAGCGT. (SEQ ID NO: 41) Reverse fGH BglII GAGATCTGAGGGTGCAGTTGG.
(78) The Bip leader sequence was fused to fGH by a third PCR, using the amplified PCR products (Bip, fGH), and the mentioned primers for Bip+Revf BgIII, resulting in the construct designated 356 having the nucleic acid sequence set forth in SEQ ID NO:17 and the amino acid sequence set forth in SEQ ID NO:3.
(79) Construction of the Salmon Growth Hormone Gene Targeted to Vacuole
(80) The fGH encoding polynucleotide was fused to a vacuole leader sequence (nucleic acids: SEQ ID NO:18; amino acids: SEQ ID NO:4) at its 5′ and to an HA tag (nucleic acids: SEQ ID NO:47; amino acids: SEQ ID NO:5) at its 3′ to produce the vacuole-fGH-HA polynucleotide (nucleic acids: SEQ ID NO:19; amino acids: SEQ ID NO:6), according to the following:
(81) The synthetic fGH was amplified using the following primers:
(82) TABLE-US-00005 (SEQ ID NO: 42) Forward fGH EcoRI GGAATTCATGGGCCAAGTCTTTCTCTTG (SEQ ID NO: 41) Reverse fGH BglII GAGATCTGAGGGTGCAGTTGG.
(83) The product was ligated to a pPhaT1-HA plasmid using EcoRI, BgIII.
(84) The fGH-HA template was amplified using the following primers:
(85) TABLE-US-00006 Forward fGH BamHI: (SEQ ID NO: 43) GGATCCATTGAAAACCAGCGTTTGTTCAAC. Reverse Hind HA: (SEQ ID NO: 44) AAGCTTTTACTGGGCGGCGTAGTCCGGGACGTCGTAGGGGTA.
(86) The PCR product was cloned into pPhaT1 by BamHI and HindIII.
(87) The vacuole leader sequence was amplified from Phaeodactylum tricornutum cDNA using the following primers:
(88) TABLE-US-00007 (SEQ ID NO: 45) EcoR1-Vac54681: ATGAATTCATGTCGATTCGTCTCT. (SEQ ID NO: 46) BamH1-Vac54681: ATGGATCCAGTTTGGGCAGTTGCC.
(89) The fGH-HA and the vacuole leader sequence were ligated with EcoRI and BamHI, resulting in the construct designated 398, having the nucleic acid sequence set forth in SEQ ID NO: 19 encoding the polypeptide having the amino acids sequence set forth in SEQ ID NO:6.
(90) Construction of the GFP-Encoding Polynucleotide Targeted to Vacuole
(91) In the construct described above, the polynucleotide encoding the fish growth hormone was replaced with a polynucleotide encoding GFP (accession P42212, having the nucleic acid sequence set forth in SEQ ID NO:29 and encoding a protein having the amino acid sequence set forth in SEQ ID NO:28) by BamHI and HindIII, leading to a vacuole targeted GFP (SEQ ID NO:30, amino acid sequence; SEQ ID NO:31, nucleic acid sequence—prepared with Phaeodactylum tricornutum codon usage), resulting in a construct designated 527, having the nucleic acid sequence set forth in SEQ ID NO:31 and the amino acid sequence set forth in SEQ ID NO:30.
(92) Construction of the Vacuole-fGH-MTS-HA
(93) A membrane translocating sequence (MTS) from the fibroblast growth factor was synthesized according to the Phaeodactylum tricornutum codon usage by Biomatik (SEQ ID NO:7). The translocating sequence was ligated to the vacuole-fGH-HA at the 3′ of fGH using BgIII, to produce the construct encoding vacuole-fGH-MTS-HA having the amino acid sequence set forth in SEQ ID NO:8.
(94) Construction of the Vacuole-GFP-MTS
(95) A membrane translocating sequence (MTS) from the fibroblast growth factor was synthesized according to the Phaeodactylum tricornutum codon usage by Biomatik. The translocating sequence was ligated to the vacuole-GFP at the 3′ of GFP using HindIII, to produce the vacuole-GFP-MTS construct (nucleic acid sequence: SEQ ID NO:33; amino acid sequence SEQ ID NO: 32).
(96) Construction of the Vacuole-fGH-TAT-HA
(97) A trans-activating transcriptional activator (TAT) from Human Immunodeficiency virus 1 (HIV-1) was synthesized according to the Phaeodactylum tricornutum codon usage by Biomatik (SEQ ID NO:9). The domain was fused by BgIII in tandem of two repeats to the vacuole-fGH-HA at the 3′ of fGH to produce the vacuole-fGH-TAT-HA construct (SEQ ID NO:10).
(98) Construction of the Vacuole-GFP-TAT
(99) A trans-activating transcriptional activator (TAT) from Human Immunodeficiency virus 1 (HIV-1) was synthesized according to the Phaeodactylum tricornutum codon usage by Biomatik. The gene was ligated to the vacuole-GFP at the 3′ of GFP using HindIII, to produce the vacuole-GFP-TAT construct having the nucleic acid sequence set forth in SEQ ID NO:35, encoding the vacuole-GFP-TAT protein having the amino acid sequence set forth in SEQ ID NO:34.
(100) Cloning Constructs into an Algae Expression Vector
(101) The various polynucleotides and constructs of the invention were further cloned under the control of the fcpA promoter and fcpA terminator in the plasmid pPHAT1 (accession number AF219942) (SEQ ID NO:11) according to Apt et al. (1996. Mol. Gen Genet. 252:572-579). The fcpA promoter is the only one that is currently known to be operative in Phaeodactylum tricornutum. However, it is to be explicitly understood that other promoters can be used in Phaeodactylum tricornutum as well as in other algae.
(102) The vector contained: An fcpA (fucoxanthin chlorophyll protein A) promoter, under which the gene of interest is cloned. MCP—Multiple cloning site An fcpB (fucoxanthin chlorophyll protein B) promoter, which controls the sh ble gene from Streptoalloteichus hindustanus, which encodes a protein that confers zeocine and phleomycin resistance. fcpA terminators, which appear after the gene of interest and after the zeocine resistance gene. Ampicillin resistant gene Origin of replication from Escherichia coli.
(103)
(104) The fGH encoding polynucleotide (SEQ ID NO:1) was cloned under the fcpA promoter and fcpA terminator. The plasmid contained the selectable marker, Bleomycine, under the control of the fcpB promoter and fcpA terminator.
(105) Cloning and Molecular Techniques
(106) PCR reactions were done using Phusion Polymerase Cat. # FZ-F-5305 Finnzymes (Zotal) or REDTaq ready mix PCR reaction mix Cat. # R2523-100RXN Sigma. PCR reactions were cleaned using Wizard® SV Gel and PCR Clean-Up System (Cat. No. A9281, Promega).
(107) Ligations were performed using DNA Ligation Kit (Mighty Mix)-Takara Cat. No. 6023 (Ornat) or T4 DNA ligase M0202T NEB (Eldan). Blunting of 5′ or 3′ overhangs was performed with T.sub.4 DNA polymerase: (Fermentas #EP0061).
(108) DNA Midi preps were performed using Pure Yield™ Plasmid Midiprep System A2492. PROMEGA and DNA minipreps were performed using AccuPrep Plasmid Mini Extraction Kit-BIONEER K-3030. DNA genomic isolations were performed according to Fawley & Fawley (Fawley M W and Fawley K P. 2004. J Phycol 40: 223-225). All kits and enzymes were treated according to the manufacturer's instructions.
(109) Algae Culturing and Harvesting
(110) Algae culturing and harvesting was done as described in U.S. Patent Application Publication No. 2011/0081706 to the Applicant of the present invention. Briefly, algae were cultured in filtered sea water enriched with F/2 nutrient for growing diatoms (modified from Andersen R et al. 2005. Recipes for freshwater and seawater media. In: Algal Culturing Techniques (R. A. Andersen, eds), pp. 429-538. Elsevier, Amsterdam). F/2 was added every 72 h at a dosage of 1:1000 to the final culture volume. A constant temperature regime was maintained at 21° C. Light: dark was set at 16:8 hours at a light intensity of 100 μmol photons per m.sup.2s.sup.1. CO.sub.2 was mixed with air and delivered to the cultures at controlled ratio via the aeration systems. Algae were harvested for experiment near their maximal culture densities. To help flocculation of the algae calcium hydroxide was added to the culture as a fine suspension of particles in water containing 0.15 g/ml Ca(OH).sub.2, and the culture was then filtered or centrifuged. The resulting algae sediment was lyophilized.
(111) Algae Transformation
(112) I. Transformation by Particle Bombardment
(113) Fresh algal culture were grown to mid exponential phase (2-5*10.sup.6 cells/ml) in artificial sea water (ASW) F/2 media as described above. 24 hours prior to bombardment cells were harvested, washed twice with fresh ASW+F/2 and resuspended in 1/10 of the original cell volume in ASW+F/2. 0.5 ml of the cell suspension is spotted onto the center of a 55 mm Petri dish containing solidified ASW+F/2 media. Plates are left to dry under normal growth conditions. Bombardment was carried out using a PDS 1000/He biolistic transformation system according to the manufacturer's instructions (BioRad Laboratories Inc., Hercules, Calif. USA) using M17 tungsten powder (BioRad Laboratories Inc.) for cells larger than 2 microns in diameter, and tungsten powder comprised of particles smaller than 0.6 microns (FW06, Canada Fujian Jinxin Powder Metallurgy Co., Markham, ON, Canada) for smaller cells. The tungsten was coated with linear DNA. 1100 or 1350 psi rupture discs were used. All disposables were purchased from BioRad Laboratories Inc. After bombardment the plates were incubated under normal growth conditions for 24 hours after which the cells were plated onto selective solid media and incubated under normal growth conditions until single colonies appeared.
(114) II. Transformation by Electroporation
(115) Algal cultures were grown to mid exponential phase in artificial seawater (ASW)+F/2 media as described above. Cells were then harvested and washed twice with fresh media. After re-suspending the cells in 1/50 of the original volume, protoplasts were prepared by adding an equal volume of 4% hemicellulase (Sigma) and 2% Driselase (Sigma) in ASW and were incubated at 37° C. for 4 hours. Protoplast formation was tested by Calcofluor white non-staining. Protoplasts were washed twice with ASW containing 0.6M D-mannitol and 0.6M D-sorbital and resuspended in the same media, after which DNA was added (10 μg linear DNA for each 100 μl protoplasts). Protoplasts were transferred to cold electroporation cuvettes and incubated on ice for 7 minutes, then pulsed in an ECM830 electroporation apparatus (BTX, Harvard Apparatus, Holliston, Mass., USA). A variety of pulses is usually applied, ranging from 1000 to 1500 volts, 10-20 msec per pulse. Each cuvette was pulsed 5-10 times. Immediately after pulsing the cuvettes were placed on ice for 5 minutes and then the protoplasts were added to 250 μl of fresh growth media (non-selective). After incubating the protoplasts for 24 hours in low light at 25° C. the cells were plated onto selective solid media and incubated under normal growth conditions until single colonies appeared.
(116) III. Transformation by Microporation
(117) A fresh algal culture was grown to mid exponential phase in ASW+F/2 media. A 10 ml sample of the culture was harvested, washed twice with Dulbecco's phosphate buffered saline (DPBS, Gibco, Invitrogen, Carslbad, Calif., USA) and resuspended in 250 μl of buffer R (supplied by Digital Bio, NanoEnTek Inc., Seoul, Korea, the producer of the microporation apparatus and kit). After adding 8 μg linear DNA to every 100 μl cells, the cells were pulsed. A variety of pulses is typically needed, depending on the type of cells, ranging from 700 to 1700 volts, 10-40 msec pulse length; each sample was pulsed 1-5 times. Immediately after pulsing, the cells were transferred to 200 μl fresh culture media (non-selective). After incubating for 24 hours in low light at 25° C., the cells were plated onto selective solid media and incubated under normal culture conditions until single colonies appeared.
(118) Protein Extraction
(119) 10 ml cells at 5×10.sup.6 cell/ml were harvested and resuspended in 500 μl extraction buffer (50 mM Tris pH=7.0; 1 mM EDTA; 100 mM NaCl; 0.5% NP-40; and protease inhibitor (Sigma cat # P9599). Then 100 μl of glass beads (425-600μττκ, Sigma) were added and cells were broken in a bead beater (MP FastPrep-24, MP Biomedicals, Solon, Ohio, USA) for 20 sec. The tube content was centrifuged for 15 min, 13000×g, at 4° C. The supernatant was removed to new vial for quantification and Western blot analysis.
(120) Protein Separation by SDS-PAGE and Western Analysis
(121) Extracted proteins were separated on a 4-20% gradient SDS-PAGE (Geba gels 4-20% Bio-lab, 10GG0420-8), at 100V for 1 h. Following incubation of 1 h in blocking buffer (5% skim milk, Difco), proteins were either stained by Coomassie (Sigma) or blotted onto PVDF (Millipore, Billerica, Mass., USA) membranes for 1 h at 100 volts in transfer buffer (25 mM Tris, 192 mM glycine and 20% methanol). The proteins were detected either with an anti HA (Biotest MMS-101P-500) or the salmon growth hormone (GroPep: PAN1) antibodies, diluted to a ratio of 1:1000 in the blocking buffer. Mouse (for the HA antibody) or rabbit (for the Salmon growth hormone) horseradish peroxidases secondary antibodies (Millipore, Billerica, Mass., USA), at 1:10000 dilution in the blocking buffer were used. Detection was carried out using the EZ-ECL kit (Bio Ind. Promega: 20-500-120) according to manufacture instructions.
(122) ELISA Analysis
(123) ELISA plate (microlon, Greiner) was coated in carbonate/bicarbonate pH 9.6 with monoclonal anti HA Antibody (Sigma Aldrich) overnight at 4° C. Next, the plate was washed with PBST (0.05% Tween), and blocked with 1% BSA (Sigma Aldrich) in PBS for 4 hours at room temperature (RT). Serum samples were serially diluted in ELISA coating buffer and loaded onto the plate. After an overnight incubation with the serum samples, the plate was washed with PBST and incubated with anti HA-biotin (Roche) for 1 hour at room temperature. Following additional washing steps, horseradish peroxidase (HRP) conjugated sterptavidin was added and the plate was incubated for 1 hour at room temperature (RT). The plate was washed with PBST and tetramethyl-benzidine (TMB) substrate was added to the plate. Once sufficient color was developed, the reaction was stopped with 0.16M sulfuric acid. The absorbance in each well was measured at 450 nm using Enspire 2300 multilabel reader (PerkinElmer).
(124) Fish Maintenance and Feeding
(125) Groups of 10 Tilapia fish, weighing 70-100 grams were maintained in 100 liter aerated tanks at a temperature of 26-28° C. The photoperiod was 12 h light: 12 h dark. All fish were acclimated in the tanks for a week before the treatment. Oral administration with algae suspensions was conducted on fish lightly anesthetized with 100 ppm of clove bud extract (Roth). Polyethylene tube (length 6-8 cm, i.d. 3 mm) attached to an injecting syringe was used for oral administration (gavage feeding) of the different algal suspensions.
(126) Feeding Trials
(127) Lyophilized transgenic algae expressing the Salmon growth hormone were added in a final concentration of 1-4% to the regular fish feed. Fish received with feed at 10%-15% of their total body weight. The transgenic algae and the regular fish feed were used to feed the ornamental fish, Koi, Scalare and Goldfish Shubunkin for 6 weeks. Each trial was monitored for temperature, pH, ammonia, nitrite levels etc. At the end of each experiment fish total growth, morphological abnormalities and survival rates were analyzed.
Example 1: Algae Expressing Fish (Salmon) Growth Hormone
(128) Transgenic algae of the species Phaeodactylum tricornutum, harboring the Salmon growth hormone encoding polynucleotide targeted to the ER (designated as construct 356) or to the vacuole (designated as construct 398) were cultured and analyzed for the expression of the transgenic protein. An equal amount of total soluble protein (20 {umlaut over ( )}g) was extracted from the transgenic algae for Western blot analysis. Detection was made using anti Salmon growth hormone antibody as shown in
(129) The algae line expressing ER-targeted Salmon growth hormone has shown higher expression levels of the transgenic protein compared to the algae line expressing the vacuole-targeted growth hormone.
Example 2: Angel Fish Feeding Trial
(130) Ornamental Angel Fish (Scalare), were fed during 6 weeks with fish food supplemented with transgenic Phaeodactylum tricornutum over-expressing fish growth hormone targeted to the ER or to the vacuole (constructs 356, 398, respectively), or with the regular, non-transgenic fish food (control). The algae supplement was added at 4% into the regular fish food. Fish growth was followed within tanks as independent repeats (n=5) containing 20 fish each.
(131) Fish fed with food containing the transgenic algae harboring construct 398 (in which the growth hormone was targeted to the vacuole) gave higher total fish biomass (˜15%), compared to fish fed with the regular food (control), whereas fish fed with food containing the transgenic algae harboring construct 356 (in which the growth hormone was targeted to the ER) did not grow significantly better compared to the control.
(132) In a parallel experiment, also conducted with Angel fish, feeding the fish with regular food containing algae expressing fGH targeted to the vacuole (construct 398) resulted in an increase in the number of fish reaching over 2 gr compared to fish fed with regular fish food (
(133) Another experiment conducted for 8 weeks with Angel fish in 5 repeats of 25 fish each, resulted in a significant biomass increase of fish consuming food supplemented with 4% algae expressing fGH (fGH expression targeted to the vacuole, construct 398) compared to fish fed with regular fish food (
(134) These results imply that the subcellular targeting of fGH to the vacuole of the alga cell results in better functional efficacy of the protein, even though the expression level was shown to be lower than the expression level of fGH targeted to cell ER.
Example 3: Koi Fish Feeding Trial
(135) Post larva koi fish (4 independent repeats each including 600 post larva koi fish) were fed either with the regular fish food or with regular fish food supplemented with 4% algae expressing fGH targeted to the vacuole (construct 398). The feeding experiment was performed over 8 weeks. At the end of the experiment, fish were screened for body deformation (as defined by Jha P et. al. 2006. Journal of Applied Ichthyology; 23 (1) 87-92). Body deformation includes but is not limited to any morphological irregularity, any type of body asymmetry, irregular body shape, irregular fin shape, irregular tail shape; irregular body/fin area, length or width ratios; irregular body/tail area, length or width ratios; irregular tail/fin area, length or width ratios; or irregularities in any body part.
(136) As is apparent from
Example 4: Goldfish Feeding Trial
(137) The post larva ornamental Goldfish (Shubunkin) were fed over 6 weeks with fish food supplemented with transgenic Phaeodactylum tricornutum overexpressing fish growth hormone targeted to the vacuole (construct 398), or with regular fish food (control). Algae supplement was added at 4% to the regular fish food. Treatments were tested in 6 independent repeats of 40 fish each.
(138) In addition to the growth performance, the survival of fingerlings during the experiment was approximately 64% at the control tanks. The survival rate was elevated to approximately 80% within tanks in which the fish were fed with food supplemented with fGH expressing algae (construct 398), implying that the fGH expressing algae contributes to fish survival in addition to its growth enhancement effect.
Example 5: Artemia Feeding Trial
(139) Brine shrimps (Artemia) were fed for 12 days with wild type Phaeodactylum tricornutum, wild type Nannochloris or with fish growth hormone (fGH) expressing Phaeodactylum tricornutum (construct 398). Artemia fed with fGH expressing Phaeodactylum tricornutum were significantly larger (by about 40%) and the females reached sexual maturation 3 days earlier, when compared to Artemia fed with wild type Nannochloris or wild type Phaeodactylum tricornutum respectively (
(140) Specifically,
(141)
Example 6: Macrobrachium rosenbergii Feeding Trial
(142) The fresh water shrimp Macrobrachium rosenbergii, PL 10, were fed over 6 weeks with regular food (control), or with regular food supplemented with transgenic Phaeodactylum tricornutum overexpressing fish growth hormone targeted to the algae vacuole (construct 398). Algae supplement was added at 8% to the regular food.
Example 7: GFP Absorption by Fish
(143) 1 week starved Tilapia fish at a size of 50-100 grams were fed with fish food mixed with wild-type Phaeodactylum tricornutum or with Phaeodactylum tricornutum expressing GFP targeted to the vacuole at 1:1 fish food to algae ratio. Tilapia stomachs and intestines were taken out 1-4 hours post feeding and were analyzed under fluorescence binocular.
Example 8: GFP Absorption by Shrimp
(144) The Brine shrimp Artemia were fed with wild type algae (Phaeodactylum tricornutum) alone or with algae expressing GFP targeted to the vacuole (vacuole-GFP expressing algae) alone for 3 days post hatching. 8000 Artemia grown in 1×ASW medium were fed with 1.5*10.sup.9 algae. 4 hours post feeding, Artemia were carefully washed and analyzed under fluorescent light.
(145) In still additional experiment, starved fresh water shrimps, Macrobrachium rosenbergii, PL 10, were fed with pellets composed of regular food mixed with powder of wild-type algae (Phaeodactylum tricornutum) or with powder of vacuole-GFP expressing algae in food to algae ratio of 1:1. Shrimps were analyzed under fluorescent light 4 h post feeding.
Example 9: GFP Absorption by Chickens
(146) Two weeks old chickens were force fed each with 100 mg of powder of wild-type algae (Phaeodactylum tricornutum) or with algae expressing GFP targeted to the vacuole suspended in 5 ml of 0.5× artificial sea water (ASW). Chickens were sacrificed 2, 4, 6 and 24 h post feeding and livers were taken out and analyzed under fluorescent light.
Example 10: Oral Delivery of Proteins to Fish Blood
(147) Tilapia fish were fed with algae (Phaeodactylum tricornutum) expressing fish growth hormone or with algae expressing GFP (both targeted to the algae vacuole; vacuole-fGH expressing and vacuole-GFP expressing algae, respectively). 800 mg of algal powder was suspended in 30 ml of 0.5×ASW. Each fish was force-fed with 2 ml algal suspension. Blood samples were taken from the caudal vein using sterile syringes and tubes. Fifty microliters (μl) of each of the blood samples were allocated for direct fluorescence analysis for the activity of GFP in a fluorescence plate reader and the rest of the samples were left to stand for 15 minutes at room temperature, and after an overnight period at 4° C., sera were separated by centrifugation at 250 g for 10 minutes at 4° C., and stored in sterile tubes at −20° C. for ELISA analysis.
(148) Absorption of fGH in Tilapia fish
(149) Tilapia fish were force-fed with vacuole-fGH (construct 398) or vacuole-GFP expressing algae (construct 527). Blood samples were taken 1 h post feeding for ELISA analysis. The presence of the fGH protein was confirmed by detecting the expression of the HA domain, which is fused to the fGH using anti-HA antibody (see Materials and Methods hereinabove). The blood samples taken from fish fed with vacuole-fGH expressing algae, reacted positively with the anti-HA antibody, while blood samples taken from fish fed with vacuole-GFP expressing algae gave non-significant signal (
(150) Absorption and Activity of GFP in Tilapia Fish
(151) Tilapia fish (n=5) were force-fed with vacuole-GFP expressing algae (construct 527) or with vacuole-fGH expressing algae (construct 398). Blood sample were collected one hour post feeding and analyzed under fluorescence light (excitation 480 nm, emission 515 nm) using Enspire 2300 multi-label reader. Blood samples collecting from fish def with vacuole-GFP expressing algae exhibited fluorescence. In contrast, blood samples of fish fed with vacuole-fGH expressing algae (construct 398) gave non-significant signal (
Example 11: Vacuole-Targeted Exogenous Proteins are Protected in the Gastrointestinal Tract
(152) Vacuole-GFP and vacuole-fGH expressing algae (harboring construct 527 and 398, respectively) and total protein extracted from the vacuole-GFP expressing algae line were measured for GFP fluorescence before being administered to the fish by force feeding (
Example 12: Oral Delivery of Proteins to Mice
(153) Delivery of fGH into Mice Liver
(154) 12 weeks old balb-C male mice were starved for 12 hours prior to the experiment. Mice were lightly anesthetized using Isoflurane, and fed with 1.5 ml of vacuole-fGH expressing algae (construct 398) or vacuole-GFP expressing algae (construct 527) by gavage-feeding.
(155) Two hours post algal administration mice were euthanized by overdose of isoflurane. Livers were removed and frozen in liquid nitrogen. Total protein was extracted from the livers, followed by ELISA analysis directed towards the HA tag, recognizing specifically the recombinant fGH, expressed in the algae. The ELISA results, shown in
(156) Absorption of GFP to the Blood
(157) Mice were treated as above, and blood samples were taken from the heart 2 hours post feeding. The blood samples were then centrifuged and the plasma was analyzed under fluorescent light (excitation 480 nm, emission 515 nm). Blood samples of mice fed with vacuole-GFP expressing algae showed significantly higher fluorescence compared to blood samples of mice fed with vacuole-fGH expressing algae, demonstrating the passage of the GFP from the digestive tract into the blood in an intact and functional form.
Example 13: Enhanced Protein Absorption by Fish and Mice
(158) CPPs are short peptides that facilitate cellular uptake of various molecular cargos. Examples of CPPs include the trans-activating transcriptional activator (TAT) from Human Immunodeficiency virus 1 (HIV-1) and the membrane translocating sequence (MTS) from a fibroblast growth factor. The constructs comprising the gene encoding fGH targeted to the vacuole or the gene encoding GFP targeted to the vacuole were further designed to include one of the CPPs as described in the “material and methods” section hereinabove.
(159) Algae lines expressing the vacuole-fGH-MTS-HA or vacuole-fGH-TAT-HA are used to feed fish in feeding trials as described above. Alga lines transformed with the above-constructs wherein the fGH is replaced by GFP (vacuole-GFP-MTS- or vacuole-GFP-TAT-) are used as a model system. Additionally these algae lines are used to feed mice by gavage. At the end of the feeding trials the presence of the algae-expressed protein is examined in blood of the fish or mice fed with the algae using ELISA or Western blot analysis directed toward the HA tag. Additionally, GFP fluorescence of blood samples is detected directly by a fluorescence plate reader or GFP protein is detected by ELISA using an anti GFP antibody.
(160) The results presented above demonstrate that the algae Phaeodactylum tricornutum serves as an efficient means to orally deliver recombinant proteins to various target animals. Without wishing to be bound by any specific theory or mechanism of action, the algae serve as a native bio-encapsulation, with the algae cell wall protecting the recombinant protein from its enzymatic degradation in the acidic stomach. The results further suggest, again without wishing to be bound by any specific theory or mechanism of action, that the vacuole targeted protein enables its efficient absorption from the intestine to the target organelle.
(161) In summary, the present application demonstrates for the first time the establishment of an algae based platform, which enables oral administration of recombinant proteins to animals in their intact and functional form.
(162) The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. The means, materials, and steps for carrying out various disclosed functions may take a variety of alternative forms without departing from the invention.